#neurodivergent friendly study

[visciously-face-fckd-by-a-cactus]

this is by no means comprehensive, as this app has a skewed demographic to begin with, but I'm just trying to decide on whether this is a worthwhile topic for the women and gender studies project I'm doing.

[ashthenerdtheythem]

I made a community for nd students to share tips and resources with each other. Everything is screen reader + photosensitive friendly. You do not have to be diagnosed, diagnosis is a privilege. It's a really nice environment and everyone is super friendly. Comment under here if you want me to add you and feel free to ask any questions 💙💙💙

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[wangxianficfinder]

I'm in the mood for...

Aug 8th

~*~

1. Could you recommend me a list of the saddest fanfics of mdzs?

I need a trigger to uplift my reading slump. Thanks^^

🔒 salt to the sea by starmins (M, 31k, WangXian, WWX & JYL, Modern AU, Grief/Mourning, Emotional Hurt/Comfort, Road Trips, Additional Warnings In Author’s Note, Canonical Character Death)

Across the street to another life by danegen (M, 99k, WangXian, Modern, unleashed au, Family Fluff, Set in America, Hurt/Comfort, Past Child Abuse, Addiction, Crime, Amnesia, Ableist Language, another fridged mother, POV Alternating, past wwx/ofc, past wwx/omc, Medium parent YZY, A-Yuan is wwx’s biological son, Musicians, Happy Ending)

grave goods by luckymarrow (E, 28k, WangXian, Grief/Mourning, Minor Character Death, Modern AU, mortician!wwx, Angst with a Happy Ending, Established Relationship, Accidental Baby Acquisition, Marriage Proposal, abrupt tonal shifts, Tragicomedy, Comedy, Romance, Angst and Fluff and Smut, Adoption, Implied/Referenced Abuse, for lan parents, it’s not described and is all backstory, Family Bonding, Family Dynamics, Married WangXian, brief daddy kink, the barest hint of consensual non-consent, Anal Sex, Oral Sex, BDSM)

Meet Me At The Corner After Dark by Omen1991 (M, 21k, WangXian, Modern, Ghosts, Angst with a Happy Ending, Hurt/Comfort, Grief/Mourning, Character Death, but he's already dead, Injury, Concerns about self-harm, no actual self-harm, Panic Attacks, Office, Tears, Sad with a Happy Ending, Reincarnation, kind of, mild romance, POV LWJ, Ghost WWX, Neurodivergent LWJ, Amnesiac WWX, Siblings who love each other, Autism, Autistic LWJ, Translation Available)

to the act of making noise by words-writ-in-starlight (WordsWritInStarlight) (G, 19k, LSZ & LWJ, LSZ & WWX, WangXian, Grief/Mourning, Father-Son Relationship, inquiry, LSZ is the best of boys and I will not hear debate, Music, Angst, Fluff and Angst, Found Family, [Podfic] to the act of making noise by Ceewelsh, flamingwell, kisahawklin, Rionaa) This is basically Lan Yuan growing up with Inquiry as a lullaby (and seeing LWJs grief through his eyes). It has a happy ending, but I couldn't get through this without a box of tissues. If you want the emotions dialed up even more, listen to the podfic version with music

ius in bello by Lise (T, 2k, JC & JYL & WWX, Canon Divergence, Tearjerker, Sad Ending, Heavy Angst, Grief/Mourning, Originally Posted on Tumblr, Not A Fix-It, POV JC, [Podfic] ius in bello by flamingwell) WWX doesn't survive Qiongqi Path, told from Jiang Cheng's perspective

dormiveglia (in between sleeping and waking) by comforting_monachopsis (M, 13k, WangXian, XuanLi, Diary/Journal, Golden Core Reveal, Canonical Child Abuse, Canonical Character Death, YLLZ WWX, Oblivious WWX, Protective WWX, WWX Needs a Hug, Grief/Mourning, Burial Mounds Settlement Days, Sort Of, Dysfunctional Family, Family Issues, Thirteen Years of WWX’s Death, Dead WWX, Angst and Tragedy) where wwx doesn't come back but left a journal behind and everyone has to live with it

~*~

2. itmf wangxian dating in cloud recesses study arc?

🧡 Stunted, Starving Juvenility by TomatenMark (E, 828k, WangXian, WIP, Fix-it of sorts, Talisman master WWX, Not JFM Friendly, Study Arc, Getting together, Fluff and Angst, Engagement)

Just Say Yes Series by edenwolfie (T/M, 338k, WangXian, Matchmaking, Pining, Getting Together, Canon Divergence, POV Alternating, Fluff, First Kiss, Declarations Of Love, Humor, Cloud Recesses Study Arc, Good Uncle LQR, Engagement, Hurt/Comfort, Fix-It)

it’s just (aah) a little crush (crush!) by sweetlolixo (T, 9k, WangXian, Canon Divergence, Romance, Fluff, Pining LWJ, Humor, Courting Rituals, Teen Wangxian)

🔒 in the shadow of moonlit flowers by Reverie (cl410) (T, 56k, WangXian, LXC/NMJ, cloud recesses, NHS & LWJ friendship, developing relationship, LWJ pov, minor injuries, autistic LWJ, implied/referenced child abuse, aka YZY warning, genius WWX, light angst, hurt/comfort, WWX protection squad)

💖 Hoards and treasures by apathyinreverie (T, 21k, WangXian, Siblings, Family, not particularly Jiang friendly, YZY Bashing, slightly darker Gusu Lans, LXC being the best brother, Some manipulation, But with the best of intentions, and not between wangxian, Dragon LWJ, Fox WWX, Smitten LWJ, Fluff, perfect happiness, adorable WWX, Romance, Some worldbuilding, courting)

30 Days of Secret Marriage at Cloud Recesses by starandrea (T, 43k, WangXian, Canon Divergence, Bunnies, Gusu Lan Forehead Ribbon, Accidental Marriage, Coming Out, Falling In Love, supportive family, Fluff, Happy Ending, the whole story is happy)

A Wedding of Choice by scifigeek14 (T, 17k, WangXian, Everyone Lives, Marriage Proposal, Episode Related Canon Divergence, POV Third Person Limited)

You Are My Euphoria by orphan_account (M, 17k, wangxian, canon divergence, fluff, making out, 5+1, pining)

loveliness by orphan_account (T, 1k, WangXian, Canon Divergence, Tooth-Rotting Fluff, Love Confessions, First Kiss, Pining, Teen Romance, Getting Together)

~*~

3. ITMF any fics where there is a focus or moment where wwx knows lwj can and will spoil the hell out of him and give him money for anything. kind of like the "it's not my money anyway" moment in the drama. preferably set in canon time period, but won't say no to a modern au if it has a good plot! thank you!!

~*~

4. I was wondering if anyone was aware of any fics that are dark!LWJ but the relationship between him and WWX isn't toxic or dubcon? Something like a mafia, a/b/o, or emperor au, but without the more non-con like elements that are often found in those fics. I would love to read more dark!LWJ, but the tag is full of the more toxic stuff that I personally can't handle (no judgement here, I wish I could lol), so any help is much appreciated! (ITMF ask)

🔒🧡 Rule Number One: Never get attached. by KizuKatana (E, 130k, WangXian, Modern AU, A/B/O, Criminal underworld AU, Fluff and angst, Crime boss LWJ, Rouge criminal genius WWX, Explicit Sex)

Crown Jewel of the Hoard by xFourLeafCloverx (E, 29k, WIP, WangXian, Dark WangXian, Organized Crime, Gun Violence, Consensual Non-Consent, Omegaverse, Shifters, bunxian, dragonji, killing as foreplay and postplay, LWJ is So Whipped, Intersex Omegas, Disfigurement, Blood and Gore, Sugar Daddy LWJ, Jiang Family Bashing, Anal Sex, Anal Fingering) Got mafia and wangxian being together without one of them being forced into it

~*~

5. itmf deaf or hoh wei wuxian please

misunderstood 'verse by sysrae (M, 7k, WangXian, Modern, College/University, Emotional Hurt/Comfort, getting hit by cars, Past Child Abuse, Friends to Lovers, Abusive YZY, Caring LWJ, Injured WWX, partial hearing loss, the real OTP is everyone x therapy)

~*~

6. ITMF fics where Lan Zhan and/or Wei Ying smoke/get high (not drunk) can be weed or harder drugs, also okay if it's just Lan Zhan feeding Wei Ying drugs. @thehappyyellow

a constant satellite of your blazing sun (i obey your law of gravity) by Ariaste (M, 26k, JGY/LXC, WangXian, JGY & WWx, Madam LAN/QHJ, Modern, Slice of Life, Established Relationship, Family Drama, Flashbacks, HOAverse, Marijuana, Nice Lan Boys Marry Gremlins, (bass boosted) NICE LAN BOYS MARRY GREMLINS, OC(s), (sort of), OC Death(s), (but like it's already in canon so you know about it already)) this is part of the HOA series, but does feature wwx and lwj (among others) getting high. Not entirely sure if it can be read as a standalone, but the entire series is hilarious and absolutely worth checking out.

2am on a saturday by detectorist (E, 11k, WangXian, Modern AU, College/University, Recreational Drug Use, (no sex happens while drunk/high!), Humour, Pining, Getting Together, Blow Jobs, it's about the yearning, somehow a harmonica gets involved, the lz/mm/jzx best friends agenda)

~*~

7. Itmf the juniors being protective of WWX?

Rotten Work by ShanaStoryteller (Not Rated, 63k, WangXian, WWX & JL, Post-Canon, Protective WWX, Protective JL, Yunmeng Bros Reconciliation, Reluctant Matchmaker JL)

🔒 The Absolutely True Story of the Yiling Patriarch: A Manifesto in Many Parts by aubreyli (T, 19k, WangXian, In-Universe RPF, Romance Novel, LJY’s sense of justice, OYZZ’s sense of romance, Featuring a surprise appearance by WWX’s oft-absent sense of shame, Look the ducklings just want their sort-of dads to be happy okay?, And it’s not like WWX or LWJ are doing a good job of ensuring their own happiness, LJY rejects canon reality and substitutes his own, highly relatable actually, Post-Canon Fix-It, primarily drama-canon with cameos from novel-canon, Podfic Available, Russian Translation Available)

🧡 the stone-filled sea by yukla (T, 9k, WangXian, LSZ & WWX, Post-Canon, senior wei defense squad, a study of the way prejudice and injustice and anger trickle down from generation to generation)

bespoke by cafecliche (G, 3k, WangXian, Post-Canon, Fluff, LSZ is a very good boy, which is specifically a tag for the fic but also just true in general, mostly novel-compliant but could easily be CQL-compliant too)

~*~

8. hello! for the next itmf, i would love to see fics where wwx does empathy with lxc and/or lqr and find out how mistreated he is. could be during his youth or post-sunshot, either one. thank you!

And Time Is But a Paper Moon by sami (M, 139k, WangXian, XiChengQing, Time Travel, Fix-It, Everyone Lives/Nobody Dies, Healing, Mental Health Issues, PTSD, Hurt/Comfort, Depression, BAMF WWX, BAMF JC, BAMF LWJ, BAMF JYL, Getting Together) I'm not sure if these are quite what the requester was looking for but Lan Xichen uses Empathy (and is traumatized by it) to see a past timeline

❤️ All will be well when the day is done by abCEE (T, 76k, LQR & WWX, WangXian, Canon Divergence, Fix It, Not Jiang Family Friendly, JFM & YZY Bashing, YZY Bashing, Definitely not YZY centric, Fix it for our main characters, Time Travel, Butterfly Effect, Madam Lan Lives, No Sunshot Campaign, Artistic License, Unreliable Narrator, JC Bashing, non-yunmeng WWX, Accidental Baby Acquisition, Good Uncle LQR, OOC, WangXian Get a Happy Ending, WWX gets the love and care that he deserves from the very beginning, Mainly CQL but has elements of the novel as well, WWX Isn’t Adopted by the Jiangs, verbal and physical (c/o Zidian) abuse from YZY) and Lan Qiren uses Empathy to learn who a sick child Wei Ying is and learns about Wei Ying's abuse in his past timeline

Rise of the Divine Oracle by BlakSalt (T, 291k, WangXian, Boy Love, Hurt/Comfort, Romance)

~*~

9. Does anyone have any Sizhui-centric fics where he learns about or pieces together his past with wwx and the wens before wwx comes back? 🥺 Like 'Would You Come Home?' By s6115, that was so good I need more fics with that concept. 😭 Please and thank you 🙏

~*~

10. Hi I wondering if you knew any fics similar to: A Corpse Called by Name by jaemyun👀 thank you so much for your hard work?

~*~

11. rogue cultivator wangji PLEASE

doesnt matter if its like post wwx's death or before the cloud recesses study arc i just have a NEED for rogue cultivator lwj if no one can find any i'll just write it myself i swear

🔒 And Miles To Go Before I Sleep by Glitterbombshell (T, 23k, WangXian, JC & LWJ, LSZ & LWJ, LXC & LWJ, Heavy Angst with a Happy Ending, LXC is not really a good brother in this sorry, Canon Divergence, rogue cultivator LWJ) This one is good & has an interesting impetus for LWJ leaving (the Jin find out LSZ is a Wen) but sadly hasn't been updated in almost 4 years. BTW please write a rogue cultivator!LWJ fic - this is an insanely underutilised trope considering the obvious story potential

~*~

12. Hey! I’m in the mood for any and all fic where Lan Zhan marries into the Jiang sect with Wèi Ying. Thanks! @shapeshifters-anon

The Fire Lapping Up the Creek by notevenyou (E, 66k, WangXian, Canon Divergence, Hurt/Comfort, Canon-Typical Violence, Injury, Injury Recovery, Blood, Respiratory Illness, Major Illness, Fever, Grief/Mourning, Burial Mounds, Angst with a Happy Ending, Implied/Referenced Suicide, Hunger and food scarcity, Surgery, Fix-It of Sorts)

~*~

13. Hey, I'm looking for (and really need) a good story where WWX has had enough and just becomes a villain (+100 to interest if he goes back in time and is evil from the beginning) (+10 if WWX is a genius and uses his inventions to manipulating, getting what he wants and/or establishing his position so that no one can hurt or take advantage of him).

e.g. after destroying his new home and killing all the Wen, WWX destroys the seal and goes back in time, but instead of trying to fix everything and make it better he says "f*ck it" and simply stops being a good boy. He will be the same as the rest of the world... or something like that :)

Just... WWX as a villain <3 @ethealia

~*~

14. Hello! I am looking for fics where Meng Yao / Jin Guangyao is wholly nice and good (and not secretly scheming and villainous and such). Any au or era, I just want to see him happy and safe and supported by friends. Thank you so much!

what builds a home by Stratisphyre (T, 45k, WangXian, MY & WWX, Canon Divergence, Adopted WWX, POV Multiple, warning for JGS behaving exactly as expected, child endangerment, Brother Feels, Minor Character Death, [Podfic] Cold read of "what builds a home" by Stratisphyre by KeriArentikaiPods (KeriArentikai))

Debts of a Child Part 2 by Hauntcats (M, 111k, WangXian, YZY Bashing, Not Jiang Family Friendly, Angst and Feels, lots of anger, JC Bashing, not Jiang friendly, Angst with a Happy Ending, Content warning for icky spiders in later chapters., hurt no comfort for Jiang siblings.)

a micro utopia born as the overture plays by tardigradeschool (T, 18k, wangxian, JGY/LXC, fix-it)

Meng Yao vs. the Board of the Homeowner's Association Series by Ariaste (M/T, 119k, WIP, XiYao, WangXian, Modern AU, Established Relationship, xiyao and wangxian are both already married, Family Feels, Domestic Fluff, Family Bonding, Slice of Life, Discussions of Past Trauma, wwx's canonical kinks, HOAverse)

结局难更改 (the ending is hard to change) Series by PorcupineGirl (G, 50k, WangXian, Time Travel, Modern with Magic, Modern Cultivators AU, Canon Divergence, Time Traveler WWX, discussion of canonical character deaths, conveniently localized fires, Discussion of Canonical Suicide Attempt, mostly happy but slightly bittersweet ending, Reincarnation, LWJ POV, Established Relationship, Aromantic JC) Not JGY centric, though.

Peony to Lotus series by Deriliarch (T, 65k, JYL/JGY, wangxian, canon divergence, arranged marriage, demisexual character, demiromantic character, fix-it, slice of life, angst)

~*~

15. ITMF Jiang disciples trying to actually get Wei Wuxian out of the Jiang sect or keep him safe from the main Jiang family for his own safety

Just go forward like you mean it by tawaen (M, 101k, WangXian, WWX & WN &WQ, WWX & JYL, NHS & WWX, Canon Divergence, WWx does not attend the Wen indoctrination, WWX saves Lotus Pier, Inventor WWX, No Golden Core Transfer, Sect Leader JYL, JC Has No Golden Core, Bad Parents JFM & YZY, Not JC Friendly, but he gets a happier ending than canon so don't look here for bashing) There's a small scene where WWX decides to leave & a disciple helps him sneak away

Dispersing Clouds by dreamingofcake (E, 283k, WangXian, Canon Divergence, Genius WWX, Inventor WWX, Not Jiang Family Friendly, Abusive YZY, Canonical Child Abuse, Hurt/Comfort, Slow Burn, Eventual Sex, Implied/Referenced Self-Harm (Background Character), Background Character Deaths, child deaths, Canon JC, Good Uncle LQR, Accidental Baby Acquisition, Cultivation Sect Politics, Homophobia, Heteronormativity, Feelings Realization, WWX is Not Oblivious) This might count? WWX leaves the clan himself, but there's a scene later in the fic where JFM & YZY are on trial & the Jiang disciples rebel & testify against them over WWX's treatment

~*~

16. May I ask an ITMF for wwx having a pet/befriending/encountered avians like cranes, songbirds, crows, etc. please? I read a fic where wwx has an army of mischievous ravens and I'd like more recommendations if you have any!

A Long Road by Vathara (T, 187k, WangXian, Fluff and Angst, Crossovers & Fandom Fusions, Scheming NHS, Necromancy, Fire, Ghosts, Accidental Child Acquisition, is it an accident if the ghosts keep bringing them?)

We Meet at the Thousandth Step by Admiranda, Rynne (T, 316k, WangXian, CSSR/WCZ, Canon Divergence, No Sunshot Campaign, CSSR & WCZ Live, Rogue Cultivator WWX, Different First Meeting, Night Hunts, Genius WWX, Inventor WWX, Plot, Romance, Drama, Fluff, Strangers to married, Unresolved Sexual Tension, Unresolved Romantic Tension, Everyone Lives, Developing Relationship, Minor Violence, Case Fic, Mystery, Flirting, WWX’s Canon-Typical Flower Flirting, Arson, There Was Only One Bed, Getting Together, First Kiss, Meeting the Parents, Resolved Sexual Tension, Resolved Romantic Tension, WWX Is a Good Big Brother, New Relationship Bliss, Chinese Mythology & Folklore, Blood and Injury, Yiling siblings, Married WangXian, Honeymoon, Wangxian’s Baby Fever) Wei Ying and Lan Zhan befriend and save a Zhenniao (a mythical bird) in chapters 41-44

~*~

17. ITMF fics where Wei Wuxian is the Yiling Laozu but, like, he is established as such prior to or external to the events of canon? As in, WWX isn’t raised in Yunmeng and he doesn’t do the canon Gusu Lectures arc or Wen Indoctrination arc and such, instead he is already in Burial Mounds with a scary reputation. Usually this plot crops up in arranged marriage or war prize aus where Lan Wangji is given to the big bad Yiling Laozu to gain favor, kind of like in 山水盆景 (Shānshuǐ Pénjǐng) by meicairoubingfan where the Yiling Laozu is an immortal who the sects appeal to to intervene in the Sunshot Campaign conflict. Does this description make sense? Thank you!

what price is duty, what cost is love by thunderwear (G, 18k, wangxian, canon divergence, WWX was never adopted to Jiang, war prize, YLLZ WWX, pining, first kiss, first time, falling in love, angst w/ happy ending)

💖🔒 love, in fire and blood by cicer (E, 360k, WangXian, Canon Divergence, YLLZ WWX, Arranged Marriage, political scheming, Gratuitous Domesticity, Mutual Pining, EXTREME SLOWBURN, the inherent eroticism of the forehead ribbon, The Mortifying Ordeal of Being Known, neither wwx nor lwj want to be Perceived, but sorry kids! it’s gonna happen!, rated E but the the NSFW stuff doesn’t begin until chapter 19!, bottom LWJ in chapter 20 and 27)

Old Foreshadows by protos_metazu_ison (M, 15k, WangXian, YLLZ WWX, BAMF WWX, War, Universe Alteration, Sunshot Campaign, Rated For Violence, Timeline What Timeline, Mojo's post)

🔒Fated Series by LtLJ (G, 31k, WangXian, Canon Divergence, Arranged Marriage, Post-Apocalypse, Magical Apocalypse, Hurt/Comfort, Happy Ending, Canon Diverted via Volcano, YLLZ WWX, Badass LWJ)

🔒hold me fast, fear me not by cicer (M, 16k, WangXian, Canon Divergence, Fairy Tale Elements, Ballad 39: Tam Lin, Mpreg, Bottom LWJ/Top WWX, YLLZ WWX, brief reference to abortificants, Implied/Referenced Dubious Consent, may be interpreted as noncon by some)

~*~

If you didn’t get an answer to your ask here, don’t forget to make use of @mdzs-kinkmeme and MDZS KINK MEME on Dreamwidth. Authors actually do use them for ideas. You may get what you order!***Your prompt doesn’t have to be kink! Fluff, crack, whatever - it’s all good!***

[anthroamazed]

tips for stem majors in math and science courses (spoonie + neurodivergent friendly)

hi y’all! my nameis lila and i’m a 28 year old physics and anthropology major who’s about 2 years through college (in the US)! as we’re coming up on the start of the fall ‘23 college semester, i thought i might share some really solid hacks for fellow STEM students taking science and/or math courses that i’ve basically built my college academic career on. and! these study tips are spoonie and adhd friendly! as a matter of fact, a lot of these are tips/methods that specifically work for me as a neurodivergent spoonie (i have pretty severe adhd, as well as POTS and ME/CFS), but that i think non-disabled/non-spoonie and/or neurotypical students could also benefit from using! so with out any further ado, here are my 7 tried and true study hacks for college math and science classes…

1) discover your learning style and tailor your studying towards leveraging it.

you’ve probably heard of visual, audio, and kinesthetic learning styles, but did you now there’s actually way more learning styles than just those three? i’m personally a “social learner,” meaning i learn best through discussion and socialization with 1+ other people to interact with. this could look like teaching other classmates concepts and methods that we’ve learned or discussing ideas with classmates and/or professors until i fully understand the concepts at play and how they connect and can reflect them in performing analysis and application, etc. honestly, figuring out my learning style was hands down one of the most helpful things i’ve done in college. it has allowed me to choose professors who i will mesh better with in terms of how they teach, as well as to adapt materials and methods to my style of learning in order to master them quicker and more effectively.

2) rewrite your notes after lecture, for the love of god.

this tip actually comes from my high school IB Math HL teacher, who told me to do this when i originally left high school for college. even if you think you’ve mastered the basics of the topic covered during the lecture, rewriting those notes after lecture helps really hammer in the knowledge that you’ve already established and also helps to get the wheels turning on pieces of information you might have less of a grasp on. try tp set aside at least 30 - 40 minutes after class to just rewrite your notes and try to really digest the information.

3) body doubling is one of the most beneficial things ever to be invented even if you’re not adhd, and i WILL die on that hill, thank you very much.

“body doubling” or “having an accountabilibuddy” are interchangeable terms in the adhd community that mean you have one or more consistent study buddy/buddies who you do all the homework and/or studying with in person on a regular basis, even if you’re just working next to each other in total silence. this does a couple of things. first off, it forces homework/assignments/studying to become a concrete social obligation you need to regularly show up for, rather than a nebulous obligation based on an invisible deadline. second off, it gives you 1+ partners to work out your problems concerning course topics with. third off, it allows you to build a network of peers where you feel comfortable helping each other with course material (this is especially great because it’s likely you and your classmates have different strengths regarding course content). tbh, body doubling is the other method that i, personally, have found most useful in college and i highly recommend trying it, even if you don’t have adhd.

4) teach others/your classmates the analysis and application methods you’ve learned, even if those methods aren’t 100% solidified for you (trust me on this).

the goal of stem courses is never memorization, but rather being able to understand a topic well enough to analyze a similar situation and apply the what you’ve learned creatively. this is where teaching others comes in. in order to teach others a concept and its related analysis and application well, you have to have at least a fraction of a decent understanding of these things yourself, and, further, often time in teaching these things you also learn to grasp the concepts/aanalysis/applications even better than you did before with each new teaching session. basically: teaching others is a creative way of also teaching yourself. you get the benefits of repetition, of thinking about a concept/technique/analysis and application in a new way, and of getting to apply the concept/technique/analysis and applicatioin to a new scenario each time. plus, you’ll typically make friends quickly in the process! there’s really no downside to this tip imo ;-)

5) utilize your college’s tutoring center/program(s), even when you don’t think you need to.

usually colleges have either set up a general “tutoring center,” on campus where you can find tutors for all different kinds of topics and courses available during regular hours for walk-in sessions and/or appointments free of charge or departments will hold regular weekly (or twice weekly) free on-campus tutoring sessions for specific courses. regardless of which of these options your college has, i highly recommend attending at least one tutoring session/appointment (ideally with the same tutor if/when you eventually find one you click with) every single week, even when you don’t feel like you’re struggling with the topic(s) covered in that week’s lecture. this will help you review topics and techniques covered in lecture, deepen your understanding of them, and, if nothing else, it’s an excuse to get homework out of the way while having someone else there who can help you if/when you get stuck. attending at least one session weekly also helps you get into a habit and routine of keeping up with your assignments, so you’re not left scrambling at the last minute before they’re due.

6) if you have accommodations, request access to record lectures. if you do not have accommodations, ask your professor if you are allowed to record lectures. IF YOU RECORD LECTURES, DO NOT FORGET TO REVIEW THEM!

okay, so first up for my fellow spoonies and neurodivergent peeps: when you apply for/renew your accommodations, make sure that “recordinng lectures” is on your MOA (memorandum of accommodations), because so long as it is, your professors legally cannot deny you permission to record lectures without risk of themself and the college being sued for an ADA violation. also, make friends with a classmate and ask them to record lectures and send them to you if/when you are absent (let the professor know that you’ve asked this classmate to record and send you the lecture if you are absent)

now, if you aren’t disabled, a spoonie, and/or neurodivergent, you aren’t guaranteed permission to record lectures. however. ask the professor if you can have their permission to audio record lectures (be sure to also let them know that such a recording would be for personal use only and that you don’t plan on distributing the recordings). i’ve found that many professors don’t mind you having an audio recording.

even if you aren’t an audible learner it can be really useful to have these recordings to review at a later point. oftentimes reviewing lecture recordings can be useful if you glazed over and missed a section of the lecture and/or if you can’t remember what a professor taught during a section of a lecture.

7) last but not least, on a related note, if you have accommodations, also request access to your professor’s lecture notes. if you don’t have accommodations, check if your professor posts their lecture notes for students to use.

having your professor’s notes can be extremely useful for review purposes, but they can also help you understand where your professor is going with course content and what they want to stress as important.

[autisticlifelessons]

Tips for Autistic Students

I managed to get really good grades both at school and university, but it involved a LOT of emotional anguish. I had this reputation of being really smart and nerdy, but the truth was I had to put in an almost inhumane amount of effort in order to sustain my grades. I lost perspective and sacrificed other aspects of my life - such as building friendships and having experiences - that I'm still catching up with, now.

If I had to do it all again, knowing I'm autistic, there are definitely some things I would change that would have made my life as a student so much more enjoyable. Read on to learn from my mistakes!

Spend time going over the things you aren't so sure on - I wasted a lot of time reading over and over stuff that I could recite off by heart, but to be honest I don't think it made one iota of difference to my grades. I tended to avoid the scary stuff I was struggling with, but with hindsight this would have been a much more productive use of my time. Identify the areas you know you are weaker in, and focus on plugging those gaps in your knowledge rather than aimlessly wading through course materials.

Look after yourself - it's all too easy when you're looking to get good grades to totally overwork yourself. But this can actually be counterproductive as when you are tired/stressed you are actually more likely to make mistakes and underperform. Try making a studying timetable for yourself, and make sure it has a cut off point so you know when to stop. Trust me - grades are not worth burning yourself out over.

Give yourself plenty of time to complete assignments/study for tests and exams - it's very common to hear other people on your course bragging about how the started a essay 2 hours before the deadline and still got an A, but don't listen to them. More than likely they're lying or at least exaggerating, but they are also NOT you. You don't need to compare yourself to anyone else. For most autistic people - even those with executive function issues who are prone to procrastination - having to do things last minute can lead to overwhelm and burnout. A neurotypical person may be able to handle this approach, but for neurodivergent people this strategy could lead to a fallout period where you would need to recover. Starting ahead of time will allow you to pace yourself and ensure you have the chance to ask for help or clarification if necessary.

Try and make a few friends in every class - socialising often doesn't come easy to autistic people, but I promise going to class is much more bearable if you have a least one friendly face to look forward to seeing. Statistically speaking there is a really good chance there is someone else who is neurodivergent, and you likely can relate to each other's experiences more than a neurotypical person's. It also gives you people to arrange to hang out with outside of class, which is how friendships are built and sustained. Just a simple 'good morning' or complimenting someone on their clothes is enough to begin building a rapport.

Pay attention to your sensory needs - it's much easier to concentrate and take in information if you are comfortable. If the sun is in your eyes or if your desk is wobbly, ask if you can switch seats. If having a stim toy in your hand helps you concentrate, do what you need to do to get permisson to use one. Advocating for yourself can be scary, but it makes such a difference to your experience.

Did you find my tips helpful? Let me know!

[darcymariaphoster]

I'm going back to school??

Quick, give me your top five life-saving study tips! (Bonus if they're ADHD/neurodivergent friendly, but absolutely not a requirement.)

[theic-manic]

Landing page: Welcome traveller!

I would like to acknowledge the Gadigal of the Eora Nation, the traditional custodians of this land and pay my respects to the Elders past, present and emerging. I acknowledge that Aboriginal sovereignty has not been ceded.

Hello!

What I am about:

I am a mid-30s pagan (chaos witch & devotional polytheist) and tarot reader of over two-decades and late diagnosed multiply-Neurodivergent located in Australia.

Taught how to use Ouija when I was 4 years old.

I am of European, Jewish and UK descent, so I try to hold space for PoC folk as best as possible, while doing my best to avoid cultural appropriation.

I generally don't discuss my disabilities unless relevant (e.g. ND friendly practices).

I am happy to assist others with queries however there are some housekeeping rules that I will add below.

While I am also Nonbinary with They/Them pronouns, how others choose to perceive me is none of my concern.

Federal Australian Public Servant since 2013 and Union Representative since 2015, I am blessed enough to be able to offer my daily grind as devotional acts.

Previously a Norse Pagan/Heathen until Hermes & Apollo had me relocate to a Greek neighbourhood (it's a thing)

Norse Gods I was previously devoted to: Loki, Freyja & Njord

Norse Gods I previously worshipped: Odin, Tyr & anyone else wanting to pop in & say hello.

Greek Gods that I am currently a Devotee of: Apollo, Ares and Hermes

Greek Gods I casually Worship: Zeus, my other soul parent deities (linked post on this concept below), Aphrodite, Melinoe and any deity who decides to pop in.

I do casually engage in Demonolatry & other Occult studies.

I have briefly worked with the Kemetic Gods and still respect them.

I have performed "baneful" magick and am absolutely not hesitant to lay down a bloodline curse when pushed however Shadow Work and healing are the better paths to heightened spiritual growth & abilities.

What I am not about:

I avoid closed cultural practices unless otherwise guided by a member of that culture, preferably one of their elders.

I am however human so if I accidentally engage in a close practice, please tell me.

I generally avoid ancestral worship or ancestral magick since many of my ancestors were on the problematic side of most historical conflicts.

I am too tired for bickering & pettiness, if you see something you dislike or disagree with then keep scrolling. I will not respond to hate-asks.

DNI the usual: terfs, racists etc. it's not that hard to simply not be a piece of shit.

DNI Minors who call yourselves Devotees outside of established religious communities (some cultures do allow children to be devotees under strict spiritual guidance & care, if this is you then please specify this)

I do not feel comfortable engaging with minors who commit themselves to a deep and personal relationship with deities as this requires consent to an unwritten contract (in many practices) and as such if you're not old enough to consent to a legal contract without adult guidance then you're not old enough to consent to being a devotee.

I do encourage you to become worshippers however to build a strong foundation with your chosen deities.

Tags to search on my blog:

#Deity Communication

#Devotional Polytheism

#Low effort practices

#Low Cost witchcraft

#Neurodivergent pagan

#Spooky God Squad

#ADHDeity

⚠️ Minors ( (< 18 y.o.): go to your settings and filter the NSFW tag, thanks.

Asks/queries housekeeping:

Please specify whether you are a reconstructionist pagan or neopagan, noting that I am Neopagan of over 2 decades and as such, I am best equipped to assist the latter.

Please specify whether you are a Worshipper or Devotee or just wanting to start the process of worshipping a deity.

I love assisting my fellow pagans however the expectation is that you know how to use the search bar in your search engine and social apps of choice so unless your query specifically requests details on certain things I am running under the assumption that you know the difference between worshipper & devotee, the basics of the deities you are seeking guidance with etc.

Please state whether or not you are a minor so that I can ensure that my advice is age appropriate, I would hate to have a "Minors DNI" when I would prefer to help guide you on your journey since when I was a teenager I had to rely on magazines and books alone.

Some posts of mine you may find useful

How do I pray?

AI usage and spirituality

Deity & Devotee consent

Hellenic offerings

Soul Parent Deities & how to calculate them via Numerology

Deity identification tarot mega post

Part 1 of Spooky God Squad

Trickster Deity discernment

[the-whumpening]

So like . . . I have a lot of experience with academic-level writing, and I've been studying creative writing for over a decade (including professional seminars and a special high school program for writers). I generally know what I'm talking about when it comes to writing and editing, at least on a technical level. I've had experience working with APA and Chicago Manual style (Chicago is what most creative writing seems to use, in my experience) and I have a handful of resources I'd love to share.

Would anybody be interested in a (hopefully neurodivergent-friendly) series on writing skills? I mostly mean things like grammar, syntax, punctuation, formatting--the things that make your writing as readable and polished as possible. I do have some advice as far as the creative side (voice, tone, theme, word choice, etc), but I understand if that advice isn't as welcome! I also understand if your response is "who the fuck do you think you are to give out advice?" But that would be kinda hurtful.

[ashthenerdtheythem]

I made a community for neurodivergent students and over half of the people who were interested in joining asked if they were still allowed to because they aren't diagnosed. To anyone who wonders if they are allowed to be included in nd groups see below👇

View this post on Instagram

A post shared by Sonny Jane Wise (@livedexperienceeducator)

Also, comment if you want to be invited

Image description below the cut

Are you wondering if you are allowed to identify as neurodivergent?

You don't need permission from anyone to identify as neurodivergent, but if you're struggling to give yourself permission, here are some reminders.

You don't need permission from a medical professional to identify as neurodivergent.

You don't need a diagnosis to identify as neurodivergent.

You're allowed to identify as neurodivergent even if you want or need medication.

You don't need to view your neurodivergence as a positive experience to identify as neurodivergent.

You can identify as disabled and neurodivergent at the same time. They are not mutually exclusive terms

It's okay if you became neurodivergent later on in life; you still count,

Neurodivergence includes every diagnosis in the DSM, it's not just autism or ADHD. Don't let anyone tell you otherwise.

End image discription

[attorney-anon]

Hey, I’m a law student and I’m also autistic and ADHD and I was wondering if you have any tips for working in law as a neurodivergent person? I love my course and I can’t wait to work but the 85% unemployment statistic really scares me.

This is a long answer, so I'm going to cut it for the sake of mobile users. I do link some products below; I'm not getting paid, and I'm only linking them because they honestly work for me. Also, as a caveat, a lot of this advice assumes that you're American and/or working in-person at a private law firm; unfortunately, that's my only experience other than a month doing part-time intake for my regional legal aid service.

The biggest hurdle you will meet is the bar exam*: you need a study buddy who does not have ADHD and can help keep you on track. Don't study separately then meet up; do things like watching lecture videos together and keeping pace with one another in person. I'm not ADHD myself, but my best friend and forever study partner is, and she struggled to self-start.

Buy a bar prep course. This is not the time to be a scrooge; don't buy Kaplan just because it's cheaper (it also sucks). Barbri and Themis are both good - of these, use whichever you can get for cheapest or, if the costs are comparable, use Barbri if structure gives you comfort and use Themis if you need some control over the order in which you do things. Also use Themis if humor engages you; the Property and Contracts lecturers are hilarious. Stick to your bar prep program, but be gentle with yourself if you fall behind pace - realistically, you need to get through all the topics at least once, but you don't have to do every practice MPT, every practice essay, and every practice MBE quiz. Use the same study techniques that got you through law school. IMO, useful supplemental tools include the Critical Pass flashcards (get them used if possible, or get a referral code from somebody) and the Finz Multistate Method guide. Do your best to treat the bar exam as a game - because it is one.

There's a strategy for every section, and you should practice these strategies. For the MBE, use the Finz method - it works. For the MEE, or any other essay exam, use IRAC - and make up the R if you need to. The UBE, and most state bar exams, are graded such that you do get more points for knowing the rule, but you can still get points if you make up a reasonable-sounding rule and then apply it correctly. For the MPT, just throw in as many case and rule cites as possible. Try to cite every document you're given.

Join a bar prep FB group if you use FB; I was in Themis Memes for Should-Be-Studying Teens, but I know there's a Barbri group too. I found that being able to laugh at my bar prep course made it less miserable to do it. Don't be afraid to turn the videos on 2x or 0.5x speed - or faster or slower as needed. Some of the Themis lecturers talk to slowly that we went up to 3x; one of them talks so fast I had to slow him down.

Practice for the test in as many different environments as you can. I took the 2020 Pandemic Bar, so my bar was different than standard (I took it in a hotel room with my back to the door and proctors patrolling the hallways, it was mildly traumatizing fun), but I highly recommend getting used to noise while you're taking the test. Your ADHD/Autism hyperfocus will help here - make the bar exam your hyperfixation to the extent possible.

Once you pass the bar exam, your next hurdle will be the job search. You are going to have to mask for interviews, there's just no getting around it, but how much you mask will depend on your area of law. Big Law firms and intense, litigation-focused practice areas (e.g., business lit or criminal law) will expect you to be gregarious, friendly, and charming from the get-go; less litigation-focused practice areas (e.g., probate or family law) will often have more tolerance for quieter, less aggressive types.

Do not panic if you wind up at a less-than-favorable firm on your first or even your second job; a lateral shift between firms won't kill your resume as long as you can give a tactful reason you left (e.g., "I found that I prefer to focus on X instead of Y," or "I found that I had more opportunities to explore X at Y firm, and I am interested in focusing on X"). It is not normal to cry every day after work. It is not normal to routinely have panic attacks in the bathroom.

Once you have a job, billing is going to be difficult unless you gamify it. I use the Finch self-care app, so I have a task at the end of every week to make sure I have billed my time. My friend rewards herself for every day she bills by buying herself a new pen. Some people thrive off of timers (MyCase and Clio are popular case management software programs; both have timers built-in), but if nothing else, simply note when you start tasks and when you finish them by sending e-mails to yourself (or others, if relevant) at the end of every task. If your case management software can integrate with your e-mail (MyCase can integrate with Outlook, for instance), then use that to tag outgoing e-mails so you can be sure each one gets billed.

Outside of Big Law or intense practice areas, very few people bill 8 hours per day - a lot of the work you do will be non-billable, but also you will suffer from exhaustion or burnout if you try to bill 8 hours per day (my minimum is 20 hours per week, which is just 4 hours a day). You also will usually have some discretion in billing - use that to make yourself feel better if inattention issues make something take longer than you feel is fair. As for billing enough, if you find that you are most productive outside of work hours, find a firm that will let you access client files offsite - work at home if they'll let you.

I do a lot of my best billing either in the mornings right when I get to work or at 10:00 at night. That's okay so long as you take breaks during the workday (I watch a lot of TikTok during my breaks, but I also fiddle with various online games and such); you'll need mental rest to reset between cases. If you struggle with task-switching, use a break to help reset your focus. I strongly recommend setting an alarm for yourself during breaks so that time blindness doesn't derail you. Make your alarm kind of annoying; something you won't just mindlessly ignore.

Let yourself hyperfocus on things; all of that time you spend researching and drafting and correcting and perfecting that motion or brief is billable, and it's also good practice of law - your client and your partner will appreciate your thoroughness, and the judge will almost never hate it (some judges prefer brevity, but I've never had a judge upset at me for wordiness).

I also recommend getting apps that can automate things for you; I use Espanso to make my life easier by having easy-to-type shortcuts for common phrases and information (e.g., the current date, my bar card number, my work e-mail address, etc.). You can customize these things to make sense to your own brain - your process doesn't have to work for anyone but you. Similarly, I use macros in Word to make drafting go faster by letting buttons do all my formatting for me.

Excel sheets make excellent task lists because you can split them up by case, and set them up to highlight things (e.g., today's date) automatically. Most firms will have some kind of "docket meeting" where everyone goes over the status on each case - some people prefer handwritten notes (my best friend does), some people prefer digital notes (I have an excel workbook I use). Find a method that reduces distractions but lets you keep up with the flow of conversation.

On the topic of technology, if your firm provides a computer for you, or if your firm will provide accessories to supplement your own computer, push to have multiple monitors - I use my own laptop, but my boss provides monitors and I have two plus my laptop screen. It is WAY easier to keep up with billing if you can keep your time entry software open and visible on one of your screens.

You will be spending a lot of time in your office; make it comfortable. Once you are making enough to get by, invest in a good office chair (that you own, so you can take it with you if you leave the firm) and some basic office supplies that you like, such as a post-it note dispenser (mine is a cat!). My office chair is designed to let me sit cross-legged - I highly recommend having an office chair that matches your most comfortable sitting style. Having some things that are yours will make any future moves less awkward. I also strongly, strongly recommend getting some simple and quietish fidget toys - I have several spinners, wacky tracks, tangles, and clicky fidgets in one of my desk drawers, amongst others, to help me self-stim, as well as a sensory sticker on my desk pad (on the linked set, I have the rough version of the bottom middle sticker, the rainbow finger labyrinth one).

For me, I find that actual litigation requires scripting. Whether it's an oral argument or just a temporary orders hearing, I typically have every word I intend to say written down as much as I can (re-direct examination or re-cross examination can't be scripted before the day of, but I usually at least scrawl a summary of the question I need to ask as I'm taking notes). I don't necessarily read from it, and sometimes I veer off-script, but there is a specific comfort in having the words scripted out. On the few occasions I have ad-libbed things, I find that I come off less authoritative and confident, which gives the judge the impression that I am guessing. I also find comfort in having a copy of the code I need (which is always the Texas Family Code for me) on-hand at the counsel table. You are allowed to tell the judge you'd like to consult the statute when the judge asks you a question.

I also find that, for courtroom litigation, it's worthwhile to make sure your court clothes are comfortable. Courtrooms in my area are universally a little too warm, so I have a linen blazer that breathes and a variety of shell tops that don't have sleeves. I also have bad ankles, so I wear exclusively flats despite the fact that I am less than 5 feet tall. For me, heat sensitivity is a part of my sensory issues so I am all about setting myself up for success. It's also worthwhile to bring extra water bottles; at my firm (we are almost all ND in some regard), the standard is 2 per attorney and 1 for each support staff, then 1 for the client.

For out-of-court days, even "business" can be comfortable if you're a creative shopper. My last firm required business attire, though not necessarily courtroom attire. I wore a lot of dresses to stay cool, and a solid-color dress in a modest cut paired with a black blazer (which you can remove when you're just working in your office) almost always makes the cut. For those who don't like or can't wear dresses, comfortable slacks and a modest blouse or dress shirt, paired with a blazer, also works. My current firm only requires business casual for client meetings, courtroom attire for court, and otherwise as long as we cover our shoulders and don't wear shorts, we're good to go. I use a cardigan to cover my shoulders when I'm outside my office, as most of my blouses are sleeveless. It's worthwhile to invest in a good office sweater anyway; I like a thin t-shirt material cardigan for me, but my officemate uses a pullover knit sweater. Do what's comfortable.

Office meetings, or even court hearings, can sometimes get loud and overstimulating - buy you some Flare Audio Calmer ear inserts, they really do help take some of the 'sharpness' off of the noise. I also recommend a playlist that contains binaural beats (assuming you like them) or colored (white, brown, pink, etc) noise and a solid pair of ANC headphones or earbud, depending on your preference (the linked products are far from the only options, they're just reasonably-priced options that I know work; I personally use first-gen Airpod Pros). If you don't like binaural beats or white noise, instrumentals of pop songs are also excellent.

You can also get phone apps that layer binaural beats over your music - I find that it sometimes helps me calm down when I'm close to a meltdown, though I personally feel worse at the lower frequencies (I usually stay around the alpha-beta frequency line, but ymmv). I think there are probably also some apps for colored noise over your music, but I haven't looked. If you haven't before, I recommend experimenting with binaural beats and/or colored noise - I find that they can help calm down some of the staticky feeling I get from overstimulation.

Offices also sometimes involve other sensory dangers - like, for instance, food texture issues (another big one for me). You can often get out of things like that by simply explaining that the food doesn't agree with you, or that you're not very hungry - or, if your boss knows that you have sensory issues (mine knows I'm autistic), you can just quietly explain that it's a sensory problem and you have it under control. Keep some safe snacks in your office. You can avoid alcohol, if you're picky about it or just don't like it, by explaining that you're not in the mood to drink (or that you don't drink, period) and that you'll stick to soda/tea/water/whatever. Only major assholes will push past that.

Most coping mechanisms for sensory issues can be justified with "I don't feel good" or "I have a headache."

If your office chair hurts your back, get up and walk around. You are not in elementary school; at most firms, you can step out and just let your coworkers know where'/how to find you, and when you'll be back.

For intra-office and extra-office communications, if you have any doubts about the quality of the communication, you can put it in writing afterwards. A quick e-mail saying, "Okay, so this is my understanding of X, please let me know if I've misunderstood anything or if anything changes" is a good CYA to cover any communication difficulties; don't use idioms or shorthand in these e-mails - actually spell out exactly what you think happened, or what you think you've been asked to do.

If you're worried about your tone in written communications, Chat GPT is good at doing a first draft. It can also do a first draft of your attorney bio, if you're asked to write it yourself. Tell it the message you want to convey, and the tone in which you need it said. For instance, if you need to convey to a pro se opposing party that your world does not revolve around them, but you want to do it professionally, you might tell Chat GPT, "Write a professional e-mail to my opposing party conveying that my world does not revolve around them and that I will get to them when I get to them." That won't give you a perfect e-mail, but it gives you an idea of how to set the tone. Never trust any citation the thing gives you, but you can also use it to simplify complex thoughts for motions that you need to be simpler.

Law practice is also emotionally draining. Take the time to cry if you need to, or to go outside or into a breakroom and breathe.

Essentially, working in law when you're ND means finding tools to help you. It's definitely doable (as I said, most of my current firm is ND), but you'll need to find coping mechanisms to soothe yourself. If you've gotten into law school, I think it's clear that you're competent enough to work. The trick is not burning yourself out entirely, which I hope the above can help with.

* - This is not and never will be an endorsement of bar exams as a measure of competence for new attorneys. The bar exam is a racist and classist institution born from the desire of old white men to keep their good-ol'-boys club exclusive. Fuck the NCBE and abolish bar exams nationwide.

[ren-054]

Hey! Sorry, but I'm curious and I would like to ask u something. I've already asked the same question to another blog but I decided to gather different opinions/feedbacks, out of curiosity.

Do you think Sun, Moon and Eclipse, canon-wise, are a good representation of a system?

I know that many people see them differently, everyone has their own hcs and I do too, but if they were a system would it be accurate in terms of shifting/fronting etc?

I apologize if this question sounds weird or if I come off as offensive, it was not my intention. I don't know a lot about DID, I'm still studying, so feel free to correct me or to simply ignore this ask.

Oooh this question! Hrmmm

Also it’s all good, I love answering questions that have to do with pulling from my experiences :] I don’t mind at all!

TL;DR because I’m very wordy— I think the DCA’s a decent rep of the idea of a system but it still ends up with a lot of the pitfalls of current system rep (like alters framed as evil vs good since it’s a horror game and Moon is an enemy + Sun and Moon’s inner conflict being resolved either through a fusion into Eclipse or simply letting a more stable alter front with little further elaboration on the matter)

So the DCA definitely feel like a system that could exist, but it still reads like that awkward middle stage of media rep where there’s still a dependence on shock factor and spectacle over them just being a system that exists, but they’re overall fine.

I think viewing them as a system is very neat and I love how validating/relatable a lot of the fan works can be when tackling the DCA’s dynamic with each other :] I see little issue with viewing them as a system, if that’s part of the question

Long answer below pfpf

Where do I start…

I think I’m a bit torn? Their canon switch from SB, if we are viewing them as a hypothetical system, definitely felt dramatized because it’s a horror game (but maybe some people experience switches like this! I wouldn’t know)

Also the fact the horror effect is likely coming from having an overall benign doormat of a guy suddenly becoming unsafe post-switch feels a bit iffy to me since it feeds into that othering/demonizing narrative of mentally ill + neurodivergent folk, but Sun’s panic about Moon fronting is still a mood, to be fair. I have my own paranoia about certain alters getting triggered out ajhdks

As for fronting, the DCA don’t really get to express how that works for them, so I can’t say. The only thing I could glean is that,

1, Sun was aware a switch occurred that allowed Moon out but, for whatever reason, was upset enough to still kick Gregory out the daycare knowing he could still be in danger so there’s not much info there, and

2, Ruin Eclipse seemed to have less memories than Sun or Moon given he acted like he just met Cassie when he fronted, sort of reminiscent of either an alter coming back after a long period of dormancy or a much more generally dissociated alter. Sun still talked after Eclipse came back so he’s still in there, and presumably Moon too.

For me, I think I have a lot of internal communication and rarely have hard switches (a switch where there’s only one alter fronting with little interference from any other part) so I can’t say too much about hard switches like what seems to happen with the DCA. Sun and Moon were in a terrible rapid switching and/or fighting-for-front situation in Ruin though, and I feel for them. I’ve been through it and it’s not fun.

I was actually surprised at how much more.. system-coded the DCA were in Ruin but I always had a bit of an issues with it for one reason

There wasn’t a lot of closure for Sun and Moon specifically (only implied through Ruin Eclipse’s calm and more child-friendly nature) so I’d feel a bit weird to say that the DCA as we know them at this point is a great.. summary for systems as a whole? Like you gotta do what you gotta do to heal yknow so this isnt judging how they need to help themselves, but I’m looking at the bigger picture of system rep and the preconceptions of a layman audience.

I know not every system likes the idea of their parts being ignored/shunted in favor of a more “complete” fused hypothetical version of themselves, including myself. But for the DCA, as Sun strongly implies, this is the best solution for them in the moment in order to stabilize so really I can’t judge them.

Sun said thank you, though, so I hope that means them and Moon are getting some well deserved rest away from front. I do hope to see things from them feeling better in the future, but I don’t have much faith that we’d be given that.

[starffisher]

Hellooo, i wanted to ask for advice🥺✨ well I've been trying to shift for a while, and i struggle to find the method that works for me, i can't stay still for long, i have a good mindset, i know i will shift soon, but i don't know what method to try, I've tried all the methods at least twice, but i always move and I feel like I've ruined it by moving and turning over, what method do you suggest? 🥺❤️ Thank u

hellooo ml!! first, i want to say i am soooo honored that you came to ME to ask for advice, makes me feel like those old mentors in action movies :’)! anyways, i personally don’t really use methods and i never have. i also struggle so much with staying still and keeping my mind from wandering, and since a lot of methods are not neurodivergent-friendly, i just never use them. (also because i procrastinate doing methods, but that’s another story).

if anything, i heavily prefer the intention method because it is SO simple. a lot of people tend to overcomplicate intention, but it is just the same as studying with the intention to take a test and get a good grade, y’know?

also, if you haven’t already, i recommend looking into the law of assumption. i am not the best at explaining it myself, sadly. just keep up with your awesome mindset and persist in it. that’s really all you need:)!

[aster-ology]

fat friends discord server

hello, my name is aster :) i'm an admin in the fat friends server. i also helped found it around 3 years ago with my friends Beca (it.me.b on tiktok) and Peach. we are all fat and queer.

today the server officially reopened! as such, we want to welcome new members. if you're fat, (or plus sized, etc), and are interested in being in a space with other fat folks who are fat positive and pro fat liberation, then we would love to have you!

✶ to be clear, this is not a political or activism server. it's a friendly, casual, community server made by and for fat folks ✶

˗ˏˋ✨ fat friends ✨ˎˊ˗

is a fat-centered, fat-positive, pro fat liberation space,

created by and for fat folks of the world

founded by Beca (it.me.b on tiktok)

· 🌻 ───────────── 🌻 ·

🍄𓂃 ˖ what we are

╭━━━━━━━━━━━‧ 🌿₊˚⊹

┃░ 18+ only

┃░ fat folks only

┃░ anti-fatphobia

┃░ english-speaking, casual community server

┃░ BIPOC, Latine, 2SLGBTQIA+, neurodivergent, and disabled fat folks welcome

╰━━━━━━━━‧ 🌸₊˚⊹

🤲🏾𓂃 ˖ some things we offer

╭━━━━━━━━‧ 🥭₊˚⊹

┃░ fat studies and fat education resource channel

┃░ 70+ reaction roles to tell us about yourself

┃░ various server events, and regular chat prompts

╰━━━━━━━━‧ 🍑₊˚⊹

❌𓂃 ˖ what we are NOT

╭━━━━━━━━‧ 🍓₊˚⊹

┃░ NOT a dating server

┃░ NOT a fetish server

┃░ NOT here to educate straight size folks

╰━━━━━━━━‧ 🍒₊˚⊹

🍉 𓂃 ˖ to enter

╭━━━━━━━━‧ 🌱₊˚⊹

┃░ be fat

┃░ agree to the rules

┃░ post a short intro

╰━━━━━━━━━━━‧ 🌺₊˚⊹

✨𓂃 ˖ if you're fat and looking to connect with fellow fat folks in a fat-centered, fat positive, pro-fat liberation space, please join us! we can’t wait to meet you!

[eos0anemone]

Analysis: Genshin Impact Autistic characters - KOKOMI

This is going to be a section in my blog talking about which Genshin characters I think fit very well inside the autism spectrum. If we know Hoyoverse's record, we know that they're not autism friendly (*cof cof* cure for autism in Tears of Themis *cof cof*) but well, neurotypical people accidentally writing neurodivergent characters happens a lot, and at the end of day, it is free to our own interpretation how we see them.

I want to open this section with my favourite Genshin character: Sangonomiya Kokomi. I relate to her a lot (partially the reason why I'm convinced she's autistic) but keep reading if you want to know specifically why I think she is.

INTRODUCTION

Kokomi is a 5 star character, Hydro catalyst from Inazuma. Lorewise, she is Watatsumi's Divine Priestess; in other words, the leader of Watatsumi Island, a small town that relies a lot on fishing and agriculture to subsist.

In terms of 'waifu-uwu', Kokomi is your average overworked waifu who shows a shy demeanor, steady leadership but delicate presence. Is very feminine presenting, has a quirky military side and shows a soft spot for traveller, probably because she falls in love with him too (and yeah, I talk specifically about Aether because we know who thinks this way). A lot of western people, especially men, also reduce her to this stereotype common in Genshin Impact women.

However, we can take some more steps and see in depth everything that Kokomi has to offer.

HYPERFIXATIONS

One of the aforementioned cliches is actually true: Kokomi is an overworked woman, but not in the same way as Ganyu or Keqing, for example. While they overwork themselves because they seem to enjoy being occupated or feeling useful, Kokomi's job is a responsability that she actually doesn't wan't: just by reading her voice-overs (More About Sangonomiya Kokomi: IV), we discover that what she really wanted to do was study military strategy and become an adviser.

And this is one of the most interesting points about Kokomi: she loves military strategy. While some people reduce it to a quirky trait, I think it can be clearly interpreted as an autistic hyperfixation. Not only Kokomi is presented to us as a girl who is an expert on this field (Archon quest was so horribly written that it doesn't do her justice, but canonically she is very smart and a strategy master), but she also tells us on voice-overs that she loves military books the most (Chat: Reading), and wanted it to be her full-time job.

The least we can say is that it is her passion, one that fuels her motivation so much, just like how autism or writing fuels mine to the point of wanting to work on that field and enjoying it on my spare time or when I'm regulating myself.

BURNOUT AND MASKING

In relation to the last point, there's another reason as to why Kokomi preferred to be a military advisor rather than the island leader: social interaction.

As stated in both voice-overs and her quest, social interaction exhausts Kokomi to the point she 'gets negative'. She also tells us (Sangonomiya Kokomi's Troubles) that she's not good at communicating with others, and that putting on her Divine Priestess airs helps her with it. Kokomi is a clear case of a women who does masking in order to survive socialization with other people, and in this case, her being a figure of authority well-respected and loved by her people helps her a lot with the interactions she's forced to endure day by day. I see myself on this, because I too feel more at ease interacting with other people if I have a title that gives me clues about how others will be talking to me (being the class rep, an administrator...) but it still exhausts you, and usually it is even more tiring because you have to keep up to extra expectations. The 'getting negative' references being so burn out that you can't keep masking anymore, making you seem gloomy/uninterested/rude/clueless.

In Kokomi's quest Dracaena Somnolenta, we learn that when Kokomi is too tired of social interaction, she hides for a while on a cave where she sleeps and reads books in solitude. That is decompression. All autistic people need it to regulate their bodies and mind.

For Kokomi, this decompression time is very important, but also a secret she has. Social interactions represent a sensory overload for her, and we can see it on her dialogues during Dracaena Somnolenta, especially when we go find her to the cave:

Sangonomiya Kokomi: Oh... you noticed? I guess I haven't quite mastered the ability to hide how I'm feeling. I'll keep working at it... (masking)

Sangonomiya Kokomi: To be honest, I'm not really cut out to be a leader. At first, my dream was to read up on military strategy and perhaps become an adviser. (another hint to her hyperfixation)

Sangonomiya Kokomi: Constantly communicating with people, trying to retain their morale, having to read between the lines, making sure everyone gets the recognition they deserve... It's such hard work. (more masking, she has to force herself to do all these things because it doesn't naturally come to her)

(...)

Sangonomiya Kokomi: So whenever I feel overwhelmed, I come here to just lose myself in a book and relax for a while... (decompression)

Kokomi also explains that she uses spoon theory to regulate her energy. Spoon theory is a method created by Miserandino and it is used to ration our energy during the day. So yeah, Kokomi literally uses for herself a method that is directed to disabled people; whether it is autistic individuals, people with chronic illneses and pain, etc.

In her case, she writes it on her diary, adding or substracting points according to the tasks she has done and the events that happened to her. Traveller, whether it be Aether or Lumine, seem to be an individual that Kokomi trusts and feels comfortable with; so much that their presence doesn't disregulate her, but actually does the opposite. I don't like to think of it as a romantic thing, but rather as a platonic neurodivergent bond that they both share with each other.

A cute detail is that she also speaks loudly about those energy points with people she trusts, like Traveller and Paimon. I think it's beautiful when neurodivergent people feel free to explain out loud the 'weird' things they do after enduring so much masking.

SENSORY REGULATION

Although I already touched the most important points as to why I think Kokomi is autistic, there are some others I want to emphasize, being one of them sensory regulation and disregulation.

Kokomi is clearly disregulated by social interaction, and uses reading books, resting alone and militar strategy as a decompression mechanism. She also enjoys diving, and as she says, it fills her heart with peace even if the world underseas isn't bright and sunny like the dry land. Water can be very pleasant for some autistic people due to the stimuli and the temperature (I, for example, love swimming but hate being wet and wrinkled afterwards), and I like to think that, when Kokomi is at her limit, she goes diving to calm her mind (this is a headcanon lol, unless I missed something on lore).

Kokomi also dislikes seafood (fish, crustaceans...) and it's funny because I also hate seafood due to it's texture and flavour. Her favourite food, Bird Egg Sushi, is described by her as both 'simple' and 'simple to prepare'. Now I could be analyzing too deeply, but autism and sensory problems with food usually go hand in hand, making us prefer the simplest food possible and avoiding dishes with too much things on them, strong flavours or unpredictable textures... So yeah, Kokomi also fits this.

JUSTICE AND MORALS

Kokomi is leader of Watatsumi Island and goes against the Vision Hunt Decree that Raiden Shogun imposes on Inazuma. As she states on her voice-over (About Raiden Shogun) she doesn't feel rightfully to categorize or criticize Raiden Shogun's actions as good or bad. However, as she fights against it for the welfare of her people, we can assure that she does fight back against things she considers an injustice, even if it burns her out; just because that's what is right.

She also shows a great worry about all her people. If it's raining, she thinks about the fishermans who may not be able to return. The soldiers that died under her charge are in her mind even when she has agreed to not talk about them out loud. That should ideally be the average prototype of a leader, but just by watching Raiden Shogun we can agree that it is, in fact, not it. Seeing Kokomi, a woman who dislikes social interaction and burns herself to fulfill her duty, being at the same time so empathetic, considerate and kind to her people is something I see in a lot of neurodivergent people. The urge to please and help others the best you can do, even if it means sacrificing yourself in the process; not healthy at all, but so pure at the same time.

Kokomi also says something interesting on one of her voice-overs (Chat: Fish) which is that 'respect must be given to the will of every creature'. It is no mistery that she loves sea creatures so much, and I also think that the reason she dislikes seafood is because of this same thought about respecting all lives in nature. Not a very important point, but worth to mention.

I think I covered all the points I wanted to talk about, but if I forgot about anything, I'll update the analysis and add it.

There are a lot of characters I want to talk about apart from Kokomi (Albedo, Alhaitham, Sucrose, Freminet, Fischl, Noelle, Chongyun, Shenhe...) but I will take it slow to bring them all here. Autism spectrum is so colorful and endless that each character has significant but different traits, and I'll cover them up little by little.

This is the end of the post, I will return tomorrow with more things to say.

But here's a little cute Kokomi ❤️

[trans-axolotl]

for anon asking about NPD/ASPD resources

For context, anon sent in an ask searching for nonstigmatizing resources for support with PD diagnoses and other stigmatized diagnoses.

And this is such a good ask--it is so fucking frustrating and dehumanizing to try to search for support when half the stuff that pops up is using really cruel language or just directed towards family and friends. The community definitely deserves better, both when it comes to the way psych professionals perpetuate stigma and in regards to the prejudice and sanism that shows up in other communities in our lives. Unfortunately, I don't have a ton of resources on hand, although I do know one good support group. The rest of the resources I know of are kind of mediocre or not PD specific, so if other people could add on I would really, really appreciate it!

Neuromancers runs a discord and a Cluster B peer support group that I've heard really good things about. I haven't been myself, so I can't 100 % vouch, but they're a group with abolitionist and mad pride values.

This might not be exactly what you're looking for, but it's an article exploring cultural bias in PD diagnosis that links to a lot of sources that talk about how psychiatry contributes to stigma around personality disorders. I clicked through some of the studies that it links to and it does use a lot of medicalized language, but I thought I would link the article anyway in case it's ever helpful to have academic sources to show to other people.

Also not exactly what you're looking for, but another article debunking some of the common talking points about NPD in pop psychology (Content warning that it is discussing some very ableist myths in the context of challenging them)

Last sort of general resources for peer support that I have some trust that they are PD friendly are the Wildflower Alliance and Hearing Voices Network Groups. Wildflower alliance groups offer a lot of different general peer support and I have one friend with NPD who has spoken positively of those spaces. Hearing Voices Network groups can vary a lot depending on location, so defintely plan to email ahead, but I've been to a few groups that welcome people who generally identify as psych survivors/mad/ex patients who want to share community spaces around those values. Also want to share is the neurodivergent friendly workbook of DBT skills (the link is to buy it directly from the creator but if anyone who is interested can't afford it rn, dm me and I'll send you a pdf.) Again, I know this is really not super relevant to what you asked for but is one of the less stigmatizing, less medicalizing workbooks I can find for accessing info about coping skills and this is one of my general favorite support resources.

Overall I'm really sorry that I don't have better resources to offer you, and I think that really should be a sign to the mad pride/psych abolition/peer support community that we need to do a lot better job in making sure that our spaces are explicitly welcome to people with stigmatized PD diagnoses. The work shouldn't have to be on you to try to navigate these spaces and figure out whether or not you're welcome, and any spaces that offer peer support, are aligned with mad pride and psych abolition, really should be doing the work to make sure lateral violence and sanism aren't being perpetuated.

followers, esp followers with lived experience, please add on!