#gonna post it here too cause why the hell not

[weirdraccoon]

Tom's First Murder

Tom stood as still as a statue and as pale as a ghost. Delphini was hissing apologies and excuses behind him while the Ravenclaw girl laid lifeless at his feet.

In the back of his mind, he was aware that he wasn’t breathing. However, he felt about to crash down, to drop into the worst panic attack of panic attacks. He didn’t dare blink, in case the body was still there when he opened his eyes. He didn’t dare move, in case it brought someone’s attention to this.

How did it look?

Tom Sallow, from the Gaunt bloodline, standing over a lifeless girl in the girls’ bathroom with a huge basilisk at his back.

And it was not any girl either.

It was that Ravenclaw, Myrtle Warren, the one with a crush on Harry, his Harry.

There was a motive.

There was a tool - a beast in this case.

There was the fact that he was still standing at the crime scene and he couldn’t get to fucking move-

“¡Tom!”

Professor Sallow took him by his shoulders and shook him. But it wasn’t Professor Sallow at that moment. It was Uncle Ominis. Worried pale eyes looking in his direction, close to meeting his own eyes, wand pulsing irregularly, taking in the scene he walked into. 

Tom couldn’t help but notice that Ominis seemed to be ignoring the two big elephants in the room, keeping his main focus on the boy that caused everything.

“I didn’t-” he began to say, hating how his voice stuttered, how he sounded his age for once.

“Hush, hush, I’m just glad you’re fine,” Ominis replied, wrapping his arms around the boy in a warm hug.

“But-

“Hush,” Ominis repeated, then turned his head to the hissing noises of the basilisk. “ Go back to the Chamber,” he ordered, and Tom was again wrapped in the feeling of home at listening to his dad’s parseltongue, the one thing he and only he shared with Tom. “Tom,” he called, getting the boy’s attention back. “I’m going to take you to your dormitory, and I need you to promise that you won’t leave it until tomorrow morning for breakfast.”

Tom stared at Ominis with a couple of tears gathering in his eyes.

“What about-”

“I’ll handle it,” Ominis said. “Your mom and dad might come to visit,” he added. “I just want you to stay in your dormitory, and convince your classmates that you were there the whole night. Forget this happened, for now.”

“I didn’t mean for this to happen,” Tom whispered.

Ominis sighed. There he was, his fifteen-year-old, following two of his parents' footsteps and staining his hands with blood at a young age. None of them were clean, though, how was he supposed to punish him when they -the three of them- were no better.

“We’ll talk about this later,” he promised. “Try to act like your usual self. No one can suspect you, ok?”

Tom nodded, forcing himself to keep the tears at bay.

“Good,” Ominis smiled, ushering him out of the bathroom and through the hallway towards the Slytherin wall. “We’ll be waiting tomorrow in my office after breakfast.”

Tom nodded once more and entered the common room, making a beeline to his dormitory where he eyed his dormmates with his usual cold calculated gaze.

“What were we doing?”

Being a Gaunt descendant had its perks, even if some hated that the name was lost to Sallow. But no matter. Gaunt, Sallow or Sayre, Tom and his family were respected and feared on the same level.

Ominis, meanwhile, was levitating a girl’s body down to the Chamber. He didn’t want Ishbel or Sebastian in there, mainly because Delphini could very well kill them as she did with Warren, but he couldn’t take it up to the Charm’s classroom or his office or his quarters.

Someone could see. Tom had… special problems with the Transfiguration Professor and Ominis wouldn’t let him blame Tom for this. Even if this time Tom was to blame.

“Go hide, ” he ordered the basilisk. “I’ll tell you when you can come back outside,” Delphini hissed sadly about disappointing his young Master when she left. Ominis deposited the body in a corner, running his hand through his hair. “Honestly, why couldn’t he adopt a stray cat?”

Then he went to his office and send an owl to his spouses. Not ten minutes later, they were crossing the floo flame, looking worried.

“Where’s Tom?” Ishbel asked, looking around the office.

“I sent him to his dorm. Thought he should have an alibi.”

“An alibi?” Sebastian repeated, raising his eyebrows. “What did he do? Kill someone?”

Ominis hadn’t written details for obvious reasons. He just told them they needed to come as soon as possible. His silence, however, was answer enough.

“I’m surprised it wasn’t you,” Ishbel joked weakly, turning to Sebastian.

“Hey!” Sebastian scoffed. “I’ll have you know that the kid and I have been getting along really well lately.”

“Yeah, since you began teaching him dangerous spells,” Ishbel smirked. “I guess if it worked with us it’d work with him,” she signaled to Ominis and herself. “You get to bond with him!”

Ominis shook his head. He had expected it, them not taking this seriously enough, but he had hoped. He cleared his throat.

“I followed his pet’s frantic hissing to the girl’s bathroom,” he explained. “He was in shock and clearly traumatized. I can only guess, but it seemed like Delphini came out before he could clear the room and this Ravenclaw girl saw her.”

“Ouch,” Ishbel grimaced. “The first murder is always the hardest. Especially if it was an accident. Can’t we see him?”

Ominis shook his head.

“Maybe tomorrow,” he said. “I told him to come here after breakfast. I called you to help me with the body. We can’t leave it in the Chamber, after all, someone could track it.”

“Wait, hold on,” Sebastian raised a hand. “The Chamber. The Chamber of Secrets? Is it real!? And you didn’t tell us?”

Ominis could only imagine the kicked-puppy look Sebastian was sporting at that moment. He could also picture Ishbel mirroring him. They did spend their last year at Hogwarts looking for clues to that particular secret. After the Scriptorium, anything was possible.

“I told you it was in the bathroom!”

“No, you said there was a snake in a sink,” Sebastian turned to Ishbel.

“And you said it was impossible for it to be in the bathroom!” Ishbel crossed her arms. “Only because it was the girls’ bathroom, I bet.”

“Ominis and I couldn’t just walk in!”

“Of course, you could,” Ishbel said. “I was always sneaking into your dorm and the lockers!”

“It’s different.”

“Is not.”

“Guys!” Ominis exclaimed, sending red sparks from his wand as he did in classes and he had to get his students’ attention. “Tom, please.”

“Oh, yeah,” Sebastian rubbed the back of his head. “Sorry.”

“Well, let’s go,” Ishbel said, hopping to the door. “I knew he didn’t just find a stray basilisk. This makes much more sense.”

With the help of Ishbel’s Ancient Magic and Sebastian’s Unspeakable secret knowledge, they were able to completely erase the body from existence. Ominis, for good measure, swept the bathroom with a charm and cleaned any hint of Tom’s magic and presence from the room. 

Ishbel went to Ravenclaw tower and the girl’s dorm (it only took her two tries to solve the riddle) and raid the girl’s belongings in silence, making sure to not wake up the other two girls. She took everything that looked important to be able to claim that she left on her own.

From what she read in her diary, it wouldn’t be hard to believe. This Warren girl was as bullied as Puffskein Dunkein, and as likable as Cressida Blume. She also wrote a few days ago about how she wished “she could be anywhere else”.

Ishbel left the diary under the pillow with a giddy smile, then she pocketed the rest of the belongings and scurried back to Ominis’ office. Her two husbands were sprawled over the couch, listing with his fingers to make sure they didn’t forget anything.

They fell asleep, recounting how they felt about their first murder, and planning what they were going to tell Tom in the morning.

To Ominis and Ishbel’s surprise, it was Sebastian who talked to him first. In retrospect, it made sense, because Sebastian was the one who suffered the most that one time. Tom cried a little and apologized, and vowed to be more careful.

Ishbel crushed him in a hug.

“Don’t worry about it Tomtom,” she shushed.

Once Tom left for his classes, Sebastian and Ishbel turned to Ominis with matching grins.

“Don’t say it.”

“Our precious dark lord,” Ishbel gushed.

“His very first murder,” Sebastian continued.

“I've got to write to Imelda,” Ishbel said. “She’s gonna win so many bets with the others.”

“I should go to work,” Sebastian mussed. “Let me know when we’re looting the Chamber.”

Ominis facepalmed.

“Sure, I have a NEWT class anyway,” he waved them off.

[scarletiswailing347]

just finished reading delilah's statement, there was a lot of things in it that was either only tangentially related to the allegations or straight up unnecessary to put (in particular: putting in media references and cc metrics several times as flavor text, detailing the don turnt situation with no claims of whether or not permission was granted by the affected party, namedropping certain ccs who had nothing to do with the allegations, and putting the tweet and yearbook photo of one of the ppl who put forward that zam was a bully with no claims of whether or not permission was granted) which contributed a lot to the 47-page length

honestly so far what im getting is that there was a Lot of toxicity on multiple sides like not even just between zam and delilah

[vngelicc]

e s p r e s s o

⋆ TAGS — boxer!jk, he’s a fanboy, pouty jkkkkkk, oc’s a idol, sugar daddy elements, fluffy, rom-com vibess, jk’s secretly a little sub who loves praise, praise kinks, making love, jealous!jk, possessive!jk, rough sex, pussy-eating, unprotected sex, creampies, very light dirty talk, oc’s a tease, jk just loves oc, some violence (nothing serious jk punches a guy), oc’s a pillow princess, mainly dom!jk, subby!oc who is a menace, jk is super protective and a good bf, he beats someone up for you, tit play

⋆ WORD COUNT — 14.6 k

Jeon Jungkook was many things—charismatic, “lover boy”, charming—but the biggest one of all: a pain in the ass (for Yoongi). Jungkook was the type of guy to do whatever he wanted WHEN he wanted.

The kid had a strong backbone, Yoongi will give him that but it was an absolute nightmare dealing with the press for someone like Jungkook. Yoongi can count on his fingers how many times Jungkook’s gotten into heat for his loud ass mouth. Sometimes not all publicity was necessary whether it was good or bad in Yoongi’s opinion (not that anyone’s ever asked).

“Where is he? That little shit–” Yoongi growls behind gritted teeth as he storms through the gym towards the private training room Jungkook usually practiced in.

He slams the door open and locks eyes with his target, “There you are–!”

Jungkook stops in his tracks and turns around in surprise, “Hyung?” He’s confused as fuck because he’s been behaving himself lately, sooo what did he do now? “Yoongi hyung—ow! What the hell was that for?”

“How many times did I tell your ass to keep your little flings under the radar? I told you: if you’re gonna be fooling around with people do it on the down low but no, you just gotta fucking let the world know huh?” Yoongi seethes, literally trembling with rage from where Jungkook stands.

Jungkook makes a confused noise, “But I didn’t–”

“Then, what. The. Fuck. Is this?” Yoongi slaps his phone in Jungkook’s face, on it there’s some tweet with an article linked to it.

Jungkook squints his eyes mumbling under his breath as he reads the tweet out loud, “..Idol l/n y/n caught in a dating scandal with infamous boxer Jeon Jungkook–what’s the big deal though, everyone usually ignores these types of things.”

Yoongi looks like he wants to scream, “Kid you realize you’re a celebrity right?” Nod. “Okay, and she’s a celebrity too right?” Nod. “So why in the FUCK wouldn’t this be a big deal? I mean, it’s not like we’re not talking about the nation’s ‘sweetheart’ here, the country’s fucking pride and joy.” He really needs a fucking smoke right now.

“Hyung it’s just a fucking rumor she probably doesn’t even care or know about it, I don’t see why you’re stressing out. Not like I know her either,” Jungkook carelessly says as he throws a few punches at the bag, “you’re gonna end up bald with how you’re stressing right now.”

Yoongi takes a deep breath, in, out, in, out. “Because, idiot,” emphasis on the idiot, “this shit is getting out of control, you have any idea how many fucking news outlets are talking about this? For fucks sake the entire country is in shambles cause their ‘precious’ y/n is supposedly dating some lowlife boxer, no biggie really it’s not like I haven’t been getting threats either over this little stunt of yours.” He glares.

Jungkook lets out an exasperated sigh as he stops in his tracks, “Hyung I didn’t do anything, so fucking what if I posted a pic with my photocard, it’s MY photocard! Don’t her fans do that shit too, so why is it a problem that I do it too?”

“Because people think you’re dating now! They think you’re soft launching her or something!” Yoongi tugs at his hair, “You realize if people find out you fucked with her just to get in her bed they’re gonna lose it and not just on her but you mainly. You want a fucking witch hunt out for you? Because you know damn well they love her more than you.”

“Ouch.” Jungkook grumbles petulantly.

“No, ouch, use your fucking brain think about the damage you’ll take all because you wanted to fuck their little princess.” Yoongi glares.

Jungkook’s almost offended that Yoongi would think of him like that. Sure he had his fair share of groupies and models but Jungkook wasn’t a complete asshole about it! He had feelings too, he’s not sorry that he was fucking casually like any other normal person who was looking to unwind. It also isn’t his fault that they labeled him a playboy.

In the eyes of the public Jungkook was a menace as there were rumors of him knocking models up and cheating on the girls he’s ever gotten spotted with. Everyday he woke up and there was something new that came out whether it was him “dating” or his flings coming out to talk about their one night stands.

Needless to say he didn’t have the best public image.

“Okay let me stop you there, I’m not after her for sex or anything. If you really want to know, I'm actually interested in her. I wanna get to know her some more and take things further y’know?” He huffs and wipes the sweat off his brow with his shirt.

Yoongi scoffs, “Yeah right, I’ll believe it when I see it.” As he finishes his sentence the door opens and Namjoon pops in with Seokjin, the two team members hauling in some duffle bags in tow.

“What’s going on? The hell Yoongi look so red for?” Namjoon huffs as he drops the bag gracelessly, “Jungkook what did you do now?” He clicks his tongue in disappointment, tutting him like a misbehaved child.

Jungkook’s mouth drops open, this traitor! He’s supposed to be on his side, not Yoongi’s. Seokjin interrupts with a loud cackle, “What didn’t he do?” Another traitor! Jungkook can’t believe this, his own hyungs against him.

“Long story short Romeo over here is in a dating scandal—not with just anybody though, fucking l/n y/n. Y’know, the poster child.” Yoongi spits harshly, shooting Jungkook another pissy look while he’s at it.

Namjoon’s mouth drops open in shock, Seokjin actually looks pretty terrified too which is funny because if only he could see the face he’s making right now.

“No way you’re insane for that, shit good luck with the press because they don’t play about their little popstar.” Namjoon manages to utter once the shock passes.

Jungkook glares, “I didn’t do anything! They’re mad I’m showing off my photocard, I bet you that they’re jealous because they don’t have this one.” He huffs and thrusts his phone out to show them his phone case.

“What exactly did you do?” Seokjin laughs.

“Nothing! I posted a mirror pic and I didn’t expect a bunch of crazies to over analyze shit and spot the photocard. Not like it’s MY fault people make up narratives and shit.” Jungkook rolls his eyes and tucks his phone away safely in his pocket, “But you know what, just wait and see.”

“Wait and see what?” Namjoon snorts in amusement.

“Hyung doesn’t believe me but I’m serious about her, I’m gonna ask her out and from there maybe talk and get to know each other. One thing for sure she’s gonna be my girl unless she slaps me in the face and tells me to leave her alone or somethin,” Jungkook grins as he elbows his still pissed off manager.

Seokjin looks at him with a shit-eating grin, “Sure let me know how that ends up going for you.”

Jungkook purses his lips, “You’ll see..”

𓂃 ﾟ｡ ⋆ ⟡

They end up in Miami for a boxing match Jungkook has pending but his opponent ended up coming down with something so it got canceled. Now Jungkook has no clue what to do for an entire week and it doesn’t help that he’s jet lagged, hungry, and tired. Not a good combination.

“Did they say when the match will be back on?” Jungkook mumbles boredly from his spot on the lounge chair in his hotel. He’s slumped over scrolling down his phone looking at random shit on his feed.

“Hard to tell Kook, apparently the guy’s really sick and can barely get outta bed or somethin’. They said it was better to wait it out for a week and see what happens with him.” Yoongi sighs deeply, “Fuck, just our luck too.”

Jungkook nods in agreement, “What do we do now hyung? Do we go back or..?”

Yoongi takes a seat on the opposite side of him with a shrug, “Dunno, do whatever you want since the match is canceled. Me and Joon gotta stay back to talk with the event organizers and shit.”

He goes quiet for a few moments before sitting up, “Oh wait there’s an award show going on right now, they sent me an invite for you but I don’t know if you wanna go or not.”

“Award show?” Jungkook makes a face but what other shit does he have to do? It’s not like he’s got a match anymore anyways, maybe the after party will be cool or something. “I guess, why do they want me there?”

“Appearances for the press—you know, the usual.” Yoongi hums.

Jungkook’s lips are pursed as he looks around deep in thought. DOES he wanna go? It’s not like this would be the first time they’ve asked him to make an appearance but Jungkook doesn’t really like these types of things. Red carpets and interviews are so tedious and time consuming.

Wait—

“Hyung!” He suddenly gasps, “Holy shit—pass me my suit.” He says as he bolts away into the bathroom.

Yoongi looks at him in confusion, “What..kid what the hell are you on?” He snorts, “Don’t tell me you’re excited to go to this thing.” Nonetheless he still takes out Jungkook’s suit for him and lays it on the bed.

“No you don’t understand,” Jungkook cuts off as he splashes his face with water, “y/n is probably gonna be there!”

“y/n—Jungkook really?” Yoongi groans, “I thought you were playing around last time, I didn’t think you were actually serious about it.”

Jungkook holds back his whine, “Hyung you always think I’m playing around, why isn’t anyone taking me seriously about her! I swear I have good intentions.”

“I dunno, maybe cause you have a habit of sleeping with anything that walks and looks pretty to you. Or maybe the fact that you’ve done this before. Should I remind you of that one model from Cancun?” Jungkook pouts, “Or the bartender chick from LA?” His pout deepens, “Or the girl from Paris?”

“Okay I get it!” Jungkook grumbles, “But this time I’m serious hyung, more than I ever been about someone—especially her.” He says with a sigh while changing out of his clothes and into the suit Yoongi laid out for him.

Yoongi sighs deeply, “Look all I’m saying is to be careful how you go about this, it’s a lot at stake right now not just because of you being involved with her but the fact that the public has their opinions about you already as it is.”

Jungkook appreciates the sentiment but he doesn’t need anyone to approve or disagree about his feelings. The public didn’t deserve any explanations over what Jungkook chooses to do with his life, he’s here to fight and that’s it. Not to be anyone’s marionette or dress-up doll.

“I know hyung, thanks.” He smiles back and slips his blazer on, “I’ll text you later on and tell you what happens.” Yoongi doesn’t reply verbally rather with a low grunt, “See ya.” Jungkook says with a final grin and heads out of the room down to the main lobby and into a car Yoongi had waiting for him.

On the way to the venue he checks out the award show on Instagram, he sees a lot of people he recognizes and a few new faces. His eyes scan over the page eagerly in hopes of seeing you on there. Are you performing tonight? Were you already there on the red carpet? Oh he bets you look absolutely divine tonight (you always do).

“Yes!” He says a bit too loudly startling his driver in the process as he sheepishly apologizes.

Jungnkook finally comes across a post about you and he reads over the caption with an excited hum, biting his lip when he sees that you are performing after all. He’s getting a mean adrenaline rush right now like the ones he usually gets before his matches. Just thinking about how he’s gonna get to meet you tonight is getting him all worked up. He wonders if you’ll even give him the time of day.

Only one way to find out.

.

“Jeon over here!”

“Jeon, look here!”

“Jeon, is it true you and y/n are dating?” Jungkook makes a point to ignore this and act like he didn’t hear it even though he’s screaming on the inside.

The red carpet’s full of singers and models, the fans are screaming and reporters keep getting in his damn way as he tries to make his way through the crowd. Of course he stops for a picture or two with a fan, poses for the paparazzi too but he’s not concerned with them right now. He knows he must look a little lost with the way he keeps looking around like he’s trying to find something (yeah, you).

Jungkook almost frowns like a child who didn’t get their way once he sees you’re not anywhere in sight. You probably already headed inside which sucks cause he really wanted to see you beforehand since it was probably arranged seating in there. At this rate he won’t be able to even say hi–

“Oh shit, my bad.” Jungkook says when he bumps into someone behind him. He turns around to apologize properly when his heart fucking stops. Ohmygod, ohmygod, ohmygod—it’s you.

You look up at him with those dreamy eyes of yours, face scrunched up cutely (your lips pouty) in confusion as you tilt your head up (UP!) to look at him, “Um, you’re stepping on my dress.” Even your voice is so prettyyy.

“Sorry my fault,” Jungkook steps back and kneels down to fix the rumpled state he left it in, vaguely aware of the fast flashing (the paparazzi must be eating this up), “lemme make it up to you though.” He says once he comes back up.

You tilt your head, “And how would you do that?”

“I’ll buy you a new dress.” Jungkook’s dead serious too, if you asked him to buy you a whole house he’d do it in a heartbeat. Take everything at this point—have it.

“And who said I want you to buy me things?” You muse softly.

Jungkook chuckles softly and leans down to talk in your ear because the crowd’s getting louder and it’s hard to talk to you, “Don’t be like that, if you let me take you out I’ll show you all the things I can buy you.” He murmurs low, voice husky.

You tilt your head to look at him, eyes dropping down to his lips and then back up as a coy smile plays at your soft lips, “You’re funny.” You pat his cheek with a soft manicured hand and walk away.

His heart nearly skips a damn beat when you do that. Oh he swears he can still feel your soft hand sliding over his cheek when you walked away from him like the little tease you were. He doesn’t know how long he stands there until he gets moving, a stupid grin on his face the entire time as he replays the moment over and over again in his head.

Jungkook’s not gonna lie, this little cat and mouse game that just started has him eager for more. He’s so getting your number by the end of the night, call him delusional but he swears you’re digging him too with the way you checked him out just now.

He spends the entire night throwing a few sneaky glances your way, hell when you got on stage to perform he nearly folded then and there. Everything about it—sultry gaze, soft husky voice, and sensual body rolls—was perfect. Jungkook don’t even care that people are watching him ogle you in 4K, he doesn't bother to hide the fact that he likes what he’s seeing right now.

To make things worse you pass by his seat and shoot him a dazzling little smile, waving your fingers coyly at him which makes the people go wild. Oh he’s in love. Jungkook makes a point in looking for you afterwards at the afterparty. You’re changed out of your outfit from earlier, now in a pretty babydoll and your little Prada loafers.

When he makes eye contact you shoot him a smile, “Thought I’d wear something you can’t step on again.”

Jungkook snorted softly, “I already told you, I dunno why you’re being stubborn, quit playing and let me take you out already.” He says smoothly and wraps his arm around your waist, surprised that you don’t push him off or anything.

You look him up and down with a soft hum, “Mmmm I’m kinda in the mood for some paella.”

“Then let’s go.” Jungkook’s ready, he will literally drop everything to get you some paella.

“Not from here though, I hear it’s way better in Spain.” You wrap your arms around his neck, tugging him down so he’s eye level with you, “So unless you’re willing to take me to Spain, I’m not going anywhere.”

Jungkook licks his lips, “Fuck it, let’s go.” He starts leading you away, peeping the way you look surprised, “What?” He laughs.

“You’re serious, right now?” Once you recover from the initial shock you smile at him with a quiet giggle, “You’re crazy.”

Oh he just adores that cute eye-smile of yours, “Let’s get you some paella yeah?”

It’s a nine hour flight you both impulsively leave on with no bags, didn’t even tell your managers, and only your phones and wallets. No one questions when Jeon Jungkook walks through first class hand in hand with you trailing close by, you’re even wearing his blazer over your shoulders because you complained about how chilly it was.

Jungkook’s smiling like an idiot the entire time he’s sitting with you in the first class cabin. You don’t seem to mind how touchy he is so he keeps an arm over your shoulder so you’re pressed close to his side. He nearly screams when you lay your head on his shoulder and doze off into a peaceful slumber.

You left Miami around one in the morning and got to Madrid at nine with Jungkook booking you two a room at the infamous Four Seasons hotel. You knock out with him for a few more hours until you’re complaining about your paella.

“Hurry up, I'm starving and you promised me my paella.” You grumble and poke at his face.

“Yeah, yeah I’m awake.” Jungkook murmurs calmly as he rolls out of the bed to make himself presentable.

Jungkook feels like he’s in a dream right now, god this better not be because the sight of you looking so happy in front of him while eating your beloved paella is one for the books. Your little brunch date turns into a shopping date because you complain you don’t wanna be wearing clothes from yesterday since the two of you decided to stay in Spain for the weekend.

He has a goofy smile on his face as he swipes, taps, and inserts his black card at different stores you drag him to. He lets you spend his money how you want to, relishing in the way the BVLGARI store worker’s eyes nearly bulge out of their head when Jungkook pays for a forty-eight thousand wrist watch, all for you.

“Doesn’t it look pretty?” You grin softly while holding your wrist out to him.

Jungkook gently takes your hand in his and admires the watch, “Perfect, really suits you.” He grins softly as he thanks the employees and heads out with you to another store to see what you find.

By the time Sunday comes Jungkook’s spent well over one-hundred grand on you but does he care? No, not really because he did say he’d show you all the things he’d buy you. Jungkook doesn’t wanna go back to Miami but Yoongi’s bitching at him to go back because apparently his opponent got better and the match was back on and set for Tuesday the earliest.

“Let me make you mine already.” He finds himself mumbling low in your ear as he tugs you into a loose hug, not caring that you two were standing in the middle of the airport about to board different flights back (of course he pays for your first class ticket home).

You look up at him with coy eyes and a soft little smile on your glossy lips, god he just wants to kiss the fuck out of you but he doesn’t because you haven’t give him the okay for anything past non-sexual intimacy which he’s fine with because he does wanna take time to get to know you.

His breath hitches when your finger comes up to trace over his lips gently, “Cute.” You don’t say anything else and walk away after the intercom announces your flight. You leave him standing there in the middle of the airport, dreamier than ever but sadly it’s cut short by his phone ringing.

“Where the hell are you?” Yoongi growls.

“Calm down hyung, I’m boarding in a few minutes.” Jungkook sighs as he rolls his eyes, “I got so much shit to tell you.” He smirks to himself and begins walking.

𓂃 ﾟ｡ ⋆ ⟡

Sometime into the next week when Jungkook lands back in Korea he asks for your number through Instagram. He’s kinda surprised you gave it to him instead of dodging him like before, nonetheless he’s happy and giddy about it. He quite literally looks like a schoolgirl kicking her feet in bed texting her crush, that’s how he feels like right now.

You’re a quick texter which he likes and you don’t seem to mind him spamming so that’s even better. Jungkook spends his week giggling over dumb shit (it’s not) you say which has Seokjin making fun of him for it, which speaking of them they still couldn’t believe Jungkook pulled you.

“No way let me see.” Seokjin had demanded, “You’re lying, she would never, she looks like she has standards.” Jungkook can’t tell if he’s jealous or something, maybe he’s a secret stan too who knows.

Jungkook long established he was down bad for you ages ago but this just took the cake, a whole new level of simping. It starts when Jungkook decides to post a training video of him boxing/training, he goes viral and trends for a week because in the background he’s playing one of your songs. He’s got a shit ton of people calling him a “girly pop” or “cunty boxer” but most tell him he knows what’s up.

He doesn’t know but by him doing that it opens a new door to your developing relationship because you start asking him to do things for you. It starts with you telling him to change his profile picture with a pic from your latest comeback (he gets made fun of by your fans but he doesn’t care).

Then you make him tweet: “stream y/n for clear skin” while promoting your music video through him (again he’s a laughing stock). The nail in the coffin is when you prettily request him to wear a shirt from your merch collection after one of his boxing matches.

“Oh my god.” Yoongi says with his mouth dropped open in shock as Jungkook steps out of the backroom wearing a baby pink t-shirt with your face all over it, the cameras flash like crazy and reporters yell out a slew of different questions.

Jungkook runs around carefree in his little pink shirt posing for the cameras and grinning like an idiot because he knows you’re probably at home watching this. Yoongi asks him why he does these things and Jungkook just shrugs, he likes the praise you give him for doing everything you ask him to. He knows it’s light-hearted fun and you’d never do anything to humiliate him intentionally, if you’re happy then that’s all that matters.

jk: did u see me tonight?

y/n <3: yess lol can’t believe you actually did itttt

you looked super cute too, you should wear more shirts with my face on them.

jk: mayyybeeee you can come to one of my matches? don’t u think i earned it?

y/n <3: when is it?

Jungkook damn nearly yells out in excitement, he’s literally shaking as he types out a fast response like you’re about to change your mind or something. He sends you the time and day for it, promising front row seats so you’ll have a good view as he kicks this guy’s ass. You have him cheesing when you say this is going to be your first boxing match too, he’s so excited now.

“Calm down kid you’re gonna give me a headache with all that tapping.” Yoongi grunts as he slaps his hand against Jungkook’s knee, “I don’t know why you’re nervous, she already told you she’s here.”

“Because hyung! This is a big deal to me, she’s here at one of my matches and she’s gonna get a front row view of the fight. Now I have to win this, I have to make it worth her time.” Jungkook grumbles with a pout.

Somewhere off to the side he hears Namjoon snort at him, “She’s really got you wrapped around her finger don’t she?” He says while hauling in a cooler with water bottles.

Jungkook doesn’t even refute that statement, he barely bothers to acknowledge him because he’s reading over the texts you’re sending him. “Hyung she said yes to coming to the after party!” He grins cheerfully.

“Good now get your head out of your ass and focus on what I’m about to say. You have less than five minutes before you’re up in that ring and I need your head in the game.” Yoongi says sternly as he plucks Jungkook’s phone out of his hand, “You remember what I said about pacing yourself?”

Jungkook sits there listening as Yoongi goes into trainer mode, he knows his hyung means no harm and just wants him to win this so Jungkook can’t really be mad at him. He must have zoned out because Yoongi brings him back with a sharp smack to his arm, “Are you listening to me?”

“Yeah,” Jungkook smiles as he stands up, “let’s do this.”

“Get out there and make me proud.”

The entire atmosphere outside has Jungkook’s adrenaline kicking in already. He hears the crowd chanting his name, the loud booming music, and the chatter from the on-goers. He mentally psyches himself, lightly bouncing on his feet as he closes his eyes and mumbles a small prayer. Once he hears his name echo loudly and the screams he steps out with his gloves in the air.

This is what he lives for—the crowds, the music, and the atmosphere. He looks around the arena with a grin as they chant his name over and over again, stopping here and there to pose with fans. Jungkook’s not entirely focused on them though, his eyes wander through the front row looking for you and when his gaze finally lands on you he can’t help the big smile he sports.

You look so pretty with your MIUMIU glasses over your head. You’ve got on a plain baby white tee under your black leather jacket, some low rise jeans and your loafers. Right now you’re the center of attention in your section with people taking pics of you from every direction and some asking for an autograph. You even brought your little friend (Jeon Soyeon?) along.

As he passes by Jungkook shoots you a wink to which you wave back with a flirty little smile. He doesn’t miss the way your eyes skim over his bare chest and the desire begins fueling him with more determination to win. Sure he likes winning because who doesn’t? But now he has more reason to win, he has to impress his future girl.

Jungkook gets pulled up on stage with his heart drumming against his ribcage, he’s so ready for this. The ref calls out both of them and soon enough after slipping his mouth guard and gloves on he rises to his feet and stalks forward slowly with a glint in his eye.

“I want a clean fight okay,” the ref says to both as Jungkook nods, “alright, to your corners.” He sends them both away, the announcer saying some shit Jungkook doesn’t really concern himself with.

Jungkook makes eye contact with you one last time, the two of you mutually nodding before the sound of a bell has Jungkook immediately shifting his focus. He’s light on his feet and takes his time watching with diligent eyes as his opponent circles around him, waiting to get the hit on him but Jungkook’s faster.

The guy swings but Jungkook easily dodges, another swing and Jungkook manages to catch him off guard with a sucker punch to the jaw sending the guy reeling backwards. Jungkook feels like he had enough time to warm-up, he doesn’t play around anymore and launches himself towards his opponent with determination.

Punch after punch and round after round ends with Jungkook delivering one final blow, easily sealing this poor guy’s fate as the guy just lets go and falls to the ground. The referee jumps in, counting down from ten as Jungkook watches with anticipation and adrenaline, ready to go again if this guy gets up. He sees Yoongi sitting with clenched fists and a hopeful look in his eye, and then he sees you.

You’re looking at Jungkook with worry, eyebrows furrowed and doe eyes filled with concern. He manages a bloody smile despite the fucking world of pain he’s in right now (he’s not looking forward to the ice bath after this). He swears the world around him blurs until he finally hears the bell and the announcer’s voice echoing through the arena.

“Knockout!”

Jungkook sags in relief as he hears cheers and yells all around. The paparazzi flash him with their cameras as the crowd loses it, Jungkook turns in time to see Yoongi crawling into the ring and bringing him in for a tight hug, “You fuckin’ did it kid,” he laughs in disbelief as he has Jungkook spit his bloody mouthguard out.

“Fuck hyung, water.” Jungkook rasps out as Yoongi yells for Namjoon to come over.

“You good?” Yoongi asks, “Look at me kid, you okay?” He pats his cheek as Jungkook nods tiredly given that the adrenaline rush was now gone, leaving him bruised and exhausted.

Namjoon comes over with water as Jungkook takes sips, spitting it out into a bucket Yoongi holds out for him to rinse his mouth out. The referee comes over to announce Jungkook as the winner as he stands there barely holding on from pain. He makes eye contact with you again, smiling through the exhaustion despite feeling pretty shitty right now. He slowly makes his way over as you simultaneously rise from your chair to meet him halfway.

“So, what do you think?” Jungkook smirks as he crouches down and hops out of the ring.

You pout cutely with a frown, “You’re hurt.” You softly murmur as your delicate hand comes up to cup his face, “I’m happy for you though, you did really amazing.” You smile.

Jungkook feels his heart swell with happiness hearing that, he goes to wrap his arm around your shoulder but stops in pain. He forgot about this part as a low groan slips from his lips, “Shit he got me pretty good.”

“Don’t overexert yourself,” you help him wrap an arm around you, “gotta be careful, you took some pretty hard hits in there.”

Jungkook laughs tiredly as he lays his head on top of yours while you walk together to the back, “Shoulda seen the other guy.” He says low, ignoring the pointed glare you shoot at him, “Yeah, yeah, I’m just messing with you.”

You grumble something under your breath but he doesn’t catch it, he’s riding off on the high from winning and being so close to you. He likes this and wouldn’t mind having you in his life more after this as he’s long made peace with the idea of you being in his future. All he can think about at this moment is you, you, you.

.

“Say you can't sleep, baby, I know that's that me, espresso,”

Jungkook’s laughing and talking with his friends, he’s got you wrapped up in his arms pressed against his chest as he nurses a whiskey in his other hand. You play with one of his necklaces and tune out his conversation which he doesn’t notice until he turns to you and sees how sad you look, “What’s wrong?”

You look up at him and shake your head, “Just thinking.”

“About?” He gently prods, shifting his entire attention to you.

“You didn’t look so good earlier..how do you do it? I mean, I get you trained for this but I dunno, kinda scared me seeing you all beat up.” You softly murmur, “It’s just a thought of mine, I don’t mean to offend you or anything.”

Jungkook softens at that, he thinks it’s adorable you’re worrying about him like that. Almost feels like.. “Let’s dance?” He asks when a favorite song of his comes on, “C’mon, it’ll take your mind off things.” He grins.

You smile at him softly and follow him to the dancefloor, wrapping your arms around his neck as he holds you by the hips with gentle hands. He hums along to the song playing in the background with his dark eyes trained on yours. You look so beautiful under the dark lights and he can’t help but lean in.

“You’re super pretty y’know that?” Jungkook softly hums as he presses his forehead against yours.

You softly laugh, “Tell me something I don’t know.”

“Mmm did I mention I really like your lips?” His lip curls in a smirk, “Love how soft and plump they look, ‘specially when you wear lip gloss..” He slowly trails off as his lips hover over your own, “Can I kiss you?”

The way your eyes light up, crinkling with joy as you eagerly nod. Jungkook presses his lips to yours in a gentle manner, it’s sweet and slow, just like how he likes it. Your arms tighten around his neck and you tug him further down until he's towering over your figure, blocking you from everyone’s view.

Feels like everything’s complete now and Jungkook’s never felt happier than ever.

He slowly pulls off from the kiss as he stares down at you suddenly feeling shy, “Can I, um, maybe drive you home? Just to make sure you get home safe ‘n stuff. You don’t have to if you don’t want to, just thought I’d ask.”

“Yeah, I’d like that.” You gently reply.

A slow smile spreads over his lips and he nods, “Let’s go then.” He guides you out of the party and into his sleek black car that’s parked out in the front.

The car ride’s quiet and peaceful, he has the windows rolled down as the fresh breeze brushes over the two of you. Jungkook wishes the car ride lasted a little longer but it’s late (two in the morning actually) and he knows you’re tired. He makes a mental note to take you out on a drive next time you guys meet up.

“We’re here baby.” He murmurs softly, gently waking you from your sleep.

“Hm?” You sleepily blink and look around, “Damn, I’m more tired than I thought.” You smile tiredly while stretching your arms out.

Jungkook chuckles, “Don’t worry I got you.” He steps out and rounds the car, opening your door for you and helping you out, “Want me to carry you?” He teases.

You shoot him a sleepy pout and shake your head, “I’m good, maybe next time though.” You breathily chuckle.

“There’s a next time?” He teases.

You toss him a knowing look, stopping in front of the building door, “Good night, or morning I dunno I’m tired.” You spin around and lean over to smooch his cheek gently, “I’ll see you tomorrow.” You softly murmur.

Jungkook’s completely entranced by you as he nods slowly, “Night.”

“Morning.” You teasingly correct him as you make your way inside.

Jungkook doesn’t leave until he sees you hop into the elevator, and even then you still wave at him before disappearing inside. Once you’re gone Jungkook lets out a deep sigh as he leans back on his car, what a night.

𓂃 ﾟ｡ ⋆

A few weeks pass and it’s nothing but bliss for Jungkook. Seeing that he has no matches lined up or anything he decides to hang out with you nearly everyday whether it be you and him going out for ice cream dates or Jungkook just taking you out for evening drives out of the city.

He’s on cloud nine right now—he’s got the girl of his dreams, his payout from the last match was pretty big, and everything’s going right for him. Sure you haven’t sat down to actually clarify what you two are but Jungkook knows you feel the same way about him. Maybe it isn’t such a bad thing with the way things are right now, the you’re mine and I’m yours is left unsaid but it’s there.

You’ve both been hard launching each other on your socials for the past few weeks anyways. By now people knew there was something up with you and him, given that Jungkook wasn’t exactly discreet when he posted on his stories with you in them. Jungkook knows you’ve been doing the same thing too so by now the media kinda labeled the relationship.

Will he say anything? Probably not. Does he care? Nope. He didn’t owe anyone an explanation, he just wanted to be able to date you in peace.

Sometime in the week though you send him a message asking him if he wants to come with you as your plus one to some award show taking place in Hong Kong. He says yes of course duh, why the hell would he say otherwise?

He posts a pic with you in the private plane before calling it quits and ignoring his mentions/comments for the rest of the day. Today’s your big day and while you’re not performing he wants to put his entire focus into being there for you.

“How do I look?” He hears you say as he’s getting ready.

You’re dressed to the nines styled in vintage Chanel and Jungkook had a suit tailored to match your aesthetic for the evening. He knows you both are gonna look so good tonight, no doubt you’ll blow anyone away with your unwavering beauty too. “You look amazing.” He says as he stands behind you.

Your eyes flick up in amusement, “That’s all?”

Jungkook lays his chin over your shoulder and grins softly, “Breathtaking, beautiful, ethereal, stunning—” You cut him off with an embarrassed laugh as you swat at his hands.

“Okay, okay, I get it.” You turn around and play with the buttons to his shirt, “You look really good too.”

“That’s all?” He grins back.

“Don’t push it, you make the compliments here.” You smirk and lay a sweet kiss over his lips, to which he happily and eagerly reciprocates.

He might have gotten a little carried away with it because he’s pushing you against the sink counter and kissing you stupid like he’s been doing these days. A soft muffled groan leaves him as he circles his hands over your hips and uses his grip to pull you into him until your lower pelvis is pressing against his own, dangerously close to his friend down there.

“Jungkook–” You sigh, “We’re gonna be late.” You say in-between his eager kisses.

“Don’t care, let me kiss you stupid.” Jungkook replies as he closes the distance between you two again, moving his lips passionately against yours.

You let out a sweet little moan as your fingers card through his hair, he doesn’t even care if you mess it up either. Looks are superficial and at the end of the day regardless of how people see him they’ll never know him or you and Jungkook’s okay with that.

Suddenly the sound of a knock interrupts the two of you and you pull away with a breathless sigh, “Yeah?” You call out.

“The car’s here and traffic’s looking pretty bad so it might be good if we leave right now. We got thirty minutes to get there since the red carpet’s already started.” Your manager says through the door.

You look at Jungkook with a soft smile as you lean up to smooch his lips, “We’ll meet you down there.”

No one expects you to come out hand in hand with Jungkook and he relishes in their shocked faces/reactions. He likes the thrill and can’t help but pull you closer by the waist with his arm tucked tightly around you. They yell and beg for pictures as you walk on by with him, ignoring their weird comments or stupid questions with no meaning.

“You wanna head inside baby?” He leans down to whisper in your ear after a few rounds of interviews and photos with the paps.

“Yeah I’m getting bored.” You hide your shoulder in his shoulder and follow as he guides you towards the venue with a hand splayed protectively over the small of your back.

He can tell you’re nervous about tonight with the way you sit with your hand tightly wrapped in his. You’re currently nominated for two major categories with one of them being album of the year. He’d be shitting himself too if he was going up against other talented singers. You’re gonna win though, you have to and if you don’t he’ll fight them to recount the votes.

“Easy baby,” he whispers low, “you got this okay?”

“I know but what if I lose?” You purse your lips, “I did really well this year so I’m hoping maybe that I do win.” Jungkook doesn’t like how sad and worried you look right now.

“If you don’t win I’ll buy the fucking thing.” Jungkook snorts, “No one had the highest record sales and streams like you did baby, you basically have this in the bag and everyone knows it.”

You huff out a laugh and look at him in disbelief, “Jungkook you can buy me all the things you want but you’re not buying me an award. Don’t be ludicrous.”

He shrugs carelessly, “I won’t if they just give it to you.” He says seriously as he leans over to kiss your cheek, “I believe in you no matter what.” You look at him with a precious smile and turn your attention back to the show.

Performance after performance passes until soon they’re announcing the winner for album of the year. You didn’t win the other category but Jungkook knows for sure you’ll win the next one. He can feel you nervously bouncing your knee and gripping his hand extra tight while the presenter takes their sweet time opening the envelope.

“And the award goes to,” pause, “y/n!” The crowd erupts into loud screams and cheers, hell Jungkook yells out as he looks at you with glee and helps you stand up.

“You won baby!” Jungkook hugs you tightly as he sways side to side, “So fuckin’ proud of you.”

You happily laugh and bury your face in his neck, “I was so scared, oh my god.” You accept his hand as he helps you step up on stage so you could get your award. He stands back filled with pride as he watches you stride with confidence towards the main stage, walking past all these other people he could care less about.

After the show Jungkook’s surprised you choose to go back to the hotel instead of the afterparty some other singer invites you guys to. He doesn’t protest because he’s been dying to get away from all these people all night (you reprimanded him for suggesting that you guys leave right after you get your win). He walks hand in hand with you, smug as fuck because his girl bagged album of the year, just like he knew you would.

“Smile,” Jungkook holds his phone up, the flash going off as he hears you complain about not being ready, “you look fine, I don’t know what you’re talking about.” He snorts and shows you the picture he took.

You shoot him a pouty frown and take his phone, “Delete it I look bad,” you huff, “you better take a better one.”

“Whatever you say princess.” Jungkook takes a series of photos for your Instagram and his, you look so pretty in each one he takes, it’s disgusting how much he’s obsessing over them, “Damn you look sexy.”

“I always do, thank you very much.” You huff and sit back in your seat, enjoying the rest of the ride back.

Jungkook’s immediately on you when the two of you get to the hotel. He’s been wanting to pick up where you two left off earlier before your manager interrupted. If it was up to him you two wouldn’t have even gone to the damn show, he’s been dying to get you out of the dress the minute he saw you in it.

“Jungkook wait–mmph,” you’re cut off as he slips his lips over yours, his hands coming up to cup your face as he swallows your lips in a passionate-hungry kiss.

“Can’t,” Jungkook whispers, “been waiting all night baby.” He reaches behind you to push the door open, kicking it open all the way as he tugs you close and walks you backwards into the room.

“Moment I laid eyes on you I was gone, knew I had to have you.” Jungkook whispers as he leans down to bury his face in your shoulder and neck leaving a flurry of hot kisses all over, “Wanted to rip this shit off you.” He growls softly.

You whined in protest, body falling backwards when the back of your knees hit the lush bed, “Not my dress–”

“I’ll buy another—hundreds baby, don’t you know who your man is?” Jungkook smirks as he climbs over you, “Can I take it off you baby?” He knows he’s being a bit too eager right now, so naturally he wants to make sure you’re both on the same page.

“Yeah.” You softly breathe out, “I want you to take it off,” you trail off looking at him with those siren eyes, “make me yours.” You say as you let the strap of the dress slip off your shoulder invitingly.

Jungkook swallows hard, hands itching and trembling with excitement as he reaches up to pull the other strap, “You already are.” He muses.

“All the way,” you intertwine your hand with his with a precious little smile on your face, “want everyone to know who my man is.”

Fuck. Jungkook bites down on his lip and nods, “You want them to see my marks, want everyone to know who’s fucking you good?” He purrs and leans down to hover over you, lips against lips.

You nod with a cute ‘mmhm’, “I want it all, you promised you’d give it to me.” You softly pout, “Or was that a lie?”

“Fuck no, take it baby, ‘s all yours.” Jungkook hurriedly unbuttons his dress shirt, hastily throwing his belt off and peeling his slacks off, “Gonna give you exactly what you need till you can’t take it.” He says as he reaches for the zipper to the dress.

He all but rips the thing off of you and tosses it to the corner of the room (mind you it’s worth over twenty thousand). It’s the first time seeing you like this under him and he wants to make it special for you, a night you’ll never forget.

“Fuck, you’re beautiful baby.” He comments as he leans down to leave a trail of kisses along your chest and tummy,slowly slipping down the bed as he inches towards your panty covered pussy.

“You have no idea how long I’ve been dreaming of this, been thinking about all the ways I could have you,” he whispers and lays a kiss over your damp folds, “I didn’t know if I wanted to lay you on my bed or bend you over the car—you make it so hard to control myself, you have no idea.”

He sees the little tremor that passes over you when he says this. Your eyes are filled with want and need but like the stubborn little thing you are, you don’t say anything. Jungkook can’t have that either, he wants—no needs—to hear your sweet little voice beg for him.

“What’s the matter baby? You need something?” Jungkook softly croons as he peppers soft kisses against your inner thighs.

You bite on your lip and nod, “Need you.”

“But you already have me?” He grins, he can see the frustration bubbling up on your face.

“Here,” you softly breathe and reach down to tug your panties upwards, the material digs into your cunt giving him a perfect outline of it, “won’t you give it to me?” Your voice pulls him in like a siren singing to a sailor, he’s so entranced by it he almost feels like he’s gonna drool right now.

Jungkook wastes no time in yanking the damp materials down your thighs, not bothering to slide them completely off as he lifts your legs up. They’re pressed together with your soft pussy lips pressed together for him, tempting him with a glob of shiny slick running down your soft asscheeks.

“Fuck,” Jungkook growls as he leans in to smother his face with your cunt, tongue slipping through your drenched dewy folds to lap up the globs of slick.

You kick your feet in the air with a tiny whine, hips wiggling in an attempt to get him on your clit. He laps at you messily, circling the tip of his tongue over your throbbing bud that’s squished between your folds. The moan you let out sends shivers down his spine and he’s eager to hear more.

“So fucking good,” he pants, “jus’ like I imagined pretty baby.” He slurs out, pussy drunk already.

He can feel you reaching down to tug your panties all the way off but he can’t be bothered with stopping, not when your cunt’s gushing for him. Jungkook licks with vigor, swiping over and over against your tender clit. Your cunt opens up beautifully with a low squelch and your thighs begin trembling under his strong hold.

It gets harder with each passing second to contain himself, his cock feels like it’s literally about to burst. He pulls away from you and lets your shaky legs fall back as he tears your panties off completely.

“Gonna fuck you so good baby,” he climbs over you and reaches down to pull his heavy cock out, “can’t wait anymore.”

Your legs easily fall apart for him and make room as he shuffles closer between them. Jungkook sees the way your eyes go dark when they land below between his legs where his cock hangs heavy, swollen at the tip with beady trails of precum oozing from the head. You lick your lips and reach down to grip him in your soft hand, tentatively squeezing and stroking as if you were feeling him up.

“Like it baby? Gonna have my fat cock fill this little pussy up?” Jungkook has a sleazy grin splayed over his lips as he watches you, “Hm?”

“Yeah, ‘m not gonna let you cum anywhere but inside,” you deviously smile back like the nasty little minx you are, “till it’s dripping.”

He groans at the thought of that and kicks his hips forward, “Lemme in baby,” he slurs out, “slip it right in for me, there you go.” He purrs when he feels the head slide over your messy pussy, smearing your slick and his precum all over your cunt before you’re guiding him towards your winking sopping hole.

You bite down on your lip when the tip catches against your rim, it pops inside feeling you inch for inch slowly—cockhead spreading you open until he’s fully seated in your tight cunt. He can’t help but bite his lip with the way you’re squeezing him so tight—so snug and warm.

“So nice ‘n warm for me,” he hoarsely says as he rubs his hands along your sides, gently squeezing at your hips as he pulls you closer until your pelvis is smacked tight against his own.

You let out the most sinful fucking moan ever when his cock slides deeper. Back arching and toes curling—he just loves how beautiful you look spread out under him with your pretty pussy snug against his cock. You release a stuttered moan as you reach for his hands and squeeze tightly.

“Hurts a little,” you say through gritted teeth, “why the fuck are you so fucking big?”

Jungkook nearly laughs at that because he doesn’t think he’s ever heard that many curse words leave your mouth before. “You want me to pull out?”

“No don’t you dare,” you glare, “took me a minute to get this thing in and you want me to do it all over again?”

Jungkook looks back down with a low whistle, “Little pussy looks like it’s struggling to keep me all in baby, you sure you can handle it?” He teases as he reaches down to flick his thumb over your swollen clit.

Your hips jump and you whine out for him, “Stop playing around Jungkook,” you turn to hide your face in the soft sheets, “you know I can.” You mumble softly, eyes half-lidded with pleasure.

Jungkook bites down on his lip and rolls his hips slowly, “I know, you were made for this dick.” He smirks and lazily flicks his thumb pairing it with his slow but deep thrusts.

Your moans come out soft and breathy, everytime he backstrokes there’s a light sheen of slick covering his cock from the base near his pelvis. Your cunt makes these adorable little squelching noises as he pushes back in, balls lightly pressing against your taint when he buries himself back in. Occasionally he stops for a few seconds before he resumes his lazy pace.

He never imagined it’d feel this good with you, something about the way your little pussy refuses to let go for even a moment—squeezing him so tight it’s almost impossible to move. His own noises come out soft and husky, he can’t help the moans and soft sighs he lets out from the hot pleasure coiling in his stomach.

“Baby,” he gasps as he leans forward to hover over you with hands on either side of you, “this good?” He asks as he steadily increases the pace in his thrusts, hips smacking wetly against your ass and balls swinging now.

You nod eagerly, “More than good—mm, jus’ like that,” you sound blissed out, gaze half-lidded and dreamy as you stare up at him with those pretty eyes of yours.

“Like that?” He groans, “Or like this?” Suddenly Jungkook snaps his hips up, a loud smack filling the room alongside a warbled cry of his name, “Oh you like that, don’t you? Baby likes it rough?” He purrs.

The slide’s fucking nasty with a mix of precum and your slick, he feels it slide down your taint where his balls slap repeatedly. The noise is filthy and sends pleasant tremors down his spine, “Oh, fuck,” he groans softly, “doing so good for me.”

Jungkook begins moving earnestly now, slamming his cock in and out of your bruised and battered cunt. Slick spills everywhere—the sheets, your inner thighs, his pelvis—it’s like music to his fucking ears right now. He can’t resist and leans down to smother your lips with his, swallowing every little cry and moan you let out.

Your arms come up to wrap around his neck as you hold on tightly, he reaches down to wrap a leg around his waist as he manages to slide in deeper with the tip brushing over your g-spot. You let out a loud cry into his mouth and bury your fingers in his hair, your thigh starts trembling again only this time more intense than before.

“You gonna cum for me baby?” He pulls away with a moan, “C’mon, be a good girl and make it messy.” He purrs against your lips while watching your expressions closely.

You stare into his eyes with unshed tears as more whimpers and whines escape, “So close,” you manage to wrap another shaky leg around him, “please, please, ‘m so close.” You whine out as your legs cross behind him on his back.

Jungkook doesn’t wanna disappoint or hold out any longer as he manages to stick a hand down between you to roll your clit between his fingers, “Cum for me, give it to me baby.” He growls softly as he plows into your tender and sore cunt.

The squelching gets louder and your moans turn into weak whimpers as you lie there and take it. His cock stirs at the sight of you nearing your end, he decides to give you a little extra push as he meanly pinches your clit. This causes you to cry out and go stiff under him, body shaking like a leaf as you gush around his cock.

“Jungkook,” you gasp repeatedly as your eyes flutter shut, face pinched in pleasure and overstimulation, “so good.” You slur out.

Jungkook lets your tender clit go and focuses on his own pleasure now that he’s got your orgasm out of the way. He grunts quietly and buries his face against your soft tits, mouthing at your sore stiff nipples. You squeeze around him tighter and tighter until the coil in his stomach snaps and he lets out a long moan of your name.

“Fuck..” Jungkook whispers breathlessly as he presses your pelvises close together, burying his cock balls deep till every last drop’s inside your battered pussy.

You moan quietly and let your legs fall from his hips, limbs feeling like jelly as you lay there panting softly. Jungkook rests his forehead against your tit and sighs deeply, “Are you okay love?” He asks softly.

“Yeah, jus’ really tired.” You whisper hoarsely and close your eyes, “Fuck, no offense but I feel really gross right now. Start a bath for me, pretty please?” You softly ask with a lip jutted out in a pout.

Jungkook of course can’t say no, “Course,” he presses a gentle kiss to your forehead and lifts himself off of you, “I’ll be back.”

𓂃 ﾟ｡ ⋆

Your company’s the first to make a statement confirming what everybody already knew, and then Yoongi followed shortly after. If Jungkook had thought it was bad before, people went ape shit now that it’s been officially confirmed by you two.

Before, they put all the heat on Jungkook because it was easier to blame him for it given the public’s opinion about him. It was easier to blame him because why not? He was some low-life boxer in their eyes. But then the attention shifted and people started targeting their hate towards you which pissed Jungkook off to no end.

Why the fuck was everyone so invested in what you did and didn’t do? Why was it that they felt entitled to dictate who you date and don’t date? Jungkook really needed these people to get jobs or mind their business because clearly they had no life outside of hating on a stranger for finding their own happiness.

He saw those vicious comments people left all over your posts and he fucking hated that he couldn’t do shit to stop them from coming back, pissed him off even more because his girlfriend didn’t deserve this. You deserved the world and more, not this shit.

So, Jungkook did the next best thing he could think of. He started taking names and screenshotting profiles before turning them over to a attorney he hired, if he couldn’t beat these stupid fuckers himself he’d let them have it with his private team. He made headlines after people started noticing that he was suing the people opening their big ass mouths.

“Baby, it’s okay really.” You softly complain, “You don’t have to waste your time with these weird people, I’m sure they’ll get over themselves if we ignore them.”

Jungkook shakes his head, “No, I’m sorry baby but I can’t sit there and watch these fuckers call you degrading names and demand shit like they know you—seriously who the fuck do these people think they are?” He growls under his breath as he paces back and forth, “And that’s not even the gist of it, these idiots are lucky I don’t catch them out in public because I’ll beat the fuck out of them.”

Out of the corner of his eye he sees you curl up on the sofa with a sad smile, “I know, but you can’t go around beating up millions of people for leaving a hate comment. It’s normal, this happens all the time I learned to live with it.” You’re trying to sound sure of yourself but he doesn’t buy it.

“Baby look at me.” He comes over and kneels down in front of you, “This shit is not normal nor is it ever okay, fuck them for making you feel like this. I hate seeing you look so dejected reading all those hateful comments,” he takes your hands in his and kisses them, “just lemme take care of it. Please?”

You look conflicted like you’re not sure if you should say yes but with a little more coaxing you finally sigh, “Fineee, just don’t do anything crazy. I don’t need my boyfriend in jail, thank you very much.”

Jungkook cracks a smile and buries his face in your lap with a happy sigh, “I promise baby, if I go to jail, who else is gonna cook you fried rice at three in the morning? Who else is gonna give you their black card?” He teases.

“Yeah, yeah now come here.” You open your arms for him, “You know I only need you and that’s all.”

Jungkook kisses that soft pout off your face as he nods, “I know you do baby, didn’t think otherwise.” He grins and lays his head on your chest with closed eyes.

The two of you sit there in silence together with the TV playing low in the background. Jungkook for the most part behaves himself despite being so close to your soft tits that are poorly hidden under your camisole. He can literally dip his head in there and get a sneak peek, maybe even a mouthful of titties—

“Jungkook, really?” You sigh, “You’re such a pervert.”

“You like it,” Jungkook winks as he mouths at your tit through your little camisole, “can I?” He knows you can’t resist and judging by the way your thighs press together, “Pretty pleaseee baby?” He gives you the best puppy eyes he can muster, all a man wants is some titty loving, that’s all.

You don’t even finish saying yes before he’s diving in and tugging your camisole down so that your tits spill out and into his face. His eyes light up and he immediately wraps his lips around a nipple, suckling gently as he laves his tongue over the stiff bud in his mouth. You quietly sigh and sink into the sofa with him following as he rolls his tongue over your nipple and flicks it repeatedly.

“You’re such a baby you know that?” You murmur, “But you’re my handsome bun,” the nickname has him perking up, “my strong, big, handsome bun.” You coo softly while stroking his hair slowly.

Jungkook’s eyes flutter shut as he sinks into the warm feeling, his sucking slows down until he’s barely moving his tongue anymore and simply suckling on your teat. “You like hearing how strong you are don’t you baby—love knowing you can easily beat someone’s ass for me?”

He nods pathetically with a low groan, “Of course you do,” you softly coo, “it’s why I picked you, knew you’d be able to take care of me the way I deserve.” You scratch his scalp lightly, moaning softly when he makes another noise, “Treat me so good like the princess I am.”

That he does. Jungkook is in heaven right now, he feels like he can just pass out right here and now with a titty in his mouth. He can’t help but shudder as he slips into a dream-like state, “Go ahead baby, just rest yeah? I got you.” You softly say while cradling his head and going lax under him, “Take what you need.”

And he does. He ends up falling asleep, one of the best fucking naps ever with your tit still in his mouth even when he wakes up. He so needs to do this another time, shit’s relaxing and a good stress reliever. Jungkook doesn’t think you’ll have any complaints either.

.

It’s a busy week for Jungkook because he has a match coming up in a few weeks and Yoongi has him completely locking in at the gym for training. You don’t mind it and being the best girlfriend you are you come as support during his sessions. You also confirmed his suspicions that Seokjin was a secret stan because his hyung fanboys out when he meets you.

“Hyung stop it.” Jungkook glares, “Leave her alone before I punch you.”

Seokjin scoffs, “No way, I get to meet my idol and you wanna ruin it for me? Where’s my respect, you brat.” This guy—needless to say Jungkook’s shooting daggers at his hyung the entire time he’s there.

The real challenge comes during the press conference/weigh-in Jungkook goes to like he always does. It starts off normal, the guy doesn’t trash talk and Jungkook’s not one for it either unless the fighter’s cocky then yeah he’ll put them in their place but this guy’s alright which he appreciates. It’s the fucking reporters that get Jungkook heated sometimes.

“Jeon, how do you feel about this upcoming match? Any thoughts on your opponent?” One asks with his recorder held out.

“I’m excited like always, I know potential when I see it so I’m hoping to have a great match with my opponent. He looks like he can give me a run for my money.” He laughs softly into the mic.

Another reporter asks something but it’s directed at his opponent so Jungkook just nods off listening to the two. Out of the corner of his eye he sees someone laughing when he looks at him, and at first he doesn’t pay attention and just keeps his focus on the reporters. But then this guy comes to the front and Jungkook just knows he’s about to hear the stupidest shit in his life.

“Jeon, so how are you and your girl doing? Heard the news and wanted to congratulate you.” He says with this sleazy grin.

It rubs him the wrong way but Jungkook keeps his temper in check as he forces himself to politely answer, “Good, thank you.” He curtly replies.

He hears Yoongi clear his throat next to him with a fierce glare, “Let’s try and keep this about the match, he's not here to answer questions about his life, this isn’t a personal interview.”

You’d think that after being called out like that he’d stop there and move on but no, this guy’s a piece of work. “I mean I was just askin’ cause I was kinda surprised with the news since you know, she been ran through by the entire industry.” This gets Jungkook to react as he pushes his chair back, causing it to fly backwards as he slowly stalks forward.

“New guy every month—say, you the new boy of the month Jeon?” He smirks.

Jungkook doesn’t even think before he lunges at him, he hears Yoongi call his name as Namjoon springs into action to get Jungkook back but it’s too late.

Jungkook’s fist connects with the side of this man’s jaw and sends him flying to the ground as Jungkook lifts his (now) bloody fist up to strike him again with a sick sound. He’s so far gone right now he doesn’t even feel when Namjoon yanks him off the guy.

“Jungkook! Calm the fuck down and get off him!” Namjoon yells through the chaos as reporters scramble to get shots and videos of this.

“No, get off me hyung! Let me fuckin’ go where is this little shit? If you’re such a fuckin’ man come say it to my face one more fucking time, I dare you! Say it!” He yells as he struggles against Namjoon’s strong hold.

It takes three guys to get Jungkook away from the reporter, Yoongi deals with the rest but Jungkook’s so fucking mad he can’t even sit right now. He’s pacing back and forth in the little backroom they got him in as Namjoon watches with concern in his eyes. He hasn’t tried to calm him down because even he knows the danger of trying to talk to him while he’s this mad.

The door slams open and Yoongi steps in, “Jungkook what the fuck was that?! That guy went to the hospital, do you even realize the mess you caused? He’s gonna press charges–”

“I don’t give a fuck!” Jungkook interrupts, stunning Yoongi into silence, “He fucking disrespected my girlfriend thinking that shit was funny. I could really give two fucks if he wants to press charges or not!” Namjoon watches the two in silence, but he’s ready to jump in if Jungkook turns on Yoongi or something.

Yoongi, who usually has something smart to say for everything, for once doesn’t have shit to say. He just stands there watching Jungkook kick the chair over and pace around the room furiously. “Kid, look, I get you. I would do the same too if I was in your place but this shit isn’t worth it. You can’t be letting them get to you like this, that’s what they want.”

“Well he fucking got what he wanted.” Jungkook scoffs with a humorless laugh.

“Just go home, I’ll deal with the press.” Yoongi sighs as he rubs his temples, “Please, for once just do what I say.”

The news is bad, there’s a shit ton of articles coming out within the next hour about how Jungkook attacked the reporter and left him a bloody puddle on the ground. It’s all over the place and there’s a shit ton of people commenting about it on online forums and comment sections. One side praises him for defending you, and then the other criticizes his inability to keep himself under control but Jungkook doesn’t care.

The REAL cherry on top is when you post your response to the news—you use that video of Latto saying “thank you to my man” along with a cute selfie of you cuddled up in bed with Jungkook. Even you made it clear as day you didn’t give a fuck about that guy either.

Your fans who had previously had negative reactions to your dating news were coming around too in favor of Jungkook. They said shit like “free JK he did nothing wrong” and voiced their support for him. Some were even harassing the reporter who had dared to say those things about you, demanding that he lose credibility as a reporter amongst other things.

Jungkook thinks it’s going to be okay because that guy totally fucking deserved it (and more).

.

The weeks fly by and the day of his big match comes—the biggest one yet because bets are high and on top of that Jungkook has a winning streak to keep up if he wants them to give him the title of “undefeated”. Following the conference nothing really happened, the guy turned out to have some shady shit on him so he decided not to press any charges in the end. God bless Yoongi for digging shit up.

With that being dealt with Jungkook could finally put his entire focus on the match. He had heard the entire arena sold out and some of the richest people on earth were attending. This was a huge deal and he had everything to lose. Jungkook was confident in his win but this guy was also the deal too, which only means Jungkook has to keep his guard up.

“You ready kid? This is about to be the biggest fight of your career.” Yoongi says as he comes to sit in front of Jungkook, “You’re gonna have to kick it up a notch this match, the guy’s good but he isn’t better than you.”

He nods at that because Jungkook’s confident in his fighting abilities, “I know hyung, I have a really good feeling about tonight.” He smiles, “Don’t worry about it, I got this under control.”

“Good, that’s what I like to hear from you.” Yoongi grins back as he pats his back, “Now get out there and make me proud.”

The arena buzzes with life when Jungkook enters the room, he’s hit with flashing lights in every direction as people scream and chant his name. He’s getting worked up again as the adrenaline slowly kicks in. Jungkook makes his way up to the ring, passing over your section where you’re sitting with Namjoon and Seokjin.

He closes his eyes for a brief moment, blocking out the crowd and music as he tries to focus. He can do this, he can do this. He will win, for you.

The guy packs a good punch and each round gets progressively harder and harder to fight him off. During one of the breaks in-between the rounds, he slumps into his corner as Yoongi immediately springs over to help him with his mouth guard.

“He’s tiring you out Kook, he’s gonna wait until you’re low on energy to give it his all.” Yoongi warns, “You need to match his pace instead of wasting your energy so early.”

Jungkook pants tiredly as he shakes his head, “Hyung he’s gonna knock me out.” He says deliriously, filled with pain and adrenaline.

“No he isn’t, because you’re not going to let him, you hear me? You’re going to get back out there and show that punk what you’re made of.” Yoongi sternly replies, “Do it for the pretty girl waiting for your win.”

Jungkook’s eyes snap over to where you sit, you look really scared and on top of that worried. He sees the way your knee bounces and how you pick at your fingernails. This isn’t what he wants to see.. This isn’t what he wants at all.

“Okay.” Jungkook grunts with renewed energy, “Fuck, okay.”

Yoongi pats his back gently and steps away from the ring, “Remember: match his pace.”

Jungkook rises to his feet and gets ready for the next round. He only has a few more before a winner has to be announced or the match is tied. Only one of them will walk out a champion, and it’s going to be him.

He takes Yoongi’s advice and matches this guy’s pace, he observes his every move and studies the combos he throws out. The guy’s a corner tech type so Jungkook avoids the edges and keeps him in the middle. He also notices that he goes for uppercuts and rear hooks.

As Jungkook prepares to strike he loses his footing and the guy takes the chance to hook him across the face. It sends Jungkook to the ground as he falls with a groan of pain. “Fuck.” He whispers.

He’s not sure how much longer he can keep up, can he even get up? His vision is beginning to blur a little and his hearing’s a little hazy too. He barely even makes out the referee counting down to a knockout.

Through the blurriness he sees Yoongi run over to the side of the net, “Get up, kid! Fuck, c’mon Jungkook get up!” He desperately says.

Jungkook wants to, but everything hurts so much and he’s so tired right now. He weakly tries to get up, barely managing to hold up on all fours as he pants heavily with blood dripping down onto the mat below. He lifts his head up slowly and suddenly the world stops.

You’re standing there with tears in your eyes, your mouth’s moving rapidly (most likely pleading with him to get up). Jungkook doesn’t like that, he swore he’d never let you feel that way again after you attended his first match and saw how bad it was. Fuck.

“Four…three..”

Get up. Get up. Get up. Get up.

Jungkook grits his teeth and stumbles forward, barely managing to catch himself on the nets as he looks back at his opponent with renewed strength. The countdown stops and the match continues, he is going to win this if that’s the last thing he does.

He lunges forward and the guy doesn’t expect it coming as Jungkook manages to get him cornered before he lets loose. He rains a slew of punches, too fast for the guy to keep up who doesn’t expect him to suddenly be this fast.

Jungkook feels like he blacks out during all this, landing hit after hit until he’s finished with one last uppercut and then everything stops. He feels a pair of hands pull him back as the referee begins the countdown. Jungkook stands there heaving as he watches tiredly.

“..Two..one..” The bell suddenly rings and the crowd cheers.

He did it. Holy shit, he did it!

Both Yoongi and Namjoon rush into the ring together, bringing him into their arms as they jump with joy. “You fucking did it!” Namjoon smiles happily.

“Where’s…where’s y/n?” Jungkook blearily asks as he looks around.

“She’s right there,” Yoongi points out, “she’s still here Kook.”

He pulls away from the hug and trudges over to the net, holding it up and holding his arm out for you, “C’mere baby.” He calls out.

You immediately stumble over and climb into the ring with him, sinking right into his arms when he tugs you close. “I’m here,” he whispers, “I’m here.”

“Don’t ever scare me like that again! You hear me? I don’t ever wanna see you like that.” You whimper and cup his face, “Oh Jungkook..”

He smiles softly and leans down to kiss you passionately in front of everyone. You easily melt into the kiss and wrap your arms around his neck. When he pulls back he looks around with a stupid grin on his face, “Fucking won but everything hurts.”

You frown cutely and ignore the reporters that begin to swarm the two of you. Jungkook keeps you tucked into his side as he answers their questions, “Feels really good I can’t lie, even if I feel like shit right now though. But I’m just glad I won, I've been wanting to dedicate this win to my beautiful girl.” He smiles down at you and kisses the top of your head.

They start throwing more questions at him after that. They’re all kind of the same regarding their relationship because they’re just dying to know all about his relationship to you. They even try to ask you some questions but luckily Yoongi intervenes when it begins to get out of control.

“Alright back up, give Jungkook some space.” Yoongi says as he pushes some reporters away, “You ready to go Kook?”

“Yeah, get me the fuck outta here.” Jungkook groans as he follows after his hyungs with you close by.

Yoongi and the others help Jungkook get into an ice bath as soon as they get into the back room. You work on cleaning the blood off his face and icing his wounds, “Does it hurt? Well, more than usual?” You softly ask.

“No babe I’m fine.” Jungkook replied calmly as he closed his eyes, “The ice feels really good, I’m sore all over.”

You hum, “Let me know if I’m hurting you.”

“I will.” He hums back and sinks into the ice with a relaxed sigh.

The cold sensation on his body is working wonders on his sore muscles. It feels like he’s living the dream right now. He doesn’t think he wants to even party after this, sure a big win calls for a celebratory dinner or something but right now cuddling and going to sleep sounds way better.

Yeah, way better.

.

“I thought you were too sore to do anything, what happened to that?” You laugh softly while looking down at him.

Jungkook’s pout deepens, “I can still move my hips, see?” He says and demonstrates with a little thrust up, “Pleaseeee! For me baby? I promise I’ll tell you if it hurts or something.”

You look at him in disbelief, “You literally just got beat up what do you mean please? Look at you! Why the heck is sex even on your mind right now?”

“Because, you looked so sexy on that billboard on our way back here.” He huffs casually leaving out the part where he raged because everyone can see you and no doubt millions have.

Not that he’s petty but he’s petty, he wanted to tear that shit down and keep it for himself. “That’s not the point,” he groans and tosses his head back on the pillow, “I can still move and it’s not like my cock got beat up too.”

“You are so nasty.” You laugh softly and sit back on his lap, “If I ride you will that make you happy, hm?”

It’s comical the way his hair bounces when he nods vigorously, “Yes.” He says without hesitation, “It’s like a reward.” He grins toothily.

You roll your eyes at him with a sigh, “You’re so spoiled,” you mumble while reaching down to help him pull his boxers down.

“Wait!” Jungkook looks up at you with pouty eyes, “Can you..?” He tugs at the loose shirt you’re wearing.

Immediately you know what he wants and you nod, “My baby deserves it doesn’t he?” You softly say while tossing the garment somewhere else, “Did so good out there,” you purr and lean over him.

His eyes sparkle as he nods, “I did,” he whispers and licks his lips, “means I get a reward right?”

“Yes you do.” You gently coax him closer as you lean down to press your soft tit to his lips, “Take it, ‘s all yours.” He latches on without wasting another second.

Your lips part as a soft breathy moan escapes, your soft hand reaches down to fish his hard cock out of his boxers. He shudders when you start stroking him, it’s slow and sensual as you gather bits of precum with your thumb and slowly work your way down around the shaft.

His balls sit heavy and they ache with need to empty themselves in you. Jungkook has to fight the urge to buck his hips as he accidentally grazes his teeth against your bud.

You yelp softly and he pulls away apologetically, “Easy, not so hard.” You softly chastise.

“Sorry.” Jungkook murmurs and presses a kiss on your tit before moving to the opposite one.

“Just sit back and relax baby,” you murmur, “I got you.”

You position the head at your weeping pussy, slapping it repeatedly in small taps until the tip catches on your hole. Jungkook holds his breath as you begin to slide down on his sensitive cock until you're bottoming out with your ass meeting his thighs.

“Good?” You softly whisper.

Jungkook nods and goes back to suckling on your nipple in peace. You rock yourself in his lap steadily like you’re scared you’re gonna hurt him but Jungkook encourages you with a little buck. This makes you sink down in his lap with a lewd moan, his cock shifting deeper inside.

“Use me,” Jungkook quietly pipes up, “I can take it.” His breath hot and heavy over your pebbled nipple.

“You sure? What if I hurt you?” You murmur.

“I’ll be fine baby, I’ll let you know if something hurts. Please?” He opens his mouth to take your nipple back in.

You shiver and bite your lip still a bit worried but you end up giving in. You slowly pick up the pace, switching from grinding to bouncing. There’s a low smack here and there but it’s nothing too crazy because you’re going as gentle as you can.

Jungkook’s lips tighten around your nipple with every grind and bounce. Your pussy tugs at his cock with the right amount of pressure sending shivers down his spine. He moans softly and moves one hand up to grip your bouncing tit.

“Fuck you look good like this,” he breathes out in pleasure.

You groan softly as he squeezes your tit in his strong hand, massaging the soft mound of flesh afterwards. He pulls away to push both tits together and buries his face between them with a happy sigh, “Never wanna leave, I could die a happy man like this sweetheart.”

“You’re just a perv.” You chuckle with a moan.

“For you.” Jungkook grins and then lays back, “Don’t tell me you’re getting tired already.” He notices that your bouncing has slowed down.

You glare cutely at him and sit up, “I don’t like doing the work in case you haven’t noticed.” You mumble while grinding back and forth over his cock, “You’re lucky I love you enough to do this.”

His eyes widen when he hears the words “love” and “you” in one sentence. It makes his sappy little heart beat with joy and pride hearing those words leave your lips, he can’t help but buck his hips upward eagerly.

“Jungkook..!” You gasp throwing your head back.

“Say it again baby,” he huffs as he uses his strong grip to haul you up and plop you back down on his lap, “I wanna hear it–” He cuts off with a breathy moan.

“I love you.” The words make him groan louder as he slaps his hips upward.

“Fuck I love you too,” he moans, “so, so fuckin’ much, you have no idea.” He whispers and looks up at you through hooded eyes.

You bite your lip hard and throw your head back with a whine, “ ‘m coming.” You whimper.

“Oh you like hearing that don’t you, knowing damn well that you got me wrapped around your fingers.” Jungkook huffs with exertion as he fucks into you harder.

“Y-Yes, love it so much knowing you’re mine,” you mewl softly and grind on him, “fuck, fuck..!” Your pussy clamps down and suddenly you’re coming all over him in slow waves of harsh pleasure.

Jungkook pulls you down for a passionate kiss as he holds you down against his pelvis. A few more rolls has him coming too, cock throbbing and twitching. He lays there panting heavily with hazy eyes while you whine about him being careful.

“Don’t put pressure on your side,” you grumble, “I told you we shouldn’t have fooled around.”

“I’m fine, see? Nothing’s wrong.” Jungkook laughs and delivers a sharp smack to your ass, “Now tell me you love me again. Wanna hear it from your pretty lips.” He mumbles and traces over your bottom lip.

“I love you.” You fondly sigh.

“Again.”

“I love you.”

“Again.”

“You’re so annoying! I’m going to shower.” You huff and stomp off with cum leaking down your inner thighs.

Jungkook lays there with a soft grin as he watches you go, “Yeah, yeah, I love you too though.” Forever.

And ever.

TAGLIST: @fragmentof-indifference @jungkooksseuphoria @kooliv @angelarin @jjeonjjk7 @lilliankoo @pb-n-juju @ellesalazar @saweetspoiled @laylasbunbunny @prettyprincejk @cherrysainttt @hyunjinswifeee @joongraduatewithonor @hellbornsworld @leire-mia @m1sss1mp @lissful @winkii @lifeless-firefly @exactlygreatcoffee @taestoess @ayalies @floweryjeons @softtcurse @lilspinachwrld @tearyjjeon @littleobsessedkitty @lovelovelovebts @angeljmnie @rerefundslocals @bangtans-mama @thvhoe @maddkitt @tvse @ohjeon @teteswtnr @jkslovey12 @kelsyx33 @milfpo1ice @sluttydidi @ztyur @beomgyuult @shescharlie @sweet-sourhotcoco @lalita-7 @hazzzelsdimension @p34rluv @kook-net @bonita0-0 @vmapy @dahliadaenerys @frieschan @lilyflowerguk @sayokodiary @babycandy111 @looneybleus @ash07128 @gyukookswhore @rrosiitas

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[ynbabe]

We don’t hate each other ୨୧ Arthur x fem! reader

Y/n was Ollie's oldest friend, growing up with him as he raced his way up to formula one, somewhere in between she found Arthur Leclerc, found him a massive fucking pain in the ass that is until something changes when Ollie debuts in Carlos Sainz Ferrari.

A always, comments and requests are always welcome! lemme know what y'all think of this!

Warnings: curses, lime

y/nl/n

y/nl/n GET THIS MAN IN A FERRARI ASAP 💪 💪 💪 😮‍💨

Username they're relationship is so important to me actually

username arent they just friends?? username girl you believe that? LOOK AT THEM THEY'RE LITERALLY MARRIED username theyre 18 go touch grass pls 😭

username GET THAT MAN IN A FERRARI!!!

Username shes so real for that bow, ollies so cute 🥹

olliebearman thank you for the very serious pictures of me, a very serious, very profession man

y/nl/n "very serious, very professional man"🤓 shut up you literally cried in my arms when you got called olliebearman i'm telling my pr officer to block you username did what in whose arms now?? username oooh so hes in love love

arthurleclerc Way to go Ols!

y/nl/n gtfo my post arthurleclerc gtfo off my fyp y/nl/n block me bitch arthurleclerc too much effort, cry olliebearman guys you're in public 😭

username whats with Arthur and Y/N? 😅

Username they're competing for Ollies love Username bro you wrong for that 😂

arthurleclerc

arthurleclerc to MY bestfriend, congratulations on making it to Ferrari and f1! You deserve the best! Hope my brother treated you well.

username SHOTS!! HAVE!! BEEN!! FIRED!!

Username he know he wrong for that first photo

Username okay wait. How do both Leclerc have a Wattpad ass gay romance is it genetic??

Username bro all capped the my 😭

username mans petty as hell

username @/y/nl/n me personally, I wouldn't take that

username hes stealing your man girl go get him!!

oliiebearman Thank you Arthur! Yes he did!

arthurleclerc ur welcome ols ❤️ username @/y/nl/n were waiting for you boo username its the red heart for me Username Charles come get your brother!!! he's cosplaying you and max on main again

y/nl/n Congrats Ollie!! love you 🥰 (Not gonna make this abt myself like some other girls)

arthurleclerc revoking ur paddock pass btw 🥰 Olliebearman ... I'm blocking you both 🥰

username mans done with them 😂

You rolled your eyes as you saw Arthur's comment on yours, how could he be so childish. Forget it, you reminded yourself, today is for Ollie and Ollie only.

You waited in Ollie's driver room till he was done with the debrief, you'd go out to celebrate with him and his family later. His trainer had given him a pass on the diet, after all, scoring points in F1 was no joke.

You jumped off the chair you were lounging in, ready to hug the man as you heard the door open but to your disappointment, it was only Arthur.

You groaned as you saw the boy and he scowled in return. You never knew how your rivalry began. One moment you were visiting Ollie for the first time at Prema and the next you were in a screaming match with a Monagasuque man with the cutest accent.

"What are you doing?" He asked, rather, demanded.

"Waiting for my friend," you replied with the same annoyance in your voice, "What are you doing here?" you accused, stepping towards him.

He pulled a face, closing the gap, "Here to support my friend, you know cause we can actually stand each other,"

"Hah, sure, at least I'm not jealous of my friends, you know cause they actually make it into f1," you shrugged, knowing it was a low blow.

His face morphed into anger as he pushed closer towards you, "You need to shut up," he spoke in a low voice, you'd be scared of the taller, much stronger boy if you weren't doused in anger yourself.

"Make me then," why did you say that- Oh shit.

Your eyes widened as he kissed you, making both of you stumble back and fall on Ollie's driver room bed. You groaned as your back hit the mattress, the older boy breaking the kiss, looking down at you in concern.

"O-oh, my god! Y/n I'm so sorry, I don't know wh-" he began rambling but you couldn't let him win, could you? So you kissed him back, letting your hands run through his hair.

He led one hand to your waist, letting it fall under your shirt, he hissed at the warmth your skin radiated under his palms.

"Oh my god, OH MY GOD," Someone yelled, making Arthur push off the bed, and fall on the floor.

"Ollie this isn't what it looks like," he explained from the floor making you frown.

"It isn't?" you asked making him turn to you.

"No, it is," he explained to you, then turned to shocked Ollie in the doorway, "I mean- it is," he tried to explain.

Ollie paused for a moment, "On my bed, really?" he replied, disgust in his voice.

You picked up the pillow on his now messed up bed, throwing it at his head, "Shut up,"

He laughed as he ducked, "Hey, at least none of us had to intervene," he confessed making you and the boy who was now getting up off the floor groan in defeat.

olliebearman

olliebearman never make out in my room again, I beg you

Y/nl/n sorry I stole your boyfriend, Ols

arthurleclerc you are still the love of my life, y/n's just a friend olliebearman DO NOT START THIS AGAIN

Username HUH?

username chat is this real rn? username fr thought they hated each other username bro said he was going to get his Wattpad enemies to lovers one way or the other

username Charles Leclerc it's your turn now.

charlesleclerc So all the ranting actually led to something?

y/nl/n he talks about me?? arthurleclerc NO I DIDN'T! Charles shut up or I'll tag someone you rant about. Charleslecler y/n changed you i dont like this relationship anymore username WHAT DO YOU MEAN??? Username First we get Arthur x y/n and now we are getting Charles read like filth 😭

trying something new, thoughts?

[lovebugism]

“you were outside for one minute, how can you be dying of hypothermia?” with Steve and ditsy reader🥹

ty for requesting! — you walk in the freezing cold to ask steve if he would still love you if you were a worm (ditzy!fem!r, established relationship, 1.6k)

bug's one year celebration ♡

Your arrival is marked, first, by an ignored knock. 

Steve’s lazing on his couch, heavy with post-work exhaustion, with his resident schmuck slouched at his side. Robin acknowledges the tapping at his door before he does. “You gonna get that?” she mumbles, mostly uncaring and partly distracted by the TV.

Steve shrugs, unblinking. “It’s probably just a package or something.”

“Or maybe it’s your girlfriend,” she retorts, voice dripping with sarcasm as she turns to him with wide ocean eyes. “Remember her?”

Steve scoffs. “She said she wasn’t coming over today… Why do you think you’re here?”

Robin would punch him in the shoulder if she wasn’t so tired. “Asshole,” she mutters under her breath.

Another knock echoes down the foyer. This time, followed by a voice — muffled and achingly familiar. “Can somebody let me in before I die out here?” 

Steve jumps off the couch without thinking, filled suddenly with newfound life and distant horror. He vaguely hears Robin mumble “told ya” as he rushes to the door. 

He wrenches it open with an iron grip around the knob. He’s smacked in the face by the bitter breeze waiting on the other side. Snow falls from heavy clouds, swirling with freezing wind, and you’re standing out in the middle of it all.

“What the hell are you doing out here?” Steve blurts. Not because he’s unhappy to see you, but because it’s basically a tundra outside, and you’ve got on the thinnest jacket he’s ever seen.

Your brows pinch as your face swirls something pitiful. Eyes wide and glassy, you blink snowflakes from your lashes. “Dying of hypothermia,” you murmur into your knit scarf, shrinking into your crossed arms.

Steve manages a small laugh. “Okay, you were outside for one minute. You’re not dying of anything— now get in here before you freeze.” He ushers you in with a warm hand pressed against the small of your back. “And I meant, what are you doing here? You said you were staying home ‘cause of the snow.

“I had a very important question to ask you,” you insist while he helps you peel off your jacket and scarf. Crystalline flakes fall from the fabric and onto the hardwood, melting almost instantly.

He hangs both on the rack for you. “You walked half a mile in the snow to ask me a question? Why didn’t you just call?”

“‘Cause it’s too important— I had to see you first.”

Your pout is childlike and firm. Steve concedes with a nod. “Okay. Well, uh— Robin’s here. Is that okay?”

You’re beaming almost instantly, forgetting about the boy entirely as you duck past him and down the entrance hall. You find Robin slumped on his sofa, still in her Family Video vest because unbuttoning it was too much work. Her bitten lips curl into a smile at the sight of you, the ball of sunshine Steve’s trying to tame.

“Are you guys having a sleepover?” you ask, all giddy at the thought.

She leans her elbows along the back of the couch and shrugs. “Well, we were. But since you’re here, I’m thinking we should just kick Stevie out.”

“Yeah. No. Not happening,” Steve deadpans as he appears behind you. He guides you towards the stairs with a warm arm around your shoulder. “C’mon— Let’s go.”

You pout. “Wait. Where are we going?”

“To get you some fresh clothes. I just got a load outta the dryer— Remember when you said you were freezing?”

“I’m past freezing, Stevie. I’m dying.” You groan and lean much of your body weight into the boy beside you. He laughs and carries it no problem.

“I’ll warm you up. You’ll be okay.”

He gets you into his bedroom and starts taking off your clothes. “At least take me out to dinner first,” you quip in a tiny voice as he pulls your sweater up and over your head. He scoffs and replaces it with a sweatshirt. Hissweatshirt. From the laundry basket full of fresh clothes he hasn’t folded yet. Then he sets you on the edge of his bed and tugs your jeans down your thighs, only to put a warm pair of baggy sweatpants over them again.

There’s something distinctly domestic, you think, about someone taking off your clothes only to put fresh ones on you again.

And then, even though he knows you’re perfectly fine, Steve cuddles with you under the sheets of his bed for a moment. He says it’s to help you warm up faster — “‘cause you were dying, remember?” But really, he’d just missed you. In a very simple, human way. And it feels good to hold you to his chest like this.

“Feel better?” he asks, filling the silence of his bedroom, chin bobbing against your head.

“I feel more alive now. If that’s what you’re asking,” you answer.

“Less than an icicle?”

“Exactly.”

“Well, you’re the cutest damn icicle I’ve ever seen—” He pulls just far enough way to see your face, smiling when he finds you grimacing at his dumb attempt at flirting. He plants a chaste kiss on your pouted mouth. A low smack fills the bedroom. You’re beaming all over again when he’s gone.

“What was your question again?”

Mouth still sparkling with longing, your face swirls with confusion. “Huh?”

“You said you came over to ask me something.”

“Oh, yeah!” you shout, wiggling out of his hold to face him more. You grow suddenly serious — as serious as a person like you can be, anyway. You talk wildly with your hands as you ramble. “Well, I was at the trailer earlier, and I was talking to Eddie, and I’m pretty sure he was high—”

“Figures,” Steve scoffs.

“—‘Cause outta nowhere he was like, ‘Would you still love me if I was a worm?’ And I was like, ‘Yeah. Obviously. I mean, I’d be sad about it and everything, but I’d still take you everywhere with me.’”

“He might be easier to tolerate that way,” he jokes, pink lips curled into a small smile.

You don’t seem to hear it.

“And then I thought— ‘Oh my god, what about Steve? Like, would he still wanna be my boyfriend if some evil witch turned me into a worm?’ And it really freaked me out, and Eddie was zero help, and then I got so sick about it that I had to come over here and ask you.”

You don’t take a single breath until you’ve vomited all the words out.

Steve — equal parts impressed and worried by you — nods slowly and with wide honey eyes. He calculates carefully what to say, lest the wrong thing spill from his mouth and send you spiraling all over again. “Okay… Well… For starts, yes, I would still love you.”

He swears you breathe a sigh of relief then.

“But like… Can I ask why you got turned into a worm?” he wonders with pinched brows.

“The optics don’t matter,” you insist girlishly.

“Right. Well. Can the evil witch-woman turn me into a worm, too? Or is that against the rules?”

Your doe eyes begin to sparkle, wide and full of hope. “You’d wanna be a worm with me?” you wonder in a tiny voice, distant with disbelief.

Steve scoffs. “Of course, I would. I wouldn’t wanna be anywhere without you.”

You knock the breath from his lungs when you lurch suddenly forward. Chest against chest, your arms wrench tight around his neck. He’s stunned for one moment, then hugging you back the very next. His wide palms rest warm along your spine. He manages a laugh despite being halfway strangled.

“I mean, think about it. I could spend the rest of my life hugging you like this if we were a couple of worms.”

“Well, you’re gonna do that anyway,” you quip, muffled into his neck.

Steve hums. “Touché.”

You pull away from him after a moment or more, serious all over again. There’s a firm furrow to the center of your brow and an unsmiling glint in your eye. “We have to set ground rules, though. Just in case.”

“Of course,” the boy concurs, fighting back a smile.

“If I get turned into a worm, and you couldn’t be one with me, what would you do?”

“Like… If I wake up and there’s just… A worm on your pillow?”

“Yeah.”

“I don’t know,” he shrugs, face pinching ‘cause he’s really thinking hard. “I’d be really sad.”

“But what would you do with me?”

“I’d get you a tank or something. Or, like, a little necklace to put you in— so I can carry you around everywhere.” He figures that’s the most perfect solution to this wildly unlikely situation, given the risk he couldn’t be there with you. Then your pout deepens, and he second guesses. “Is that okay?”

He can’t believe he’s entertaining this at all, really, but you’re worrying’s got him stressed about it, too.

“I want you to hold me in your hand,” you tell him, quiet and sincere.

Steve nods. “Deal.”

“…And hold me at eye level at all times.”

He laughs before he can stop it. “Sure.”

You start to smile, but don’t let yourself. “But how would you find me?”

“If you got turned into a worm?”

You nod, slow like a sheepish child. “How would you know which worm was me?”

“I’d find you,” he insists.

“Yeah?”

“Yeah,” Steve scoffs with a shrug, mostly uncaring because the idea of finding you has never worried him before. There isn’t a world where the two of you aren’t together. Even in the infiniteness of time and all its parallel existences, Steve thinks you’ve found each other in every single one. 

“I’d always find you. In every universe,” he assures, wearing a crooked smile on his lips when he boops the tip of your nose with his finger. “And out of every worm.”

[creganslover]

Cregan Stark with

“It’s okay. It’s okay. I’m right here, okay? I’m not gonna leave you. I’m never gonna leave you.”

cregaaaaaaan <333 sorry if its short!

warning/s: mentions of kidnapping, slight violence, cregan being worried

✦•┈๑⋅⋯ ⋯⋅๑┈•✦

You had gotten taken, someone had managed to sneak into Winterfell and had a target upon you, Cregan Stark’s spouse. They were smart enough to attack at the time when Cregan had been off to the Wall to check on his men in training. 

All of Winterfell had been alerted of your missing presence, causing alarm and panic from your people, with Cregan left with no knowledge of your taking. 

Until a raven had been sent to the Wall. 

Cregan was absolutely fuming, the spouse he had promised to return to, that he promised to take care of until snow seeped into his bones- taken at the time of his absence. 

His horse took him home, few of his elite men following suit as Cregan was nearly going berserk with worry and agitation, the folk witnessing as their Lord torn the walls apart with his booming voice, demanding as to why his spouse was not guarded that night and why had they let the intruder take them easily. 

Cregan began thinking of the possibilities of who could have done this, it could have been anyone, sending out patrols whilst getting no ounce of sleep, mind running million miles an hour. Were you well? Had they hurt you? Or worse, killed you? 

Yet the news of an unknown camp sighting came within the sights of Wolfswood, Cregan hopped onto his mount before one could even speak his name. 

It had been a long search, a day or three when Cregan and his men narrowed it down and found indeed the camp within Wolfswood, overhearing the men laughing and celebrating the capture of you followed by your cries made his blood run cold. 

In a matter of moments, their entertainment was cut short by Cregan appearing, demanding his partner be released or face such consequences, the leader had been surprised and made the mistake of taunting Cregan, not knowing he would go through the Seven Hells and back for his other half. 

Cregan gave the signal, and his men came out from the woods, dealing with the goons. Cregan then searched until he had stumbled upon a lone tent, his heart fearing the worst as he neared and grasped the flap of the tent. 

There you were, shivering and tied to a post. Thankfully, you did not look too harmed nor defiled, Cregan kneeling as you shook, realizing it was him as he cut off your ropes, wasting no time in embracing his burly frame, shaking in his hold. 

Cregan wrapped his strong arms around you, murmuring in his deep voice, clutching you tighter as he rubbed warmth onto your back. “It’s okay,” he began. “They’re gone, it’s okay. I’m right here, okay? I’m not gonna leave you. I’m never gonna leave you.” He told you, shrugging off his own furs to wrap around you. 

You can ensure that once you get back to Winterfell, Cregan would punish those who had failed to protect you that night, sending them to the Wall as he replaced them, you had also noticed him be hesitant when he is required to leave you, even for a short while. But as you kept reassuring him when you had felt better and regained your strength and life, Cregan could slowly see your usual self coming back. 

Cregan entered your shared chambers, wanting nothing more but to get back to you after his responsibilities, shrugging off his cloak of furs before he joined you on the bed. “Are you alright?” He always asks, holding onto your hand. 

Leaning in to nuzzle against his form, you sighed in content as you placed your hand over your man’s chest. “I am, do not worry.” You reassured. 

“Thank you, Cregan.” You voiced after a beat of silence, which he returned with placing his lips against yours, giving your hand a light squeeze. 

✦•┈๑⋅⋯ ⋯⋅๑┈•✦

cregan tag-list: @misswynters

[pierregazly]

always the prize, always the winner ꨄ logan sargeant smau

logan sargeant x pop star!reader

in which logan is actually pretty okay with being known as the biggest pop star in the world's arm candy. who would complain about that, really?

yourusername

liked by logansargeant, lilymhe, oscarpiastri, and 4,539,209 others

yourusername back doing what i do best!! (watching this handsome man get asked solely about me in interviews and then singing songs about it) (ps i love you) (pps yes that is a song)

view all comments

logansargeant why are you so obsessed with me?

logansargeant im not complaining btw cause like... never stop?

logansargeant but also pps cant wait to hear it 🤍

yourusername just for this attitude you're the LAST to hear it now (handsome)

username still never gonna understand how LOGAN SARGEANT bagged ms ma'am but okay! 🤭

username a couple mutually obsessed with each other? (gag) (obsessed)

oscarpiastri i get asked questions about you too?

yourusername yes and your one word answers are SO riveting.

username why is no one talking about the SONG??? PS I LOVE YOU???? im going to throw up

username it's going to be the most disgustingly loving obsessive song ever and it's all about this american MAN

username never seen a man luckier than logan sargeant

logansargeant has posted a story

tagged logansargeant

liked by logansargeant, oscarpiastri, alex_albon, and 3,201,326 others

yourusername nothing makes me happier than running into you in the most random of places. always there when i need you most 🫶🏻

view all comments

logansargeant i would meet you in the middle of a croc swamp if i had to

logansargeant not a snake pit though, you're on your own for that one kid

yourusername you're on your own kid... what a song title 🤭

alex_albon we have a race next week??? in australia??? why are you in america

logansargeant 🤫

username god these two make me sick!!! (affectionate)

username if they ever break up... imagine the album ugh. i need it

username maybe let's not wish a breakup on anyone??? especially these two?? wtf

lilymhe begging u to release the songs even if they're about logan

yourusername they're actually about you?? 🫶🏻

tagged logansargeant and yourusername

liked by username, username, username, and others

ynupdates during an interview before the melbourne gp this weekend, logan gushed about finally getting to see yn after a few weeks apart, and when asked if she'd be attending any of the upcoming gp's all he did was smile and say 'she could be here right now, but i'm not going to be the one to expose her?' - so, if anyone is at the melbourne gp be sure to keep your eyes out!

view all comments

username oh he SO flew to san fran so she wouldn't have to fly to australia alone.. king energy??

username i know he always says he's the winner but that man would walk through hell for her so idk

username omg omg im gonna be at the gp this weekend!!! i'll keep an extra eye on everything and anything william's

username imagine going to a FORMULA 1 RACE and running into THEE pop star yn

username logan it's your weekend to get some points!!! impress your gf, be the prize and the winner for once!! (at least get points)

yourusername has posted a story

liked by logansargeant, username, username, and others

replies

logansargeant not you posting my garage but not even coming to see me??? hell is a place on earth and it's where i am right now

yourusername literally my words every time im away from you??? go win points love u my handsome lil eagle man <333

logansargeant gross <3

liked by yourusername, alex_albon, oscarpiastri, and others

logansargeant LFGGGGG!! first points of the year, and a 5th place finish at the melbourne gp!! let's go up from here!! honoured to have had my best friend here, always gonna be a winner when you're involved angel 💗

view all comments

yourusername literally wreck my plans, THAT'S my man

yourusername so fricken proud of you handsome!!! knew calling you my lil eagle man would win you some points

yourusername love you so much pls

logansargeant love you more pretty <3

williamsracing that's OUR shared comfort american man. it's all up from here!

username LFGGGG

username RAH RAH WTF IS A KM 🦅

username 🦅🦅🦅

tagged logansargeant

liked by logansargeant, lilymhe, oscarpiastri, and 12,320,433 others

yourusername in honour of my boyfriend, my new album 'lover' will be out 24.03.14 - an ode to the man who has shown me how you can be a prize and a winner all in one. logan, i love you more than anything. always.

view all comments

logansargeant and to think i always said it was a joke when i asked you to write an album for me.

logansargeant i love you to the moon and back, i know i've heard every song but i can't wait to hear it again. you're the best ever

yourusername god. i'm so lucky to be known as yours lo 💗

oscarpiastri if anyone asks me about this. one word answers only. riveting.

yourusername riveting?

oscarpiastri riveting.

username I KNEW IT

username THERE WAS WAY TOO MANY REFS TO NEW SONGS

username god this is gonna make me feel so single. i literally can't wait.

ynnation love songs for the ages, we know it. an icon, and congrats to logan for getting his first points of the year!!

username this is SO for all the logan haters, ain't none of y'all ever gonna make our girl feel the way he does!!!

authors notes

this was so self-indulgent bc i haven't written in forever but im going through a logan phase. i hope you all love it 💗 i also lost my tag list so pls enjoy regardless ily

[whorenerdking]

I’m feeling so fucking seen by a stupid fanfic that’s it’s making me feel worse about myself than I already do. anyway I’m gonna go drive my car off a cliff.

[bindeds]

[ DON’T BE SORRY. ] : 5.1k words. 𖤐 LUCIFER MORNINGSTAR X FEM READER. — you’re dating the big boss of hell himself, but it’s a sticky situation when you’re also good friends with a tech-savvy overlord who believes the cause of your boyfriend’s daughter is absolute bullshit.

#tags. slight hurt/comfort, slight jealousy, nsfw (+18), fluff, smut, vox being a hell of a friend, lucifer being vulnerable as hell,

a/n. fuuuuck i forgot to post this under the request but this was the request that i wrote this for <33 didn''t even remember they wanted fluff which is lucky bc i suck at fluff so i don't write it too often but i ended up writing in fluff anyway bc it felt appropriate for the fic SO

masterlist. request something :>

“Sir, someone is here to see you.”

Vox growled. His office would have been pitch black if it weren’t for the multitude of tv screens that stared right back at him, boring holes into his screen. They buzzed and whined with a cyan glare bright enough to light the entire pentagram. Claw marks left the edges of his head unpolished, his bowtie askew as his teeth grinded so hard he wanted to encounter a system error.

“Tell Val I am not in the mood for sorting out whatever’s got his panties in a twist this time—”

“Someone else, sir.”

“Well don’t just stand there you useless fuck! Who the fuck is it?” Static shocks ruptured from the wires on his head as he jumped out of his chair fuming. 

The employee pulled one of the handles of Vox’s grand doors. In pranced a sunlit woman with a grin that stained her cheeks red. On her arms were shopping bags lined all the way down their forearms, marking their weight on her flesh.

You pulled your rose-tinted sunglasses away from your face as you cocked a brow.

“What, are you not happy to see me Vicky?” 

“When are you gonna stop calling me that, you absolute slut!” Vox beamed, and as if a new line of code had entered his program, he shedded his jacket off to peel your shopping bags off you as he set them on his couch.

“What brings you back here after all this time, whore? And whose money are you wearing because I know there’s no goddamn way that’s all yours,” Vox laughed through his clearly lighthearted remarks. 

“Whatever. Whore is right because you’ll never guess who I’m fucking.”

.

On the edge of the pride ring resided halls and halls of vintage red wallpaper and intricate gold decor. Knocking frantically at her father’s door just to ask where his partner had gone was never how Charlie would have imagined her morning to go, ever, but here she was, knees wobbling with her hands clasped together as she waited no longer than a second before she had her fist in the air again to—

“Charlie?” 

“Dad!”

When Charlie had asked of your whereabouts, Lucifer simply frowned, though a hint of terror struck his shrunken pupils.

“Uh—I thought she was with you? Don’t you guys have that trust building exercise thing on today—”

“Yes! Yes that is precisely why I am panicking—she’s not in her room and she never misses our gatherings! Dad, how do you not know where she is?” Charlie screeched anxiously.

“Relax, Charlie I’m sure there’s a perfectly reasonable explanation for—”

“For her not to tell her own boyfriend where she’s going?” Charlie seethed with dirt kicked into her tone. 

“Let me call her, okay?” Lucifer pulled his phone out and speed dialed you. 

Something in his room buzzed intermittently. 

Charlie peered into her father’s room, only to find another phone rattling on the further bedside table.

Lucifer looked over his shoulder to the same view. His shoulders dropped.

“Ohhh no.”

.

“Face it baby, I got bigger bucks than daddy could ever conjure up.”

“Vox!” You punched him in the shoulder, unable to hold back laughs that pulled at the bottom of your stomach.

“What? Oh my god, you actually call him that in bed don’t you, you bitch? Holy shit, you really are a slut!” Vox cracked up after you both had left his building. “Where to?” 

“A few blocks away I got something to show you in the ma …”

Your lips fell numb when your gaze fell on a certain man with a white overcoat tailing in the wind as he approached your direction with a storm in his steps. He had been looking at his sides—your hand moved to shove Vox even before your body could follow.

“Ow, what—”

“Go.”

“Babe, what’s—”

“Vox go GO! Back in now!” You spun him on his heel and elbowed him back into the glass doors of his building lobby.

“Honey?” 

“Fuck fuck fuck fuck fuck—”

He called your name, loud and clear as day that even the ruby skies of hell echoed it.

“That’s him, isn’t it?” Vox deadpanned.

“Hey!”

Both yours and Vox’s heads turned to the sound, Lucifer just a few strides away from possibly opening a portal down a ring.

“You!” Lucifer barked, gaze locked with Vox’s. “The fuck are you doing calling my girlfriend ‘babe’?” 

“Oh, that’s not—”

“Lie to me and I swear to fucking god I’ll make sure they’ll be prying you for parts.”

“Luci.”

“What?” His head snapped in your direction.

A silent gasp escaped you. 

His shoes hadn’t nearly been dragged through as much gravel as his voice had been. It was something he’d dug up from the depths of his chest like it was nothing—and it brimmed with the filth of his own disdain. 

Lucifer blinked hard as he shook his head. “Honey, I didn’t—”

“We’re just friends.”

“I know that but—”

“It’s an expression.”

Lucifer blinked a few times again, and with each blink he lost more and more tension in his brows, his shoulders—even his lips parted, perhaps to say something, perhaps not.

You and Vox were frozen halfway through the door so Lucifer kicked him in and shut the door quickly to leave you and himself out on the street.

“Why didn’t you tell me where you were going?” Lucifer asked, and it was like he placed a pillow to your head with the way his tone softened. His thumb had somehow ended up stroking soft circles on the back of your palm as he held your hand.

Vox stayed inside but his prying eyes stared through the glass nonetheless. He crossed his arms.

“Don’t look at him, darling,” Lucifer consoled with a lowered voice. He delicately took your chin and pivoted it back to him. “Look at me.”

“Look, can we talk about this back at the hotel?” You asked, but with the tone you used, you were teetering on the edge of pleading. “I’m … I’m sorry.”

“Oh, honey,” Lucifer cooed, tucking away any small pieces of hair that hung over your face. “Of course we can.”

All you could do was give Vox a weary glance before you ducked down into Lucifer’s car and disappeared in the distance.

.

The ride back had not been short of thick silences that hung in the air. Everytime you looked to him for some sort of emotion, there was nothing for you to read; his complexion was a still pond resting under the moon’s grace. Not even anger bubbled up the surface—and this is solely based on your assumption of what he must have been feeling, because he was a blank page. It’s only reasonable. 

Lucifer stopped at the newly built hazbin parking lot but didn’t pull out the key.

He looked at you expectantly, turning even his upper body to face you. 

You bit your lip.

“You don’t wanna go inside first?” A squeak of a voice was all you managed.

“I don’t want Charlie to see us upset,” Lucifer reasoned solemnly as he frowned at the floor before he returned his attentive gaze to you. “Whatever it is, I’m sure we can work it out in here.”

“I’m … ashamed, okay,” you exhaled, folding your arms over your chest as you slouched forward. “I’m in hell for a reason. I know it looks bad but I’ve known Vox since he was alive. And I still believe in Charlie’s cause! I’m doing better … you know that, right?”

“Of course, I do, sweetie,” Lucifer blurted immediately, holding your arms like he was the glue to keep you from crumbling apart. “But why did you … did you think I wasn’t going to understand if you had told me?”

“Yes,” you admitted. “Even I wouldn’t have understood if I were in your shoes. I mean, I act like a completely different person around him. And I know what Vox has done, trying to send in Sir Pentious as a spy. It’s horrible. But he wasn’t always like that. Or, maybe he was but—never with me.”

“Honey, I trust you more than just about anyone in this hell. And fuck, that’s difficult in this side of the world, right? I mean—I just … you had me thinking the worst. Well, maybe not the worst but—”

“You thought I was cheating on you, didn’t you?”

“No, never,” Lucifer denied immediately as his eyes widened but his brows furrowed. “I knew it was some kind of mistake. I know you’d never do that to me. But you know … catching up with an overlord like it’s a regular tuesday still raises a few questions if—”

“I know that. I’m sorry. I should have told you. I’m sorry,” you repeated rigidly, curling into yourself so much that your head landed on his shoulder as he still held your arms. 

Lucifer pulled back to hold your face by the cheeks, and you didn’t struggle against him as he pressed his forehead on yours, his hat tilting up to accomodate you. 

“How about a kiss and we’ll call it even?” He smiled, and you felt his warmth spread to your cheeks.

You grinned back. “Okay.”

You tilted your chin up and gave him a kiss, and both of you had sustained it longer than either of you had expected. Your hand cupped his own over your cheek. 

Your lips finally parted, but not much before you both reconnected again, then again, and the third time your mouth was a little more open—and Lucifer’s tongue slithered inside. 

Your tongue met his, and they rolled over each other every time you kissed him. A few more kisses, and suddenly you were biting his lip lightly. He chuckled.

“I can see you’re eager to make it up to me, princess,” he said in that voice he knew drove you up the wall.

“I am,” you hummed, a little more innocently than you had intended. 

“Well, what are you gonna do?” He asked, genuine curiosity brewing in a higher tone.

You slipped away from his flowerbud grasp and pulled the lever of your seat. The backrest declined all the way backwards, and you laid down comfortably while your thumb slid under your dress and hooked around something that was already mildly damp.

“I’m gonna sit back …”

You chuckled as Lucifer’s eyes followed your every movement like a moth to a lamp; he followed the way your underwear slid down your knees before you folded your legs up to your chest to fully rid yourself from the garment. You tossed your underwear in his face before he could get a good view of what he’s getting himself into. 

He shook his head in a jolt, crumpling your panties and stuffing them into his pocket anxiously. But by then you were modest again, with your dress covering your thighs but still riding up dangerously high. 

“And let you decide the rest,” you finished in a thin breath.

“Goodness, okay, woo! Okay—” Lucifer sputtered and fanned his overcoat as he averted his gaze. It didn’t last long when his gaze gravitated towards your core that had been concealed but outlined your dress.

You bit your lip. “Well?”

Lucifer’s shoulder emerged from his coat as he shrugged one side of it off, and your gaze magnetized to the view as it slipped down him like a snake traversing down a tree. 

He planted his knee on the closer edge of your seat and it didn’t take long for him to shift your legs closer together, allowing space for his knees on either side of your thighs. Though, steadying himself naturally had his chest protruding as he held onto the car ceiling for support. His muscles peeked through the folds of his dress shirt, and the same can be said with his chest under his waistcoat. But that—that was no complaint. 

He finally fell to you with only his forearms to keep him up. His eyelids sank, his gaze indecisive between your eyes and your dry lips.

He settled on neither when he ducked below your jaw and planted kisses along it before he strayed downwards. 

The spaghetti string of your dress slid down your shoulder the more your squirmed at Lucifer’s nibbles. You knew the moment he caught sight of this because he hesitated for a tenth of a second. 

He grinned. He took it between his fingers delicately and slid it down further. 

“Whoops,” he grinned. 

Glossy silicon mocked him as it peeked out from what had been peeled off you. 

“Luci, careful with that, I’ll need to put it back on later—”

Lucifer tore it off you anyway, tossing it to the back with his overcoat. “I’ll give you my coat when we go in, you’ll be fine.”

“Luci!” You laughed as he did the same with the other, your nipples stiffened from the cold air of the car. 

Lucifer sat on your pelvis, his hands traveling under your boobs to cradle them. 

You both have had sex multiple times together, and yet every time he removes undergarments off you, he enters a dazed trance like it was something new. Something to bask in the wonders of. 

He massaged your breasts gently, and it didn’t take long before he ducked down and had his lips wrapped around one of your nipples, one hand twisting and playing with the other.

A noise bubbled in your throat but you held your breath and bit your lip. Watching Lucifer hadn’t been any help; he cocked a brow at you, and a cheeky grin still made its way to the red circles on his cheeks as he quicked his tongue’s flicks against you. You gritted your teeth, a squeak making it past your lips. 

His hand abandoned the other nipple, but before you could whine in protest a new sensation rose in your lower stomach as Lucifer shifted his entire body further down.

His fingers had already been deep beneath your folds, your clit sitting pretty between as he pinched it and rubbed it in his grasp.

“Luci … fuck …”

“Atta girl,” he chuckled. Hell, you hated just how raspy his voice gets when he’s worked up. That by itself had been a leg-opener all on its own. “That’s it. Let me hear you sing.”

Your legs flinched at the jolt of pleasure his fingers brought, and Lucifer took this opportunity to lift the hem of your dress for easier access—and perhaps, a pretty view.

Every so often, he’d bring the threat of pushing his middle finger past your walls, but through the haze of pleasure, it was impossible to read his intentions when he easily could have been using your juices to lubricate his ministrations on your clit.

It had been like the wave of a wand, the way his free hand undid his tie. It dangled loose below his collar that he used to straighten out so diligently; something once so clean soon turned into a crumpled mess in your name. 

His wrist pivoted down to the buttons on his waistcoat. The faintest flick of his thumb and suddenly his waistcoat hung dead on his torso before he rubbed faster on your clit, making your squeal. 

Cold air brushed past your arousal at the sudden absence of him, and your walls throbbed against each other in response; they bruised and ached and when Lucifer turned down the brightness of the car light, it was all you could feel besides the leather your nails were sinking into.

“Luci, please …”

“Please what, honey?”

“It hurts,” you whined. You didn’t mean to, and in fact a burning sense of shame rose up to your neck and cheeks as sweat tore through the pores on your forehead but all you could do was grab his hand.

“I’m coming, daddy’s coming.”

A slow zipping sound ensued and just as quickly, the head of his erection pressed into your folds and your dripping walls pushed back from the pressure.

You moaned and grabbed Lucifer’s shoulders out of raw instinct, which brought him closer to you. 

“You want it all, princess?”

“Yes, fuck yes,” your mouth sagged numb from having to carry your writhing heart in your throat. The vulnerability of his skin on yours, the way his head was just so warm compared to the cold air earlier—your pussy throbbed once more.

 “Are you sure?”

“Please please please Luci I can’t—oh! Fuck!”

He pushed his length into you, your neck arching back as you grabbed a fistful of his shirt from where your hands hung around his neck.

Your throat clogged with the embarrassing sounds you knew you would have let out if you had no restraint left. You closed your eyes, knowing well that they were halfway to the back of your head. 

Your stomach seemed to make way for his size in you, tossing and spreading the ache to your limbs as your entire body steeled to accommodate him and the space he filled in you. 

“Are you okay?” He asked. 

You nodded, and a hole punctured through your throat as you sighed shakily. “Yes, god—” 

“Don’t say his name,” Lucifer breathed, his hand soft on your neck as he looked at your lips then back up at you. “If you have to say someone’s name, let it be mine.”

“I’m sorry.” Was the first thing your brain conjured, and the only thing you could utter when all else in there had been undone. 

Lucifer kissed your jaw. “Don’t be sorry baby.”

He took your lips in his, his forked tongue brushing past your teeth once more. “Don’t be sorry.”

It was barely considered movement when he pulled out less than half his entire length and pushed in gently, as if you were something fragile he couldn’t afford to drop. You bit your lip and hummed at how smooth he slid into you, how your juices coated him beyond what was needed. 

He pulled out quickly but reentered languidly, like a wave finding its way to shore your core clenched at the nerves that tingled in you, the bruises almost sated in what it yearned for as he thrusted again, and your heart spewed.

“Fuck, if you make a sound like that again I don’t know if I’ll be able to control myself,” Lucifer panted. “You’re so pretty, it makes me tremble.”

You reached up to give him another kiss, tilting your head along with the circles spinning in it. “Do whatever you want to me. You deserve that much.”

“Yeah? Well, I want to treat you like fucking royalty. Savor every inch if you,” Lucifer hissed through his pleasure. A choked moan left you, causing Lucifer to smile. “Yeah, see? Just like that princess. Fuck, taking me so well …”

With how soft his thrusts were, pressure subsided into more liquid pleasure that sloshed over your nerves. They lit up like christmas lights in your brain as you both moved in tandem to Lucifer’s pace. 

A fire had started at your nape from the body heat that had nowhere to go, sweat dripping from your hairline and paving wavy lines of hair that caused your forehead to glisten. Your collarbones warmed up in a different way, Lucifer’s hot breath filling the space between the both of you. 

His thrusts grew anxious over time, but his hips never once hit your ass which might have scalded your stomach further; the fact that this man possessed an iron grip over his control in his strokes, he had been careful not to taint you—he only took from places he knew both of you would be enraptured in—and absolutely nothing less. 

“Honey, I can’t—” he hissed through gritted teeth as his fingers curled in your hair. His eyes wandered down to how your breasts bobbed to his strokes. He moaned your name, and if the car hadn’t been shaking from Lucifer’s rutting, it shook from the way he proclaimed your name and dropped his head like he was bowing to a god. “Holding me so tight—you worried I’m gonna let go, sweetie?”

“No—ngh! You just feel so good I c-can’t!” You yelped in time with each thrust that followed. “Luci, I—fuck!”

His head perked up, just like the bundle of nerves in that oh-so familiar spot. An old friend. 

Lucifer gave a determined grin, sweat trickling down his cheek as he paused to wipe it away. 

“Well, hello,” he greeted in a low sultry voice.

He resumed fucking you, but this time he had you screaming his name as his length rubbed up against that spot your body purred to. You shivered and your walls clenched, causing Lucifer to falter.

“F-Fuck, that’s it, good girl,” he grunted in between controlled thrusts that had your gut squeezing. He never once missed. 

When your walls fluttered, Lucifer chuffed through his teeth and through the fog of your satisfaction, you indulged in the smell of cotton candy sweat. 

“You’re close, princess, so close, I can feel it.”

You gritted your teeth with whatever strength you had left, even your hands had begun to slip from Lucifer’s shoulders. 

 “You?” Was all you could manage. 

“Me? Baby, seeing you like this has me fucked out,” Lucifer huffed. “Shit!”

You squeezed his shoulders before he could pull out.

“In me, Luci!”

He froze, shaking his head to wave away his own daze to focus on you, the things your … request entailed. 

“Darling, I don’t have a condom on,” he whispered as the inner corners of his brow quivered. 

“You’d make beautiful fucking babies, Luci—I wanna carry them.” Your voice had been obliterated from the sounds Lucifer had fucked out of you. Wispy breaths was what it had become—but the red in your cheeks and your weakened yet felicious state made Lucifer smile.

“You’re not thinking straight,” he said your name and it was nearly enough to get you back down from the clouds. “C’mon, honey …”

“Luci …” you whined. “You’re so goddamn hot when you’re being responsible …”

“Yeah?” He laughed softly, cradling your cheek in his hand. 

“Yeah …”

“Let’s finish you up, okay?” He reached up to kiss your forehead but you squeaked from the fact that his length slid deep into you in the process. “Ah, sorry—”

“Don’t be sorry, baby,” you quoted him from last time, and his surprise melted into a warm smile instead. “Please fuck me.”

“As you wish.”

You screamed brokenly as he continued his ruthless pace from before, and he remembered the exact angle to hit. Your nerves were about ready to jump out from your body as you skyrocketed back into the clouds, your orgasm coming sooner than you could warn him. 

“Cumming!” He gritted through his teeth as his horns shot up from his head and you both came together with Lucifer’s cum hitting your dress instead.

Your head hung off the car seat’s headrest. Sweat shimmered on the leather you laid on, and your legs trembled from how long they’d been held at the same position. The only thing you two shared now was open-mouth breaths. You thought of moving, but your muscles were well past its limit to even be lifted.

Lucifer twisted around to grab tissues from the passenger seat compartment. In just a few seconds, he wiped out most of the evidence of himself on your dress. By this time, his horns were long gone and his eyes had returned back to its original form.

“Fuck … I didn’t think this through …” Lucifer grumbled to himself as he hit his temple with his palm. He ran his fingers through his hair before he mustered a weak smile for you. “Wait here, I’ll grab your clothes from your room.”

You exhaled audibly as he vanished with a swirl of sparkling red smoke. 

A few breaths of silence by yourself wasn’t ideal, especially when you felt the whine and ache of your limbs in the fact that you were as good as scattered leaves across autumn grass. 

Just then, your phone buzzed from the cupholder.

You winced as you bent to take it.

Brat >:)

you better not be fucking him right now i swear to FUCKING GOD [ 13:06 ]

you disappear for years and suddenly you’re back and you’re telling me YOU’RE DISAPPEARING AGAIN?&2$:$$3;: FUCKING [ 13:05 ]

HELLO? THE FUCK [ 12 :57 ]

i’m not gonna let even the king of hell himself keep you from me [ 12:16 ]

because i am not done with you yet [ 12:15 ]

bitch you better show me whatever the fuck you wanted to show me earlier before daddy decided to whisk you away like some fucking fairy tale prince [ 12:15 ]

You chuckled as you swiped the notification.

You [ 13:06 ] : bitch you know the dick is good cmon now

Vox [ 13:06 ] : i mean this in the most platonic and murderous way possible, i will fuck you myself if that’ll get you to ACTUALLY BE A FRIEND AND VISIT ME INSTEAD OF DISAPPEARING FOR YEARS

Vox [ 13:06 ] : i already have to deal with the heartbreak of al

Vox [ 13:06 ] : ykw doesn’t matter THE POINT IS THAT YOU ARE THE SHITTIEST FUCKING FRIEND AND I MISS YOU IS THAT NOT REASON ENOUGH

You [ 13:07 ] : okay, okay, how about this sunday then lmaoo

Vox [ 13:07 ] : you better fucking believe i’ll be blowing a fucking hole through that radio prick’s hotel just to pick you the fuck up asshole

You [ 13:07 ] : if i didn’t know any better vicky i would have assumed you’re actually coming to pick alastor up HAHAHAHAAHAHAH

Vox : ( typing … )

Your phone levitated out of your hands and when you followed where it zipped off to—

“Luci!” You sprung up from the declined backrest in surprise.

Lucifer squinted at your phone as he swiped his thumb down on your screen.

“First of all, I’m honored that you’re telling people how well I pleasure you. Second of all,” Lucifer paused, leaning into you as he used his free arm to hold himself up to you. “Vox is in a world of hurt if he thinks I’m gonna let him lay a finger on you.”

“Yeah?” You copied the way Lucifer says it and watched as his face reddened.

You noticed your spare clothes on his lap and you lifted the dress over your head and discarded it on the floor of the backseat. 

You held out your hand for Lucifer to hand you your clothes.

He simply looked at your hand, then back at your naked body, then back at your hand as took it in his own.

You laughed. Hard.

“What—what’s happening why’re you—”

“The clothes, baby!” 

“Oh—Oh! Right! Shit!” He finally handed you an oversized shirt, fresh underwear and a pair of shorts you used to at-home wear. “I thought you were asking for another round or something, holy shit—”

“I mean …” you smirked. 

“Honey …” Lucifer warned, as if trying to keep a predator from attacking. 

“Oh? You don’t wanna? My bad,” you replied innocently. “I was just wondering if Vox was free tonight—”

“I know you’re trying to get a rise out of me but honey …” Lucifer trailed off as he flipped your phone and shoved it into his back pocket. 

He crossed over to your seat once more and pinned you back down where you once were, one knee pressed on the side of your seat as his hands ended up on either side of your neck.

“I hate to remind you that I am the fucking devil,” his voice dripped with a poison much worse than what you’ve heard from Alastor’s static. His horns hadn’t sprouted out yet but with his eyes aching red, it wasn’t too far from reappearing. “And if you love me as much as I love you then there is no goddamn way in this realm I am sharing you with anyone else let alone some overlord who thinks Alexander is worth anyone’s fucking time.”

“It’s Alastor and—” you paused, combing through your hair idly. “Luci, Vox is only a friend from the living world—“

“A friend who thinks he can fuck you.”

“He’s in hell for a reason.” You crossed your arms.

Lucifer sighed and closed his eyes, the red dissipating from them once they reopened. 

“Listen, honey, I—” Lucifer’s gaze lifted away from you for a moment, almost like he’d been overwhelmed with the words clogged in his throat. “You’re someone I can’t afford to … mess up … again. And I know that means simply letting you be. But also, I’ve just—I’ve lost so much, and I only just got Charlie back so I …”

You lifted your arm as your hand fell on his cheek, your thumb softly stroking him back and forth. 

He closed his eyes, letting out a shaky breath as he placed his hand on yours. 

“I know Vox is just a friend. And I know it’s insane to think I’ll lose you to him, but … at the end of the day, this is hell. He still mocks the very thing we’re trying to achieve and I get that you’re not like that and that you’re not easily manipulated but I just …”

“Luci …” you muttered. You sat up and kissed him chastely on the cheek. 

“I think about losing you a lot. I think about it to an irrational degree. So it’s not actually something you can fix. It’s something I have to do on my own.”

“Even if that’s true, I can still do my best to be with you and make sure you feel loved everyday. I really was a dick today, I had no idea you were … I’m s—”

“It’s okay. We …” Lucifer chuckled weakly. “We made up, remember?”

“Yeah,” you smiled. “Luci … you know I love you, right?”

“Like the sun loves the moon,” Lucifer said. 

And you knew where it came from, maybe not its exact whereabouts but just how deep it was embedded to him, that statement; he himself had witnessed the creation of the sun and the moon. He knew the tides the two shared, the way their yearning for each other’s pull had been the natural way of things, the only way the people could ever experience day like they do night.

I know you love me because we love like it’s fate.

.

You and Lucifer walked into the hotel, your back slouched with Lucifer’s overcoat hanging over your shoulders as you folded your arms beneath them. 

“Hey Charlie,” Lucifer greeted, and he told her daughter who was already making her way to you that you weren’t feeling well and that you needed rest. Of course, Charlie nodded and resumed her activities with her other friends. 

You retired to Lucifer’s room, the left side of the bed while he took the right.

“I love you,” your chest exhausted what it had been used to holding for him, until you saw him.

“I love you, too,” Lucifer hummed back, a sigh escaping him like cherry blossoms in the wind. 

“I love you for the soul you are beneath your bones.”

[sir-kettle-of-countertop]

So, I saw a post circulating here about the “extinction of birds in 2023“, with this picture attached

My, what a bold claim! All these poor birdies, “went extinct” in just one year alone? Why would such an outrageous, depressing and catchy claim be spread around? Let’s fact check it.

All the species listed, Bachman’s wabler (Vermivora bachmanii, 1988 or 1980s), Kāmaʻo or large Kauaʻi thrush (Myadestes myadestinus, 1989 or 1987), Bridled white-eye (Zosterops conspicillatus, 1983 and 1983), Kauai ʻakialoa (Akialoa stejnegeri, 1969 or 1960s), Kauaʻi ʻōʻō (Moho braccatus, 1987 and 1987), Kauaʻi nukupuʻu (Hemignathus hanapepe, 1899 and 1899), Maui ʻakepa (Loxops ochraceus, 1988 and 1988), Kākāwahie or Molokaʻi creeper (Paroreomyza flammea, 1963 and 1963), Maui nukupuʻu (Hemignathus affinis, 1896* and 1996 ) and Poʻouli (Melamprosops phaeosoma, 2004 and 2004) are all, indeed, either extinct or possibly extinct, according to IUCN Red List of Threatened Species and U.S. Fish and Wildlife Service.

What are the dates after the scientific names? Well, those all are *last sightings* per IUCN Red List and USFWS accordingly. So, these birds were not seen for DECADES and in one case FOR MORE THAN A GODDAMN CENTURY. And sure as hell there is NO information about them very suddenly being gone all last year.

What’s the deal then? Where did this claim even come from? Well, likely from this article "21 Species Delisted from the Endangered Species Act due to Extinction" from U.S. Fish & Wildlife Service. It includes all the birds in the picture (with the last date of sight, listed above).

From the article: “The U.S. Fish and Wildlife Service is delisting 21 species from the Endangered Species Act due to extinction. Based on rigorous reviews of the best available science for each of these species, the Service determined these species are extinct and should be removed from the list of species protected under the ESA. Most of these species were listed under the ESA in the 1970s and 80s and were in very low numbers or likely already extinct at the time of listing.”

They didn’t ALL fucking suddenly drop dead all in the same year – if they did, as some other people have already pointed out, there would be an uproar EVERYWHERE. Ornithologists alone would not let it live down. They were officially delisted from endangered status by U.S. Fish & Wildlife Service that year, there was a proposition to do so back in 2021, too. Some were already declared extinct before by IUCN.

Despite not being seen for so long, they remained on the list of critically endangered for a long while, cause you cannot just immediately declare a species extinct. There’s no RTS unit amount number that goes to 0 once there’s nothing left; people keep checking for them over and over and over again. Sometimes it turns out that a species previously thought to be extinct is actually still out there. Attenborough's long-beaked echidna for example was last sighted SIXTY YEARS ago before being sighted again in 2023. It was thought to be extinct for a while, before 2007, when signs of its activity was spotted again. More often than not though, a species turns out to be actually very extinct, unfortunately – like in this case. I cannot possibly know if the creators of this picture, or people that spread it on social media ever had good intentions behind it for awareness, however even if they did, it turned out to be nothing but very blatant misinformation, with a fearmongering effect. The only thing this achieves is not awareness of habitat destruction or pernicious tourist influence or climate change or what have you – the only thing this achieves is despair and panic. People already so casually fall into complete doomerism, they’re very used to hear bad news. And guess what doomerists do? Typically nothing. It renders people helpless. It’s not gonna make people get up and be ready for action, it, at best, would just make people feel sad and/or angry, or at worst, feed into the current alarming rise of ecofascism. NOTHING good comes out of this. At the very goddamn least, no one needs to lie to promote a goal.

The aim of the USFWS article, on the other hand, IS to make people aware about those animals that are already gone from the face of the planet, no matter how long ago, and that now we have to protect those animals that are critically endangered and still out there – to not have to repeat those tragedies.

Be very critical of what you see on the internet, especially if it’s sited with no sources. Especially-especially if it causes a strong emotional reaction. Lies and misinfo could only hurt the cause, no matter how noble. And please, be aware of your local wildlife status. Check in with it accoding to trusted sources.

[*sic, possibly a typo and it was meant to be 1996, other confirmed date listed there is 1989] Addendum: I could not for sure find the uncredided (who woulda thunken that ppl that don't cite their sources would also not credit the artists) author(s) of the bird illustrations. If someone finds them, please, let me know! Edit: Huge thanks to moosefinch for finding the sources for the artwork! I'll add their contribution below:

"Image sources!

The Kauai ʻakialoa, Kauaʻi ʻōʻō, Maui ʻakepa and Kauaʻi nukupuʻu are from Birds of the World.

The "Maui nukupuʻu" and "Molokaʻi creeper" illustrations are also Birds of the World, but are actually a female Kauaʻi nukupuʻu (the other being the male) and Laysan honeycreeper/Laysan ʻapapane respectively.

The bridled white-eye is by Lauren Helton according to this source.

Bachman's warbler is by Lynn Hawkinson Smith/smithhouse2 according to this Etsy listing.

The Poʻouli is by Christina Czajkowski."

[hazelfoureyes]

Ok I need a Lucifer x Reader fic based on Griftwood by ghost pretty please ( just listen if you haven’t heard it you’ll understand)

Listen, I went the opposite direction I think you wanted? Lol gonna work on brevity and get more snack sized smut out on weekdays and entrees on he weekends

[Warnings/Promises: snack sized, Lucifer x GN!AngelReader, lil smut smut, Fuck Sera, Luci corrupts absolutely, all hail dat dick, sacrilegious as fuck]

🫸🏼minors DNI🫷🏼

Lucifer avoided the heavenly embassy for obvious reasons. The vast halls, the empty and useless pews, it was, in a word, 

“Creepy,” He hissed. 

He was surprised to find the reception desk manned. Very rarely did heaven actually send anyone down to hell. Oh, wait.

You were stunned already to see Lucifer, so when he poked your nose you let out a tiny squeal.

“Oh shit! You’re real!” Lucifer took a step back, “Sorry about that! Not used to an … actual person.” He gave a little bow, “Forgive me?”

The fact is no one wanted to go to hell for desk duty, so the job was actually a punishment reserved for the most misbehaved. You had to intentionally set fire to Sera’s robes to get that severe of a scolding. She was reluctant, but it had been threatened (promised) to you last time you (intentionally) caused trouble. Rumors were abuzz about Lucifer, and you just had to see for yourself what the Great Big Boss of Hell was like.

Rosey cheeks, bright sharp smile. He didn’t look as scary as you had imagined. You expected a seven foot eight inch tall behemoth with fire pouring from his mouth and blood stained horns.

The devil, the real one, looked quite sweet.

A tiny existential crisis washed over you. Maybe there was a reason they didn’t want people down here. Why they made it sound oh-so-terrible.

“You still in there?” He leaned over the counter, tapping at your forehead. Your hands flew up, capturing his finger and bringing it down.

Warm. 

He froze, a little shocked you would touch him. Your smile went crooked, cheeks blushed. 

“Uhhh you good?” He pointed with his free hand to where you still gripped his finger. You nodded, a hum of confirmation. The blush rose up until you were fully red in the face.

The realization struck Lucifer like heavenly lightning, “Oooh, I see what’s going on here.” A wicked smirk taking you by surprise. “Did you want to meet me, little one?”

You broke out into a sweat, “Yes.”

Lie! Why didn’t you lie?!

He leaned over the counter, “Did you do something bad to get sent here?” Was there fire behind his eyes?

Uneven breaths, “… yes.”

Lucifer’s knee came up and over as he crawled onto the desk, “Should the King of Hell reward you for such bad deeds?” His eyes had gone red now, your hand still on his finger.

Your knees began to shake, “Y-yes.”

His face was inches from yours when your legs gave out, both of you falling to the floor.

Horns tall, yellow pupils dilated as he straddled you. “I think you’ll find I’m a generous ruler.”

It made sense. As Lucifer bent you over the reception desk and fucked you from behind, you could completely understand why they made this job posting sound horrid. Heaven would be empty if every winner could freely interact with Lucifer. You’d damn humanity too, if that was the cost. His hips snapped against your ass with divine determination, sweet praises on his forked tongue. 

The sounds of your gasps and his skin on yours echoed through the pristine white and gold halls. Like a pastor giving his sermon, he made the most delicious promises as you bent at the altar. 

Could heaven hear you? Your chants of “God, Oh God,” shifting to, “Lucifer! Luci—fer”, when one of his hands came down, fingers stroking your heat?

“What do you pray for, my curious Angel?” He growled, a flame you couldn’t see licking past his lips. “I’ll grant you anything”

Your cheek was sliding across the marble, small line of drool smearing on your face. Claws raked down your back, the stimulation making you shake.

Your fingers reached for his thighs, failing to take purchase. Lucifer took both of your wrists in one hand and held them at the small of your back for leverage. Your legs bent up, toes curling as you came around his sweetly punishing cock.

Taking a few deep breaths, you rolled your hips back against him, “More.”

Lucifer laughed and lifted one foot onto the desk to add more force behind his thrusts, “Say please.”

am I too horny? No. No, the cardiologist is wrong.

╭──────༺♡̶༻──────╮ Masterlist ╰──────༺♡̶༻──────╯

∰ Summoning the Horny Little Deer Cult (general tag list): @cxrsedwxrlds , @nonetheartist , fizzled-phoenix , @tsunaki , @janchei , @wettiny-in-smutland , @moonmark98 , @hoebihoeshi , @fjorjestertealeaf , @pansexual-opera-house , @ive-no-idea-what-to-call-this , @roxxie-wolf , @polytheatrix , @lorddiabigmommymilkers , @backinthefkingbuildingagain , @harley2223-blog , @coffee-colored-hopeless-romantic , @poinappel , @midnightnoiserose , @spookieroz , @missmidorima , @phobophobular , @ivebeenthearchersstuff , @downbadforfictionalppl , @xx-all-purpose-nerd-xx , @sleepylittledemon , @aether-th3-enby , @dontfuckbutimfab , @surusurusuru , @breathlessaura , @aperfectidiot , @certainlygay , @jth12 , @star-kujo-platinum , @ivebeenthearchersstuffn, @rubyninja1 , @simphornies , @mariaclarade-la-cruz1 , @whateverlololo , @alleystore , @readergirlstuff , @berry-demon , @simplyonehellofanotaku , @chirimeimei , @fairyv-ice , @olive-frog , @thonethatflies620 , @tiredkiwiii , @ilikemyteawithmilk , @whateverlololo , @xixflower , @i-am-nonbinary-bean-deal-with-it , @psipies , @howabouticallyou , @a-case-of-attachment , @multifandomfanatic02 , @watereddownmilk , @raynerrold , @crazii-saber-wolf , @valkyrie-expeditions , @bontensbabygirl , @sillyb0nez , @oo0lady-mad0oo , @jazzmasternot

[vngelicc]

⊹₊ ⋆ “that dick make my soul smile,”

TAGS — creampie, fingering, slight degradation, dirty talk (LOTS), jk’s a sleazy mess at first, oc is done, mamas is stressed out, rough sex, jk rocks her shit 💀, some praise here n there, jk’s affectionate tonight, sex tapes r mentioned again, shower sex(?) not rlly, possessive!jk, breeding kink, never ending saga of jk saying “mama” or “ma”

WORD COUNT — 2.6 k

“Trash, trash, trash,” you mumble to yourself while you sort out the mail in your hands, “oh definitely trash.” You sigh and shake your head. You’re knocked out of your thoughts when you feel a pair of arms wrap around your middle and pull you back, “What the hell–” You hiss in surprise.

“Hey mama.” Jungkook’s stupid voice comes from behind, you already know he’s sporting a stupid grin on his fucking face. You shove his arms off and turn around to look at him with an annoyed glare, “Oh c’mon don’t be like that, aren’t you happy to see me? You weren’t mad at me like this yesterday when you had my head between your–” You quickly reach up to cover his mouth and look around the empty hall.

“Are you insane? There’s people around, Jesus, you don’t have any shame do you?” You side eye him, “First off,” you shake your head, “what are you doing here? I didn’t text you and Jiho didn’t ask, so why are you here?” You give him a look, “And if you’re looking for Jiho you’d know he’s on a camping trip with his cousins.”

Jungkook raises his hands in surrender, “Can’t a man come see his baby mama anymore? Shit you suck the fun out of trying to surprise you baby,” he shakes his head but you know, Jeon Jungkook isn’t fooling anyone and certainly not you.

“You forgot, didn't you.” You scoff, “Of course you did, what else did I expect? This camping trip is all Jiho talked about last week and yet you still manage to forget that because you’re thinking with your other head.” You roll your eyes and turn to unlock the front door, “Sometimes I wonder what Jiho even fucking sees in you, you’re a deadbeat Jungkook, a deadbeat.”

Jungkook chuckles, “To be fair my other head is the reason you get a good night’s sleep.” He says with a smirk on his lips as he stands there admiring the way your ass looks in that tight pencil skirt you’re wearing. You turn around to shoot him a glare but say nothing else and simply step into your apartment. Jungkook leans against the doorframe with both arms raised, “So, you gonna let me in sweetheart?” He licks his lips, poking his tongue out to push at his lip ring.

You look into his eyes and then down at his lips, “Well?” You shrug your coat and slip your heels off, “You gonna stand there all night or what?” He chuckles quietly and slips into your apartment, shutting the door behind him.

“This is new.” Jungkook comments, “Don’t remember you ever smoking.” He inspects the ashtray with a noncommittal hum.

“It’s not just for me.” You say uncharacteristically calm, “I bought it for you, figured you needed one since you love leaving a mess on my patio.” You don’t miss the way he smiles fondly at you, “Don’t get too excited dipshit, I smoke too, don't forget that.” You scoff and disappear down the hall.

Jungkook whistles under his breath and follows after you, “I didn’t say anything ma,” he kicks your bedroom door closed and settles himself over your bed, “what’s up with you? You’re not being your usual angry self.” He watches you go around your room putting things away and picking out your clothes.

“I’m tired Jungkook, I had two meetings back to back and all I wanna do is come home to shower and sleep. Can’t do that because you decided to come bother me at this fuckin’ hour.” You mumble and then throw a pair of panties at him full speed, “Don’t think I didn’t see the shit you posted either, you’re not funny.”

Jungkook throws his head back with a laugh, “Really? Cause I thought it was hilarious, I think it perfectly describes us.” He cheekily grins at you with that dumb lovestruck look of his.

You stop to give him an exasperated look, “Jungkook,” sigh, “telling people you’re always fucking your baby mama regardless is not funny, neither is saying ‘I fuck her when she mad at me.’ You’re a child.” You shake your head. You throw more clothes onto the bed and grab your robe and towel, “Don’t make a mess in my house Jungkook, I’m not in the mood tonight.”

Jungkook watches you with a pleased smile, “I won’t.” He reaches for your tv remote, “I’ll be rightttt here, sitting like a good boy for you ma.” He winks, “You just go ‘head and shower.” You eyed him suspiciously for a few seconds, he kept smiling goofily so you ended up walking away with no words.

You know he was up to something with the way he kept smiling so stupid. You grumble under your breath and hope he just doesn’t cause you to have a fucking aneurysm or something. You swear this man was going to send you to an early grave at this point.

Everything sounded pretty quiet out there, you heard Jungkook get up at some point but you figured he was going to smoke or get something. He even left the TV on, which you were grateful for because you didn’t do too well with silence. “What are you doing..” You mutter with closed eyes, just enjoying the hot water running down your exhausted body.

You were in the middle of reaching for your loofah when you heard the glass door open and Jungkook step in after you. “Pass me that bottle over there.” You softly hum.

Jungkook whistles softly and tugs you back into him, “Relax baby, let me do all the work.” He says in your ear, “I got you..” He gently pries the loofah out of your hands, “Worked so hard this entire week, baby deserves to rest.” He squirts some of your body wash onto the loofah. You don’t correct him because that’s true, hell you deserved this princess treatment for putting up with his ass too.

He gently ran his hand over your body, lathering your body up in the soap suds leaving you smelling like strawberries. He doesn’t try any funny business surprisingly, when he finishes he puts his hands on your shoulders and begins massaging gently. A quiet moan escapes your lips as relief rushes through you, “Damn you’re stiff as shit here.” Jungkook comments.

You lean your head back on his chest with a closed eye smile, “You’re finally being useful for once.” You chuckle.

“What are you talking about? I fuck you plenty baby, far as I know this dick makes you fall asleep faster than the fucking melatonin you take.” He laughs, making you laugh a little too. Jungkook lets your shoulders go and wraps his arms around your waist, tugging you backwards so your back is to his front. “Got you something special.” He mumbles into your shoulder.

“Did you now?” you huff in amusement and gently stroke his arm, “What did you get hm?”

“Nothing much, figured you needed a night in so I ordered some fried chicken and soju.” He lays gentle kisses over your shoulder and buries his face in your neck, “I set up a movie to watch too.”

You turn your head to face him, looking into his eyes before smiling softly and pressing a gentle kiss to his lips, “Thank you. Guess you’re not a dipshit afterall.” He laughs at your words and you ignore him, opting to press your lips against his once more. Jungkook welcomes you, his fingers dance across your tummy and inch downwards causing your breath to hitch in excitement.

Jungkook’s lips wetly smack against yours, muffled grunt leaving him as he holds you tighter against him. The kiss initially started off slow and more controlled, now it’s wet and messy with sloppy noises filling the space between you two. You pant into his mouth and your eyes flutter open to look at him pleadingly.

Jungkook grins softly as he pushes you towards the glass, “There you go baby, let loose for me, I’ll make you feel so fucking good.” He has you pressed right up against the glass, tits smushed and hands on either side of you. You bite your lip and push your ass back against his thick cock, it’s hot and throbbing against your cheek making you all the more eager to get it inside of you.

“Look at you, pussy’s drooling all over my cock,” he bites his lip and swipes his cockhead through your dewy slick folds, “hear that? ‘s your pussy callin’ out to me baby.” He pushes in slightly, letting the tip pop in with a lewd squelch.

Your lips part in a breathy moan and you push back for more but he stops you with a gentle hand on your hip. “Not here baby, relax for me.” He says as he lets his cock slip out, “Gonna fuck your pussy with my fingers first, get you nice and stretched out before I fuck you with my cock.” He cups your pussy in his hand and lets his fingers slip through the mess dripping from your folds.

Jungkook takes his time opening you up, slipping his middle and then his ring finger into you until they’re knuckle deep. Your mouth falls open but nothing comes out, this is exactly what you needed after those long hours in the office this entire week. Jungkook does not disappoint when he begins pumping them in and out slowly, making sure he hits every nook and cranny inside of you.

“There we go,” Jungkook whispers and begins kissing down your neck, “doing so good for me mama,” he sucks a hickey into your skin, “let go for me.” He nibbles on your earlobe and uses his other hand to wrap around your throat, not choking–simply holding it.

Your eyes flutter shut and you lean your head back on his shoulder, “Oh fuck yes,” you sigh in bliss, “right there.” You circle your hips, gasping when his fingers brush against your g-spot.

Jungkook pulls you back in and kisses up your neck slowly, “You’re so fuckin’ pretty baby, look at you, dripping all over my fingers like a little cock hungry slut. Bet you missed this dick baby, need me to come fuck it in your needy little pussy, have you all spread on the bed for me begging for more,” he whispers as he kisses the side of your face, “you gonna be a good girl and take it?” He jabs his fingers into your g-spot causing a burst of pleasure to hit you.

“Yeah,” you pant softly, “want it deep inside,” you bite your lip and spread your thighs a bit wider, “need it so bad.” You whimper quietly and push back on his fingers.

Jungkook chuckles breathily, “Yeah..” He moves his fingers faster, jostling you as your back arches, “Make it messy for me sweetheart, go ‘head and cum,” he has you locked in place, keeping you from moving anywhere. His fingers piston in and out of you rapidly, loud squelching noises resonating as bits of slick drip down your inner thighs.

“Oh fuck..!” You gasp and clench down, “C-Coming..” You hump his fingers desperately, “K-Keep going, right there, right there,” you whimper out and feel your orgasm come crashing down on you, hitting harder as all the stress lifts itself from your body.

Jungkook slows down until you’re whining in overstimulation, “Clean ‘em.” He slips his wet messy fingers into your mouth, “Fuck.” He groans, “C’mere baby.” He turns you around and lifts you up in his arms, “Need you on my cock.”

“Wait, the water!” You reach behind blindly to turn the knob, groaning when he begins sucking on your soft tits.

.

“Fuck..!” You throw your head back on the pillow with gritted teeth. He’s fucking you so fast and hard you’re honestly no sure what to focus on anymore..him? The skin slapping? The bed creaking? He’s not making it so easy either with the way he’s groaning and panting right by your ear.

Jungkook has you folded under him, his hands grip the back of your thighs and hold them up while he plows your swollen dripping pussy with his fat cock. The room feels stuffy, sheets are strewn about messily and you’re both laid bare in the open without a single care. Jungkook isn’t faring much better, his moans are choked up and every so often you feel him throb inside you.

“You like that baby?” He pants breathlessly against your lips, “Got you clenching so tight around my cock, practically drooling all over me.” He rolls his hips against yours smoothly, pelvis pressing down and rubbing along your clit stimulating it. His balls press against your taint with soft palping noises every time he grinds into you.

You shakily claw at his shoulders and moan needily, the angle certainly has your legs feeling like jelly and your poor cunt throbbing from the pounding he’s giving you. “Love it,” you turn your face to slot your lips against his messily, “fills me up so good baby.” You cup his face in your hands and hold him in place while he works his cock in and out of you.

Jungkook lets out a muffled moan as he starts picking up the pace, hips smacking into yours over and over again with deafening slaps. He lets your thighs go in favor of planting them on either side of you on the bed, “Hear that sloppy little pussy? Got it creaming all over my cock and makin’ a mess. Who’s fuckin’ you baby? C’mon tell me.”

“You are.” You whimper out, “Shit–right there,” you mewl.

“That’s right sweetheart, no one else can give it to you the way I can. You can fucking try but at the end of the day this pussy is mine to fuck,” slap, “mine to use,” slap, “mine to breed.” He growls in your ear lowly, “Gonna ruin you for anyone else, so next the time you plan on letting someone else have it you’ll be remembering the way I fucked you so good.” He hisses softly and sits up, landing a set of punishing thrusts on you, making your body bounce a bit off the mattress.

Your head rolls back and you let out a series of staccato moans, crying out for more and scrambling to grip the bed sheets, the pillows, the blankets–anything. He’s fucking you within an inch of your life and you feel like you’re about to pass out from the sweet pleasure mixed with a tiny hint of pain from the way his hips smack into your ass. “Jungkook..!” You sob out.

Jungkook grits his teeth and reaches down to pinch your clit cruelly, relishing in the way your back arches off the bed. “Go on, cum for me little mama.”

With perfectly aimed thrusts and the combination of his fingers on your sensitive bud, you cum for a second time on his cock. He leaves you trembling on the bed, whimpering and whining. Jungkook follows up shortly with a low moan and your name escaping his lips, “Fucking hell.” He whispers breathlessly.

You let your jelly-like legs fall on the bed, “I’m not getting up.” You mutter, “Put the chicken away, ‘m going to sleep..” You turn on your side and curl up, shivering when his cock slips out of your battered pussy.

Jungkook hums, “The things I do for you baby,” he sighs softly as he strokes your thigh up and down, “lucky I love and appreciate you mama so much.” He rolls out of bed and slips his loose sweats on.

“You love me.” You sleepily mumble, “ ‘n you love my pussy.. I love your dick too.” You smile in your sleep, a bit delirious from the fucking and the strong orgasm he had given you.

Jungkook eyes you with a grin, “Damn right I do.”

TAGLIST: @fragmentof-indifference @jungkooksseuphoria @kooliv @angelarin @jjeonjjk7 @lilliankoo @pb-n-juju @ellesalazar @saweetspoiled @laylasbunbunny @prettyprincejk @cherrysainttt @hyunjinswifeee @joongraduatewithonor @hellbornsworld @leire-mia @m1sss1mp @lissful @winkii @lifeless-firefly @exactlygreatcoffee @taestoess @ayalies @floweryjeons @softtcurse @lilspinachwrld @tearyjjeon @littleobsessedkitty @lovelovelovebts @angeljmnie @rerefundslocals @bangtans-mama @thvhoe @maddkitt @tvse @ohjeon @teteswtnr @jkslovey12 @kelsyx33 @milfpo1ice @sluttydidi @ztyur @beomgyuult @shescharlie @sweet-sourhotcoco @lalita-7 @hazzzelsdimension @p34rluv @kook-net @bonita0-0 @vmapy @dahliadaenerys @frieschan

[newtkive]

shift shenanigans - social media au (pt. 2)

note: yes there’s the main work chat w carmy, the secret coworker chat w/o carmy, and the secret secret bestie chat w syd, marcus, and yourself. it would be canon.

warnings: crude humor, slightly offensive jokes

part one

liked by carmyberzatto, marcus.brooks11 and 40 others

chefboyardee: life lately

see all 9 comments

syd_adamu: that pho was life changing

↳ chefboyardee: i think it was the best i’ve ever had

marcus.brooks11: feet off the table @syd_adamu

↳ chefboyardee: leave my girl alone

↳ richietheking: I knew you guys were lez

↳ syd_adamu: we aren’t and you can’t say that

↳ chefboyardee: oh.. we aren’t? ☹️😔

↳ syd_adamu: 😑

carmyberzatto: 🍲🔥

THE GOLDEN TRIO

[ 7:45 AM ]

y/n: did you see

did you see

did

you

see

ogmgokggkowkfofsk

syd: pardon??

what did richie do oh my god

did he post another picture of him with the gun from that one day

fuckkkk carmys gonna be so mad

marcus: nope i wish

y/n: he commented on my post 😭😭😭😭

syd: who

marcus: think about it

who else would cause this reaction

y/n: carmy!!!!!!!

i woke up to him commenting 🍲🔥 😍😍😍😍

syd: woah and the heart eyes?

y/n: no that’s my addition

syd: the bar is in hell

HES YOUR BOSS

y/n: AND I WANT HIS BABIES??

marcus: y’all so hype to be pregnant THEN BOOOMMM ‼️ THE BABY’S UGLY AND BALD WITH ECZEMA 😩🤨

syd: LMFAOOOOO WHOS YALL THO????

y/n: bye im done

im leaving for work.

don’t talk to me ever again

done.

marcus: bye 👋

why do you leave so early fool

syd: so she can be teachers pet

marcus: smh always there before everyone

y/n: not true.

syd: i thought you weren’t talking to us

y/n: 😒

marcus: want me to bring y’all an iced latte again

y/n: …. 😁

WORK

[ 8:15 AM ]

y/n: AYOOOO

great job cleaning up after work yesterday 😊👍

richie: Is this a joke?

y/n: why would i joke about such a thing

carmy: Y/n what are you doing

y/n: u said to tell everyone their housekeeping is shitty

carmy: No I said I was going to tell them that, and you said no I’ll do it

This is not what I meant

y/n: well you yell too much

marcus: ouch

that’s my station 😔

carmy: Well clean it better

y/n: im using reverse psychology and positive reinforcement

carmy: Not what that means

y/n: well notice how no one’s mad at me

im making alliances day by day

richie: You’ve worked here for two years and we are already friends

y/n: so you’re saying you aren’t my ally

richie: No

We are definitley in an alliance

y/n: love u richie

richie: Don’t go that far

chefboyardee’s instagram stories

WE HAVE THE BEEF 🥩

[ 3:25 PM ]

y/n:

he so fine im bouta cermmmmm

syd: …..

marcus: :O

y/n: why are you acting shocked

like i haven’t said this daily

tina: Woah girl who?

y/n: HUH

richie: I’m not in the picture I don’t get it

syd: let’s just keep working before carmy notices

tina: I don’t care I’m on smoke break. Who are you talking about girl? Spill the tea..

marcus: she was talking about me you guys

y/n: the guy in the back

oh i mean yeah marcus

tina: The meat delivery guy? He has a wife..

y/n: we are having an affair

marcus: no it’s about me

richie: I didn’t know Marcus and Y/n were a thing..

tina: Something ain’t right. No way they are.

marcus: we aren’t it’s just our sense of humor

y/n: i was just being funny!

tina: What did Jeff just yell inside?

syd: came out of the office and said “just cuz we’re slow doesn’t mean you can play on your phones” 👍💯

tina: Whatever. No chance Y/n meant Marcus. You got the hots for Jeffrey?

y/n: what no

tina: Well I wouldn’t blame you. He’s cute

y/n: OMG RIGHTTTTTTT

its the tattoos isn’t it

richie: You have to be fucking joking

tina: I was playing..

y/n: im confused

syd: that was cruel

marcus: who cares it’s not a big deal

y/n: so you don’t think he’s cute tina?? ☹️☹️

tina: No he is cute… for you 😝

y/n: this is humiliating

richie: I’ll tell him

y/n: NO

stop

sSTOP THATS NOT FUNNY

richie im not joking i’ll put a bomb in your floorboards

richie: I’m just fucking with you kid

tina: This isn’t over.

THE GOLDEN TRIO:

[ 3:40 PM ]

syd: y/n….

marcus: you look like a ghost y/n

y/n: i cannot believe i sent that to the wrong gc

i’m done im so done

marcus: stop looking so sad it’s making me feel bad

syd: it’s okay! just be thankful it wasn’t to the work groupchat with him in it..

marcus: true it could be worse

y/n: i guess so

thank you for trying to cover for me marcus

marcus: anytime you know i got you

syd: let’s get back to work before we start looking obvious

[springalwayscomes]

Closer

Closer (Teaser) Closer: Too Close (Teaser) Masterlist Taglist

Plot: To have each other close is something that you both always wanted, in a way or another. It’s just that… close is not close enough anymore for Jungkook.

Pairing: Jungkook x Reader

Genre: Fluff, Angst, Smut, Domestic, Humor, Friends to Lovers

Wordcount: 27k

Content Warning: mentions of masturbation, dirty talk, swearing, pining, minor injury, praise, cunnilingus, cum eating, unprotected sex, mentions of blowjob, masturbation, hand job, dry humping, multiple orgasms, love making, creampie 

Author’s Note: Hello! I had the first line of this fic stuck in my notes for a while, it stayed there without really going anywhere, then inspiration came and the miracle happened in a few days. I like this so much so I hope you will like it too! There are some parts that just do things to my heart, one of these is inspired by Gaelforce. I don’t know if you follow him but if you do you sure will realise when you’ll get there!

Let me know what you think about it, again I hope you’ll like it!💜

If you want to be tagged in my taglis to get notified when my other works will come out let me know here, under this post, with a message or an ask. Feel free to talk to me for whatever, I always appreciate your messages!🫶🏻💜

Jungkook walked in on you using your vibrator as a microphone when you were nineteen, lipsynching as if your life depended on it. 

He had laughed so fucking loud that time that you still feel your ears grow red when you think about it. 

He has teased you for it from the moment it happened, still does it now.

Back then, it was so freaking hilarious he would bring it up every time you were too mad at him, to make you laugh it off and let go of the heavy atmosphere creating between you every time you used to fight as teenagers. 

Five years afterwards, as of now, he still thinks about it from time to time. It makes him giggle when he’s in the middle of a meeting at work, when he has a stressful day, when he’s just laying in bed with his head empty. Usually, that would be the case. Now that you’re sitting on his couch with a bag of pop corns squished in your hands while the tv is playing though, is a new circumstance. 

«What are you laughing at? You’re so loud» you wince at him, monotone and annoyed.

He licks his lips, shaking his head.

«Your vibrator still haunts me» 

It takes you less than two seconds to realise what he’s talking about. 

«You’re so annoying. Should I bring up the time you farted out loud in class too?»

«That’s not the same,» he laughs «I told you that I wasn’t feeling good but you insisted on going to class anyway»

«You didn’t go for three days straight-» you fight back, stopping yourself when the camera points on Park Seojun. 

«Gosh, this man. I’m gonna marry him someday» you sigh dreamily. Jungkook snorts.

«Cause I was sick?» he opens the fridge.

«You drank with Jin the night before. You shouldn’t drink if you’re sick. Maybe that’s why you couldn’t hold it until class was over»

«You’re so noisy» he rummages through the shelves, finally finding the bowl of strawberries he was looking for.

«Want some?»

You quickly glance at him over the counter, pop corns stuffing your mouth full.

«No, thanks. I’m full with these»

He gets a spoon from the drawer, walking back to the sofa. 

«The face you made when I walked in is still funnier than-»

«When you farted in front of the class?» you cut him off, trying to get some sense in his head.

«Hell, yeah» he laughs.

«You literally-»

«Okay, now stop!» you slap his ass before he gets a chance to sit down.

«Oh, yes keep going» he fakes a moan. You literally want to slap him hard enough to make him stop being an idiot, but you have to hold yourself back.

«Just shut up and let me see Park Seojun» you shake your head. Jungkook gets a spoonful of strawberries into his mouth, eyes falling on the screen and eyebrows pinched together.

It’s a Saturday, thanks God the both of you don’t work on weekends, so usually you both find yourself on the sofa, watching a movie or just messing around. You’ve known each other since you were sixteen, so to say that you’re pretty comfortable with each other is an understatement. Even when you first met him, the nineteen years old Jungkook never made you feel uneasy. You were inseparable. Best friends that used to sleep at each other’s place every three to four days because you were just used to it. It was natural, so natural that a lot of the people around you thought you were a couple. Back then, you would grimace and shake your head vividly, not even giving it a thought. Jungkook would laugh it off, heart beating loudly in his chest every time anyone made him imagine how it would’ve been. 

«Do you still have it?» he asks, voice low as he stares at the screen.

«What?» you murmur. He doesn’t answer, his spoon scraping against the plastic of the bowl to get as much strawberries as he can into his mouth. He munches on them, gulping down and enjoying the sweet taste.

«That vibrator» 

«Jungkook! What kind of question is that?» you stop the drama, his thigh getting hit by the remote.

«I was just asking!» he raises his hands as to make sure you understand he meant no harm, the bowl now sitting on his lap.

«Why would you ask that?» your tone makes his eyes smile first, as he always does. His eyes smile first, then his lips just follow.

«Why are you so sensitive about it? I won’t ask, but we both know you still use it» he gets up from the couch, getting to the sink to put the empty bawl inside. 

«We say filthier things when we’re in bed!» he goes on from where he’s standing at. Your head is going to explode. It’s at times like this that you rethink about your life choices. From being sixteen and dumb, until you’re twenty four and ending up with sleeping with your best friend. 

«In bed! Leave those for when we’re in bed!» you fight back, another pop corn getting shoved into your mouth.

«Okay,» he appears by your side «wanna go to bed so I can ask you?» 

You can’t believe him. 

«Jungkook!» he laughs, bright and out loud, crystal clear. It makes your insides twist and turn with the need of shutting him up.

It’s not like it’s a everyday thing, sleeping together. It just happened three times, out of the blue. You both agreed that it’s not something big, something that will change your bond or friendship, it’s just something that… you both needed? In those moments, you guess. Maybe mentally? However you try to justify it, the answer is always the same: nothing is going to change between you. It’s just sex. But for the sake of your relationship, you try to keep it where it belongs: in bed. Talking about such things outside can be confusing, it can lead your friendship too places you don’t want it to be. You love Jungkook, as your friend. Being too sexual won’t lead to good places, just a fucked up friendship and a fuckbuddy living with you.  So you both better keep your minds at bay, don’t pass the limits of friendship at least when you can.

«I’m going to get a shower» you announce, shutting the tv and getting up from the couch. His eyes are questioning, but you just tap his shoulder. 

«Put this away, please?» you hand the pop corns to Jungkook. He grabs the bag. 

«Why?» you’re already almost out of the living room when he asks.

«I’m going out tonight!» 

«With the girls?» he raises his voice a bit to make you hear him from the other room, as he looks for a peg in the drawer to close the popcorns.

«Yeah, it’s Eunji’s birthday!» you remind him. Jungkook winces, he knows what that means. You will come back home late, and you’ll end up being awake until morning cause you hate going to clubs and will feel like you have to make up for the six hours you lost in there. You still do it, for your friends, but it’s something that you don’t enjoy a lot. If you add the fact that you don’t actually drink, that makes it all even worse. 

«What about Jimin?» he’s out of your bedroom door, you can hear it from how close his voice sounds. Thank god he has a good sense of privacy, cause you’re naked. 

«They were together the whole day, tonight is girl’s night» you answer. Jungkook nods, telling himself he’s going to ask him to come over later.

«I’m taking a shower now!» you let him know the conversation is going to end, already walking to your bathroom.

«She said it’s girls’ night, so» Jimin’s munching on a chicken’s wing with so much eagerness it looks like he hasn’t been eating for a week. 

Namjoon nods at him, getting a beer from the fridge. 

«You’ve been together the whole day, though» 

«I know» he answers, «what can I do if I want to spend every second with her?»

«I feel like I’m gonna throw up» Yoongi murmurs from beside him, giving him the most disgusted glance ever. Jungkook laughs.

«What have you all been up to lately?» 

Hoseok sits on the carpet, ready to start eating as he waits for the group’s answer. 

Jin shrugs.

«Just work. The restaurant is always full, I think I might die from overworking»

«Listen to him bragging» Taehyung pats his hyung’s shoulder.

«I’m not! It’s going well, but it’s fucking tiring! Last night I came home to Hana and…  nnghh, why am I so dumb?» he closes his eyes, breathing through his teeth. 

«What happened?» Jungkook asks.

«She’d kill me if she knew I told you this,» he gulps a big sip of beer down «you have to promise me it won’t slip out of your dead-ass mouths»

«When did we ever say-»

«That time?» Yoongi’s question gets cut off, Jin’s eyes big as they remind him of what happened last time.

«It wasn’t me! It was Tae!» 

«Yah, I didn’t do it on purpose» he fights, holding back a laughter.

«Alright, stop. Just don’t make it happen again» Seokjin gives him a fiery glance.

«She was like, really in the mood and… I told her I would take a shower and then go to bed with her but my muscles were so sore I decided to run a bath. I felt asleep. She waited up for me for a whole hour,» he takes a bite from the chicken «she was… god, what did I do? I was so tired I didn’t do it on purpose but she felt rejected or humiliated I guess… I’m such a-»

«Hyung, you were just tired» Jungkook stops his rant. Namjoon nods.

«You should talk to her»

«I didn’t get the chance, she left earlier this morning and didn’t answer my texts all day» he answers, eyes gloomy as he pours himself another glass of beer. 

«Wait for her up, she’ll come back after they are done with the club» Yoongi proposes. Jin nods.

«What about you?» he asks.

«I’m good» he smiles. A little too much, actually. It’s too bright, too much. 

«You’re good?» Hoseok smiles at him, already knowing that there’s something else. There has to be, with him smiling like that.

«Really good» he echoes. 

At this point, Jin hits his shoulder.

«Yah, give us the good stuff!» 

The music in the background fills the air as Yoongi ponders on how to explain what’s happening in his life at the moment, a big smile taking over his features. 

«I’m…» he smiles again «I’m going to be a dad» 

«What?!» it’s a scream that comes out loud, the same word coming from every single person present. The man nods, eyes teary. It makes Jungkook’s heart squeeze, to see his hyung so happy. The room is filled with happiness, as they all proceed to ask questions, hugs and congratulations getting shared. After all, he and Hyunjoo have been trying for the last year. The night is filled just like that, with jokes and laughs until Jin and Jimin decide that it’s time to go back home to wait for their girlfriends, the others deciding to stay until you will be back to say hello and goodbye to Jungkook. 

It’s when the bell rings that they know that something is definitely weird. The knock on the door too sounds eager for you, and when Jungkook gets up to open it what they hear right after makes their eyes shoot right open.

«Fuck, are you drunk? Who took you home? Why did you drink?»

«Leave me alone» you stutter as you try to walk inside, Jungkook’s arm getting to your waist. You can’t even stand, how much did you drink? 

«Who took you home?» to say he sounds worried sick is an understatement.

«Some guy with a really pretty dick» you laugh. Taehyung gets up, everyone following after him. They never saw you drunk, simply because you just don’t drink. You don’t like the taste of alcohol, can’t even gulp down a sip of beer properly without having to go brush your teeth, apart from the fact that you can’t hold it. Half of a glass is enough to make you the drunkest version of yourself; apparently now it’s not like that anymore.

«What?» the shock from seeing you like this makes Jungkook hold his words back, first he needs to make you sit somewhere.

«Grab a wet towel, or just… water, give me water!» he orders around. Someone gives him just what he asked for, and he doesnt even spend time in thanking them as he wipes the makeup off from your face. 

«Water» Yoongi gives him a glass.

«Why- you’re here! Hello!» you wave to your friends, Taehyung smiling at you. 

«My bestest friend! Tae, I missed you» you whine, grabby hands reach for his wrist, making him sit next to you.

«Yah! I’m your bestest friend!» Jungkook shakes his head.

«I missed you too» Taehyung scoffs, your head falling on his shoulder. Jungkook hisses, it’s harder to get your makeup off when half of your face is squashed like this.

«Why did you drink so much?» Taehyung tries.

«I was… feeling left out? I can’t remeber well» you murmur, chuckles coming out as you decide it’s time to mess with Jungkook. Every time he tries to wipe a part of your face, you just turn in the opposite direction.

«Will you stay still?» he shakes his head, annoyed.

«You’re a pain in the ass, Jungkook. I hate you»

«I think it’s better if you go home, she needs a shower» Jungkook turns to face Namjoon, Yoongi and Hoseok. They look pretty shocked, but worry is weighting down on them more.

«Are you sure? We can help you?» Hoseok tries, but he shakes his head again.

«It’s fine, I got this» 

«Don’t go! Why are you kicking them out! So annoying» you fight, holding Taehyung’s arm tighter.

«I’m not kicking them out, but you need to shower and get changed and they- just…» he turns again «Don’t worry, just go home and rest. I got this» he repeats.

It’s 5.43 am. And it’s so frustrating that you’re laying by his side, sleeping, while his eyes are wide open. 

You might not feel good, so it’s better anyway, he tells himself.

Jungkook is annoyed. A lot, actually. Why, he doesn’t get it. Your words echo in his mind, making him bite on the inside of his cheek when he should be resting.

Did you sleep with someone? It very much sounded like it. A really pretty dick? He scoffs. The adjective sounds almost out of place, still he feels his insides burning even hotter. He wants to ask you right now, but you’re sleeping. Again, he should be too, actually. 

He decides it’s better if he sleeps on the sofa, you’re asleep anyway, so you won’t make a fuss about it. He lifts the covers, gently and slowly, then sits on the bed, a leg already out and his foot laying on the ground. The cold makes him wince.

«Don’t go» you hold his wrist, digits caressing his skin. 

«Stay with me,» you plead «I’m not feeling good» 

His defences fall down instantly. It’s hard not to succumb when you’re murmuring against him. He does it without you having to ask twice, his foot back under the warm covers.

«Hold me?» you ask. It’s low, sweet and sleepy, and he guesses you’re still drunk but he doesn’t care. His arms wrap around you and hold you close, your head lays on his chest as you would do after having sex. Jungkook holds his breath and swears to himself, he needs to slow down his heartbeat because it seems like his heart is going to combust. 

«I don’t hate you,» your voice is faint

«I’m sorry I told you I hate you, Kookie»

«It’s okay» he caresses your hair, trying to make you relax.

«Just get some sleep» he can’t hold himself back, not when you’re laying in his arms so defenceless and looking so frail and delicate. His lips land on your forehead, soft and gentle, incredibly caring. You don’t say anything though, you’re already asleep.

«Alright, what is it?» Taehyung snaps at him, eyes fixed on the maknae. Jin nods, eyebrows high.

«Nothing» Jungkook shrugs, going back to stare at the screen. The movie isn’t playing, stopped by Taehyung. 

«It doesn’t seem like nothing» he answers back. 

Yoongi taps Jungkook’s shoulder.

«Tell it to Yoongi hyung?» he smiles. 

Jungkook scoffs. It’s something he used to tell him when he was younger, it would reassure him to know that there was someone older than him to relay on and to count on. Now, though, Yoongi can’t do anything about it.

«I’m your hyung too» Taehyung pats his other shoulder.

«Me too» Jimin adds.

«We’re all older, we got it» Namjoon looks at the two who are smiling wide at Jungkook.

«Talk to us? We could help» he prompts. 

«I just… I don’t know» he doesn’t know where to start from. He doesn’t even know why he’s feeling so bothered about it, it shouldn’t be such a big deal.

«I don’t know… why?»

«What? We can’t understand like this» the confusion is clear on Hoseok’s features.

Jungkook sighs, deep and shaky, head falling on the cushion of the couch.

«I’ve been sleeping with someone» he declares, bringing the back of his hand on his eyes. 

«What?» it’s Jimin and Jin, ready to ask why he didn’t tell them. Yoongi glares at them in a second, shutting them up before they even have the chance to start.

«And?» he coos.

«And- she… slept with someone else» he adds. It’s blurry, and the situation is not clear, but just seeing Jungkook like this makes all of them on the edge.

«Are you in a relationship? Or you just-»

«We’re not» he answers Namjoon.

«We’re not, but…» he doesn’t finish. 

He can’t believe himself. What the hell is this about? It’s not like you agreed on being exclusive, you didn’t even talk too much about what happened, it just happened, three fucking times. And god, how fucking good it was. The best sex he’s ever had. Fuck, he didn’t even think about someone else after sleeping with you. 

Maybe it wasn’t the smartest of choices since he’s been fighting against his feelings for six years, but until now they were pretty good. He dated, you dated, he kept them at bay and they didn’t get in the way. 

«You wish you were» Yoongi finishes his sentence.

Silence fills the air. Jungkook feels like he’s going to throw up. You wish you were, it’s the only thing playing in his head. He wishes you were. That’s the point, that’s the fucking point. He wishes you’d see in him what he’s been seeing in you for all these years, he wishes you’d crave his touch just like he craves yours, in the same way. He wishes you could share more than just a home and bills, friendship and bags of popcorns. He wishes for more, and fuck, he’s been so fucking stupid all along to think that a little taste couldn’t do too bad, to think that he could have at least that much.

«Have you talked to her?» Jin tries. Jungkook shakes his head, the back of his hand still pressed against his eyes.

«Why don’t you try?»

«Why would I? We’re friends»

«Fuckbuddies?» Jimin asks «How can you be-» Taehyung slaps him on the neck. A faint moan coming out of his friend’s lips.

«Shut up»

«No, friends. We’re friends» he slightly raises his voice on the last word, to make it clear. 

Yoongi’s eyes narrow.

«You mean you… you’ve been sleeping together but you’re friends?» 

«Isn’t it clear?» Jin looks at him like Yoongi has two heads, eyes trying to suggest something that no one gets. His head moves as to beckon him to something that’s right in front of him, Yoongi’s expression still clueless. Then, he gets it.

«Y/n! Is it Y/n? What the hell Jungkook!» he breaks out. Everyone’s eyes shot right open, Jungkook’s hand falling on his lap as he realises that there’s no way back. 

«When? Why?»

«It just… happened» he sighs, eyes closing again. 

«When?» Taehyung can’t believe what he’s hearing. 

«Four months ago,» he murmurs «the first time»

«How many times? Oh, my god» Jin wants to know everything, every little detail. Not sexually, it would be awkward since you’re his friend, but every thing he can, he has to know.

«Three» 

«Three?» He repeats.

«Three times,» Jungkook says again «I don’t know what to-»

«Is it because of the guy with the pretty dick?» Yoongi asks. Jungkook tilts his head, glaring at his hyung. 

«Okay, it is»

«Talk to her» Hoseok prompts but he only gets a big, steady shake of the maknae’s head.

«She was drunk. Do you know what you’re doing? Like, have you talked about it at least? Are you exclusive with each other?»

«We didn’t, and I guess we’re not» Jungkook answers Jin, not really in the mood for all of his questions.

«Jungkook, you have to-»

His phone rings, cutting Hoseok off. Your name comes up on the screen, everyone’s eyes and ears ready to steal information, Jungkook’s thumb stopping before hitting the green icon. He takes a deep breath, then answers. 

«What-»

«Jungkook, please help me» 

Something inside him snaps, worry filling every part of his being. Your voice is shaky, fragile. It sounds like you’re crying.

«What, what happened? Where are you?»

«At home,» you whimper «I’m in the tub. I slipped and, I can’t move. It hurts» 

«Fuck, wait I’ll be there in five minutes. Stay on the phone, don’t move. Please, don’t move, okay?» he’s already on the way to the door of Taehyung’s house, their eyes fixed on him in worry. He waves goodbye before closing the door, mouthing “emergency” at their inspecting eyes.

«Fuck, are you okay?» 

To say he’s worried sick is an understatement. His eyes travel to every part of your body to make sure that you’re not hurt, until they reach your arms covering your chest. 

«Don’t look! Give me the bathrobe» you want to cry, you feel so embarrassed that you actually could. 

«Yes!» he passes it to you quickly, helping you as best as he can with his face turned to the side. He wants to tell you that it doesn’t matter if he sees you like this cause it already happened but he guesses you might feel embarrassed or just not at ease, so he shuts up and does what he has to. 

«It’s fine, I…» your voice trembles. You hold his wrist on the side of the tub, fingers cold and wet. 

«It’s fine, it’s alright. Ssshh, don’t cry» he kneels down, his arms wrapping around you and leading your head to his chest. 

«I’m not crying» you whisper, gulping down.

«You’re about to,» he caresses your hair «I’m here. I got you» he feels his throat tightening. He was so fucking worried he run two red lights while coming home, all the ones he met. 

«I always got you» he coos. 

For some reason, his words make you shake in his hold, a faint whimper coming out as you let the tears fall. The embarrassment and the stress about the situation, the pain of your ankle and his presence seem to mix together to combine into a perfect crying solution.

«You won’t tease me about this, right?» you mumble, voice muffled. Jungkook’s heart feels slightly reassured at your words, a weak smile gracing his lips.

«I won’t, baby. I promise» he whispers.

Your faint sobs fill the air, and he feels like his poor heart will break only by listening. His fingertips dig into your bathrobe so much it’s like you feel them on your skin, his other hand caresses your hair, his breath shaky. 

He waits for your weeps to summer down and stays like this a little longer, his presence reassuring and his touch relaxing you.

«Let’s get you out of here, okay?» he asks. You nod. He’s gentle when he parts his arms from around you, gentle when he tells you to relax, gentle when he smiles at you, soothing. 

«Where does it hurt?» 

«My ankle» you let him know. His eyes travel down, hands getting wet in the water as he lightly feels both of them. 

«There» you hold back your breath, the pain makes you grimace.

«Okay, just… can you get up? Just lean on me and don’t put weight on your right leg. Lean on me» he instructs. You follow his words and try to get up as best as you can, leaning your weight on him and keeping your ankle up. Jungkook helps you out of the bathtub, his hands coming to your back and the back of your legs to pick you up. He makes sure not to hurt your ankle with any movement, eyes on your face to check in with you without having to ask.

The path to your bedroom is silent, he lays you on your bed and tells you he will change the sheets himself afterwards because of the wet bathrobe. 

«I think you need a pillow, you need to keep your ankle up» he works diligently, worry guiding him until he realises you’re set. On the bed, with the pillow underneath your ankle, comfortable, kind of.

«Do you want ice? Wait, I’ll get it with something to drink» he lets you know. He vanishes out of your bedroom and into the kitchen to get a glass of water and the ice, then goes back to the bathroom to get a towel to wrap around it so it isn’t too cold.

When he comes back, he smiles at you.

«You need to drink at least a bit» he hands you the glass. He sits next to you, looks as you gulp down the entire glass with a proud smile, his hand reaching out to take the glass back and put it on your nightstand. You stay with your mouth closed, still too embarrassed to say anything.

He puts the ice on your ankle, careful not to hurt you more than what you’re hurting already. It’s an instinct he doesn’t think of or can fight back, when he strokes your hair tenderly. It makes you gulp, heart swelling in your chest. 

«I was so fucking scared» he admits, low and shaky, almost a whisper.

«I’m sorry» you really are. He was enjoying his night with your friends after a hard week of work, and you called him and made him come all the way home, worried and-

«It’s okay, don’t worry» he smiles.

«But we should go to the hospital, your ankle is a bit swollen and-»

«Not now, please» you refuse.

«Y/n, you really should»

«I know,» you nod «just please not now? In a bit» 

Jungkook sighs, but he nods. He keeps the ice on your ankle, eyes on your face to check if he’s hurting you in any way to the point you feel your ears burn. 

«Come here?» you ask, patting beside you. He raises his eyebrows, looking at your hand on the mattress. 

«Please?» you ask sweetly. 

«The ice» he says. You shake your head.

«Just for a little, please» you gulp your beating heart down. You want him close, closer and closer. You don’t know why, but you want him so close it’s getting hard to breathe.

Jungkook can’t say no to you, not when you’re in your most fragile state, telling him to lay beside you. He puts the ice on the nightstand, next to the empty glass. 

When he lays on his side, his eyes instantly fall on your face, a bit of worry still painting his features.

Your hands move on their own, reaching his and bringing them around you. 

The atmosphere is dreamy like, a pinkish feeling invading Jungkook’s chest as he stares at you, his arms squeezing you and your eyes getting lost in his. It’s odd, how you can feel you heart pulsate, the sound echoes in your ears until they become numb. His hold seems to calm your racing mind a bit and you find yourself craving for something you can’t really touch, get a grasp of.

«Jungkook» you call. 

«Mmh?» 

«I want you» 

Jungkook feels like a leaf about to fall. Swept away by the wind, scared to fall but what if the fall is so sweet, so gentle? What if he can’t say no? He wants you just as bad as he wants you to want him. He wants you sweetly, he wants you lovingly. He wants you. Every part, every shiver, every fear and every night. Every fucking night. If he can’t have that, he’ll have to settle for this at least. He can’t say no to your love. And now that he realises, he thinks, this is the last time. The first time loving you and the last. 

«Fuck, come» he holds you tighter.

«Come into my arms» as if you weren’t already. He stays like that, seconds passing by and his breath getting rougher, he tries to  slow down his heartbeat but it’s to no use, you probably can feel it even through your bathrobe and his clothes. He wonders what are you thinking, if you want him as bad as he wants you at least sexually. It makes him breathless, how much he wishes you were his.

«I need-» he gulps «I need you close»

His body moves on top of yours, his legs in the middle of your thighs, eyes glancing at your ankle to make sure he doesn’t hurt you with his movements. It kills you, how he takes his shirt off and the light of your room kisses every single inch of his abdomen. His beautiful skin, the muscles flexing as he removes the cloth, his brownish nipples hard at the cold hair. You want to lick it, every part of him. You want to touch it, chase every ripple with your fingertips. 

«Can I take this off?» he asks. 

When you meet his gaze his eyes are made of something you’ve never seen. It’s not want or need, you’ve seen those already the other times you had sex, it’s just something else that you can’t quite grasp; you don’t focus on it too much, nodding your head and reaching you hands for the knot of the bathrobe. 

«Wait, let me» his fingers graze yours. You stop your ministrations, watching as he unties the knot, slow. There’s something. There’s definitely something. When he took your clothes off the last time, there was eagerness in his motions. There was need.

He was scared, of course he was. You guess that now he’s just glad you’re okay and trying to not hurt you in any way. You’re glad. Glad that he takes such good care of you, glad to have him as your friend. 

«Thank you» you smile. Jungkook feels his heart clench. He wishes your relationship wouldn’t be like this, for you not to thank him with that smile so uninvolved, so clear. 

He nods, hands getting by your sides to not put any weight on you.

«Keep your ankle up, please. Don’t wanna hurt you» he says. You nod, again.

His bicep flexes as he puts his weight only on his left arm, his fingers of the other caressing your clavicle. He sees the shivers on your skin as he travels lower, grabbing the edge of the bathrobe to reveal your chest. He wants to squeeze you, squeeze you so tight you don’t have any space left between you, hearts beating against each other. 

Your skin glistens, and he can’t hold himself back anymore. He raises on his calves, opens your robe so that every part of you is revealed, takes off his pants and his socks. His cock is hard, so fucking hard he’s afraid he’ll come just by the sight of you, but he wants to hold back. He has to, cause he wants to do this right, in the right way. He wants to love you even if you don’t notice it, at least for once. 

«Sit up for me, princess» his tone is like honey, and you do as he says without complaining. The pet name leaves a weird taste in your ears, you’re not used to it.

He helps you out of the bathrobe, finally having you naked on the bed. So pretty, so exposed just for him. Something inside him doesn’t set right, though. 

«Hold tight onto me» 

You’re in his arms, getting up from the bed and out of your bedroom. You wander what the hell is he doing until you get to his bedroom, confusion invading your features.

«Why?» 

He lays you on his bed, getting a pillow again so that you can keep your ankle elevated.

He looks down at you from the end of the bad, cock twitching and eyes fixed into yours. He wonders if it was too much of a bold move, but he guesses you wouldn’t see anything behind it. 

«Want you in my bed» he simply answers, transparent and straight to the point, his dark doe eyes drinking yours in. 

You just nod a little astonished. 

Of all the times you had sex, it was always in your bed. Never in his. Never your perfume stayed on his sheets, never he got to swim in the illusion of having at least a little more to keep to himself, just for him. A part of you to keep, to protect in a world that isn’t yours. 

He takes his boxers off, and god you wish he could be faster cause you think your eagerness will make you lose your mind. You want him deep inside you, close as soon as possible.

«Open your legs for me?» he coos. He looks at you from the edge of the bed, still standing. Your eyes travel all the way from his face to his cock, it stands straight up to his belly button, the tip red and angry, veins displayed. If you’re not seeing wrong, there’s a bit of precum leaking out from his tip, but maybe it’s just the light playing with your eyesight. 

You do as he says, opening your legs as much as you can for him to see, careful with your ankle. He bites down on his lips, his hand getting to the base of his cock and wrapping around it, just squeezing it.

«I love your pussy» he breathes out. The way he sounds makes you clench around nothing and when you see his hand stroke up and down his needy cock your mouth opens in awe. 

«I’m obsessed, want it every day» 

You squeeze your thighs together, how can he speak so filthy but sound so angelic?

«That can’t happen» you warn him. 

Jungkook nods.

«I know» he answers. It kills him. It fucking kills him, to have a taste and then having to let go of it. 

He gets to the bed, kneeling in front of you, his eyes on your face. 

«I want you on my tongue» 

Your yearning is making you crazy, you’re so wet you’re practically dripping by now.

«Please, Jungkook» 

It sounds so good, to hear you say his name like that. In such a filthy way, totally unfiltered. 

«Gonna give my baby what she needs»

His hands touch your thighs, he gropes your skin with his digits, so soft it makes him want to fucking lose himself and get lost just in the desire. His sentence makes you wetter, but your heart beats louder for some type of reason. 

«Please» you plead again. 

«I got you» he reassure you, he lays down on your body, face close to yours. His lips are close, so close you think he’s going to kiss you but he just lays a kiss on the corner of your mouth. 

«I always got you» he whispers, his eyes looking into yours. His hand caresses your cheek, something that adds too much to this, to you, to the both of you. It leaves you wordless, shaking.

A second later, he’s back between your legs,  his hands grabbing your thighs in the gentlest way he ever did. 

«So beautiful» he murmurs to himself as he looks at your pussy juices leaking out. It’s so fucking inviting that he can’t hold back anymore. His mouth lands on your clit, so soft and pillowy, he kisses it. A strangled moan comes out of your mouth, and he lays another, and another. His tongue starts to glide between your lips, up and down he gathers your juices and then sucks onto your clit, your back arching on the bed.

«Oh, fuck» you moan. It makes him eager. Eager for more, eager for you, ciclo by fervent. He wants it all.

He sucks on your clit again, harder and for a time that seems endless, the pleasure that takes over you is tingling and consuming and your mouth opens again in a silent moan. He lets it go with a popping sound, he blows on it, kisses it again, sucks again as his tongue plays with it. Your hands reach his hair, they tug at the strands as you moan out loud. It’s so good, so good you’re not going to last long.

«So good» your hips shoot up, whines come out of your mouth.

He feels drunk, lost in the taste of you.

«Yeah?» he coos. His tongue rubs your clit deliciously, the pattern changing from up and down to side to side and circles, it makes you lose your mind. 

«What if I do this? Take all of you in my mouth?» 

It’s unreal, how good he can make you feel. He takes you all in his mouth, from your clit to your hole, sucking on every part he manages to get, then sucks on your lips. His hands move on your stomach, eyes on your face as he grabs your breasts in his palms. He squeezes them softly, fingers rubbing your nipples, filthy wet sounds filling the air. It’s embarrassing, the amount of wetness through your folds, how your juices keep leaking out at just a look at him. You don’t think you can hold back. Not when he’s sucking on your clit again, his fingers grazing your nipples as he moans on it in his mouth. He doesn’t think he can get any other pussy, after yours. It’s too good, it’s perfect. Just perfect.

«Gonna- Jungkook» you shiver.

«Tell me, talk to me, baby» he moans on your pussy, his tongue poking at your hole. 

«Fuck, I think I’m going to- cum» 

His tongue feels so good inside you, your walls tight around it and your juices wetting all of his chin. He wants your wetness everywhere, on his chest, on his thighs, on his fucking bed. 

«Please, let me see» he begs. 

«Cum for me» 

One of his hands come down, his fingers rubbing your clit. You don’t have the time nor the voice to tell him that you’re going to, cause god, it feels so fucking good you don’t even know how to speak anymore. You just see him, his eyes staring at you from between your legs, nose brushing against your folds, his tongue deep inside you. Your legs shake, your breathing is rough.

«Cum for me, angel» 

And you do. You cum so fucking hard, you don’t even realise what is happening, how your juices flow out and drip onto his sheets,  how Jungkook presses down onto the mattress to get some sort of friction, how he gulps down your juices as if they were the tastiest thing he ever drank. 

He kisses your clit, your lips, every part of your pussy he can get a taste of, your inner thighs.

«Fuck, I only want your pussy» he moans, the fingers that left your aching clit now wrapping around his thickness, your juices on his cock make his skin glossy. You’re such in a haze that yes, you nod.

«Fuck, yes» you sigh. Jungkook can’t take his eyes off of you, he simply can’t. You’re so beautiful, so pretty when you’re so vulnerable and exposed for him that you make him helpless, totally fragile.

«You’re so beautiful, so pretty when you cum» his voice makes you open your eyes, finding him still between your legs. 

«Come here» you struggle to let your voice out. 

«Want you close» 

His heart shakes. 

«Tell me what you want and I’ll give it to you» he breathes out, laying on top of you. His voice is shaky and you feel his hands travel from your thighs to your stomach, then to your chest. They reach your shoulders, one of them cups your cheek, his eyes study every part of your face. He looks at the flush of your cheeks, how they turned to a reddish tone, your lips swollen from your teeth biting at them, your hair messy all over his pillows. In his bed, his at least for now.

«I want you, only want you» you whine. 

«You have me» he wishes you could notice, that you’d realise, look at him and mean your words just how he means them. He just rubs his cock against your folds, though.

«Right here» he moans. Cock rock hard, so fucking ready for you. 

«Please» you just keep pleading, you can’t hold back. You don’t even care if you just came and your pussy needs time to recover from the tremendous orgasm you just had, you just want him inside you. 

His cockhead brushes against your clit, a strangled moan coming out from both of your throats, your eyes focusing on his just to see that’s they were already there. Jungkook smiles at you so softly as his cockhead finds your hole and pushes in that it feels too much. Too much affection, to much loving. Too lovingly. It makes your insides twist and turn, and you wonder what the fuck is going on, but you don’t have time to voice your feelings cause a second later his cock is deep inside you, filling you up to the brim.

You just shut your mouth, take everything he has to give. You want it all, you don’t care.

«Fucking perfect» he whines. His cock never felt so good, your walls squeeze him perfectly, your pussy so wet he can feel your juices already pour down to his balls.

«Wrap around me,» he moans faintly «please»

Your legs move on their own, the pain of your ankle shooting up to your leg. You grimace, eyes squeezed shut.

«Careful with your leg» the worry makes him still.

«Lay it on the pillow, up» he whispers, his hand reaching your calf to guide it back down. 

«Like this» he kisses your temple. You sigh when you feel the softness of the pillow and your weight supported, the pain untying a bit.

«Does it hurt?» his words soothe you and you open your eyes to look at his face. You shake your head.

«It was just for the movement. It’s going away now» you answer. Jungkook nods, his fingers brush away a little strand of hair that’s keeping your beautiful face away from him.

«Like this it’s good, is it okay for you?» he asks. His hand holds your hip, your leg wrapped around him, the other on the cushion and Jungkook’s cock buried deep inside you still. You can feel it throb even when it’s still, you wonder how is it possible that he’s holding himself back so much.

«It’s perfect» you whisper. His eyes, smile first, as they always do. His smile comes right after, and you don’t know if it’s the atmosphere or your vulnerability for everything that happened but it makes your heart swell. You want him around you, you want him everywhere, all over you, inside of you.

He looks down at you, moves his pelvis back and then forward again, you wrap your leg tighter around his waist. Your arms come around him, his passes under your back as the other stays on your hip, his cock rutting inside you makes you whimper. He kisses your neck, sucks on your skin, moans in your ears. 

«Love it so much,» he shivers, eyes closing from the pleasure «getting to have you like this» 

«Feels so good, Kook» you whine.

Jungkook fucks into you slow, but his motions are firm and he knows exactly where your buttons are. Apparently, it didn’t take much for him to learn, it seems like he knew them all along, from the first time. 

«Yeah?» he coos, his digits dig into your skin.

«Yes» you moan out loud, only guiding him closer. His cock is perfect. You love it, could never imagine a better dick. 

«Tell me, baby. Wanna hear you» he doesn’t stop, only squeezes you tighter. Your breasts against his hard chest, your nipples brushing against his skin, every curve of your body against his.

«Your cock is so perfect» you tell him. He wants to look down to where he’s inside of you but doesn’t want to miss a single thing, not even a crumb of the pleasure taking up your features.

«I love it so much, the best cock ever» your voice is muffled and your fist comes out from behind his neck to press against your lips as you speak. 

«Please don’t» he whines, looking down at you. 

«Wanna hear you, don’t hold back» 

Your fist goes away. Your fingers dig into his skin again, surrendering to his request and letting your voice come out free. 

Jungkook makes love to you. It’s so sweet and so slow but so good that you’re lost. Lost in him, lost in the feeling and the pleasure. 

«Keep your leg up» he instructs, letting your hip out of his grasp. He kisses your nose, his hand travels between your legs, his middle finger on your clit. 

«Oh, Jungkook, fuck» you wail, the pleasure adding up. He moves his finger in circles, up and down, from side to side, just like he did with his tongue before. It makes him jerk inside you, throb with every thrust, bite down on his lips as he looks at your face and feel your walls clench around him. Your mouth opens, eyes looking at him through your lashes, pillowy lips ready to be kissed. 

«I want to make you feel so good,» he groans, «want you to think about this when you’re alone» he moans. 

«I want you to give it to me, all to me. Mine» he whispers onto your lips, breath hot on your face.

«All mine» 

«Fuck, yes»

Your walls are so tight, pulsating so hard. 

His finger keeps rubbing your clit, he moans when he brings it a bit lower, feeling his cock pounding inside your pussy, your pussylips spread around him, your wetness gathering at the base of his cock. His balls slap on your ass, the sounds filthy and wet, so incredibly wet.

«I’m going to- yes, feels so good» you breathe hard, his finger back on your clit rubbing faster. Your legs shake and you feel his cock dripping precum in your cunt, all of his length pulsating. 

«I want you to look at me when you cum,» he pleads, tone shaky «please look at me» he whines. If you weren’t on the edge already, you think you would probably be just by the way he sounds. He’s so sexy you think you won’t ever be able to get over this. You’re going to think about this for sure, hell if you’re going to.

«Kook, I- I…»

«Ssh, let go. Just let go and look at me» he coos sweetly. He’s holding back, he’s trying so fucking much to hold back that his cock is over sensitive and he doesn’t think he will last much longer. Your walls squeeze him perfectly, so fucking soft and warm around him, so wet, so beautiful. 

«Give it to me, love» he doesn’t notice, not until he says it. It just slips out, naturally. You don’t say anything, head burying deeper in his pillow and your walls tightening around him.

You come all over his cock. Your juices make it harder for him to control his pace as you contract sp tightly all over him, his cock still moving inside of you, your arms wrapped around him. You’re trembling but you still find the strength to cup his cheeks, eyes looking at him for all the time just like he asked you to. You watch him as he moans, fucking into you with the same pace, his cock so hard. One of your hands travel down, between your bodies and down to his cock, his tight balls in your hand. You cup them, massage them a little. Jungkook’s features grimace, a loud whiny moan filling the air as your fingers on his cheek caress his skin.

«So beautiful. Cum for me, please» you plead. His heart beats so loud it’s going to explode, and a second later he’s shooting his cum right deep inside of you, hot, thick and long spurts of cum filling you up to the brim. His lips touch yours, as he keeps cuming. They brush against each other and a second later he’s succumbing to them, moaning into your mouth as his hips fuck his cum into your pussy, your leg still keeping him close and you fingers on his cheek. 

The kiss is slow and not really controlled, his tongue touches yours and brushes it, your lips eager for each other but moving slowly. It kills him, the way you wrap your arm around him to bring him closer as if he wasn’t all shattered into pieces already. 

You kiss for long, he still fucks himself into you slowly even after coming down from his high, your body still tight to him. When you part, you feel your chest on fire. His eyes look glossy, his lips red and wet, his baby hair sticking to his forehead. His movements stop, the last trace of a kiss on your clavicle right where it all started, and then he comes out of you. He lays beside you, eyes staring at your face. Silence fills the air, your breaths the only thing audible.

«Kook» you call.

«Yes?» he hums.

«I need another shower» you laugh.

The atmosphere is odd. It’s thick. You want to go out of your bedroom and ask him what is going on exactly but for some type of reason, you’re holding back. There’s just something in the air.

Last week has been weird. 

You would come home when Jungkook was already there to find the dinner on the table, covered with a plate so it wouldn’t get cold, some days with a post it. 

I already ate, I’m going to bed, I’m a little tired.

I’m going out, but I cooked you dinner. Rest well.

Work was hard today, I’m going to sleep.

Since the two years you’ve been living together, you’ve always made sure that the one coming home later had something to eat, without having to cook when you’re both too tired. You do it for him too, when he comes home late. That’s what you did on Thursday and Friday, but when he came home you weren’t expecting him to literally eat and go to bed after putting his dish in the sink. 

The dinner was odd too, he made small talk, but there was something that didn’t feel right, as if it was a bit awkward. When you both stayed home on the weekend your friends filled the place on Saturday, and on Sunday, he just spent the day in his bedroom beside coming out to make lunch and dinner together.

You knocked on his door once or twice, asked him if he wanted to watch a movie or just chill together, but he said he was tired.

Something is off. Maybe he’s really tired, at dinner today he mentioned that work has been hard lately. 

You start to wonder if you should be worried. If Jungkook is stressed and needs someone to talk too, if you’re being just a shitty friend and shouldn’t give him all this space, if you should grab him by the shoulders and tell him to talk to you about what is going on. He doesn’t seem to have closed up with your friends though, on five days he spent three evenings at their place this week. Maybe it’s just you seeing things.

You should talk to him, cause you’re worried, and you miss him. You miss your friend.

«Jimin’s on his way too» Eunji announces, grabbing a pile of glasses. She places one for each of you on the table, then takes a look around.

«I think everything’s set?»

You nod, Hana and Jin appearing by your side with the side dishes. 

«Let’s put them on the table» Jin grabs six of them all together.

«Yah, don’t order us around. This is my house, not your restaurant» Yoongi slaps his hyung on the ass, his friend glaring at him. Hyunjoo shakes his head at the scene in front of her, her belly has just started to grow, three months into pregnancy. She looks so beautiful and happy that your heart throbs in happiness.

«Where are Namjoon and Jungkook?» she asks. 

«Namjoon will be here in ten» Hoseok answers.

«I’ll call Jungkook» you announce.

You’re about to go to get your purse, but the door rings, so you wander towards it. Jungkook stands behind it, soft hair reaching almost his shoulders, his bangs framing his pretty face. His eyes stare directly into yours, eyebrows cocked. 

«Oh, you’re here?» he asks, as if he wasn’t expecting it. He stays still on the doorway, hands by his sides. 

«Yes?» you smile as best as you can, not really knowing what to do.

«Everyone is here» you remind him. Jungkook nods eagerly.

«I know» he nods again. You move to the side to let him in. 

«I was about to call you» you say. He takes his coat off, hanging it with the others.

«I was stuck in traffic,» he shrugs «I thought it was the same for you, since you worked late too today» 

«Oh, no. I left earlier» he nods. And then, it’s silent again. You just stare at each other.

He doesn’t know. How to do this properly, how to go back to who he was, the friend you had before he realised it was too much to hold back. Every time he looks at you, it’s too much. He feels like you’re taking all the oxygen, leaving him with the smallest amount and not able to breathe properly. He tried. He really tried. He told himself that yes, it can be fixed. He repeats it to himself everyday, but something just makes him stop. He’s too… he guesses he just needs space. To get over you, to learn how to look at you differently, just like before he knew, when he was younger. Maybe he won’t ever be able to go back at that point, but at least to when it was bearable to look at you from afar and just have a small part of you? 

«Jungkookah!» Teahyung yells from the kitchen. Yoongi peeks out from the living room, he smiles brightly at his youngest friend, his arm wrapping around his shoulders. 

«Leave him alone, he just got here» he yells back at Taehyung. In a bunch of minutes, everyone is gathered in the living room, sitting on the carpet and ready to have dinner. It’s been a while since you all gathered to have dinner together, and the atmosphere is light. Everyone is laughing at something, new jokes being made and happiness shared. It makes you appreciate what you have, how every single person in this room means something to you, something beautiful. You’re lucky, very so.

But as you go on, you can’t help but go back to your old habits. Searching for Jungkook’s smile in the midst of the laughters, look for his eyes when you start to talk about something that happened to you during the day. You find him nodding at someone, eyes going back to his dish when you speak. And you can’t help but feel in the wrong. He’s mad at you, maybe you did something to make him upset, something that apparently is very much important to him. This has to be the reason why.

You realise how much you value him. His thoughts, his words, the way he makes you feel like there’s someone you can lean on, someone who’s got you. You realise how easy it is to enjoy his company, to feel happy thanks to him, to feel loved. And how cold it is without him, lost. 

You’ve always been inseparable, since you were sixteen and he was nineteen. Your pieces fixed together so perfectly that you didn’t have to worry about fighting with each other, cause you both knew that nothing was going to change between you. You went through so many things together that you can’t even remember all of them clearly now. He’s your safe place. And even though you know that this is perfectly fixable and actually nothing too dramatic, you just feel lost without his complicity. 

«Y/n?» Hyunjoo shakes his hand in front of your face, her striking smile brings you out of your thoughts. You nod.

«Oh, yes I’m listening»

«You don’t know what you’re doing» Namjoon’s hand falls on Jungkook’s thigh, lightly slapping it. He shrinks on his side of the sofa, eyes shutting down.

«I know» he whines.

«That’s at least something» the hyung scoffs. 

«Did you talk?»

«No» he lets out. If it wasn’t already clear enough, Jungkook is in very much need of advices.

«We just…»

«What?»

«We don’t speak-» he stops to gulp «like we used to»

Namjoon can’t believe what he’s hearing. 

«What? Why?»

«Cause we simply don’t, it’s complicated»

«It really isn’t» he fights back, slapping his hand on his thigh for a second time.

«Why?»

Jungkook sighs. 

«I just… I think I need time to- get over her or whatever this is, I-»

«You have to talk to her, Jungkook,» he shakes his head, unbelievable «if you don’t, she’ll think there’s something wrong. You have to be clear and-»

«I can’t» he bites down on his lips, rubbing his eyes with the back of his hands. Sleep is getting to him and the fact that tonight he didn’t sleep well makes it even worse.

«I can’t tell her»

«It’s worse if you don’t! Your friendship is not going to be fixed magically» 

«That’s the reason why I need time» he blubbers. 

«And the reason why she’s looking so gloomy» Namjoon’s response dejects him even more.

«I know I’m being a dick,» he stares down at his feet in the slippers «but I can’t lose her»

Silence is the answer that accompanies him. The cheers coming from inside the room sound muffled, the light of the moon softly grazing his skin. Just the thought of you not by his side sends a shiver of fear through his spine. He doesn’t want to get to know what it is like to be without you, he can’t.

«Don’t you think that maybe a part of her… at least a small one-»

«No,» his voice is faint «not a small one, not even a bit» 

It stings. So fucking much, it burns. 

Namjoon sees it clearly, the pain written all over his features. To be truthful, he’s always noticed it, even when Jungkook didn’t know. He saw the way he looked at you, his smile when someone mentioned you, the way he would talk about you or what happened to you the day before, the way you made him laugh while doing the dishes, how he was ready to put you first, even before him. It actually makes it hard for him to understand, how it took all this time for Jungkook to realise. 

«Even when you were- like intimate?» 

Jungkook’s eyes shoot right to his hyung’s face. He always tries not to think about that, for as much as he can. Even though, some nights your hands on his skin haunt him, your moans in his ears, your taste on his lips.

«I don’t think so» 

«Did you kiss? Like, or I don’t know, was like- two friends having sex or- what was it like?» 

Jungkook wishes he didn’t ask. Cause bringing the thought of you looking so vulnerable and ready for him in his arms sends back feelings he tried so hard to hold back in the last two weeks. 

«It was…» he takes a deep breath, letting the air out from his mouth.

«Consuming» his breath gets stuck in his throat.

«We were just…» he shakes his head «it wouldn’t be the same for her. I loved it in a different way»

«Maybe,» Namjoon pats his shoulder gently «but how was she? Like, was she like the 

Y/n you always hang out with? Like- you know, how awkward it can be when two friends fuck, come on» he chuckles lightly, not really wanting to be explicit about the two of his best friends.

«She was sweet. Like, so sweet. The last time, she…» he closes his eyes, munching on his lips. The scene playing in his mind leaves him in agony, it’s pure torture to remember you in such a crude state, all for him.

«She was in pain. When she called and we were at Taehyung’s place-»

«That night?» Namjoon’s eyes shoot wide open, mouth hanging as the youngest nods.

«She was in pain, she hurt her ankle. But the way she looked at me, kept me close… the way she opened up to me just- it kills me to remember her in that way» he sniffs. His eyes are glossy. He wishes there would be a better way, an answer written somewhere, a safe recipe to follow. 

His friend understands that he can’t ask more. Jungkook is in pain. And he wishes he could do something about it, even though he knows he can’t. So he just hugs him, his hand patting the youngest head to comfort him at least a bit. 

«Jungkook!» you yell from your living room. You’re tired. It’s becoming too much, and you need to talk, right now. 

You don’t hear any answer, so you stride to his room. The knock on his door makes him grimace, eyes staring directly at it.

«Come out,» you stare at the white wood, arms crossed in front of you «please» you add, voice softening.

He lets go of his clothes, laying the folded pieces on the bed more carefully than the others. 

«I cooked you dinner, I left a post it» the door opens, revealing him in all his height, hair still a bit wet from the shower. The black hoodie he’s wearing makes him look smaller and it involuntarily warms your heart a bit.

«You said you were going to sleep» you murmur.

«I am» he says.

«You’re not,» you shake your head «you’re mad at me. Did I do something wrong? Please, just tell me, it’s killing me» 

Jungkook stares at you blankly. His eyes scan your features for what seems to be an hour. He shakes his head slowly, guilt takes over him, the displeasure clear on his face. He softens, a step towards you and all of his defences fall down.

«I’m not mad at you» he’s sweet, voice covered in honey. 

«You aren’t?» your arms fall at your sides.

«You’re mad. There’s something off, you’ve been ignoring me for the last two weeks»

«I-» he cuts himself off, closes his eyes for a second. 

«I wasn’t… I…»

«Please, just talk to me» you plead. You can’t stand this atmosphere, not with him.

Jungkook shakes his head, his arms wrap around you in a tight embrace, it’s all he can do.

«I’m sorry. It’s just that work has been rough and I’m all over the place, just- I’m sorry» 

The knot in his throat is getting thicker, but he can’t say more. He knows he’s been a dick, a total idiot.

«You say that but I…» you shake your head on his shoulder, your arms move around him and you feel him sniff. 

«I promise there’s nothing wrong» he whispers, he moves his hand up and down on your back to soothe you, the other keeps you close.

«I’m sorry» 

«Talk to me» 

His hair tickle your skin, the itch makes you rub your face on his shoulder to tone it down and his hand fists the cloth of your shirt.

«If you feel like you need to vent or just… anything» your back shakes, and he knows you’re about to cry. Tears don’t fall though, you try as best as you can to not make your sensibility take over you even though your eyes are burning.

«Ssh, don’t cry, please» he sounds pleading, voice faint and shaky. It’s killing him for real, to not open up to the person he loves the most, you’re his best friend, his person. And he just wishes so much his feelings never showed up, that he didn’t look at you so differently from the way you look at him. 

«I will. I will, I promise» he blows. 

The atmosphere in your house feels light. It’s back to normal, with Jungkook walking around the place on a Thursday night, his voice echos in the kitchen as he wipes the floor, one of the songs he’s been listening to lately getting sung over and over again. 

«Jungkook, you need to see this» you call from the sofa. His eyes travel to where you are, the light of the kitchen shines stars in his irises and the beanie he’s wearing makes him look so cute. He leaves the broom carefully balanced on the side of the counter, his feet tiptoeing towards your spot. He squats down, eyes squinting at your phone.

«Woah!» his excitement makes you giggle as his hands zooms in the picture. 

«It’s our niece? I need to call Yoongi hyung! Did he send it to you?» 

You nod, a big smile on your face.

«Wait, how do you know it’s a girl?» 

Jungkook shakes his head.

«I can feel it» he beams.

«Where is my phone?» 

«I think you left it on the sink» you answer. He nods eagerly, getting back up. The way he hops all the way to the sink makes your turn and laugh, he’s so dorky you want to slap his cute little ass. 

«Fuck, I stepped on the dirt!» he whines, stopping right away. You laugh even harder, hands grabbing your stomach as he huffs and gets his phone. He comes back to the couch, falling on it with a thud and raising his feet on his knee. 

«Don’t do it here!» you scold, still laughing. He simply giggles, wagging his toes at you.

«Clean it for me?» he laughs. You want to puke.

«Ew! What’s wrong with you?» he laughs so hard you start laughing again too, looking at him as he just simply wipes it on the carpet. You roll your eyes, pinning a mental note to vacuum it later.

«Aigoo, I never walk without slippers and now this happens» he complains, shaking his head. 

He quickly finds his hyung’s contact and puts the call on speaker. 

«Jungkookah» Yoongi’s voice fills the room, the younger smiles brightly at the screen.

«My hyung is going to be a dad! Yah! Bring us out for dinner» you slap his thigh, glaring at him. Yoongi laughs, totally expecting his request.

«I will. You saw the ultrasound?» 

«Of course I did,» he nods «I feel like it will be a girl. Am I right?»

«We don’t know yet. It’s too soon, but I don’t think so. Hyunjoo says it’s a boy» 

«Really?» he narrows his eyes. 

«How was it?» you ask, the excitement is uncontainable. You’re so happy for your friends, can’t wait to meet the little one.

«I cried,» he laughs, «I thought I would hold it in but I cried. Fuck, I’m so happy Y/n» 

«I know,» you chuckle «how are the cravings?» 

«Ugh, getting worse» he whines.

«I came home and she was eating pickled cucumbers,» he moans out of disgust «made me go back to the supermarket cause she needed mustard. Couldn’t she just send me a text before» he shakes his head even though you can’t see him.

Jungkook chuckles, his body getting limp on the cushions.

«That’s what you get for making me clean the ten servings of noodles you spilled the other day» 

«Yah! I had to set the table!» 

«You were the one who spilled all!» he fights back.

Jungkook is really trying. And it’s going fine, it’s not hard to enjoy his days with you, it is never been. You just have chemistry together, you laugh almost all the time and never find it boring to be together. It’s just. 

It’s just the way his eyes linger on your rosy cheeks too much, he has to remind himself to look away, back to the movie playing on your tv. Or last night, when you were dancing to your favourite girl group’s new song, the way your lips curved into a beautiful smile, hair flying in the air and he had to hold back his smile, too big.

If he looks back to all these years, it makes him laugh, how fucking long it took him to realise how much you had of him. You spent entire days together and he would still do the same as he does now, stare at you mindlessly just for the sake of admiring you, then getting back to what was happening around him. It’s always been here, this feeling. It just took him so much to come to surface and even when it did he tried so hard to make it go away, push it down inside him until it became too much too bear and it hit as fucking hard as what you mean to him. All he repeats to himself is that he just has to do what he’s been doing all along, right? He lived with this for years, a day more won’t hurt him. 

«What are we doing tomorrow?»

He eats the last bite of pizza, cleaning his hands with the tissue.

«Yoongi’s taking us out for dinner» you answer, getting up to clean around. You grab the boxes and the glasses, the coke under your arm.

«We have to go grocery shopping» he adds. He sees you nod, you put the boxes on the counter and the glasses in the sink, make sure the coke is well closed and then put it in the fridge. It’s almost empty, the redness of the gochuchang box parked on the first shelf stands out too much with nothing beside it.

«Yes» you nod. 

«Are we going early? We can have breakfast out» 

He gets up from his spot, waddling to you. A big smile is all you need to understand his answer. Breakfasts out are the best. 

Breaksfast out means getting up on time. Something you both struggle with, since you spent yesterday night awake until late. Jungkook has the tendency of staying in bed until he’s at least a bit awake, staring blankly at something as he sits up, eyes puffy and hair messy. You just storm out of the bed knowing that if you don’t you’ll fall asleep again in a matter of seconds. 

You knock on his door, no answer in sight. 

«Jungkook!» you call again. You hear the shuffles of the covers, his cute mumbling words that haven’t been invented yet.

«Get ready, let’s go have breakfast» you say. You hear him moan as he stretches, take it as your chance to go back to your room and shower. 

It takes you both twenty minutes to kind of be ready for your day, your eyes both puffy and a bit red. You decide to go to your favorite cafe and when you arrive a wave of excitement washes over you. It’s been so long since you had a nice and relaxed breakfast outside, the feeling of being free the whole day and not having to worry too much. Jungkook watches you smile as you order and play with your phone as you both wait for your food, his pinkish lips curling up into a beam. It feels good to see you like this; relaxed, happy. It reminds him of when you were younger, with less burden on your shoulders. 

When you go grocery shopping together it usually ends up with him pushing the cart and you filling it up, he points at a snack from time to time and you end up adding it to the rest. You come home for lunch, watch a movie right after until your eyes start to fall shut, so you decide it’s time to take a nap. Jungkook stays on the couch, wanting to see how it ends. You fall asleep well, sleep for two hours straight until your alarm rings. Silence fills the house when you wake up and you guess your friend is probably napping too, so you tiptoe out of your bedroom to get a snack, until you hear him.

He’s working out judging from his grunts coming from the bedroom in front of you. You’re used to it, Jungkook likes to stay active and just fills his time like this from time to time when he has time. 

Just, this time your mind wanders. You hear his sounds, picture him sweaty and with his muscles flexing, his eyes focused and his jaw clenched, his breath rough… until you’re wet, pulsating. You hold your breath, close your eyes. And you go back to your room, shut the door.

Scenes of him eating you out play right in front of your eyes, his moans. You end up on the bed, your trousers off and your panties pushed on the side of your lips. There were times when the thought of him in this way turned you on after you stared fucking but you always pushed them away, telling yourself that it’s not right. Just, this time they hit you harder. It’s been a while since you had sex and the way he sounded just makes you want to open his door and… you shouldn’t do that. Just focus on you, you think. 

Your fingers graze your clit, go lower to get your wetness on your fingers then go back to their initial place. You see him between your legs, his fingers inside you and his dark doe eyes staring directly at you. You hear him whisper, telling you how good you take his cock, how your pussy wraps so good around it, how good you make him feel.

The image of his cock fills your mind, leaving you with the need to suck it and hallow your cheeks around it, his grunts filling up your ears, the sweetest sound ever. You feel his fingers, delicate and warm, they touch you and caress you, his kisses on your lips. 

You see him on top of you, telling you to be careful with your ankle, eyes worried and arms wrapped around you. You feel loved, for a second. A kind of love that doesn’t belong to a friend. You feel admired, beautiful. The way he looks at you with pure affection makes you hiss, his words in your ear and your bodies tight. 

Feels so good, getting to have you like this.

See him pounding into you at the slowest pace, his fingers gracing your clavicle, his hair on your shoulder. The way he checks in with you to make sure that you’re enjoying this as much as him, begging you not hold back your moans.

Gonna give my baby what she needs.

You shiver, legs shaking. 

His fingers on your clit, his cock brushing against your walls with each thrust, his whines. The way he called you. 

Ssh, let go, his voice faint as the pleasure takes over him, his balls tight, give it to me, love. You cum, silent and incredibly hard your orgasm hits you like a wave during a thunderstorm, impossible to hold back and too good to decline. 

You lay on the bed, breath stuttered and eyes shut. Your heart beats too loud. 

The first time you had sex it just happened. You don’t know what exactly went through your mind, the reason why you had to start it all; your body moved on its own. Jungkook was tired, arrived late at home and was sleepy. You cooked him dinner, kept him company while he ate even though you had dinner already. You listened to him whine about his day, the tiredness evident in his voice. A few minutes later you were on the way to your bed, already too intertwined with each other and with the new feeling bubbling up between you to stop whatever the hell was happening. 

The second time, it was pretty much just the same, you didn’t go to each other with the intent of fucking, but you ended up just like that, with his cock in your mouth and his eyes on your face. 

The third time, it was because you ended up talking about what was happening and how you should behave, how you should keep your friendship away from your rendezvous. It stared just like that, but again, you didn’t really behave that much.

And then, the last time. 

You never once went to each other with the intention of fucking. You wonder when is it going to happen again, in what way, the reason that could start it all. Would it be so bad if you just grabbed him and started it? Does that make your relationship different ? It would, you guess. But is it any different not looking for it but don’t say no when it happens? You don’t even know why you’re thinking about such questions, when you should be focusing on work. Today was stressful, you had a ten minutes lunch break because you had to go back to the papers on your table. You’re tired and your period is on the way which is probably the main reason why you’ve been feeling horny for the last four days. You should just leave it as it is or take care of it on your own, not really into casual sex with strangers or clubs. You wish you were more like Hana sometimes, enterprising and more likely to be ready to have some fun before she used to date Jin.

Your phone rings, displaying Jungkook’s name.

«Hey» you answer. 

«I’m bored» he whines from the other side. You picture him with his head falling back and his eyes shut, pouty lips.

«What should I do?» he stretches the last word out, childish tone. 

«Cook me dinner please?» you try. 

«Already did,» he huffs «when are you coming home?» 

«I have so much work to do, I don’t know» 

He whines again, leaned on his stomach his cheek is squashed against the cushion of your couch, arms by his sides and his legs kicking the air. 

His voice comes out muffled: «Please, I’m so bored» he complains. 

«Jungkook, I’m working» you sigh.

«Can I come?» he stares at the screen pleadingly, his ankles crossing as he flexes his toes. He eagerly takes the phone in his hands, eyes stuck on your name. He had a long day today, and even though he wishes he could go to bed already even though it’s only 8 pm, he’s not feeling sleepy nor tired, quite the opposite actually. Being alone in the living room is boring him too much, and he doesn’t feel like going to to someone else’s place, giving the usual noisy meeting they usually have. He just wants to relax, but not on his own. 

«Kook-»

«I’ll let you work, I promise» he begs, «I just want company»

If he could be an emoji, he’d probably be the one with the moist pleading eyes. You know it, the expression he makes when he craves for something, and that’s exactly your weak point.

A deep sigh makes his way out of your mouth, he can hear it from the phone. Silent follows right after.

«Okay, bring me food though please? I’m starving» 

«Yes!» he punches the air with a fist.

«I’ll be there in ten, I think. Just text me what you want to eat»

«The dinner you already made?» you ask. Jungkook licks his lips, this time the silence fills his part of the call.

«Okay, then be there in twenty I guess» he huffs.

You shake your head, what a moron.

You realise in this period you’re really all over the place. And you also ponder, how long is it been since you had sex with someone? Not Jungkook, someone else. Jungkook is your friend, you shouldn’t think about him when you’re touching yourself to get some stress out or just when you’re craving for sex. It’s not right, it’s not the place of a friend. It’s making you stressed, to think about sex and link it to his face in your mind. You shouldn’t have done it in the first place, you think. You also thought about telling him that it can’t happen again, but it seems like it’s not going to happen anyway. You’re glad. 

So for once, tonight you let Eunji and Hana take you to a club, with just the intention of trying to take your mind off of it. Your methods didn’t work until now, so maybe theirs will. Your friends know you too well though.

«There’s something wrong, I smell your frustration from here» Eunji inhales dramatically, a grimace forms on her face right after.

«Ew, it smells bad. Like onion and soju mixed together» she likes her tongue out disgusted. You laugh, Hana shakes her head.

«That’s the guy behind you» she points at the man dancing his ass out on his own, totally drunk.

«For real though, what’s wrong?» 

Both of their eyes linger on you. You sigh.

«Just feeling a bit overwhelmed» you shrug. Your friendship it’s deep, meaningful, full of memories, you know you could tell everything to them and they would understand. You could even tell them about the rendezvous you had with Jungkook, but that would put you and him in a not so comfortable position with your friends, the last thing you want is for them to think that you have sex with each other consistently. 

«I’ve been sleeping with someone» you announce. Eunji coughs on her drink, Hana’s eyes shoot right open. They stare at you as if you have two heads, still on the dance floor. 

«Oh, come on! It’s not that shocking. I-»

«We need to sit» Hana takes you by the hand, Eunji following right after. The couches are not really big, but you fit into one without any problems. The people are less here, the smell of alcohol and sweat too, thankfully. 

Their attention goes back to you; «Is he someone we know?»

«Why would you? No,» you shrug «you don’t know him»

«Is he good?» Eunji sips from her drink. That’s a weird question, not the one you would firstly expect from her.

«What? Why?» 

«You seem stressed and you said it yourself that you’re overwhelmed, so it’s either one of the two: he’s so fucking good that you can’t stop thinking about it or he totally sucks» straight to the point. Hana caresses your shoulder, glaring at Eunji for her ways even though you know that deep inside her she wants to laugh.

«No! He’s- I mean, he’s… good. It’s something else that bothers me»

«What?» Hana coos.

«He’s my friend, and it just happened. Different times» you explain.

«So you’re fuck buddies now?» Eunji raises her eyebrows.

«No! It just happened, we don’t do it often. I just… I don’t know how to explain it, it’s not like we see each other in that way. We have a good friendship, like- we value each other. Every time it happened, it’s not like we were expecting it or-»

«That’s worse, I guess» she shakes her head. You’re about to say something, but her words leave you wordless. 

«What, why?»

«Listen, I don’t think you can be friend and still sleep with him. If you had sex, that means you’re attracted to each other. Even if it’s not in a romantic way, it just… If it just happened, girl, there was sexual tension between you. I guess» she adds the end just because your expression is giving her shivers. The look on your friends’ faces screams panic.

«It would be better if you had a clear answer on what you are. Like… mmh, you know I’m bad at explaining things!» she whines, «Hana, please help»

Your friend sighs.

«Y/n, is this thing still happening? Like, are you still sleeping together?»

You shrug.

«It’s been a while,» you let out «actually, that’s the problem»

«You want to-»

«No, I don’t» you cut her off.

«I realised that it’s getting too much. Like, I think of him too much in a sexual way it’s making me feel uncomfortable»

«That’s what I meant» Eunji nods. 

«I’ve been there. Remember Hyun?» she chuckles. 

Of course you remember him. The guy was not really close to her, but it was the start of a friendship still. They used to have sex everywhere, their friendship ended up with them fucking each others brains out, after two months, they couldn’t bare it anymore. The atmosphere was heavy, too much sexual tension without even really having a conversation. The fact that Jimin started to find interest in Eunji made her end it even faster.

«We’re not like that though. We have a good friendship, we trust each other and-»

«And you have sex. Not regularly, it happens without any expectations. So it means that you don’t see each other as fuckbuddies, but there’s sexual tension. That’s the base for a relationship. If you put sex into the mix, you end up with butterflies in your stomach. I’m just saying that if you value him that much you should be careful. Understand what you want» her voice softens at the end, but you’re too upset by her words to notice. Eunji hates to be the one saying this, but she has to try at least. You need to know what you’re doing, set some boundaries wether you decide to do something or the other. 

«Y/n, you know that we love you. Eunji’s just trying to-»

«I know» you nod, a knot in your throat. 

«I just… I need to go home, need to clear my mind and sleep over it» you sigh, monotone. Your hand grabs the pochette laying by your side, eyes scamming the club that suddenly seems to little. You shouldn’t have slept with him in the first place. You know that you don’t feel feelings towards him, but thinking about him in such ways… it makes you feel guilty, like your friendship could lose its meaning, like it’s stained. Like it could get out of control. It’s too much to think about him when you’re alone deep at night, like the last one, his face invading your mind when your fingers are deep inside you, even though you’re trying not to picture him. 

«Now?» Hana asks, the worry in her eyes is clear. A glance towards Eunji and they’re both nodding, communicating with each other without having to speak. They know you too well, they could see the panic in your eyes even with theirs closed. 

The way back home it’s short, the music playing in Eunji’s car does nothing to ease your mind even though it’s your favorite girl group, your friends glance at you from time to time from the rear view mirror. When you get off and say goodbye, they wait for you to shut the door behind you to look at each other, eyes wide open and jaw hanging. 

«Jungkook» the name is crystal clear, both of them letting it out with a shocked expression.

«It’s fucking Jungkook» Hana nods.

Jungkook didn’t think that coming back home early meant this. 

You said you had company, texted him twenty minutes before he got off work, but he wasn’t expecting this kind of company. He was expecting Eunji and Hana, maybe Taehyung or some of your friends, a coworker maybe. Definitely not you getting fucked in your bedroom by someone he can’t identify. 

This is torture, it’s all he can think. When he arrived nothing seemed weird or odd, expect for the fact that he found the living room empty. As he started getting closer to his bedroom, he realised. And fuck, the slap he got on his face, the punches that hit him on the stomach and on his chest left him breathless, his injuries in pain and itching, his eyes shutting. 

This is torture, it really is. 

He moves from the hallway, goes to the bathroom to wash his hands and wet his face with cold water.

He can’t stay here, not in such a moment. Not when he can hear you like this, with someone else. It hurts. Fuck, it fucking hurts, it stings, it tears him wide open all the way from the inside to the last layer of his skin. His eyes burn, lips twitch. And suddenly, he’s sobbing. Sobbing in his bathroom, his reflection pitiful and broken. His breath is rough, cheeks stained from the tears, vision foggy. A whimper comes out of his mouth and he bites on his lower lip, repeating to himself that it’s okay. But it’s really not.

Jungkook’s eyes are swollen, puffy. You think it’s because he’s still half asleep, but when you meet his eyes you’re taken aback. He looks tired, as if he didn’t sleep well, but they’re a bit red. He cried? You didn’t hear him coming in yesterday night, you knew he worked late and left him dinner ready, but when you woke up today his food was just where you left it, the table still set. 

«Kook?» you coo from the counter. He hums in return, head hanging low on his shoulders and eyes staring down at his legs, he sits on the couch with the tv playing in front of him. 

You turn around, wash your hands quickly and dry them with a paper towel. You tiptoe to the sofa, glance at him from the side. Your senses are tingling, there’s something wrong. 

«Kook, look at me?» you ask sweetly. He stays still, fingers fidgeting on his lap. He thought you were still sleeping, his room felt too tight to stay in it any longer. He wishes you had different opinions on open spaces, when you were looking for a house. Maybe you wouldn’t have seen him with a wall dividing the living room from the kitchen, and he would be tiptoeing back to his bed already.

«Please?» you try. 

It’s to no use. All you can do is gulp, worried for what’s going on.

«Is something wrong?» you ask.

«Did something happen?» 

He doesn’t answer. He knows if he opens his mouth now he will start crying again. Maybe you should just sit beside him and wait for him to open up. You turn around the table, take a sit next to him and pat him on his shoulder. 

«Koo» you call again. He doesn’t even look at you. Your hand stays there, trying to give him some comfort but it only makes him want to break in a loud cry. 

«Please» you whisper. 

Yesterday, he thought about going over to Namjoon’s place or just anyone else’s, but he didn’t want to show how miserable he was. Thankfully, that guy was out ten minutes later. What a fucking joke, if he found just a bit more traffic coming home he wouldn’t be feeling like shit now. 

Your hand leaves him, you get up and for a second his lips tremble, his walls falling down as he thinks you’re giving him some space. But then, you kneel down. In front of him, right between his legs with your fucking beautiful eyes staring at him. Your expression changes; the worry gets more urgent, pressing. 

«What happened?» you’re breathless. You’ve never seen him like this, it scares the shit out of you and he can see it perfectly. You reach your arms around him, his breath cuts off.

«Don’t» he whines, voice faint, pleading. You don’t understand what is happening, your head is spinning. You put your arms back down.

«Talk to me» you whisper. He has tears in his eyes, his lips are red as if he’s been biting them all night long. He turns to the side, his eyes burn when he stares at the wall without blinking. His lips tremble. 

«Koo, please. I’ve got you»

The dim breaks. His chest shakes, expression contorting as the first tears start coming out. He sobs faintly, shakes his head to himself and looks down to the ground. It’s physically painful, to see him hurting this much; you wish you could take it all away from him and make it yours, if only that was possible you’d do it even if it hurt ten times more. It couldn’t hurt more than this, though.

Your hands wrap around him, holding him so tight to you that you feel his sobs vibrate against you. 

«I’ve got you» you soothe him, caressing his hair. With your warmth around him and your caresses, everything falls down into pieces. Every part of him breaks harder, the tear gets wider and deeper, your words of reassurance fill the wounds up but don’t sew them, they just make them heavier to the point that they pierce him and make him empty. Your hold suffocates him and your warmth is painful, your caresses bluffer him. 

«I- I c- Please I-» he shakes in your hold, not able to speak. Your eyes burn, seeing him like this it’s atrocious. 

«Breathe» you beg, holding him tighter.

«Please breathe for me Jungkook, breathe» 

He hears how your voice is shaking, sniffles as he tries to breathe properly, sobs bubble up from his chest when he inhales. Your cheek brushes against his neck, you leave a kiss out of comfort and his hands instinctively fist your shirt. He tells himself to slow down, think properly and hold back but with your loving arms around him it’s a nightmare.

«Ssh, it’s okay. I promise» you whisper. Time slows down, you just focus on his breathing. One thing at a time, you tell yourself. You, need to calm him down first, you need to see him breathing properly, at least a bit lucid. Stroking his back up and down you think about what you can do to make him relax. You’ll make him some tea as soon as he’s doing better, it will soothe him at least a little bit.

«I’m here for you» 

Jungkook’s breath moderately calms down,  his sobs still come from time to time, but you have all the time in the world. You don’t care about how long it’s going to take him to stop crying, you just know that you want to be here, need to. It’s desperate, the need you have to make him feel better, almost consuming.

«I’m- ngh- I’m sorry» he hiccups. He buries is face in the crook of your neck, his cheeks are still wet and his hair tickle you.

«So sorry- I’m really-»

«Ssh, it’s okay» you repeat. You keep stroking his hair, Jungkook seems to quite down the more you do it, his hold gets firmer too as if he’s trying to anchor himself. 

«Did something bad happen?» you try. 

He moves in your hold, making you squeeze him tighter until you realise that he’s looking for a way out, so you let go. He wishes it was this easy, that his feelings could let him free just as easy. With you between his legs,  it gets hard to breathe again. The way your eyes linger on his face, scan every feature and every expression, even the way he bites the inside of his cheek. 

«I… I’m sorry» he mumbles low. This time, his eyes look at you. Clear, transparent, vibrant fear lingers in them with so much weight that it takes away your braveness. Jungkook’s eyes stay in yours even while they fill up with tears again, they don’t budge. The knot in his throat gets back, your presence suddenly feels blissful and he wishes he could just linger in this feeling. The feeling of you being close even if it’s only like this, keep being satisfied with only having a part of you.

«It’s- too painful» he breathes. 

«What is it?» you look at him from down, with your glassy eyes and he just-

«I- I… I love you» his voice trembles. 

Silence fills the room.

His words make a dull sound in your head, your body stiffens, lips ajar. Jungkook is frightened, totally stuck in place. His heart beats so fucking loud that it will explode.

The shock it’s too big and it stops you from letting the three words sink in, all you can do is stare at him blankly as he holds his heart in front of you.

«I’m- I can’t,» he shakes his head «it’s too much. I just… it’s killing me» 

«You…» you gulp «you don’t mean it that way, right?» your voice trembles.

«It’s just- we-» you shake your head, take in a deep breath.

«We shouldn’t have- it’s because we had sex. It has to be because of that cause you didn’t-» you stop talking. 

Jungkook stays silent, his chest burns, the tears in his eyes get uncontainable, until he breaks again. His shoulders tremble and he sniffs but it’s so silent that it’s even more consuming. He looks at you with such eyes, such vulnerability and fear at the same time, as if he was a stray puppy and you his possible saviour or his next predator. It scares you. And you understand his answer, because you know him, because it can be seen from miles away. 

It’s not because you slept together.

«I need-» it’s hard to breathe properly «I need air» 

He’s confused, he mistook his emotions, most surely. It has to be that. How can- how can it be not? You’re his friend, his best friend. The one he likes to tease, the one that knows him almost as deep as he knows himself. The person he- this can’t be right. It simply can’t.

You can’t come back home. You really can’t, he needs space to think this through; you need it. You need peace, somewhere to relax, to just don’t think. If you go to Eunji’s place maybe- she will ask. Hana too, and what about Jin and Jimin? Maybe a hotel room is the best choice, in that way you won’t receive questions, no one will get curious. 

Thank god you had your phone in your pocket when you went out and weren’t wearing home clothes. You book an hotel room not too far, call a cab since you left your car keys at home. 

You can’t face him now. 

You walked a lot today, wandered around without a destination and ended up sipping a bottle of strawberry mogu mogu on Han river. Your phone buzzed at lunch time, then again at four pm, another time just fifteen minutes ago, but you didn’t take it out of your pocket. It scares you, because you know that it’s him. 

Your hotel room is a beautiful one, has a big double bed with fluffy pillows, big bathtub, snacks in the fridge, a beautiful view on the eighteenth floor. The big buildings and the city lights make you feel small, the look of the man at the reception desk too. He probably doesn’t care about the reason why you’re here instead of sleeping at home, but your mind does. Maybe then, you’re the one who makes yourself feel small. Still, you don’t want to care. You can’t go back home, not now. What would you do? What would you tell him, how would he look at you? You need time. 

When you lay on your bed, your phone buzzes again. You breathe in as you open the messages.

From Jungkook🐰 12.37pm

I’m sorry. I cooked you lunch, I left the food in the oven so it will still be warm when you come back. I ate early to give you some space. I’m really sorry

From Jungkook🐰 4.13pm

Where are you? Please be safe. Your car is here, do you want me to come and pick you up? Or I can call a taxi. Just, please be safe

From Jungkook🐰 7.54pm

Y/n, I’m worried. It’s dark outside and I went out to look for you but I just don’t know where you are. I cooked you dinner, so if you come back it will be in the oven too. Just text me so I know that you’re safe at least, please

From Jungkook🐰 8.33pm

I’m really sorry, please come home. I’ll go to Taehyung’s place if you need to be alone. Where are you? It’s dark outside and I’m really worried

Guilt takes over you, makes his way through every single part of your body until there’s not a single piece of your skin that isn’t drenched with it. Your fingers move on the keyboard, eyebrows pinched together.

From Y/n🧸 8.36pm

I’m safe. I booked a hotel room for tonight, so don’t worry. I need a bit of space, so I don’t think I will be back tomorrow. 

Jungkook’s fingers never typed an answer so fast.

From Jungkook🐰 8.36pm

I was so scared that something happened

From Jungkook🐰 8.36pm

Please eat dinner and don’t skip your meals

From Jungkook🐰 8.37pm

I won’t text you if you need space. Just, do you want me to bring you your car keys? You left them here

From Y/n🧸 8.39pm

No, it’s fine. 

From Jungkook🐰 8.39pm

Okay

From Jungkook🐰 8.45pm

I know you don’t want to talk right now, but I just need to tell you this: I will always have my arms empty for you, whenever you need a safe space I will be here. As we’ve always done with each other. Please remember this. Sleep well 

You wonder how is it possible, to be friends with someone for so long and don’t notice that there’s more. You wonder when it begun, how. Where did the friendship end and the love begin, the boundaries. Which one of his gestures where made out of friendship, which were made out of love. How did he realise. Why you. 

For the three days after you left home, all you told yourself was that he was confused, that he mistook his feelings, that it can’t be true. After you spent yesterday night walking in the streets, took another walk on the Han river and even dared to eat dinner on the riverside, a good look at the waters took your mind back to his eyes. To the way he looked at you, his eyes clear, transparent and full of vulnerability and fear when he opened up to you. What if, he’s always been in love with you, it’s always been this way. What if he’s not misinterpreting his feelings, what if he really loves you. 

It scared you even more than the day before.

You never saw him that way, your friendship has always been just friendship for you. Until- well, it’s still friendship. Eunji wouldn’t say so, but for you it is. So where does love start for you? With attraction most of all, you guess. With the want and the need to feel someone in more ways, physically, emotionally, sentimentally. With wanting to be whole. Love is… butterflies, feeling loved, giving love, taking care of each other. So where is the boundary? The boundary of friendship. 

Because fuck, today you start to wonder, you think that Eunji is right. 

What do friends do? Are you not allowed to feel all of that and still call it just friendship? What if, what if you are the one mistaking yourself? What if it’s something else, what if it’s not just friendship anymore. When did it start, when does it end. You’ve always craved this things with Jungkook. Always craved for physical touch, maybe not in a sexual way before, but what if you just didn’t ponder on it too much because you’ve always restrained yourself into thinking that you were just friends. You’ve felt the need to share, to the point that you got a home with him. You’ve always wanted him emotionally, always were ready for him in whatever occasion, always felt close to him. You’ve always felt loved, you’ve always gave love back. You always took care of each other with all yourselves.

Would you do all of that for any of your friends, for Taehyung, or Namjoon maybe? 

You’re not too sure. You don’t think so.

Is it the same with them? Of course not. You would do anything for them, but you guess it’s not in the same way, not as deeply.

What about before, even before the first time you had sex. Because maybe, it could be that you’re thinking this just because you slept together? Like, you could be the one mistaking your emotions now. 

You still felt this kind of connection before, though. With the Jungkook who was just your best friend. You don’t feel it for Namjoon who’s just your friend. You don’t feel that kind of tight embrace around you when he lingers his eyes on you for too much, his laughter doesn’t make you giggle like Jungkook’s. You don’t feel lost when he’s not talking to you or not meeting your eyes when you look at him. You wouldn’t want to have anything more with him in the first place, cause he’s just Namjoon. And for god’s sake, you wouldn’t have wanted it with Jungkook neither, if you didn’t feel already more. The fact that you were already ready to just welcome him in when the opportunity of being closer knocked on your door, well… that’s the answer. You still remember it, the frustration of seeing him so tired and the need to make him feel better after a shitty day, the need you had to take care of him when you first slept together. 

You were never just friends. Maybe in the first place, maybe at the beginning, maybe when you were younger. You just simply got used to him and his presence, never really gave your eyes a chance to see clearly, never really made yourself look at him differently because he was just… your Jungkook. 

But, what now? Is he still- Jungkook? Like, your best friend? Now that you realised, now that you understand the reason why you wondered when the next time was going to be, how; the reason why his eyes slipped in your mind at night, his words, the way he called you the last time you slept together. 

Now that you realise that, could you go back to who you were before? Just, craving for his touch but telling yourself that it’s not okay, looking at him and wishing you could take away all of his tiredness but thinking that it’s normal, for a friend. Wanting to take every part of him and know it all, looking from far away, peeking out and stealing some but not getting it whole. Could you still do that? Cause before, you didn’t know at least. Now, could you? Sentimentally too, would you be okay with it?

Jungkook just wants to go to sleep and forget about the shitty day he had. He didn’t sleep well tonight, the house feels to empty without you and last night his brain just wouldn’t stop working, kept wondering about you. If you had dinner, what time did you go to sleep at, how much did you work, if you finished the last drama you were watching. 

Today, it was pretty much just the same. The fear of you not coming back insinuated in his mind at some point during work, he even took a break and had a snack but he just kept picturing himself inside your house, all alone. Him without you, his best friend and his person. He typed on your chat for multiple times, asking you if you were eating your meal correctly, how work was going, if you were craving for ice cream just like he was, he texted sorry too, but he always ended up not sending the messages. 

He’s tired, work was rough and he wishes he could just go back in time to ask you what you want to eat for dinner, he’d cook it even though he’s tired as hell. He wouldn’t sleep for three days straight, if that would be able to bring you back just to have dinner together. 

He hates to know that you feel uncomfortable with him, can’t come back home because he’s there, that you won’t look at him in the same way as you did before. He hates to not have you by his side, when just a look could make him happy. 

The guys packed him on the shoulder, told him that he did the right thing, but he doesn’t think so. These days have been hell. There’s not a day that goes by that he doesn’t think about the way you looked at him, how he stuttered those words out and doesn’t regret it. 

Today they all had lunch together, with Eunji, Hana and Hyunjoo too. It was so odd to not see you there that he kept spacing out all the time. The girls didn’t talk about you and he even though he wanted to he didn’t ask because probably you didn’t tell them what happened.

The elevator doors open and the end of the hallway looks so far from here that he wishes he could teleport. Even the passcode of your door seems too complicated to enter now. He types the first three numbers, his eyes glued on the screen.

The door clicks, a grimace on his face, lips pouty in confusion. Then, your face. 

Jungkook looks at you as if you hung the stars in the sky, as if you were one of them. His eyes open wider, lips ajar, his shoulders fall down. He feels like he’s dreaming. Is it real? You’re home. When did you come, why? What- fuck, he feels like he’s going to cry.

The way he looks at you with his big starry eyes, it makes you gulp. How your fingers tingle for the need you feel to squeeze him tight and never let go. There’s a knot in your throat and all you can do is stare at him and linger in the feelings that hit you like a fucking bucket of cold water. And it’s bitter that they taste like they always did: the sweetness is the same, the audacity just bolder now that you let the door open: but they taste just the same. All this time, all these years. They’ve always been in front of you, you’ve always been way to deep and only realised after so much. 

«I… I- I cooked you dinner» 

He doesn’t budge, still on the doorway and with his eyes glossy. You reach your hand to him, Jungkook still stuck in place as you gently grab his wrist to make him come in, his body almost stumbling at your touch as he enters.

You close the door behind him, leave his wrist. 

«You- you… what? Are you…» he shakes his head, totally astonished. 

«You cooked?» his tone makes your lips stretch into a smile.

«I cooked,» you nod «I cooked us dinner» 

You didn’t think your heart could beat this fast. You really didn’t notice it for all this time. Every time it happened you always blamed it on something else, not the man in front of you. When his words would make you feel comforted, when you’d search for his eyes in the room, when just his presence was enough to make you feel at ease; in every moment the emotion you’re feeling now would bubble up in your chest just for you to push it aside without even noticing, a tag with the label friendship covering its true pinkish colour.

«Take your coat off» you coo. Jungkook stands still for a few seconds, still stunned. His eyes stare at you blankly until he nods. He puts his bag on the ground and hangs his jacket, you watch him move, eyes lingering on every part of him that you missed too much. His long hair, the bangs on his forehead, the mole on his nose, the one right under his lips. When he raises his eyes and finds you staring, you don’t move your eyesight. His eyes pierce right through you, deep and transparent just like the last time. They are scared, vulnerable and totally defenceless; if you looked closely enough, maybe you would’ve always seen it. 

«Jungkook, I…» 

His arms wrap around you. 

It’s tight and soothing and the fucking consuming. You squeeze him in your hold, your head falls on his shoulder and you know that you can’t hold it in any longer. 

«I’m so sorry,» you sniff «I was selfish. I’m sorry. I- I just-»

«Ssh, it’s okay» he sniffs too. The tears burn his eyes as he tries to keep them in but having you here in his arms makes it harder. He feels you hiccup, your back shakes, your hands fist his shirt, and your nose muffles into the crook of his neck. He clenches his jaw, squeezes you tighter.

«I’m sorry too»

«I was so scared. I just- I didn’t realise»

He knows, fuck he knows. He just wishes you wouldn’t vanish away. Don’t, just don’t cause he doesn’t think he will be able to forget himself.

«It’s okay, you don’t- just please don’t leave me» he whimpers. 

Jungkook breaks down in your arms. He loves you too much, values you too much to not have you in his life. He doesn’t care how much he has to hurt or hold back, he can’t do this without you, without his best friend. The house felt so empty without you.

«I won’t,» you sob «I promise I won’t. I’m sorry I made you worry and left. I needed time and- I- I needed to think» you sniff. His hands stroke your hair and you let go of a deep breath. You missed the feeling of his caresses, how his touch is always been enough to sooth you.

«You didn’t do anything wrong» he whispers. A tear streams down from the corner of his eye, it tickles his cheek and makes him loiter in the warmth of you even more.

«No, I- I was selfish… you opened up to me, and I- I left you. I’m-»

«You’re here,» he whispers «you came back. You’re here with me, you- you didn’t leave» his voice breaks and you feel him tremble. Your heart clenches and stings in your chest as he nuzzles his nose into your neck.

«Just- please,» he pleads «stay with me» 

Your dim breaks. You shake your head, lay your lips on his neck. He whimpers as he hiccups and when you lay a soft kiss on his skin Jungkook feels like dying inside. Your lips are so soft. Your nose brushes against him, another kiss laid on his skin just right upper, then another one and another one until you’re just under his jaw, his breath unstable as the tears wet his skin. Your hands leave his back, your body parts slightly, his hands reluctantly let go of the hold he has around you. You cup his cheeks, soft and reddish from the crying, look at him in those beautiful stars. They’re a bit swollen from the tears, his cheeks are damp, his lips trembling. 

«I was so fucking scared that I didn’t realise»

«Me neither,» he nods «but it doesn’t- it doesn’t matter. Just don’t leave. I can’t-» he gulps harshly. 

«The thought of not having- you by my side, it killed me. I- I couldn’t sleep, work was hell, I-»

«I’m not leaving you» your hand tenderly strokes his hair. Jungkook stay still as you dry his tears with your thumb. You want to slap yourself for causing him so much pain, he must’ve felt so scared already and you just- you just made it harder. You should’ve talked to him, should’ve faced him.

 «I promise» you smile softly. Jungkook could implode for how happy he feels right now, with you smiling at him just in the same way as you used to. Your lips tremble and a new hiccup comes out. His arms go back to where they were before, they squeeze you to him and it’s so familiar and bittersweet, it smells like home and trust and all you can do is let go in his embrace.

You let the rest of your tears come out, hear his breathing slow down, feel his heartbeat against you. You kiss his jaw, your lips tickle his wet skin, your hand reaches behind his neck and Jungkook wishes he could just take his heart out of his chest and step on it, make the feelings go away. But it’s just too saccharine, the way your lips linger on his skin for a second too long, how you perfectly fit in his arms.

«I want you,» you whisper «I want you whole» you lay another kiss on his mandible.

«I want every part of you, every- everything you can give» you peck his chin, look at his eyes. Jungkook doesn’t understand, his eyes wide and glossy stare at you as if you were telling him to solve the hardest mathematical problem ever. Still, he looks at you with such tenderness that it makes your insides twist. He’s lost, totally. 

If his love could be represented, he’d paint you in pinkish colours, then in black and white, in blue and all the colours in the world. He’d make a different version every time just to admire at your face some more, to keep the next one to himself when the lights will make the one before fade, so he’ll always be able to meet your eyes just like now. Remember the feeling you light up in him.

«I love you» 

It’s odd, how lives intertwine. How people can take and give from each other pieces that can’t be seen, how two roads that never meet can lead to the same place. It’s beautiful, the way you speak. It’s dreamy. Its dreamy, the way you look at him, the way he used to look at you for all this time, it’s beautiful how your lives intertwined, how you became each other’s mystery and answer at the same time. How you’ve walked together for all this years, silently hand by hand but without ever looking down at them, not even knowing. 

Jungkook laughs. He laughs as his tears fall down and he thinks that maybe the world will end, cause his head is spinning. You chuckle and your eyes are wet, and suddenly your hands cup his cheeks again.

«I love you» you repeat. He shakes his head, sniffing totally in disbelief.

«I do» you laugh, nodding. His head stops. His eyes widen slowly, the look on his face makes you bite down on your lips, it’s like seeing the sky clear after a thunderstorm, as if the sun was peeking out from behind the dark clouds. His mouth opens.

«I do» you whisper. 

Suddenly he wants to cry even more. Your lips lock with his and it’s so gentle and sweet, and oh god, so consuming. You take all the space, every cellule of his body, all the air in the room, in the house even. You leave him breathless, lungs burning on fire. His lips are soft, wet with tears, salty. Jungkook whimpers in your mouth, his hand reaches your face and fuck, there’s no end. No end to how fucking much you have of him, how much of him is yours. 

His thumb strokes your cheek, his other hand falls on your waist. His tongue is warm, his eyes shut, eyelashes fluttering against your cheeks, both of your hearts pounding. You kiss slowly, sweetly, lovingly. You wish you could never let go, have him like this forever. And for the first time your thoughts are the same as Jungkook’s in this moment. If he could read your mind, how big  would be the smile stretching on his face. Jungkook smiles on your lips, his teeth brush against your tongue, his digits on your waist lightly dig into your skin. When you part, your eyes are still shut, foreheads pressing against each other.

«I’m sorry,» you mumble on his lips, he shakes his head, pecking your lips with such tenderness «I’m sorry it took me so long to realise»

Jungkook is the happiest man in the world.

You came back, you’re in his arms, you love him. You fucking love him, you do.

«It’s okay, it’s perfect. You- just please come to me» he guides you close to him again, you shut your mouth when his warmth wraps around you, his eyes shut. You don’t want to let go, you won’t. 

«Jungkook» you call softly. He hums against you neck, his lips dare to peck your skin and he can’t fucking believe that he gets to do it cause he simply can.

«When did you realise?» 

«I already knew» he murmurs.

«But… on Eunji’s birthday… you came back home and were so drunk. You slept with someone else and I just- I guess my feelings were so strong that I couldn’t control them anymore»

«I slept with someone?» you ask, your head shooting up too look at him. Jungkook nods.

«You said he had a pretty dick» he chuckles for your choice of words, even though he can still fill it sting. Just the thought of you in someone else’s arms makes him heart clench. 

«Oh! No!» you laugh, «Jungkook, I didn’t sleep with anyone. He was peeing outside of the club and I was so drunk that I kept repeating him that he had a pretty dick for all the way home» you explain.

«Ew, it’s so embarrassing. Eunji made him take me home because he’s her brother’s best friend» 

Jungkook can’t believe his ears. His eyes are about to roll out of his sockets for how wide they are.

«You- I thought…» he shakes his head.

«I didn’t, you know I don’t feel comfortable in those type of situations» you shake your head.

«Even though… last week I-»

«I know» he murmurs.

«You know?» he nods. 

How does he? You don’t understand, how is-

«I came home early and- I… heard» his words are faint, a thin line that holds all the pain his heart was stained with. It echoes in the room, gets back to your ears until your eyes widen and you feel disoriented.

«So you-» you can’t even process your words properly «I’m so sorry, fuck» you really don’t know how to apologise. He was at home, while you were under another man. He heard you. His eyes were swollen the next morning, that’s why. He couldn’t even look at you. 

«If I knew, I wouldn’t- I…» 

He smiles softly, his heart clenches. 

«You’re in my arms now» his lips tremble slightly.

«I just kept thinking about you and when it was going to happen again. I kept telling myself that we shouldn’t have slept together in the first place, I felt guilty that I thought about my best friend in such ways and- I- I told myself that it was happening because I hadn’t slept with anyone else for a while»

You do your best to explain without getting your words intertwined, but Jungkook’s expression doesn’t change into an angry one, he doesn’t glare at you, doesn’t budge. He just nods, smiles sweetly. 

Love can be blind. It can blind you to the point that you can’t see straight, can’t decipher what’s happening. You were scared, lost. 

«I hurt you so fucking much» you whisper. 

«Maybe it had to happen, for us to be here» he whispers.

«I don’t care about anything,» he strokes your hair «It hurt. But you’re here with me and I just- I just want you close to me» 

His arms hold you just for the sake of it. 

His warmth is intoxicating, the sound of his breath too. You wish you realised sooner, you wish that he didn’t have to hear you in such circumstances cause the pain on his face the next day was unbearable. When he saw you the next morning, all he could think about was you under someone else, your skin against his, your eyes looking at him in the same way you looked at him. The same thoughts that teared him apart for all night long. But now, it doesn’t matter. It was just a step that had to be taken, in a way or another. It was just something that guided you to him, in his arms right now.

Something in the air shifts. All your senses tingle, they scream for him and his touch just the same as Jungkook’s. He wants to have you, the most vulnerable part of you, like no one else ever did. You want his lips and his caresses, his eyes deep into yours.

«Let’s go to bed?» 

His breath catches in his throat.

«I want you closer than this»

The path to your bedroom never felt so good to walk on, with Jungkook’s fingers digging in your hips and his lips on your neck. It’s thrilling, the feeling running through your body. It’s saccharine, sugar coated. Your hands in his hair fit so good, the way you whimper when you stumble cause you can’t see in front of you, how he chuckles on your lips. 

«I want you in my bed,» he breathes on your lips «wanna keep you there all night long» 

Fuck, the way he makes you melt in his arms with just a few words. You nod eagerly,  letting your hands run on his back. Jungkook can’t hold himself back any longer, gripping you by your thighs and kissing your neck, his lips are wet and with the air your skin fills of shivers. His fingers dig into your skin as he moves towards his bedroom. 

«I want you so bad» you whine. 

«Gonna give it to you baby, everything you want» 

The door is shut and Jungkook doesn’t seem to want to let go of holding you as he kisses your lips. It’s too much to ask of him, after loving you for so long. You’re too breathtaking, too perfect.

«Let me» he kisses you again «open the d-» another kiss. You laugh on his mouth, his giggles fill the air as he keeps pecking your lips. 

«Kook, the door» 

He smiles big, turns around to make you open the door without letting you go. It stays open when he walks inside, doesn’t care at all and just walks to the bed, leans you down on his sheets. 

«Take it off» you mumble. He moans when your hands reach his skin under the shirt, nuzzles his face into your neck. You lift the cloth, Jungkook kisses your clavicle, his lips get as low as your shirt permits, his nose brushes against the swell of your breasts. You pinch his back, giggle when he whines.

«Want you naked» you remind. He laughs and looks into your eyes, totally drunk. 

«You’re so impatient» he sniggers, making you smile and turn. Your cheeks grow red as your eyes look at his nightstand.

«Look at me» 

His fingers reach the hem of his shirt as you turn again, he lifts it more and takes it off from between your legs; the view makes you salivate, his muscles on full display, his brownish nipples getting hard with the cold air.

«Want me to take my pants off too?» 

You want to smack his ass but you refrain yourself, you know he’s just teasing you like always.

«Shut up» you shake your head. His fingers reach the button of his pants, he slides it through the hole, pulls the zipper down. 

«Let me» you sit on the bed. You kiss his neck, let your fingers graze the skin of his chest, your touch makes his cock twitch, hard and swollen in his boxers. You let your hand pass over his navel, down until you reach his dick. 

Your hand lingers on it, Jungkook’s head falling back. 

«Fuck, you’re too much» he moans. 

«Make me so hard by doing nothing» he hisses. Butterflies fill your chest, your hand squeezes him through the cloths and you feel yourself getting wetter as he lets out a rough breath. God, the sounds he makes. They make you want to surrender to him and his pleasure, you feel the need to take him in your mouth as if your life depended on it. His hands go back on your body, fast fingers fist the material of your skirt. 

«You’re too impatient» you mock. He hums a soft giggle looking at you. 

«I am» he admits. Your sneaker in response makes him smile big and he lays his forehead on yours. He looks at you with those eyes, all the stars in the world couldn’t be as bright and magnificent as them and you can’t help but dive deeper and deeper. 

«I want to make love to you, wanna make you feel so good» and it feels so good to be able to say it out loud. To let you know.

You kiss him, really too impatient to hold back any longer. He helps you out of your skirt, takes your shirt off, makes you lay on the bed as he takes his pants and boxers off, his socks too. And fuck, the way he looks. How fucking gorgeous this man is when he’s just standing in front of you with his cock hard and standing proudly, cockhead red and swollen, skin exposed and the tattoos on his arm on full display.

«Fuck, come here» you beg. Jungkook doesn’t let you repeat it twice, his body hovers yours and you open your legs to welcome him. He kisses your right hip, his lips are wet and they tickle your skin, make you squirm under him as he cups your breast from over the bra. 

«Fuck, I love you» he hisses as he looks up at you. You can’t control the beat of your heart, too lost in him and how much youu’ r been missing. You can’t believe it took you so long to finally understand. Your lips part as you stare down at his face, his dark eyes on you. He kisses your stomach with his eyes in yours, the scene makes you so wet that you wrap your legs around him and Jungkook’s cock brushes against your panties. He moans, the most beautiful sound you’ve ever heard, his mouth is still on you and the lace of your panties feels so fucking good on the underside of his cock that he shuts his eyes. He can feel your wetness even through them, they are soaked. Fucking hell. Your legs squeeze him more as you look at him, his mouth open and eyebrows pinched together. You lift your hips, to give him some friction. Hic cock twitches against you and you let out a breathy moan that makes him open his eyes. 

«Oh, fuck» he moans. It’s guttural and so fucking sexy. You can’t wait to hear more, you want to make him crazy. 

«Grind against me» you breathe. His cock twitches again, his jaw clenches. He lets you pull him closer with your legs, keep him tight against you until his cock is practically glued to your panties, your pussy totally soaked. His hands cup your breasts and he squeezes them gently while looking at you, your head digs into the pillows, a moan escapes your lips and Jungkook can’t help but do the same. His hips move tentatively, his cock rubs against the lace and the pressure gets to your clit. Your moan makes him whimper, your voice so sweet that it makes him repeat his movements. He can feel the outline of your lips from your panties and it’s fucking killing him.

«Fucking panties» he hisses, somehow making you laugh.

«Mh, what?» he smiles at you, his cock still brushing against your throbbing clit. You bite your lips.

«Nothing, just you» you shake your head. The pleasure is so good. Jungkook keeps smiling as he kisses the tip of your nose.

«Me what?» he asks, his fingers get under the strap of your bra, he pushes it down on your shoulder. 

«Just you,» you smile «I don’t know» 

He’s so fucking happy. 

«Am I funny to you?» he bumps his nose against yours. His movements are slow and controlled, his thighs glued to the back of yours, eyes right deep into yours. He moves his hand under your back, his fingers fumble with the opening of your bra.

«Sometimes» you laugh, cupping his cheek. You kiss him sweetly, Jungkook smiles on your lips as he lifts the bra from your chest, he guides the straps down your shoulders and your arms until he lets it fall on the ground. He pecks your lips once more, finally fondles your breast with his hand. Your nipples are hard and he wants to tease them until you squirm under him. His cock jerks when you moan under him, the pads of his fingers brushing against them. 

«Kook» you whimper. He kisses your neck all the way down to your chest, his lips lock around the pebble of your nipple as he teases the other with his fingers. Your back arches, mouth opens. 

«Feels so good» you breathe. He flicks his tongue repeatedly, sucks lightly as he ruts his cock up and down on your clit. Your legs tremble, he lets go of your nipple and takes the other in his mouth. It feels too good.

«Fuck» 

His hand travels on your stomach, his fingers pass your hip and reach the inside of your tights to caress it softly, tickling your skin until he presses his cock against you with his palm, his cockhead heavy on your clit. You squirm under him as he kisses your neck, his moans fill up your ears as he works his cockhead on it.

«Tell me you’re mine» he nuzzles his face into your skin. His balls are so tight he could cum right now.

«Jungkook, I’m going to-» you can’t even speak, you’re so close your blood is running hot in your veins. The pleasure it’s too much, it keeps building up and you just want to succumb.

«I’m yours» 

«Only for me» he grunts.

He parts his cock from your pussy. You want to ask why but a second later his fingers link around the hem of your panties and he pushes them down onto your thighs and over your knees until they pass your ankles and get lost in the room. The need to take a good look at your wetness stops him from pushing his cock back to where it was. He stares down at your lips, parts them with his fingers and fuck, he wants a taste. Your juices are leaking out from your hole so deliciously that he can’t hold back and gathers them with his thumb. 

«So fucking wet» he praises. 

His lips wrap around his thumb, sucking on it and tasting you, his cock twitches as it stands angrily. You taste so sweet, so delicious for him that he promises himself he’s going to make you cum like this tonight, eat every drop, swallow all your sweetness. And then start all over again.

«Wanna be the only one who gets to taste your beautiful pussy» 

Your hands grab his wrist on your leg as you nod.

«I promise» you whisper.

Jungkook lays on top of you again, he lets his wet thumb brush against your nipple as he his cock parts your lips and slides back between them. Your folds feels so good against him, the sensation makes him bite on his lips as he suppresses a loud moan. Your nails dig into his back as you look at his face, so fucking beautiful. It’s paradoxical how you think he looks like an angel when his cock it’s sliding against you so agonisingly.

«I want you to cum like this» he breathes.

He pushes his cockhead against your clit, rubs it in circular motions and then up and down, from side to side. Your juices mix with his precum, it’s so fucking wet that your juices drip on his sheets. He wants them to smell like you, to remember the way you smell when you’re working and he’s waiting for you at home, wants your juices to fucking claim his sheets. 

«Can you do it? Cum all over my cockhead, baby. Do it for me»

Fuck, how couldn’t you. It’s too much. Especially when he’s asking you like this, looking at you like you’re the essence of his world. 

You nod quickly, your chest raises up and down at a torturing pace and Jungkook can’t take his eyes off of you. He loves you so fucking much, you’re his. Fucking his.

«I’m- fuck, I’m going to cum» 

«Me too, baby. Cum with me?» he sweetly brushes a strand of your hair behind your ear, he kisses your cheek with such tenderness and sincerity and your heart just can’t process it. It explodes in your chest, your legs shake and suddenly you’re whimpering and squeezing your eyes shut, your head digs into his pillows, your walls tighten. Jungkook grunts, pushing all the length of his cock against your folds and wrapping you closer to him in his arms. He cums so hard that his head falls on your chest, his moans muffled against your skin. His cock jerks, his cum wets your stomach and drips down your thighs and onto the sheets, a bit of it on his abdomen and chest too as he lets himself lay on top of you. 

It’s blissful, the way your fingers stroke his hair as he breathes harsly, he feels his heart pound and his insides melt. You stay silent, look at him just laying in your arms. You never felt so light, so free as now. Love can be blind, so blind that something so special had to wait all this time to finally be seen; all these years and your souls intertwined in every way possible, the roots of your plants were always in the same pot. You were so used to his presence and his leaves that you didn’t realise how much soil you shared, how deeply were intertwined your roots, how they held each other up with such tenderness and love. You want to see his flowers, want to share your water with him, you want to bloom and wilt with him, you want it all. 

«I love you» 

You caress his cheek even though you can’t see them, his eyelashes flutter against your chest and he raises his face to look at you, then rests again on top of you.

«I love you too» he answers. A big smile. Starry eyes, rosy cheeks, messy hair, totally love drunk. And you couldn’t love it more. You pinch the apple of his cheeks, he scrunches his nose and pouts his lips. 

You feel attacked, seriously.

«Why are you so cute?» you whine. His giggles fill the room as he gets up. He lays beside you, wraps his arms around you and squeezes.

«I want to spoon you» his fingertips dig into your hips as he kisses your shoulder. You huff contently, turning around. His legs intertwine with yours and Jungkook rests his head in the space between your shoulder and neck, his chest tight against you.

«Are you comfortable?» he pecks your cheek. It’s perfect.

You nod and shut your eyes, lingering in the feeling of the moment. 

«Don’t sleep» he whines, pinches your hip.

«I haven’t finished with you yet» 

«What? I’m tired» you laugh. You really aren’t, but you like to tease him. Your eyes open, head turns slightly to look at his eyebrows furrowing as he frowns. 

«It’s not true» he blubbers. Fuck, how can he look so adorable in such a situation? All naked, tight against you.

«It is,» you pout back «I’m really tired» you fake a yawn. His head falls on the pillow. 

You stay still for a little, then decide that you want to look at his pretty face. He wails as you turn around, clearly not okay with it.

«Let me spoon you at least»

«Wanna look at your pretty face» you puff at him. His body relaxes and when you turn around the view hits you like a truck on a highway. His hair are messy, long strands following sweetly the roundness of his cheek as he stares at you. His eyes are round, doe-like, incredibly profound they capture the light of the room and exhibit it perfectly, stars scattered across their skies. His lips are red, and it’s because of you. You caress his cheek, brush the strands away. He smiles largely, his hand grazes the back of yours and squeezes it, his other one behind your back so sweetly that you melt. 

«You can fall asleep on my chest» he murmurs. You shake your head.

«I was just teasing you,» you giggle «don’t wanna sleep now» 

He huffs, faking annoyance but it’s just really endearment.

You graze his chest with your fingers, tickle him with the nails as you slowly move up and down. His cock is still hard, the tip red. 

«You’re… you’re still hard» you breathe. 

Jungkook looks at you, the way your eyes stare at his cock on his abdomen, a big smile stretching on his lips as his cheeks grow a little reddish.

«Can’t help it baby,» he simply says «it’s what you do to me» 

He doesn’t lead the conversation anywhere else, as if he doesn’t intend to do anything about it, a dreamy sigh leaving his lips. He stares at you in awe, he can’t believe he gets to do this. In his arms, you naked and relaxed, laying down to stay. You don’t get up to leave his mattress and go back to just being friends, close but not close enough, a heartbeat away. Laying with you feels ecstatic. It’s the forbidden fruit, the one he always craved for; the intimacy of it, being in your rawest states and still trusting each other in such a profound way, getting to see each others fully in every way possible, physically, emotionally. 

«Love» you whisper. His big eyes look straight at you, his heart stumbles in his chest. 

«Last time… you called me love»

«I… couldn’t hold back» he shakes his head, nuzzling into you. 

«It felt different from the times before, it was…»

«I was making love to you» he mumbles. The way he clings his chin to the fist of his hand on the pillow right after makes your stomach clench. The silence creates a foggy haze in the room, but you still see each other clearly. He must’ve hurt so much, for so long. You want to make him smile. You want to reassure him, make him feel loved just as he did to you that day. 

«My baby» you whisper, leaving a peck on the tip of his nose. He scrunches it and smiles big at you.

«Let me do the same- » you kiss his lips and although the intention was to go for just a peck Jungkook’s lips keep you attached to him like a magnet «and make you feel good?» 

«Mmph…» he moans as soon as your hand reaches the base of his cock. You feel it twitch, watch it as it gets even harder in your hand. Jungkook gulps, shuffling on the mattress to get comfortable. The view of your pretty little hand around him makes him longing, yearning to have you all over him. He doesn’t even have to wait after cuming already, he knows he could be ready for you right now. And when you stroke him, oh god, the sound he makes… you wish you could record it and play it all over again and again. 

He folds his arms, rests on the back of them to look at the view properly, head up and chest raising roughly.

«Fuck, I love it» he hisses. You lick your lips, get closer to him on your side as you let your hand pull his foreskin back, his cockhead furious and leaking precum already. 

«You like it?» you coo. He looks at you, your lips wet and your eyes gawking at him. You make him powerless just by doing nothing. Your thumb touches his slit.

«Shit, yes» he moans.

«Love it, I love it» 

You smile at him. Jungkook can’t take his eyes off your face and your hand, not even for a second. When you gather his precum and stroke it all over his cockhead he breathes hard and suddenly he craves for a taste of you. His chin points at you, lips pouting as his cock pulses in your hand.

You peck his lips, tighten your hand around him and twist your wrist. He moans loudly, his head falls back. 

«Fuck» he cries. 

«You’re so beautiful» you whisper. 

«Want you to feel so good» 

He nods lazily, his eyes shut. Your hand is… perfect. Just perfect. It makes him thaw under you, for you, until he’s just whining and moaning, totally lost.

«You- nnngh- you do» 

You push his hair behind his ears, you don’t think you’ve ever felt this feeling. This kind of excitement while doing something for someone else, only for him. This part of you is his, tied and bound to his soul.

«All the time» he shivers.

«Every fucking time you- fuck» his moan is high pitched, desperate. He’s losing his mind, it’s too much when you stroke his cock and have your pretty eyes looking at him so sweetly, holding all the love he always wished to get from you. It’s too much, and he just wants to explode.

«Every fucking time, you don’t even realise,» he shakes his head «you- you just, fuck I love you» 

It’s brutal, how he takes your face in his palm and pushes your lips onto his, brutal for your heart. Such a crook.

The kiss is messy, sloppy, totally heedless. He just wants you close, it’s just for the sake of feeling you more, and it makes you so wet you feel your juices drip down your asshole.

«Love you- so fucking much» he whines. You kiss him more, stroke his cock until his balls are tight and Jungkook is squirming on the bed, his sounds creating the perfect melody for your ears, his pleasure skyrocketing until he just knows he has to stop you. 

His hand wraps around yours, stopping your movements. 

«Want you,» he hisses «wanna cum inside you while I feel you close» you couldn’t resist such a plea even if you wanted to. 

You smile at him and nod, your skin is on fire just at the thought of it. Jungkook’s hand tickles your side as it descends on your hip, his digits dig into your skin. He goes to sit up but you stop him with your hand on his chest. 

«Huh?» he hums puzzled, his lips forming an “o” and his eyebrows high.

«Let me» you smile. Fuck, he feels like cuming already.

«Let me take care of you» you whisper. Jungkook hisses as he lays back down, soft strands of hair spread on the pillow and starry eyes look at you while you straddle him. He doesn’t know if you resemble more an angel or the devil himself with your love surrounding him and your dangerous touch, but maybe you’re the collision of both. 

You lay down to kiss his lips, a soft and gentle kiss that makes him yearn even more just because it’s ohso lovely. 

He must’ve been blessed, cause when you let your hips grind against him and he feels the warmth of your core he feels like he’s in heaven. Maybe you’re an angel, most definitely the prettiest of all. 

Your lips feels so fucking good that his cock jerks and he has to hold back himself from cuming.

«Fuck, wait-» he hisses. 

«I don’t think I can- I need to desensitise a bit or I- I’ll cum» 

You stop your movements and lean down to kiss him some more. You caress his cheek, Jungkook’s arm can’t help but keep you close and tight against him. Your soft breasts feel so good against the hardness of his chest, your hair hanging down from the side of your face. His hand squeezes your asscheek and a cheeky grin appears on his face.

«Feels so good to get to do this» he pipes. 

«You used to do that before too» you snigger and he squeezes your flesh once more.

«Only in bed» he laughs. You shake your head and pinch his right nipple lightly, watching as he keens and brings his hand to cover the injured part.

«Why?» he whines with his eyes closed. You lay down and kiss the tip of his nose.

«I get to do this too» you coo. He sighs deeply and glares at you, lips pouty.

«You used to do this before too» he murmurs. You smile at him.

«Not in bed? I should’ve and could’ve but I didn’t. I had to try» 

«Fuck, you’re so annoying» he groans even though a big smile is already stretching on his lips. It’s beautiful how the change of your relationship didn’t change the way you act around each other, the same old habits and teases. 

«Should I kiss it for you?» you laugh. Jungkook peeks at you from his half lidded eyes.

«Do I get to kiss your ass when I’m outside of bed?» 

Your laugh fills the room, the apples of your cheeks full. He pushes you onto him, his hand coming to your face, he kisses your lips, pecks your nose and your cheeks, your forehead too. Silence spread in the air as he pours his love onto you with caresses and little sighs, totally rapturous.

You kiss his neck, his clavicles, his shoulders and his pecs, lick on his nipple. Jungkook squirms under you and a second later you’re… kissing it. He laughs out loud, his giggles are high pitched and he scrunches his nose as he lets his head fall back on the pillow. So fucking cute, you think. You want to keep him in your pocket and never let go.

«Are we ready to go?» you giggle as he still laughs. Jungkook nods, eyes bright. His bangs are messy and you take some time to brush them with your fingers as his chuckles summer down. 

«It’s gonna be messy again, come on» he whines. 

«So impatient,» you sigh «let me make my baby pretty» you coo. Jungkook whines again.

«Please,» he strokes your back «wanna be inside you» 

«Mmh, ‘kay baby» you hum against his lips. You nuzzle your nose into his neck, blow on it just to hear the sound of his humming when he shudders under you as you take a hold of the base of his cock. He’s so hard that you let out a dreamy sigh, totally in love with the feeling of him in your hand. Jungkook’s hips stutter up, his cheeks paint of red when his eyes meet you and you wonder if it’s just the warmth of the room or your effect on him.

Your core brushes against him and he releases a soft yearning hum. You sit up, breast on full sight and eyes on him as you push yourself onto him. It’s so fucking wet and tight and delicious that he doesn’t ever want to leave your pussy. Fuck, he’d spend every second of the day inside you if he could. 

«So tight» he moans. You slowly fill yourself up with him, he grabs your breasts and squeezes them, fumbles your soft flesh as you start to move unrushed. You’re so beautiful on top of him, so pretty. All for him and him only. 

«Talk to me» Jungkook wants to hear your words as you ride him. The position is totally new to the both of you but fuck, it feels perfect. He fills you up so good that your walls pulsate all around him, getting to see him under you with his big dark eyes on your face makes you want to spoil him in all the love he showered you with the last time and even more, you want him to feel totally engulfed by it, from how much you love him. 

«Love it, I love your cock» you moan. You put your weight on your hands on the bed, leaning back a little as his cock hits the perfect spot inside you. Jungkook pinches your nipple, your breasts look so good that he wishes he could kiss your skin. He watches them bounce with every move, feels his cock throb and leak precum inside you. It’s so fucking wet, your juices mixed together and god, the sounds you make could make him crazy.

«How much?» he hisses. You bite your lips.

«So much baby» you whine. His hand reaches your clit, he rubs it gently with his thumb and looks at your face. His heart pounds wildly, you turn him on so much that he has to restrain himself every time. However, now he wants you close and even though he’s loving the way you’re taking him so good, your body is too far for him. 

«Love» he calls out putting both of his hands on your hips and staring up at you. You look down at him, his skin is a bit sweaty and his lips red from all the kisses you shared. Jungkook sits up.

«Want you closer, please» he maffles. 

«Let me open my legs so I can hold you» 

You let his cock pull out, the loss of contact makes you grimace and Jungkook smiles endeared as he pinches your cheek. He opens his thighs, his cock stands proud against his abdomen, so pretty. He guides you onto him, your thighs over his and your pussy back on him. His hands grab the flesh of your ass, his face hides in the crook of your neck and he breathes in your scent as you take him back into your heaven. Like this, he thinks he could die happily. Fuck, so close and perfect. The contact of your skin makes him breathless, the feeling of you all over him, so tight that not a single inch isn’t against him. The way you hug his cock makes his head spin, how you grind your hips into him and dig your nails into his back. Your moans in his ears, he captures every single and makes sure that the next one comes out because you’re feeling even better. He rubs your clit, sucks your nipples, kisses your neck, keeps you close until your sweats mix and all he can do is breathe you in.

«You’re perfect» you whisper. His heart trembles, all the defences he had to put on for all these years without even realising are down on the floor, totally scattered in pieces. They burn into ashes, fire takes over them completely until there’s nothing left but haze, and then there’s you. You on top of him, you under him, you on his lips, you in his mind, just you. You’re everywhere, part of him. 

«I was so stupid-» you hiss as he kisses your cheek «fuck, how could I not see it?» 

His nose nuzzles into your cheek and he pecks your skin repeatedly, his thumb rubbing faster on your clit.

«Ssh, we’re- nngh fuck, we’re here now» he reassures.

«Never wanna leave you,» you mumble «never» 

Jungkook feels like crying suddenly. There’s a knot in his throat that tastes like pain, like all the tears he shed and every night he spent thinking about you. All the worry that he felt when you weren’t with him, the feeling of loveliness without you by his side, the feeling of not being enough to be seen, to be considered as more. It all gets back to him and his eyes burn, his vision becomes foggy, his breath ragged for the pleasure of having you here. 

«Baby,» he whines «feel like crying» his voice trembles. 

You stop your movements, totally focus on him. Jungkook shakes his head though, pushes you onto him more to make you keep going.

«Just make love to me» he whispers. 

«I still can’t- still can’t believe you’re mine» 

«I’m yours» you don’t wait a second more to let it out. You watch him beam with his eyes glossy and can’t help but kiss him. You kiss all of his worries away, every single one. As you make love to him so sweetly, they all melt. He cries, salty tears mix with your kisses, your hands dry them and you kiss the path they walked on. You spoil him with your touch, your caresses, even your breath on his skin. Jungkook can’t even speak properly from the feeling in his chest. 

«I love you, love»

«Fuck, oh god- call me that again» he moans. He lets his head fall back as you keep moving, the expanse of his neck displayed for you. You let your hand trace it and then do the same for his chest, rub his nipples and hear him moan.

«My love» you repeat, breath rough.

«Mine, you’re mine»

«Fuck yes,» he whimpers «yours baby» 

You want to make him cum. You want to see him shake in pleasure and contract his abs, you want everything he can give and more. Your hand travels farther down, Jungkook squeezes your ass again as he feels your touch graze his skin until you get to his balls. They’re wet with your juices, so tight and full of cum for you. He moans loudly, his mouth attaches your neck as you caress them sweetly in your hand. Your touch is so gentle and his cock feels so fucking good, his body feels like levitating from how much you’re giving him. It’s too much to hold back.

«God, you’re- you’re going to make me-» he howls «cum» he shudders.

You kiss him deeply, your tongues in each others mouth and your eyes closed, foreheads touching and hearts glued to each other. 

«Cum for me» you breathe on his lips.

«Cum inside me, show me how you cum for me, love» 

His eyes open, eyebrows furrow as he moans. You kiss him more, spoil him totally. You whisper how much you love him, how good he feels inside you, how beautiful he is. Until it’s fucking unbearable, his cock twitches and all he can do is let go. Jungkook groans, digs his nose into your neck in such a desperate way that you feel your heart being wrapped tightly and squeezed almost to the point that you can’t breathe anymore, his whimpers come out muffled on your skin, his cum filling you up totally as you keep moving on top of him and in his hold. You cum with his moans in you ears as you milk him dry, the room spinning and your legs shaking. You collapse in his arms, feel him sob in your hold. Even when you don’t realise it you kiss his hair, stroke his back as your body feels light and wobbly, totally lost in its high. You cup his cheeks and peck his lips, the mole right under, the one on his nose, his forehead. Jungkook never wants to let go. 

«Cuddles» he murmurs on your neck right after, hiding from the world. You nod lazily, his cock still inside you. 

It’s weird, the roads that love takes and the path it walks onto. It’s odd, how it can blossom without asking for permission, how it grows and spreads, takes over everything it finds on its way. It’s beautiful, how Jungkook clings onto you like you’re love itself and you do the same for him, roots intertwined and shared soil in the same pot, one soul fixed together with pieces of each other, like it’s always been. Since you were sixteen and he was nineteen, for all these years. And for many more to come

Read more about Closer here: Closer: Too Close (Teaser)

Read my other works here: Masterlist

Taglist: @p-i-e-d-p-i-p-e-r, @kaitlynlovesbm, @bytheinaya, @jub-jub, @taolucha, @minayas1998, @seoulrenebae-blog, @ppeachyttae, @gluk97, @jk97bam, @diorh0seokie, @gwsjungkookie, @moonlikemeh, @skzthinker, @eyssdumpie, @sleepy-sae, @jjkw-7, @singularityjes, @vvicaddiction, @kimchijeonjk @jungkookieeee97

[a-bright-comet]

Jade Shadows Thoughts

(NOTICE: I have edited this post after a few days and many lovely replies and tags giving me more insight and opinions, overall my view of this quest has gotten a lot more positive, thank you all <3) okaaayyyy I am utterly rattled rn lmao also made the mistake of looking at tumblr after doing the quest and as expected it seems to be a 50/50 of hating or loving it. so here are my personal thoughts, I am a little scared but talk seems to be civil thankfully. I can definitely agree on the sentiment that this quest needed more time, cause let's be honest the people hating this quest wouldn't be jumping to the things they're jumping to if Jade herself got more screen-time before the big drop, warframe's style has always been vague and never 100% straight-forward and I think that unfortunately hurt it a bit this time, as what they didn't show came off wrong to many people and while I sorta see why I disagree on some parts. I also feel like the quest kinda got a bit *too* hyped both by DE and the fanbase's theories, way too short, it deserved and needed to be a bit longer for it's special narrative. Jade kinda got a weird spot, both being the main focus alongside Stalker but also hardly explored. But let's be honest, most of the negativity is caused by this outside-circumstance alone. Now, what I absolutely disagree with is people insisting that DE was trying to say "bodily autonomy bad" or that Stalker didn't care about her and only the child, thing is I thought it was pretty fucking clear that she *wanted* the child in what little was shown and she was going to die no matter the outcome (thanks to the orokin to absolutely no one's surprise) and Stalker in his guilt for all she's done for him wanted to make sure that he at least kept this one promise to Her, cause She wanted it. she still had bodily autonomy in the fact She wanted this, she wanted the child no matter what. and she wanted stalker to protect her and the kid. And he did, like a true loving partner. DE has a long track record of being very autonomy-positive. A point they make time and time again is that ripping it away is *bad* and horrifying, the quest is a bittersweet tragedy, not a horror. Honestly there would be 0 issue if DE had given us a Jade-only quest before this one, I personally would've preferred it as well, she's cool as hell she deserves it. who knows maybe DE will see all of this and make prequel quests? we can only hope. I do not want to assume the worst of anyone or anything cause that's a miserable existence. Look I personally enjoyed the quest and get the feeling whoever wrote it did it out of some personal experience or sorrow, that's at least the vibe I got. It's a tragedy, but her choice was seen till the end, many women choose to still have a child despite knowing they won't make it, many also don't, that's why choice is important. and she did, she chose her child that she was having while likely forcibly infested and turned into a warframe. (also remember there are women on the team who likely looked at this.) there are some other iffy parts of the quest, (really should've been the drifter instead of the operator if they were gonna do that, but that's personal discomfort.) but overall I enjoyed it and open to explore the implications of a born-warframe-child and Stalker healing as they both grow together. These are my thoughts, and I can understand why people like or dislike this quest, but I think it's fine and just ended up in a very unfortunate spot due to outside circumstances beyond it's control. (sorry if any of this comes off as aggressive it is not my intention despite how riled I am by some folk online, I disagree with you but I do not hate you, I don't even know you.)

Her choice, His promise, Their light.

Thank you for reading my first ever text post about something I care about, not sure I'll be doing this again any time soon out of anxiety lol (Edit: and thanks to everyone responding to this post wonderfully, ya'll are great and have lessened my anxiety and have made me appreciate this quest more <3)