"suletta's too cute to be a gundam pilot" well clearly you're not ready for the new era of women's wrongs that g-witch is ushering in
34 notes
·
View notes
Spoilers for Gundam: The Witch from Mercury Episode 12
Hi Tumblr! So, I’m breaking, like, a FIVE YEAR bout of silence and shit, but I can’t just sit quiet about this one.
Witch from Mercury has been one of the best Gundam Series I’ve had the pleasure of watching. Today, the last episode of this cour ended on a heavy note. Now the majority of takes that I’ve seen have been saying that Suletta was either totally cavalier in what she did to Nameless Grunt Number 5 or that Prospera activated her somehow with her typical ‘move forward, gain two’ line.
So, mainly to fight the opinion that Suletta is now just suddenly a murderous psychopath, I’d like to point out a few things. I’ll be laying out evidence from the series, from the Prologue story, Cradle Planet, and my own observations.
So, first and foremost, Suletta has shown to act very impulsively whenever Miorine is in any sort of danger (slapping Guel in episode 1, her confrontation with Shaddiq in episode 9). She trusts Miorine implicitly and after last episode, after having been separated from her after a really tender moment, she’s undoubtedly panicking about whether or not she’s okay. Even Prospera can see that, because she makes sure to namedrop Miorine when she tells Suletta that if she gets in Aerial she can save everyone.
The GUND-bits told her that the transport and Earth House is safe. She activates what I assume is Permet Score 6 (same tetrahedron shield as ep. 9, along with Prospera telling Delling in ep. 11 that that’s as high as Aerial’s PS went during the Grassley duel), and is able to locate Miorine. I find it hard to believe that she didn’t also see Delling and Nameless Grunt Number 5 (because I’m guessing that the bits identified them via their personal Permet ID). She came into that room hard and fast, and Aerial immediately adopted a combat stance. That wasn’t the entrance of someone who knew the danger was over and was going to enter through a proper airlock or hanger.
Then, of course, we get to the slap. I’ve seen people talk about how she could’ve just blocked or captured Nameless Grunt Number 5, but he had just overcome his shock at Aerial’s arrival and leveled his gun to finish Miorine and Delling. He was about to kill them. Suletta didn’t have time to think ‘Oh I can solve this nonviolently’. With everything we’ve seen from her so far, I’d be shocked if her first and only thought, and the one that she and Aerial acted on, wasn’t ‘Miorine is in danger I need to stop him’.
Then, she gets out of Aerial. There’s blood everywhere, she trips and falls. Suletta, who we’ve never seen properly navigate any kind of social interaction ever. Suletta, who just minutes ago was in shock, nearly shut down over her mother having killed Nameless Grunts 1-4. Suletta, who just watched Nameless Grunt Number 5 try to kill Miorine, does not have the emotional capacity to deal with all of this. So she does what she’s had working for her so far with Earth House. She plays it off as clumsy, as silly. Suletta Forgetta indeed.
A brief side bar on those who think the motto ‘run, lose one, move forward, gain two’ is some kind of trigger phrase, the Prequel story Cradle Planet shows us that Suletta has been using that since the age of nine to get over things she’s afraid of. She comes to Aerial one night because the elders at the Mercury colony don’t respect or trust her. She’s in tears. She climbs into Aerial’s cockpit, and she repeats that phrase until she’s brave enough to face the world again.
Flash forward, she’s 17 now (last age given in the story was 15, but with context clues we can assume this next part is right before ep. 1). Prospera’s putting her plan into action, Miorine is being married off to whoever claims the title of Holder at Asticassia. Suletta comes to Aerial again. She tells her about what’s happening (Aerial knows already, Prospera told her the night before. Aerial doesn’t want Suletta to go, doesn’t want her to be used for revenge). She starts to panic, she’s anxious. Then she tells herself, ‘If you run, gain one. Move forward, gain two. Right, Aerial?’. She uses the words to propel herself forward once again. Just as she has done before, and just as we see her do so many times throughout the series.
Suletta is clearly coded as neurodivergent. Whyever that is and whatever she’s specifically coded to be, I’m not going to speculate on, but she doesn’t understand social graces. She doesn’t always know the right way to respond. She defaults to a lot of reactions (hiding, playing it off) because those are what have worked for her. She’s not some manic psychopath suddenly and gleefully happy to kill, and she’s not the Winter Soldier waiting to be activated (that might be Aerial, if the red eye stickers in the Gunpla kit are any indication). She’s just doing her best. And that’s not always going to be the right thing to do, as we saw.
Thanks for coming to my TED Talk.
802 notes
·
View notes
So I finally had time to do some digging… apparently both the commander!Suletta and mistress!Miorine tidbits have been known for a while. I tracked down a scan (posted on an image-board on 2023/01/24) of an interview with Mogumo, the character designer for the series.
Unfortunately, the original post didn't include a source >.<, but the info is broadly corroborated by other interviews with Mogumo so it's probably legit.
I think the recent commmander/mistress fanart surge was just prompted by this cool drawing posted by 0321smith (the comment says: "delusional doodles based on rumored initial concepts").
Here's a translation of the scan:
Suletta Mercury: Distinctive eyebrows conveying a strong will
During the initial planning stages, I envisioned a cool and unemotional female commander character, a protagonist who calmly exterminates her enemies. I wanted to see a Gundam show with intense mobile suit battles contrasting against slightly dispassionate characters. However, the story pivoted away from the initial premise so we had to completely change the character's image. I'd drawn a few too many cool characters, Miorine included, at the start. The director requested that I design a more expressive, diverse cast to better fit a fun school setting, so I made adjustments.
Red hair tied up in a ponytail and wearing a white jacket – at a glance, not much has changed from the initial design, as the color palette and silhouette remain the same. But the character's personality had become the complete opposite, so I spent a lot of time fine tuning her facial features.
After this change of tack, Suletta is now a naive child from the countryside, inexperienced in the ways of the world. Her distinctive eyebrows convey a strong will.
The hairband is her only stylish accent - I tried to find a balance where it wouldn't stand out in the city but would still be fashionable by Mercurian standards. It took a lot of time and effort, but I think in the end I was able to design a character that differs from previous Gundam protagonists.
Miorine Rembran: A face that shows all kinds of intense expressions
Miorine and Suletta contrast each other. While Suletta has a dog-like presence, Miorine is a cat. With sharp eyes and a cool demeanor, she's not friendly at all. She's an unapproachable beauty, so I designed her as having a somewhat distant feel.
Her character started as a mistress, not a student at the school. The dress I initially drew really fit her original design, but it didn't suit her at all when she was changed to a younger student character.
With her original character design, I had imagined a quiet, cool woman, so it was surprising that she turned out to have such a fierce personality. I like that she's always telling people off and makes all kinds of facial expressions while sometimes showing a cute side. The animators really further developed Miorine's design, I think.
111 notes
·
View notes
G Witch Onscreen Text: Episode 22
Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.
<< If you forgot, Episode 21 will remind you of What You Can Do Now
Or you can go to the Masterpost.
It's the dawn of a New World.
After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.
TEXT:
(Lefthand side)
- Link Strength with Aerial currently
(Middle)
System Report
-Permet Inversion Reactor
STATUS:
Permet fluctuation reduced to [???]
Topological heat exchange catalyst replenished
Permet inversion reactor output decreased to 61%
Permet field stabilization in progress
(Righthand side)
- Link Strength with Gundnodes currently
Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...
I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.
It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....
The news report Rouji presents is from PNB, and the headline is:
Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero
- Assembly League fleet devastated, evacuation warnings issued over wide area.
- Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."
It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.
The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).
We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.
Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force.
In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.
I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.
Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.
But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.
And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).
On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.
Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)
Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.
Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.
In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.
At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.
Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.
In the end, it's not violence that allows Suletta to rescue Miorine. It's love.
And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.
When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.
Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.
And sometimes, he's still your dad.
Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.
It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...
It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.
Rolls up my sleeves
(Left, Top to Bottom)
Quiet Zero - Current status summary
MOBILITY
- After restart, movement velocity of enemy basepoint is predicted to increase
- Velocity of each enemy MS also predicted to increase by average of 37%
- Evasive Maneuvers of main unit will be complex
DEFENSIVE FUNCTIONS
- Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach
- Defense barrier strength 67942049
- Very difficult to invade domain while mutual defenses of basepoint and MS are linked
(Right, Top to Bottom)
WIDE-AREA DATA STORM CONTROL FUNCTIONS
- Expands data storm domain and stabilizes it over a wide area
- Domain is predicted to expand further in future
DATA STORM DOMAIN
- 60%
PERMET DISPERSAL SYSTEMS
- Permet dispersal index exceeds 200
- Permet density x 27.1
- Density increase is accelerating
REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES
- Increases interconnectedness of overall enemy
- Each MS appears to become a sub basepoint
- Basepoint and all Gundnodes are linked
- Link multiplexing confirmed, jamming impossible
A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.
In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links
(Baori Pack)
- Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions.
- Can also be separated from the main unit...
The 'Daedalus' multi tool system...interessante...
In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).
When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.
If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.
I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.
Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!
Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions
I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.
The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.
If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.
In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.
'CGG' functions as a blank space between words.
So, for example, if you wanted to write, "I love you, Suletta." The code would be:
GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT
In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)
I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.
You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.
But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice.
(The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)
Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.
Sibling fights....
It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...
To find out, Click here to go to Episode 23 >>
Or maybe the Masterpost could remind you.
31 notes
·
View notes
The 22nd Day of G-Witch: What We Can Do Now
It's been 2 weeks since the attack and Suletta is still working hard to help her fellow students.
I'm not going to lie, I feel like we as a fandom collectively willed Petra's survival through a week of huffing nothing but hopium that she somehow survived.
Miorine's complete breakdown through this episode is as difficult to watch as it is frustrating. She blames herself for the incidents on Earth (started by Prospera and made worse by Benerit security forces) and the school (in this case she probably correctly assumes that Shaddiq started the attack in response to Guel charging in). And while Prospera and Guel were working for her, it's still frustrating seeing her take the guilt and blame for their actions squarely on her shoulders. I imagine this isn't helped by the fact that she's come to realize that she was being strung along and manipulated by Prospera, and she walked right into it willingly.
You know what doesn't help Miorine's mindset? Shaddiq basically telling her that he decided to resort to terrorism because she turned him down, thus preventing his "peaceful" takeover of the Benerit Group. Another person's actions who she now feels guilty for.
Tomatoes are a symbol of love in G-Witch. And in this case, the tomatoes they grew together is the love nurtured between Miorine and Suletta. Even through everything, Suletta has kept tending to that love, and is now sharing it with everyone in the school. She still keeps Miorine in her heart.
It's great that we got closure to the little arc between Nika and Martin that started in episode 12, but this really should have been the conversation between Nika and Chuchu that was mentioned in the last episode but happened off-screen. I feel like the staff lost sight of their priorities a bit on this one.
Time for the first plot point that really got screwed up by the pacing/writing, and takes me back to something I talked about in episode 16.
Prospera makes a big deal that with a new President, her plans for Quiet Zero will be ruined, so she needs Miorine to run for president and win so that those can proceed smoothly. Now obviously the SAL catching onto her pushed her plans up and she had to deploy Quiet Zero before finishing it, but the events in this episode call into question if she ever really needed Miorine (or anyone for that matter) to become president to finish QZ, except maybe to buy her some time. She clearly bails after Earth and goes straight to QZ, erasing all data on the project in the process, and it's fairly clear that at no point does Miorine, as the new President, hand control of the project over to her. So she never needed Miorine to be president, she always had access to Quiet Zero itself. At best Prospera did need Miorine to become president to buy more time to finish the amplifiers (since unlike anyone else, she could count on Miorine staying out of her way as part of their deal), but it's made pretty clear later that taking them by force was on the table anyway.
So the episode really kind of just makes it look like Prospera never actually needed Miorine to be president in any way, shape or form for her Quiet Zero plans. And she only had Miorine run for the position so Prospera could use the opportunity to stain her hands with blood for no reason other than revenge against the Rembran family.
Suletta is incredibly strong. She loves her mother so much, and to just...talk about how she's not her mother's "real" daughter, that she's only a repli-child, and that no matter what, she doesn't think the mother she loves will actually listen to her because of that cannot be easy. But she does it all with a melancholic look and a smile on her face.
I would love to know how common repli-children are in Ad Stella. None of her friends seem to react to the fact that she's basically a clone, or make a big deal out of it. And Suletta, by now at least, seems to have accepted that fact of her existence and made peace with it. So it makes me wonder if it's not a rare or unheard of practice.
Suletta is also just incredibly brave. Not only has she gained a new motto to live by, one she came up with on her own, but she also wants to speak to her mother and sister one more time, no matter what. And even though she knows Eri has shielded her from Data Storms all her life, even though she knows she's being asked to a pilot a Gundam that has fewer protections from Data Storms than others, she still wants to move forward and talk to her family once more. Even if that means piloting a "monster" that will probably kill her to do it.
The Quiet Zero reveal is definitely a highlight of S2, especially the absolutely haunting and beautiful song composed by Takashi Ohmama for it. We very quickly see how overwhelmingly powerful Prospera and Ericht have become with Quiet Zero, and even before Ericht activated the override and destroyed them like fish in a barrel, the Gundnodes were absolutely tearing through an entire fleet of professional soldiers with ease.
Once again, Chuchu proves to be Suletta's closest friend and strongest ally. Knowing that Suletta could be walking to her death, and knowing that it's an incredibly dangerous situation, she still vows to make sure all of Earth House will be there to support her, so she's not alone. I love Chuchu.
I actually really appreciate that even though he was doing what he had to do to survive, Elan still makes a point to apologize to Suletta for being a creep towards her and trying to assault her. It does come across as being genuine because he does so without being prompted and he could have just tried to excuse it away as him needing to do what he needed to to survive if he had been questioned.
siiiiiiiiiigh
Fuck you, Lauda. You don't deserve the Schwarzette or the screentime.
I actually really hated this episode when I first watched it. I stumbled across the early leaks for the episode and was already pretty upset about certain things in them and I ended up just being pissed off the entire episode once I realized the leaks were real. I still have issues with it, but I've softened on it considerably since, especially Suletta's role. But this was absolutely the first episode where wasting time on episode 15 really did a number on the pacing and I started to have my doubts about if the show could pull off a satisfying conclusion.
25 notes
·
View notes
Heh, I’ll draw a better Aerial next time. The important thing is that I got over my fear of drawing mecha and also over my fear of building plastic models of robots, so thanks, Okouchi!
Some headcanons and ranting under the cut. (With spoilers)
For some reason most of my WfM fanfiction has been centered around Aerial/Ericht ever since the theory about Aerial being Eri started circulating during the first season. I’ve been thinking about AU’s where she doesn’t lose her body and instead is an older teenager/young adult who has to deal with a mother obsessed with revenge while also trying to protect her little sister from the consequences of said revenge (and precisely because of that, she ends up questioning herself wether following her mother’s path is worth it or not).
I think that Eri was a character with a lot of potential in the story. She’s this girl who lost absolutely everything, who might be sad and angry about it but can’t do much on her own. She loves her family and even if she also wants to help her mom get revenge, she knows that it’s wrong and she doesn’t want her clone/little sister to get involved in any of it but, yet again, she can’t prevent the fact that her sister is used as a pawn, and she’s also being used, even if her mom doesn’t want to admit it. The dilemma of wanting to help her mom while simultaneously wanting to protect her sister’s innocence is a very compelling part of the story. Also the relationship between the sisters had a lot of potential. Eri could’ve seen Suletta as everything that she wasn’t able to become and that could’ve lead to very complicated feelings. There were a lot of elements that would have turned Ericht into a very interesting and nuanced character and I’m not even mentioning the transhumanism angle, there was a lot that could be explored in that area.
However, as we know, there wasn’t much about this character in canon (even if she was important for both the protagonist and the antagonist of the show). She remained a mysterious figure throughout most of the story and we didn’t get to know much about her motivations. In fact, most of what we know about her comes from the short novel “Cradle Planet”, the anime didn’t bother to put that information in the story and that’s why for most viewers she’s this creepy girl haunting a Gundam who’s almost as big as a jerk as Prospera. To be honest, I was expecting her to be more conflicted during her battle with Suletta or at least I wanted to kow why she was so convinced to follow her mother’s plan. At the end we didn’t get any of that, and she remained as an underdeveloped character.
So yeah, I have the impression that in my head I made up this nuanced and tragic character out of someone that ended up being a Funny Little Guy inside a keychain. Well, I guess this is very common when one starts liking a secondary character from a show. (I always wondered how people would make long essays and fafics about characters that didn't do much in a show... guess I'm that kind of person now).
Well, I suppose that I’ll have to stick to my fanfics and headcanons, at least I know that nothing I could write’s gonna be more wild than what actually happened in canon. So there’s that.
…Thanks Okouchi :/.
P.S: I like to speculate what kind of teen/young adult she would’ve been, specially in slightly less tragic AU’s, maybe she’s more like she was in the Prologue or she’s a little bit messed up because she’s shielding her sister from everything that’s wrong with their family. Idk, I just find her very fun to write (although I’m always aware that I might be creating some sort of pseudo OC, man I really wish that canon had given us more material to work with!)
57 notes
·
View notes
So let's talk about forgiveness.
Forgiveness is shaping up to be a very important thing going forward, and so far it already kinda is.
Now the interesting thing about forgiveness is that it's never actually a requirement. Just because you hurt someone doesn't mean they have to forgive you for it. But what's fascinating about the last few episodes is that we have Petra and Chuchu showing that they want to forgive. Because they care deeply about the person they are forgiving. Petra wants Lauda to take her for dinner, and move forward. Chuchu wants to know everything - she can't forgive Nika if she doesn't know what to forgive. But she WILL forgive her. Because she cares about her.
Love being the motivator for forgiving someone is kind of at the heart of this. You don't want to lose the person you love so dearly so you want forgive them, because the thought of cutting them out hurts far more than anything they could do to you.
Petra is the lower end, from what i recall, cause she just got stood up. But Chuchu and Nika is a bit more extreme. Nika was part of a terrorist group and Chuchu still wants to forgive her, but she just wants her to talk to her. She doesn't care what Nika did! She just wants her back in her life.
And I think that the parallels with sulemio are obvious. Suletta would absolutely forgive Miorine. But she needs her to talk to her. And like Petra, she wants lunch. Dinner. To just spend time with her. Because regardles of how badly Miorine hurt Suletta, she had her reasons, and Suletta loves her so much that she just wants her back in her life! She wants to forgive her! But Miorine almost certainly does not believe she will deserve it for what she did. And that's the best part.
Forgiveness is not something someone ever deserves. You either receive it, or you don't. That is a decision outside of your control.
God i love this show
55 notes
·
View notes
I wanted to like EarthSpark. I think it does some interesting things. I really like Twitch, they somehow got me to enjoy Good Guy Megatron and I love Bumblebee’s almost meta characterization. But it just felt like a very weak show which never explored its concepts with any depth. That and the finale was a garbage fire. Oof.
Though I think one of my biggest problems is the weird disdain for humanity as a whole. Where you’re either part of the absurdly kind and accepting main family or stupid and/or evil. Where even the slightest discomfort with the people who dragged humans into a massive war they had no business with makes you despicable while the robots deserve to be treated well no matter how awful they are. I get it’s meant to be a bigotry allegory, but if I’m honest I just think it’s a really bad one. I’m not even a person who generally likes the human characters in Transformers stories, bar a few exceptions, but it really grinds my gears.
I also just get the really weird feeling from it that the writers aren’t comfortable writing for kids. So everything just feels dumbed down to an at times condescending level and feels weirdly afraid of interpersonal conflict beyond the first batch of episodes. Though I could be exaggerating. I’m kind of glad it got a second season since I think it can improve but I somehow doubt it will last long.
I don't want to hate Earthspark, or come off as a contrarian just because I like super robot stuff and don't like IDW stuff. I mean, there are things to like in Earthspark, but as I've discussed with a friend of mine, Earthspark feels like it's a bunch of characters in search of a plot. For better or for worse, I associated Twitch with Suletta Mercury because the two had that similar wide-eyed innocent energy and red motif, which endeared me to her almost immediately. I can take or leave Megatron as a more sorrowful/heroic figure, but at least he felt like he was genuine about wanting the kids to avoid the mistakes he made.
The problem is as characters, they don't really do anything. GHOST and Mandroid, as much as I adore Diedrich Bader's usually (he is the guy you want when you want a more Silver Age Batman) were not interesting villains because they weren't allowed to really do much besides be a blunt bigotry allegory, while at the same time, not really fitting the allegory. Readers of the recent Skybound comics know the kind of damage out-of-control Decepticons can pull, and humans aren't exactly being unreasonable in not wanting to deal with giant killer robots whom Earth's military has no reliable way of stopping, besides the goodwill of other giant killer robots, and a population that feels powerless. Considering Skybound has been implying such a situation horrifies the government into founding Codename: GI Joe specifically to combat the Decepticons, people are well within their rights to be scared. It's not a good allegory because most oppressed people don't have built-in chainguns!
The IDW era of Transformers stories, I presume as a reaction to the Michael Bay movies and the Unicron trilogy, did have a significant and notable hatred of the human characters. I mean, Cyberverse has a human in one scene. One. I think it's just using that framework to make your bigotry allegory, except the allegory doesn't work, and people have resoundingly rejected shows like Cyberverse.
As for your last point, I don't know if it's a case of the writers not understanding how to write to a children/family audience (if there's one thing kids hate, anyone hates, it's being spoken down to) or if they're just that adamant about hammering the life lessons to the detriment of everything else, hence the low stakes, flat villains, and blunt allegories.
I feel like most of my negative comparisons ultimately are based on the fact that the Skybound comics have proven that there's a better way to do this since those comics seem to be the first time since Animated that people writing Transformers stories get why people like mecha/super robot stories. And while I have no idea how the second season will turn out, I'm admittedly not expecting them to have learned their lesson. Then again, with the rumors that they want to get the live-action TV show going again, I imagine we're going to be in this weird sort of "leftover IDW" style writing malaise for a while since it will likely be years before enough Skybound comics are ready for a proper adaptation.
14 notes
·
View notes
(FE: Engage) Alear / Crossover Emblem Rings
Honestly, I couldn't really think of anything unique for a reverse situation, so instead, I raise you Alear meeting even more crossovers, cause apparently I can never escape my insatiable hunger for mixing games/show together.
Hope you enjoy, @unknownsymbol367!
Awakening:
(Vander) "Hm. I have never heard of this Emblem, but perhaps we should go ahead with the incantation?"
Alear nodded.
(Alear) "May all your blessings find their way their way to us, Emblem of the Witch!"
From the ring burst forward a giant being of steel, alongside a small red haired girl. She began to panic as her arms flailed in a pattern.
(Suletta) "I-IT CAN FLY! IT CAN DANCE! AERIAL!"
She froze in a pose with arms outstretched, clearly panting and showing signs that she was about to fall over. Which was impressive, given she was just a manifestation and not a physical being.
(Alear) "..."
(Vander) "..."
(Suletta) "..."
Alear and Vander stared at the girl silently, not entirely sure what to make of the situation.
(Alear) "...M-My name is Alear, and this is Vander. We require your help miss...Aerial?"
(Suletta) "U-U-Um...! Aerial is my sister. M-M-My name is S-Suletta!"
(Vander) "Are you alright? You seem to be sweating a concerning amount."
Alear rose her eyebrow in confusion, silently whispering to the side.
(Alear) "...Marth, are you able to sweat?"
(Marth) "No, we're not...Just a moment."
Marth floated over to Suletta, which she recoiled at the sight of him suddenly materializing in front of them. However, the steel giant known as "Aerial" seemed to have its eyes glow in response.
(Marth) "I am Emblem Marth, we are on a mission to defeat the Fell Dragon. May we count on both of you?"
Suletta looked incredibly nervous before looking at Aerial, whose eyes flashed again. Though no one heard any noise come from the being, Suletta suddenly had a determined expression.
(Suletta) "Right, if I run, I gain one. Move forward, and gain two!"
(Alear) "Hah, I think I quite like that saying. We're lucky to have you!"
===
Supports:
===
Alear
(Suletta) "I heard your mother was a wonderful person. I-I'm really sorry to hear what happened..."
(Alear) "Thank you, Suletta. I'm glad you still have your mother, and your sister to support you."
...
(Alear) "Suletta, I swear I'm hearing someone else talk to me whenever it's just us..."
(Suletta) "Hm? Oh, that's just Aerial saying hello! She's louder on some days more than others."
===
Clanne
(Suletta) "W-wow! You're so young! Reminds me of Chuchu..."
(Clanne) "From what I've heard of your friend, I don't want to make her angry...!"
...
(Clanne) "You say you pilot Aerial? That must take an incredible strain on your body."
(Suletta) "I've never really noticed a physical strain on myself with Aerial before. I-Is that normal? T-There's nothing wrong with me r-right?!"
===
Chloé
(Chloé) "You always seem so cheerful when having lunch with us, Suletta. I only wish we could let you have some of the local cuisine as well!"
(Suletta) "T-Thank you for the offer miss Chloé, b-but I must decline! Grilled rat seems..." shudders
===
Rosado
(Rosado) "Aerial looks absolutely adorable! But, I think she could use a few more ribbons on her. What do you say, Suletta?"
(Suletta) "Adorable? I don't think I've heard anyone call her that. Maybe we can spruce the cockpit up? I'm afraid the ribbons might get burnt up by the beams or the thrusters..."
===
Lucina
(Lucina) "Hah, looking at you talk to Aerial reminds me of my own family."
(Suletta) "Do you think my mom can meet yours? I'm sure she'd love to meet them!"
===
Victory Quotes:
"It can fly, it can dance! Aerial!"
"Move forward, gain two!"
"The only result is the truth!"
Awakening:
Alear, Marth and Vander looked at the ring with growing concern. What kind of ring to help defeat the Fell Dragon would be called the "Emblem of Calamity"? And the incantation didn't help put aside fears either.
Alear sighed before he nodded. It's better they have it than the enemy.
(Alear) "Devour our foes, Emblem of Calamity!"
A long black haired woman emerged from the ring, clothes and cape visibly torn as she stoically turned towards the group.
(Velvet) "...Who are you supposed to be?"
(Alear) "My name is Alear. We're on a mission to defeat the Fell Dragon, thus we have summoned you."
(Velvet) "You know my title and you still chose to summon me? You're clearly desperate."
(Vander) "You will not address the Divine One that way!"
Velvet's eyes glanced over to Vander, visibly getting more annoyed.
(Velvet) "If you want my help, then suck it up. Or should I eat you too?"
(Marth) "We can all be friends, Miss Velvet."
(Velvet) "I'm not here to make friends. I just want one person in my world dead...Alear, right? What is your plan for the world once this Fell Dragon is gone?"
(Alear) "To work towards a brighter future?"
(Velvet) "Not dictated by reason?"
(Alear) "Dictated by...? N-No. Peace."
(Velvet) "...I suppose that'll do for now. Let's get moving."
(Alear) "Thank you, Velvet."
===
Supports:
===
Alear
(Alear) "You put up such a harsh exterior, but you're quite kind! I've seen how you speak with Jean and Clan-"
(Velvet) "Tch, I have no idea what you're talking about. Spread any rumours like that, and I won't hesitate to eat you."
...
(Velvet) "I appreciate that you clean your own room despite having servants. Not a half bad job of keeping it tidy, either."
(Alear) "It just never felt right to me, letting someone else do all the work...Y-You're glaring at my bed pretty badly there. Is something wrong?"
(Velvet) "Who ironed your bed? It's covered in wrinkles! You need to properly-..."
(Alear) "Hah, Velvet, it's all right!...V-Velvet? Wow, she's still going on about the proper technique..."
...
Jean
(Jean) "ACK! H-Hi, Velvet...D-Did I do something wrong? You're staring at me."
(Velvet) "...Nothing. Sorry."
===
Alcryst
(Velvet) "I'm only gonna say this once. Knock it off with that self deprecating crap and you mean the world to your brother."
(Alcryst) "H-Huh? But-"
(Velvet) "Shut up and let me finish. In a war like this, you don't know what will happen. So cherish the time you have with him, and remember he'd never forgive himself if you get yourself killed."
(Alcryst) "...R-Right." ...Why did she look so sad saying that?
===
Louis
(Velvet) "...Watch where your eyes wander, Louis, or else I'll gouge them out."
(Louis) "Oh, apologies if I have offended you, Velvet! I was merely observing the way you speak to others."
(Velvet) "Tch, even Phi has more tact than you..."
===
Kagetsu
(Kagetsu) "Ah, thank you for the sparring, Velvet! It was quite the thrill to finally fight you!"
(Velvet) "Hmph. You remind me of someone back home..."
===
Goldmary
(Goldmary) "Have you no shame, Velvet? I must acquire you a new set of clothes this instant! With my taste, you'll be wowing men in no ti-"
(Velvet) "Touch my clothes, and I'll eat you."
===
Bunet
(Bunet) "Why, your recipe has come out spectactularly! How did you acquire such skills?!"
(Velvet) "Heh, I learned from my sister, who learned it from my mother. All of our cooking is passed down. Too bad I can't cook it myself...Not that I could taste it anyway."
===
Victory Quotes:
"No mercy!"
"Show's over."
"Is that all? That was barely a fight."
Awakening:
Alear felt a burning rage from within the ring just holding it. Whoever was inside would make a strong ally indeed.
(Alear) "Receive us, O Emblem of the Dragon!"
A man in a gray suit slowly rose from the ring, turning and cracking his knuckles.
(Kiryu) "My name is Kiryu Kazuma."
(Alear) "Kiryu, it's nice to meet you. I'm Alear, we need your help in defeating the Fell Dragon."
Kiryu nodded and stepped forward.
(Kiryu) "There's room for only one dragon in this world."
Alear awkwardly coughed as Vander and Marth smiled. Straightforward, but he was at least easy to work with.
Supports:
===
Alear
(Alear) "Your fighting style is incredible, Kiryu! Do you think you can teach me some of your moves?"
(Kiryu) "I'm no teacher. And your fighting isn't something to sell short either."
...
(Kiryu) "So, you're a real dragon?"
(Alear) "That I am...Well, rather I'm told that. The Divine Dragon, specifically but honestly? I don't feel that different."
(Kiryu) "I see..." (How did I even get to this point in my life...?)
===
Etie
(Etie) "WOAH! Your muscles are so dang ripped! You gotta tell me your workout regime!"
(Kiryu) "I've never had a woman ask me that before...Well, I suppose it wouldn't hurt, considering our circumstances..."
===
Alfred
(Kiryu) "Why do you keep staring at my arms?"
(Alfred) "Huh? Oh! S-Sorry, your biceps are massive! Can I feel them?"
(Kiryu) "That certainly explains Etie..."
===
Jade
(Jade) "Kiryu, may I trouble you for your experiences in the...How do you say, yah-koo-zuh?"
(Kiryu) "There's nothing funny about the life we lead. It only leads to misery, so I'm afraid I can't help you with your ideas."
===
Anna
(Anna) "You just throw your money out to distract people?! Talk about a waste!"
(Kiryu) "Aren't you a little young to be worrying about that kind of thing?"
===
Pandreo
(Pandreo) "Holy smokes, Kiryu! You got a KILLER singing voice!"
(Kiryu) "Heh, I've been told I have a passion for karaoke. I doubt anyone understood what I was saying, but I'm glad you enjoyed it."
===
Byleth
(Byleth) "People keep telling me I have a hard to read face."
(Kiryu) "Hm, I do as well. I'm not exactly sure how to change that..."
===
Victory Quotes:
"Want to die? THEN STEP UP!"
"That's rad."
"Kakatte koi!"
Awakening:
(Alear) "Accept our mission, Emblem of the Soldier!"
Electricity shot out of the ring, as a man slowly stood up from all fours, bandana flowing in the wind.
(Snake) "This is Snake. Kept you waiting, huh?"
(Alear) "I'm Alear. We need your help in defeating the Fell Dragon."
(Snake) "Any backup?"
(Alear) "Plenty. You have me, and the rest of the army at your side!"
Snake looked to Alear, Marth, and Vander.
(Snake) "An army, huh? Not used to fighting in a unit this big. But, sounds fine to me. What's my first mission, Colonel?"
Supports:
===
Alear
(Alear) "If I may ask, why exactly do you call me Colonel?"
(Snake) "Feels more comfortable than me calling someone "Divine One" all the time. Besides, you don't like that title much either, right?"
(Alear) "Hah, fair point."
...
(Alear) "You want me to do what in that box?"
(Snake) "Sit inside it and hide. It works a lot better than you think it does."
===
Framme
(Snake) "You know, you remind me a lot of a girl I know named Sunny. She's just as positive as you."
(Framme) "I'll take that as a compliment, mister Snake!"
Lapis
(Snake) "You make your own gear on the field? Impressive."
(Lapis) "Oh, I doubt it's as impressive as anything you'd make, Snake. Mine are just little knick knacks and things to make life a little more convenient."
Yunaka
(Yunaka) "Wow, you're a lot deadlier than you look."
(Snake) "Could say the same to you, Yunaka. You're smart to hide that fact...Even if it is a little obvious."
Zelkov
(Zelkov) "Snake, you are quite the enigma of a man."
(Snake) "Can't say I have a straightforward past. I can probably guess the same for you." ...Why is he speaking like that?
Fogado
(Fogado) "So, you say you don't believe in the supernatural when you see monsters rising up and us using magic?"
(Snake) "In my world, I don't. Here, I can understand the magic at least, so that means I can fight it."
===
Victory Quotes:
"This is Snake, I'm done here."
"Mission accomplished."
"Showtime!"
35 notes
·
View notes
So, I dunno, thoughts about Witch from Mercury (including spoilers under readmore, so, y'know), because it seems like it's a cool thing to do, i guess. Maybe made more or less interesting because this is the first Gundam series I've actually paid full attention to.
In short, it's good! It's very good. But, I dunno, can't give it top marks as an alltime favorite. There are lots of superficial problems that probably mattered much more to me than they would to the average viewer, and like, you could argue that they just aren't even problems, I guess.
The biggest thing I can criticize without spoiling much of anything is that it dangles a lot over your head and then waits a long time to resolve almost any of it. It's tough for people who get anxiety, like me : ). No, that's not why I'm writing this post. This isn't a coping mechanism. Fuck off.
To reiterate, though, on the whole: good. Good show. Good stuff. Don't click "keep reading" unless you want to read a fucking novel, OK?
I have to say I think the strongest character of the show bar none is Prospera, but at the same time, she showcases the recurring problems I have with the show: firstly, that they spend way too long making Prospera sound sinister without you understanding at all why, and secondly, that it's a real shame we didn't get to learn more about her feelings and why (and how?) she'd gone to all of this trouble. I understand her goal in the abstract is to "create a world where Eri can exist", but it's not clear how exactly she intends to do that, and maybe it's just me, but those practical details can be really important in selling me on an idea.
Even so, I adore her. I adore the way she possesses so much influence over the plot despite having very little economic or political power herself - she just understands people, she understands what's at stake, and she understands how to manipulate things to get what she wants. I was so delighted to learn about her true motivation, imagine a girl kicking her feet and squealing as Prospera taunts Miorine about hearing the voices of her past that are urging her to seek vengeance. I wish she could have done more. I also wish she looked better. That helmet fucking sucked, dudes. C'mon.
I really want to say kind things about Suletta and Miorine, too - they had lovely character arcs in both seasons, Miorine in particular was a joy to have on screen at all times - but, ultimately, I also found them both very frustrating. The most engaging members of the cast by and large were side characters, my personal favorites being Chuchu, Nika, and Norea. (I guess Guel turned out pretty okay too.) It was a joy watching Norea go off the fucking deep end, even if her portrayal was a little shallow until it was a smidge too late; her final fight was beautiful and touching, especially the part where she went on a massive rampage and killed a lot of innocent people. I love me a hot girl who's a violent mass murderer.
Jokes aside; I found both of the main characters frustrating, but for different reasons. Suletta was the less frustrating of the two. Throughout season 1 I kept cringing at her total powerlessness within the narrative, which I know is kind of the point, but that doesn't mean I have to like it; at least in season 2 she develops a thin veneer of agency, and more to the point, the writers demonstrate that her lack of actual agency is in fact horrifying and not some kind of endearing country-bumpkin quirk, but it feels like it takes a long time before she can finally actually engage in the world she lives in.
To be clear, I don't just mean "she can decide for herself what she wants to do", that's her final arc, I know, I get it; more what I mean is, it feels like Suletta exists in a totally different show, an entirely different setting, for 75% of the show's runtime. She's not just clueless about all of the business politics and Earth vs Space racism; she's immune to it, it simply doesn't affect her, even when it badly hurts people she cares about, because she's unable to comprehend it, and can abstract away any threat behind Aerial's cockpit and duel herself to safety without ever understanding what was even at stake.
It's like Ender's Game but Ender himself never actually participates in any of the school politics, he just kinda is a prodigy in his own corner while the real story happens around him. If you're going to create a character who is powerless in the narrative, don't then shield her in the cockpit of a Gundam for the entire show, you know? If you're going to threaten me with her inability to understand what is going on, make good on that threat!! It just felt wasteful. She spent 16 episodes being a joke that we keep hoping will make Miorine smile, 2 episodes being depressed, and then the last 6 episodes being an actual character, and the tragedy is that I really liked that character and wish she'd been around for longer.
Miorine was much more fun, but also, much more frustrating. I wasn't especially into her character early in season 1, but she was at least a bitch in a fun (and highly sympathetic) way, and unlike Suletta she grew into a real character very fast, and got to spend the whole show actually having a meaningful impact on events around her. It was great! I have a few very small gripes about things she does - like the way she chooses to cut Suletta loose. I understand she's doing it for Suletta's safety, and I understand she's doing it because she believes Suletta won't be able to comprehend that reasoning - after all, their whole arc in season 1 was about depending on each other, and Miorine is being pressured into going back on her promise.
On the one hand, though, I feel like it was weird of her not even to try. At least try to explain to Suletta, listen, things are getting worse, you are going to get hurt, I don't want that, I need you to stop being Holder for your sake. You could even twist the knife further by having Suletta react with heartbreak but willingly agree when Prospera doubles down and tells her to do as Miorine says - imagine how betrayed and disgusted with herself Miorine would feel! For them to leave her completely in the dark, for her to fully betray Suletta with no warning and no attempted justification at all - and especially for Suletta to not question that - it just felt weird.
On the other hand, though, I'm really shocked and disappointed that Miorine didn't express more guilt over that decision. Given that her arc in season 1 revolves around recognizing that relying on Suletta is what makes Suletta happy, and she cares enough about Suletta to give her that kind of trust, you can't tell me that - even if she really believes it's necessary - she can just turn around and betray Suletta like she does and feel no remorse over it.
Overall this is a larger problem I have with Miorine; we don't get enough time with her feelings, so when everything finally collapses and she has a meltdown, it doesn't sell very well. I wanna be clear: I'll open the door myself is one of my favorite moments in the whole show, and that's why I'm sad. It could have been so much more, if we had had more time to see Miorine's heartache over what she did to her best friend, not to mention how tense and uncertain she must have been handing her full trust to Prospera, or leading a negotiation to Earth with the weight of Gundam's history resting squarely on her shoulders. I love cool, calm, reserved characters who can handle tense interpersonal conflict with a stern decisiveness. Miorine should be a slam dunk for me. But the best part about those characters is seeing behind the mask, even if only for little bits at a time, and there's just not enough.
Honestly, though, it's hard for me to hold anything against season 2 especially, because I think most of what frustrates me comes down to there not being enough time, and holy fuck, does that season go hard. I'm very ready to believe that there was all kinds of stuff cut from S2 because the sheer volume of things happening was so much. It's a shame to think that it's let down by its own density, that there was just too much happening to fit all of it into 12 episodes without a few things being left behind. There wasn't time for Miorine to introspect, there wasn't time for Miorine and Suletta to develop their relationship, there wasn't time for Prospera to get even more unhinged and weird, there wasn't time to examine how we could actually improve the world and its troubles, we just had too much to do. It's an unenviable position to be in, and I think it's fair to say the show does a great job with what it has.
Umm. Is there anything else? I could talk about the dudes. I could gush about Norea and Sophie, I guess, but I doubt I have anything particularly interesting to add there, I'm sure the takes "Norea is hot" and "I wish they could have been more toxic yuri on screen" are lukewarm at best. I could talk about Eri, I suppose, but I don't feel really strongly about her - I think she's weird, her presence as a character is very strange, the fact that she was a protagonist is weird, and just like with everything else, I think it comes down to a lack of time to be able to really get into understanding her. I can't say it's a mistake, really, so that'll just stay a mystery, and it's one I don't especially care to solve anyway. She can stay a weirdo for all I care.
Uh, I think that's kinda all? Oh, what, robot designs? Uh, Aerial over Calibarn, don't @ me. They're both sick tho.
10 notes
·
View notes
so I’m largely writing this because I feel like I have to, for closure, y’know? I’ve been posting bits about most of the really impactful episodes of the second season of this show so it wouldn’t feel right not talking about the ending at all.
I’ve seen criticism floating around that the ending was rushed. I agree with that criticism, but I also don’t find myself really caring. could the ending have been better paced? sure. is the narrative conclusion to EVERYTHING perfect? nope. but I’m not left feeling that weird hollow feeling you get when you really enjoy a show and then it ends in a shitshow, largely because the parts that I wanted to happen mostly happened. the series as a whole doesn’t feel lesser for the flaws of the ending, and the things the ending DOES do right make up for it, in my opinion.
getting the obvious out of the way: they didn’t pussy out. the ending isn’t vaguely tragic and open-ended, and they didn’t pull a “and they were best friends forever :)” with sulemio. they’re married. they didn’t KISS or anything, but that’s not really necessary, even if a small part of me kinda wanted to see it anyway. they’re happy and safe and together. mission accomplished.
moving on, nika faced consequences. I was REALLY happy to see that. she was a small part of it, in the grand scheme of things, but she DID play a role in getting a lot of innocent people killed. it’s good that there were consequences for that. shaddiq faced consequences. again, awesome. shaddiq was a lot more directly responsible for a lot more death and misery, and I’m pretty sure the implication is that shaddiq will be spending the rest of his life in jail. I’m not actually a super big fan of life sentences, as I feel like prison should be about rehabilitation rather than punishment, but it would’ve felt a lot more hollow if shaddiq got away with a slap on the wrist. he did bad things. he should take responsibility for that. it’s good that he, and the show as a whole, recognizes that, even if “spend the rest of your life in prison” isn’t actually the conclusion I would have reached. I’m not sure what conclusion I WOULD have liked, but the crux of the issue is that there ARE consequences.
all of that makes the fact that prospera faces NO consequences... weird. I get it, crippled old lady with no direct evidence linking her to her crimes, but it feels EXCEEDINGLY frustrating to know that, after what she did at quinharbor especially, prospera’s ending is... getting to sit with her family in a nice field. it feels like she should have taken responsibility to SOME extent, if not legally than in some other way. that being said, I can forgive the show for this. not really because I agree with it, but because I think that suletta deserves a happy ending without strings attached, and even though I don’t think prospera is a very good mother or a very good person, suletta clearly loves her. if prospera being in her life is part of her happy ending, I think I can forgive it.
I have no idea if delling faced consequences. I like to think he did? but also I like to think miorine had a chance to... not reconnect, because I think that bridge has been burned even if their relationship has improved slightly over the course of the show, but find closure with her father. I also like to think he actually apologized and owned up to the FUCKTON of abuse he put miorine through but I’m well aware that I’m chasing a fantasy there.
um. permet ghosts. they don’t quite make sense in-universe, honestly, but I don’t really care. they were a very nice way to tie-up the narrative themes and character arcs of the people they affected, and I’ve always been the kind of person that can value thematic and symbolic parts of a narrative above the strictly logical side. I don’t really need to know how and why permet ghosts exist beyond what was explained in like, a single line, because it felt satisfying and thematically appropriate to have them. they did what they needed to do, and I can suspend my disbelief enough to quiet the part of me that questions the “how”.
I KNEW there was some shit up with elan prime. then again, I also thought it was a lot more “oh shit I just realized how in over my head I am, that’s a lot of people that are gonna be murdered and it’s overpowering my learned habit of reducing human life to numbers on a sheet of paper, this might be a bad idea”, and not as much “ya’ll are boring and I’m tired of you, see you in hell, peace out”. but I’m not sure how in-character the former would’ve been, so *shrug*.
eri in a keychain is JUST funny enough for me to forget that she killed people. well actually that’s a lie, it’s just that there’s very little ways that eri’s story could have wrapped up, really. either she dies in a heroic sacrifice to redeem her sins, which I never really like for a multitude of reasons and also feels really cruel to a child that has spent most of her life trapped in a giant robot after her family, her life and her future were robbed from her by corporate assholes, or she lives in some kind of weirdo in-between life, like she has been doing as aerial for like 17 years (or more?) but hopefully a little less awful. I like the latter better. I don’t think in-universe lore can justify giving her a new body, which I would’ve REALLY liked purely because even if she’s done some bad shit I think eri deserves to live as herself, with full freedom. but this is okay too.
suletta getting to fulfill her dream of opening up a school is *chef’s kiss*. miorine getting to be a girlboss for a cause that she believes in is also *chef’s kiss*. them being a happy couple is *chef’s kiss* squared.
all in all, I’d say the ending was a 7/10. I’m satisfied, even if it’s not perfect. that being said, the entire show as a whole remains at a 9/10 for me. is good. lesbians in space becomes political drama becomes high-stakes war tragedy becomes family drama becomes lesbians in space again. time well spent.
42 notes
·
View notes
hey its time for episode 4
starting off with one of the funniest fucking scenes in this whole show with suletta just fucking hauling ass right out of there after guel just surprise proposes to her
just want to juxtapose this with her wild feelings speech in 17 about buying rings and wearing the prettiest dresses
this shot just reminded me of a random detail from the manual for chuchu's demi trainer - it says earth house can't afford their own demi trainers so chuchu's is a modified older version because thats the best they could do.
suletta pilots a demi trainer during the whole field test thing so like... does she own or have a demi trainer loaned out for school use or something? i honestly forgot chuchu pilots her own suit in this scene cuz i had just accepted that the demi trainers for practical exams etc were like just there for the students to use whenever
i know this was like probably the easier way to write suletta becoming friends with earth house but lmao why didnt she just ask miorine from the start to help for the makeup exam. baka suletta.
suletta please.
till will forever go down as bestboy in the series tbh. like someone needs to write a fic where he wingmans for suletta while nika does it for miorine
suletta, you naive little baby
there really was absolutely no reason for miorine to get all handsy and possessive here lmao like she could just stood infront of suletta or even right next to her and still had the same confrontation and warning about the other houses being bad news
the 2nd light novel picking up from here and highlighting miorine's jealousy over el4n during this whole arc is perfect lmao
kinda fun to speculate on how suletta saw miorine during the beginning. like she was completely surprised miorine didnt belong to a house. suletta's so awkward and socially inept she couldnt tell she was dealing with the one other person at school who was equally socially inept
i feel like there's a lot of frames i never paused on to read like this one lol. i never realized suletta got so many questions wrong. well "wrong" cuz reading through her answers it almost sounds like she just didnt give the benerit group approved answers lmao kinda like when you get stupid training stuff at work and they're just chockful of anti-union propaganda
never forget the first time we saw miorine's room
i know so many people don't really care about the class conflict in ad stella, but god, i wish they really hadnt dropped the ball on this. like in the 1st cour they had something really good here
obligatory shot of chuchu's dads
miorine rembran will not let anyone insult her woman
does anyone know what this gold gate/door thing was supposed to be? after the second school shooting, there's a shot shown where it's the only thing left standing in that area and i dont think ive ever seen anyone talk about it before
see like even this is good re: class politics. like its not this cut and dry all spacians are evil capitalists thing. mercurian miners were pretty much lured out by the benerit group to be exploited for their labor and then left to dry once a cheaper source for permet was found. bless the fic writers who've turned that into appalachian town suletta because it's such a perfect analogy
suletta mercury literally got decked in the face and we all just focused on the chuchu punch
imagine miorine sitting with her in her room just helping her ice her face
by the way how excited do you think suletta was to call someone senpai just like in her fair use mangas lmao
ok all set with episode 4. ive gotta say, it is super jarring to go back to these slice of life school episodes after everything we've been through in the second cours. like yeah that was kind of the point in having the first half of the series have pretty much no stakes since these kids are about to be thrown into war
you know for all the complaining a lot of losers did when the show started about this not being a "real" gundam series, the only difference between watching suletta's journey versus say amuro's... is that we got to see suletta's life before everything got wrecked. with amuro we just immediately start off at the point where Everything Goes Bad
26 notes
·
View notes
On the reading of El4n not being interested in suletta, iirc he said a line saying something to the effect of that he’s not interested in anyone in the first or second episode, and at that point i had to stop to take a pause and cheer because new aroace character hc unlocked
Obviously other reading/hcs are valid, this is just my personal hc, and the intention of the line was emotional repression or something, but it’s still cool to have a possible aroace reading/hc of el4n
Yes, I completely agree! I think it's safe to say that at the very least his early interest in Suletta was about as far from romantic as you can get---he was curious about her, was delighted to find (what he thought was) someone just like him. He wanted to not be the only one!
And even near the end, I still don't see Elan's genuine fondness for her as anything but platonic; she's kind and he has not met many kind people. She wants to be his friend, wants to learn about him because he showed kindness to her. They would have been best buds, I think, but I doubt it would've progressed much further than that.
22 notes
·
View notes
The Witch from Mercury Season 2 Reaction
Episode 20: “The End of Hope”
Ominous title
Let’s see. Norea is ready to explode, Miorine is freaking out, Guel seems hellbent on taking down Shaddiq, and Grassley Squad is making their move. Shaddiq again seems to be laying much of the blame on Guel, even though this tragedy happened as he was leaving.
Who knew Rouji of all people had mastered the art of interrogation? Or is Martin just that much of a wuss?
Who knew Lilique could get mad?!
So Suletta has finally gone back to class, but now she’s being harassed as well. Now that she is no longer the Holder and no longer Aerial’s pilot, she’s naturally an easier target.
Now Petra is being nice to Suletta. Guess saving her boyfriend scored her some points.
Guel may be learning to be a better person, but he should learn to be smarter.
Shaddiq seems out for blood now
They’ve released a pissed off witch from the basement and she’s fixing to go on a rampage. The ball is in your court, Number 5.
Looks like Chuchu’s Demi-Trainer is out for the count. They don’t have any mobile suits left.
Petra, stop talking! You’re waving so many death flags right now with the things you’re saying! She’s going to die right after I found a reason to like her, isn’t she?
If Shaddiq is openly admitting his crimes on their comms, I doubt he plans on leaving Guel or anyone else alive.
Look, Guel, you need to understand your father was a grade-A a-hole. You could have a lengthy debate over who is a worse person between him and Shaddiq.
Now Lauda knows Guel killed their father. Will either of them live long enough for that to matter?
Not the Greenhouse! Oh, that bitch done it, now!
Now Felsi is in the firing line! What am I saying? Of course, she is. Any pilots with working mobile suits with the guts to be out there is gonna be. Too bad that even if they didn’t have the school’s limiter, they’d still be hopelessly outmatched.
When Secelia decides its time to move the plot along, she delivers. A brand new mobile suit for Chuchu and the timely return of her traitorous mechanic.
Since when did Pompom Head become a thing? That’s the second person to call her that
It’s not like I don’t get Shaddiq. He is a demon of the Benerit Group’s making. I can’t even say with confidence that in his position I wouldn’t have made similar choices. He’s still crossed a line, and got innocents among both Spacians and Earthians killed. He’s also not as clever as he thinks he is, ready to blame Guel for interfering in his plans when he is the one committing crimes.
Did Guel just outsmart Shaddiq and Sabina? And he disabled their suits without killing them. Not only was that impressive, this might be his first real win in the entire show. Unfortunately it came at the cost of Norea going on a rampage but there was a solid chance it could have happened, anyway.
I begrudgingly give points to Number 5 for talking Norea down. Unfortunately, that win is short lived. Serious though, who was the dumbass who thought it was a good idea to fire on them after they stopped rampaging? And if you were going to do that, why only take out one of them when the other as far as they know is equally dangerous?
Back to Suletta, finally. Aaaaaand, yep. About what I expect. Oh , and there’s the title card!
That is such a Suletta thing to do, honestly. She used to do this kind of thing back on Mercury, too, so really, she’s falling back on what she knows. I’m also genuinely surprised that Earth House hasn’t suffered any casualties, though they’re probably going to get blamed for this, too.
27 notes
·
View notes
Hey, Van, could you explain permet to me because I don't think I ever fully understood how it works or what happened at the end and how was it different from quiter zero? Please?
Oh dear. Gundam technobabble. Keep in mind that I'm writing this without having read any of the official additional material, this is just what I can glean from the show itself.
Alright so Permet's whole thing is that it can form a networks with itself under specific conditions. Presumably it means that anything with a sufficient concentration of Permet in it -- including human beings -- can act as components of that network, kind of like a big integrated circuit. For Gundams specifically, this means that the pilot becomes a part of the operating system of the mobile suit -- it looks like other Permet technology includes an additional layer of interfacing, which means they don't offload any processing onto the Permet networks of the user, Gund technology makes the connection go both way.
The upside is that controlling technology the way you "control" your body has immense benefits for stuff like reaction time, situational awareness and fine motor control -- the downside is that insides of humans are not nice and ordered like an integrated circuit, and so Permet trying to force itself into a structure like that clearly has some deleterious health effects. If I had to guess, it fucks with the subtle electric signals inside the brainmeats somehow, but why it causes high fever, I don't know. It also looks like constant exposure to things that activate the Permet inside a body is cumulative, like radiation poisoning.
"Data storms" are just what the larger expressions of a Permet networks are called. If I had to guess, I think the name comes from how these large networks inherit noise resulting from Permet reactions in the absence of a control system, becoming more chaotic the further their influence extends. In limited amounts, like the small-scale storms inside Gundam systems, a human consciousness can still exert control over them, organise them, but as the scale goes up, the amount of agitation the Permet inside a person is under exceeds some physical limit. The influence goes both ways, though, human biometric activity can become imprinted into a Permet network, like how Eri did with Lfrith.
Quiet Zero is basically an amplifier capable of forcibly organising ambient Permet. This includes Permet that is bound in extant systems, which is why it gives remote control over Permet-powered technology that gets within the zone of influence the large antenna structure provides for them. But, critically, I think both Eri and Suletta are amplifiers on their own, also, as a result of their physiology containing far more Permet than the average person.
Like, all Permet is connected to itself, somehow -- but most of it is too chaotic, and the trace from one end of the network to another is too long for any particular piece of information retained in the network through imprinting is too difficult usually. What Suletta and Eri did to convince Elnora was basically to use their extended reach to pull on the imprints stored in the various Gundams, stored with Eri, and stored within Quiet Zero's systems while they still had access to the large data storm.
But why that overloaded the circuit, causing it to break down... I'm not really sure. I think they may have just hit the upper limit of what is possible within the confines of the laws of physics of this universe. They extended the theory of what Elnora was trying to accomplish to, for a moment, remanifest everyone's imprints, instead of just Eri's. I also don't know why the entire structure and all materials containing Permet also disintegrated, although that could just be some kind of a cascade effect from whatever molecular or quantum links keep Permet connected with itself dissolving from being overloaded.
21 notes
·
View notes
Mer-Mer-Mercury![1]
There rode a certain witch, from Mercury it's said
She was big and strong, and her hair a flaming red
Some haters came at her, with anger and with screed
But most Gundam fans, saw in her a charming lead
She's oft the most memeable of creatures
Bringing laughter and joy to most
But her strength and kindness are the features
More would do well to host
Mer-Mer-Mercury!
Partner of Miorine!
Succeeded beyond expectations!
Mer-Mer-Mercury!
Ace pilot and Coven's Key!
That's not up for interpretations!
"Tomato's gotta go", declared her enemies
But her fanbase begged, "A few episodes more please!"
A dork (affectionate), she'd garnered much goodwill
Though she had her flaws, Suletta was well-liked still
Then one day a poll of M.C. scoring
Challenged her, it's not to blame
"Come, prove yourself", the thread was imploring
And the witch was game
Mer-Mer-Mercury!
Partner of Miorine!
They beset her with all the downvotes![2]
Mer-Mer-Mercury!
Ace pilot and Coven's Key!
She was unfazed, more scared of the goat!
Mer-Mer-Mercury!
Partner of Miorine!
They exclaimed she'd earn no higher place!
Mer-Mer-Mercury!
Ace pilot and Coven's Key!
And so they shot her off into space![3]
Oh, those Redditors[4]
***
Sung to the tune of "Rasputin" by Boney M.
I'd originally used the word 'upvotes', due to the rules of the poll dictating that you upvoted the person you wanted out, but I figured this version would better preserve the sentiment should it be voided of context.
No lesbian space tanukis were harmed in the voting of the poll; Suletta was recovered safely from the vacuum of space and has forsworn revenge. Now, her sister whose a literal ghost in the machine that can hijack WMDs, on the other hand...
Context: There's been a protagonist elimination poll on the Gundam subreddit for the past couple weeks. Suletta was doing very well, but her winning streak finally ended and she was voted out at 4th place. I didn't think the poll was supposed to be particularly serious, since the first elimination, Judau Ashta from Mobile Gundam ZZ, was due to a meme[5], so to pay tribute to Suletta's valiant struggle, I wrote a parody song. Unfortunately, some folks took the poll and their beef with fictional teenagers Very Seriously[6], so it got a mixed reception. Still, a few folks enjoyed it, and I think I did a good job, so I decided to preserve it and share it with folks here as well.
The opening song for Mobile Suit Gundam ZZ is "Anime Ja Nai ~Yume o Wasureta Furui Chikyūjin yo~", which apparently translates to "It's Not Anime (You Antiquated Earthlings Who Have Forgotten Dreams), so it's a fairly common meme in Gundam fandom that ZZ 'is not anime'.
Considering the show ended 9 months ago at this point, which as far as the modern entertainment cycle goes might as well be 9 years, the longer The Witch from Mercury continues to live in haters' heads rent-free, the more I'm impressed. Here's to hoping folks are still living mad about it 9 actual years from now.
4 notes
·
View notes