#give me money?

[biherbalwitch]

Thank you to the people who recommended I check out Ateez. Just saw their latest single.

Very cunty and gonna be stuck in my head while I go to work. I approve.

[teafortarry]

Ayem dead inside

[podcastwizard]

actually i didn't move to la to pursue a career in entertainment, i moved to la to increase my chances of getting hit by a car driven by a celebrity where i don't get injured to the point of hospitalization but the celebrity cuts me a big check in exchange for my silence. i've got my sights set on timothée chalamet but i'm flexible

[redysetdare]

You can help an aroace this Valentine's day for the low low price of 1 billion dollars sent to me.

[inkskinned]

the thing about art is that it was always supposed to be about us, about the human-ness of us, the impossible and beautiful reality that we (for centuries) have stood still, transfixed by music. that we can close our eyes and cry about the same book passage; the events of which aren't real and never happened. theatre in shakespeare's time was as real as it is now; we all laugh at the same cue (pursued by bear), separated hundreds of years apart.

three years ago my housemates were jamming outdoors, just messing around with their instruments, mostly just making noise. our neighbors - shy, cautious, a little sheepish - sat down and started playing. i don't really know how it happened; i was somehow in charge of dancing, barefoot and laughing - but i looked up, and our yard was full of people. kids stacked on the shoulders of parents. old couples holding hands. someone had brought sidewalk chalk; our front walk became a riot of color. someone ran in with a flute and played the most astounding solo i've ever heard in my life, upright and wiggling, skipping as she did so. she only paused because the violin player was kicking his heels up and she was laughing too hard to continue.

two weeks ago my friend and i met in the basement of her apartment complex so she could work out a piece of choreography. we have a language barrier - i'm not as good at ASL as i'd like to be (i'm still learning!) so we communicate mostly through the notes app and this strange secret language of dancers - we have the same movement vocabulary. the two of us cracking jokes at each other, giggling. there were kids in the basement too, who had been playing soccer until we took up the far corner of the room. one by one they made their slow way over like feral cats - they laid down, belly-flat against the floor, just watching. my friend and i were not in tutus - we were in slouchy shirts and leggings and socks. nothing fancy. but when i asked the kids would you like to dance too? they were immediately on their feet and spinning. i love when people dance with abandon, the wild and leggy fervor of childhood. i think it is gorgeous.

their adults showed up eventually, and a few of them said hey, let's not bother the nice ladies. but they weren't bothering us, they were just having fun - so. a few of the adults started dancing awkwardly along, and then most of the adults. someone brought down a better sound system. someone opened a watermelon and started handing out slices. it was 8 PM on a tuesday and nothing about that day was particularly special; we might as well party.

one time i hosted a free "paint along party" and about 20 adults worked quietly while i taught them how to paint nessie. one time i taught community dance classes and so many people showed up we had to move the whole thing outside. we used chairs and coatracks to balance. one time i showed up to a random band playing in a random location, and the whole thing got packed so quickly we had to open every door and window in the place.

i don't think i can tell you how much people want to be making art and engaging with art. they want to, desperately. so many people would be stunning artists, but they are lied to and told from a very young age that art only matters if it is planned, purposeful, beautiful. that if you have an idea, you need to be able to express it perfectly. this is not true. you don't get only 1 chance to communicate. you can spend a lifetime trying to display exactly 1 thing you can never quite language. you can just express the "!!??!!!"-ing-ness of being alive; that is something none of us really have a full grasp on creating. and even when we can't make what we want - god, it feels fucking good to try. and even just enjoying other artists - art inherently rewards the act of participating.

i wasn't raised wealthy. whenever i make a post about art, someone inevitably says something along the lines of well some of us aren't that lucky. i am not lucky; i am dedicated. i have a chronic condition, my hands are constantly in pain. i am not neurotypical, nor was i raised safe. i worked 5-7 jobs while some of these memories happened. i chose art because it mattered to me more than anything on this fucking planet - i would work 80 hours a week just so i could afford to write in 3 of them.

and i am still telling you - if you are called to make art, you are called to the part of you that is human. you do not have to be good at it. you do not have to have enormous amounts of privilege. you can just... give yourself permission. you can just say i'm going to make something now and then - go out and make it. raquel it won't be good though that is okay, i don't make good things every time either. besides. who decides what good even is?

you weren't called to make something because you wanted it to be good, you were called to make something because it is a basic instinct. you were taught to judge its worth and over-value perfection. you are doing something impossible. a god's ability: from nothing springs creation.

a few months ago i found a piece of sidewalk chalk and started drawing. within an hour i had somehow collected a small classroom of young children. their adults often brought their own chalk. i looked up and about fifteen families had joined me from around the block. we drew scrangly unicorns and messed up flowers and one girl asked me to draw charizard. i am not good at drawing. i basically drew an orb with wings. you would have thought i drew her the mona lisa. she dragged her mother over and pointed and said look! look what she drew for me and, in the moment, i admit i flinched (sorry, i don't -). but the mother just grinned at me. he's beautiful. and then she sat down and started drawing.

someone took a picture of it. it was in the local newspaper. the summary underneath said joyful and spontaneous artwork from local artists springs up in public gallery. in the picture, a little girl covered in chalk dust has her head thrown back, delighted. laughing.

[osiris-iii-bc]

How Terzo is universally considered the Ministry’s money waster/fashion victim when he only had two shitty outfits and a borrowed pair of sunglasses, while Copia rocks a different outfit for each song, tailored sparkly blazers in every color, gems covered vestments, a Goyard bag, and a McQueen outfit for his promotion (but still not a decent room) like how

[saphira-artandoc]

A champion's purpose

[emositecc]

And that's why mails from Hell are banned.

[PLEASE DO NOT DUB THIS COMIC!!]

[just-null]

i love the more well known characters and all but im pushin them all aside to focus on those in the back. i love background characters so fucking much. ino..... ino come back..

[puddicure]

I have a desk job that’s basically fancy customer service, with a manager who can be a real asshole.

So I was feeling a little cheesed off at work the other day, but then I saw a Twin Peaks post on Twitter that broke through my irritation and made me smile. And I thought to myself, ‘man, if Dale Cooper was here, he would sympathize with me and tell me I’m doing a great job.’

On a related note, did you know that in the U.S. you can use the Walgreens app to print any photo from your camera roll into a full size glossy photograph for less than $3?

[lazylittledragon]

does anyone else experience the adhd-created nightmare of having to choose between having a healthy daily routine and getting anything done at all

[paaelle]

New Trolls Fun Fair clip, that I could only check out now.

THEY MAKE ME INSANE, I'm not even kidding!

Of couse the animation is kinda off, I'm gonna be honest its giving Remix Rescue. But considering the budget probably consists of a pastel and sugarcane juice I'm not judging.

THEY LOOK SO CUTE, I LOVE WHEN THEY GIVE NEW CLOTHES TO CHARACTERS (I'm a sucker for wardrobe expansion).

[catgirlhell]

[poorly-drawn-mdzs]

Danse Macabre

[Commission]

[hajihiko]

hey Hajime, Valentine's must be REALLY busy for you huh?

Don't forget the most important Valentine, yourself 💛

(Somewhat ko-fi doodle for Vi but I was gonna make a Valentine's post anyway)

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)