#please if there's anything i missed ask me to tag it cause

[sailor-aviator]

Fool's Fare: Chapter Twelve

Fool's Fare: Chapter Twelve

Pairing: Jake "Hangman" Seresin x Reader

Summary: Captain Jake "Hangman" Seresin had come close to swinging from the gallows more times than he would care to admit. He's stolen, cheated, even killed. The worst thing he's ever done? Broken the heart of a woman. Having broken the heart of the woman whom Davy Jones himself had fallen for six years ago, Jake is now cursed to live as something not dead, but not alive. He's doomed to live a half-life for the rest of his existence unless he manages to obtain the treasure Davy Jones deems most valuable. The problem? He has no idea what it is, and he only had seven years to obtain it.

Content Warning: Talks of death, Lots of anxiety, Reader has a mental breakdown kind of, Abandonment issues surface hardcore, Talk of curses, Talk of magic, Major angst, Sea shanty, Feelings of hopelessness, Davy Jones reveal! I think that's everything, but please let me know if I missed anything!

Word Count: 4.2k

Series Masterlist || Moodboards || Playlist || Jake "Hangman" Seresin Tag List

The port of St. Augustine was much like any other port you had found yourself in. The marketplace bustled with activity, the sellers promoting their wears as others scurried about to and fro on the streets. The sun beat down, casting a fog of humidity that threatened to choke the air from your lungs.

It had been two weeks since the serpent’s attack, and the crew of the Hangman had been stranded in the large port, sequestering themselves to one of the local pubs until repairs to the broken mast were finished.

Jake had been in a foul mood since the encounter, the looming deadline heavy on his mind, and on more than one occasion you had woken up to the sound of his distressed murmurs as he slept beside you. He had flat out refused to leave your side for longer than a few minutes since the attack, anxiety and distress coloring his features every time you looked at him. You knew he feared losing you, you could feel it in the way he held you these days, the end drawing nearer with each passing of the sun across the horizon. But wasn’t it you who should be afraid of losing him? You weren’t the one in danger of falling victim to a curse.

A bothersome fly pulled you from your thoughts, the whining of its movement sparking irritation in your chest. It was too damn hot for the pesky thing to be bothering you. You pulled your hand out from under your chin, swatting at the insect as it flew just out of your reach. It zoomed back towards you, wings fluttering in your face as if to taunt you. An exasperated exhale escaped your lips as you glared daggers at the offending beast.

“You look miserable.”

You turned to see Nat approaching you slowly, a wry smile on her lips as you gave her a tight-lipped smile—an attempt you were sure came out as more of a grimace than an actual smile. You wiped the sweat drenched strand of hair out of your face, offering her a shrug as you turned your attention back to the street outside. She sighed, coming up to sit at the sill beside you. The two of you sat in silence for a few minutes, watching the different groups of people as they flitted about the street. The silence grew more tense as the time dragged on, and you could tell that Natasha wanted to say something to you. Glancing at her from the corner of your eye, you saw her chewing on her bottom lip, deep in thought.

“How’s Mickey today?” You asked her. His screams of agony were still fresh in your mind, the scarlet on his clothes vivid in your mind as he writhed on the decks of the ship. Javy had been the one to stop the blood flow, securing the bandage around Mickey’s thigh tight enough to put a temporary fix to the problem without causing more damage. You watched as Javy and Reuben picked Mickey up on either end, carrying him towards the cabins. Mickey had already passed out, a layer of sweat coating his pallid skin. Nausea roiled in your stomach, your breathing coming out in quick spurts.

You jumped as Jake came up behind you, brushing your hand with his fingertips. Your eyes darted towards him, unease settled deep in your bones.

“Is he going to be okay?” You whispered, looking at the captain for any kind of answer. Jake sucked in a breath, and it occurred to you that you had never seen him look so at a loss.

“I don’t know,” he answered, hanging his head. His hands flexed at his side before balling them into tight fists. You looked from him back towards the sea. The serpent and the British ship were already out of sight as the Hangman limped towards shore. You were sure the men on the other ship were all dead, the serpent’s hunger sated until the next unsuspecting ship made its way into the waters.

“Those men,” you continued, brow furrowing in thought. “The one’s the serpent-”

You stopped yourself from finishing the sentence, pressing your lips into a thin line as Jake glanced at you, waiting.

“Are they dead?” You asked, looking back at him. You didn’t know how the curse worked in cases like this. Yes, they could be hurt. You knew that much. But would something like what had just occurred be enough to kill them?

Jake sucked in a sharp breath, eyes widening as he dared to look back towards the water.

“I hope so.”

You had reached the port of St. Augustine early the next morning, the cold light of dawn at your backs as each crew member heaved a weary sigh. Reuben had departed the ship as soon as the gangway was in place, running to find a doctor to see after Mickey. The rest of the crew waited around anxiously, some busying themselves with tasks around the ship as everyone waited for news on Mickey’s condition.

“He’s doing a lot better today,” Nat told you, a tired grunt leaving her lips as she settled further back against the wall. You nodded, closing your eyes in a bid to ignore the heat that threatened to swallow you whole.

“Doesn’t change the fact that you still look miserable,” she prodded, earning a less than enthused grunt from you. You sighed, leaning up and stretching out your shoulders.

“I suppose I could be doing better,” you admitted, finally turning your full attention to her. She pressed her lips together, humming in agreement.

“The deadline is only a few days away,” she said, and your heart jumped at the reminder before curling in on itself. Her words were the exact reason you had been keeping to yourself the past week, dread filling you down to your very soul as the days loomed and the dreaded deadline approached faster and faster. The anxiety kept you awake well into the night, clawing at your mind until it was all you could think about. You hadn’t known sleep in days.

“Jake’s been awfully tense,” she pressed. “Rightfully so, I guess. Javy won’t show it, but I know he’s worried too. I can see it in the way he holds his shoulders. He fidgets more than usual too when he’s nervous. I do my best to soothe his worries, and I think he forgets for a little while, but…”

Her voice drifts off to silence, an air of uncertainty surrounding her. You understood what she was feeling. The moments of sleep Jake could get were spent in fitful movements as even his unconscious mind was unable to find peace amongst the chaos. You would curl up closer to him in those moments, resting your head against his chest and listening to his heartbeat. Fingers would glide up and down his arm, and your presence seemed to calm him enough that he would still, if only for a little while. You asked him early on what he dreamed of in those moments, but his eyes would glaze over as his lips pressed firm, a faraway look in his eyes before he would shake his head and walk away, shoulders hunched as if in defeat.

Bradley didn’t fare much better when you tried talking to him. The usually playful, happy-go-lucky man you knew and loved had all but disappeared. All that was left was a shell of a man who looked and sounded like your brother, but seemed to be a complete stranger to you now in these past days. You had tried talking to him, to get a sense of where his head was at, but much like your captain, no words would leave his lips. He would only stare at you, almost looking through you before turning and walking away.

You felt like you would lose your mind, like the concern and anxiety was building up so completely within you. It reminded you of how your mother once was when your father would leave for his voyages.

She’d pace around the house, busying herself with as many tasks as she could—sometimes repeating them two or three times in a bid to keep her hands busy and mind from drifting towards thoughts of the unimaginable. On more than one occasion, you’d come home to find her staring out towards the water, a faraway look in her eye. You always wondered what she was thinking about in those moments, but now you were sure you knew.

“I don’t think it’s possible to forget the ocean’s secrets,” you replied, focusing once more on the busy street outside. “The ocean will always remind you why it’s not to be crossed.”

Natasha didn’t respond, only looked at you. You didn’t acknowledge her, letting your mind wander to thoughts of what would happen if you all were to fail. Would the curse turn them into mindless monsters? Would the change be immediate? Or would you lose those you hold most dear slowly as their unslaked desire coursed through their veins for eternity?

Your friend heaved a heavy sigh before standing. She opened her mouth as if to say something, but must have thought better of it before turning on her heels and walking away. You wished you could provide her with some kind of comfort, some certainty that things would be okay. But, you could hardly convince yourself of it, let alone another.

The afternoon passed slowly, your vigil by the window continuing on even as the pub filled with sailors and your own crew. Mickey had managed to heal enough to walk, though his usually golden skin still seemed somewhat dull after his experience. The crew drank as if there were no tomorrow, and you supposed there might not be. Locals took up space by the piano, different jigs and tunes ringing out amongst the crowd as several people joined in with lyrics. You wished you could join in the merriment, bring yourself to forget for just one moment that a mere guess wouldn’t decide your fate.

Jake, Bradley, and the rest of your friends sat hunched around one of the tables across from where you sat, none of them able to meet your gaze, and a mixture of anger and loneliness filled you. Is this what your days would look like? Would they go off and leave you behind to face a life of solitude? Would they expect you to forget them?

For another moment, you were reminded once again of your mother, only this time you remembered her as she waited for that last voyage. You could tell that something was different that time, the air more tense as she paced around your home. The song she would hum under her breath the only sound she would make for days. You thought of that song, how lonely and full of despair the words sounded. You thought of how sad your mother always sounded every time she would sing it, and before you even realized, the words were leaving your lips quietly, slowly building to be heard above the hum of conversation filling the room.

“I thought I heard the Old Man say: ‘Leave her, Johnny, leave her.’ Tomorrow you will get your pay, and it's time for us to leave her.”

Several heads turned towards you as you sang, your voice clear as you felt the emotion you had worked so hard to keep tamped down swirl within you.

“Leave her, Johnny, leave her! Oh, leave her, Johnny, leave her! For the voyage is long and the winds don't blow And it's time for us to leave her.”

The conversation died down now, and you supposed you would feel self conscious under normal circumstances, but something within you longed to break free and be heard. You had long stayed quiet in fear of upsetting those around you with your own feelings. Of course, you had had your few moments where you couldn’t keep the worries and feelings within you, your fears bursting forth and out of you over the past few months on sea.

“Oh, the wind was foul and the sea ran high. ‘Leave her, Johnny, leave her!’ She shipped it green and none went by. And it's time for us to leave her.”

The conversation had stopped completely at this point, but you were only vaguely aware of your audience. The words themselves haunted you, and you knew how your mother had felt all those years ago. You wondered if she felt the exact moment she had lost your father to the sea.

“Leave her, Johnny, leave her! Oh, leave her, Johnny, leave her! For the voyage is long and the winds don't blow And it's time for us to leave her.”

Had your father been scared in his final moments? Did the waves tower over him life in the song you now sang? Had he faced the towering waves head on in the way he faced everything in life? Or had looking death in the face been too much for him? Did he think of you? Your mother? Bradley? Or did he lament the things he hadn’t done, the things he had failed to do?

“I hate to sail on this rotten tub. ‘Leave her, Johnny, leave her!’ No grog allowed and rotten grub. And it's time for us to leave her.”

Several people within the pub now joined in your singing, voices ringing out in unison. For the first time since you started, you dared a look over at the table where the others sat. Remorse colored both Jake and Bradley’s faces, the whisper of tears in their eyes as they watched you. Your heart squeezed so tight, you wondered for a moment if it would burst. You hadn’t meant for the tears to flow, and you were shocked when a cool, night breeze blew in from outside, cooling the trickle that streamed down your cheeks.

“Leave her, Johnny, leave her! Oh, leave her, Johnny, leave her! For the voyage is long and the winds don't blow And it's time for us to leave her.”

You choked on the words, unable to continue as those around you continued on. Your world would change in a few days, and there was nothing you could do about it. For the first time, hope seemed too far out of reach, slipping through your grasp as the realization that you would truly be alone for the first time gripped you tightly, refusing to let go.

“We swear by rote for want of more. ‘Leave her, Johnny, leave her!’ But now we're through so we'll go on shore. And it's time for us to leave her.

Leave her, Johnny, leave her! Oh, leave her, Johnny, leave her! For the voyage is long and the winds don't blow And it's time for us to leave her.”

You let out a quiet sob as you pushed off from your seat, practically running out of the pub. The door banged against the wall with a loud crack, the echo of laughter and conversation chasing after you into the dark street. Another tune started up, a jollier shanty than the one you had led everyone in, but the joy and merriment found in the pub did not reach you in that moment, despair digging its claws into you as you stalked down the street with no mind to where you were heading.

The world swam around you, blurred by your tears. Your chest and head hurt from how hard you sobbed, your arms wrapped around your middle in an attempt keep yourself together, to keep yourself whole.

You staggered, coming to a stop next to building, leaning your weight against the sturdy structure as you fought to gain back your composure. A hand landed on your shoulder, ripping you out of your breakdown. You looked up with wet, wide eyes to meet a sea of concerned green.

Jake didn’t hesitate to try and pull you close, moving to wrap his arms around you in a soothing gesture, but you shook your head, pressing a hand to his chest to keep him away. His brow furrowed in confusion, thumb reaching up absentmindedly to wipe away your tears. You jerked away from him, shaking your head more vigorously.

“No,” you croaked, another sob wracking through you.

“Guppy,” he started, taking a step closer to you, but you shoved at him this time.

“No,” you stated more firmly, shooting him an angry, wild look that had him balking. “I don’t want your pity, or your comfort, or anything else you’re trying to bestow upon me. Not when it’ll all be for nothing.”

“What are you talking about?” He sighed out, an edge to his tone. You sniffled, wiping your cheeks with the back of your hand as you attempted to stand tall.

“I can’t keep relying on you,” you uttered. “Not when this time in only four days, I won’t have you anymore. I’ll be alone. I’ll have no one except maybe Nat, but even that’s not a guarantee. In a few days' time, you’ll face Davy Jones, and not knowing how that will end, terrifies me.”

Jake didn’t say anything for a moment, just stood there and watched you with an indiscernible expression. Finally, he set his jaw and stepped close, pulling you into his arms. A large hand cradled your face, pulling your face up towards his.

“I’m not leaving you, sweet girl,” he said, thumb stroking across your cheek. You squeezed your eyes shut as a new wave of tears threatened to spill over.

“You don’t know that,” you whispered in return.

“I do though,” he retorted. “I know everything will work out the way it’s supposed to. Even if I’m doomed to live a cursed life, a life where I will never know peace or satisfaction again, it would be a far worse fate to not have you by my side.”

You couldn’t stop the sob that shook you, choosing instead to hide your face against his chest. Jake let out a low hum, smoothing his hand over the back of your head as he rocked you gently until the sobs died down once more.

“Trust me, Guppy,” he murmured, moving his hand to dig something out of his coat. “This will buy us our freedom.”

You turned your head to see him holding up the Soul of Polaris, the gem seeming to glow in the moonlight. You swallowed thickly, watching as it rotated slowly in his hold.

“What does it show you?” You asked quietly, gripping his shirt a little harder in your hands.

“What?” Jake asked, sounding perplexed.

“When I first saw it,” you explained, “the man who had it said that it guided a person to what it was they needed most.”

You turned your head to gaze up at him. “So, what is it that it shows you?”

Jake looked at you for a moment, eyes wide in surprise before he shifted his focus towards the gem. His brow furrowed once more as he pressed his lips together, pondering what he should say.

“We should head back,” he said finally, pocketing the gem once more as he guided you back down the street.

Four days later, the newly repaired Hangman rocked in the ocean waves as it headed up the coast towards North Carolina. The air aboard the ship had grown thick with mounting tension and anxiety, the air so thick you swore you could cut it with one of Bob’s kitchen knives.

The fog that surrounded the waters didn’t help matters, setting a decidedly somber mood as the crew waited for their fates to be decided. Sunset was approaching, something you could tell despite the blanket of fog that hid the sun from view. Jake hadn’t stopped pacing the length of the deck for two hours, and just watching him had you on edge. He had already snapped at three crew members for, admittedly, small infractions, and you were starting to wonder if he’d keep his sanity long enough to see Davy Jones at this point.

“Captain,” Javy called from the helm, face tight with his own anxiety, though his tells were less obvious compared to everyone else’s. Jake’s head snapped up to look at him, back rigid as he paused mid-step.

“We’re here,” Javy announced, dipping his head at his best friend. Jake sucked in a breath, teeth gnawing at the inside of his cheek. After a moment, he blew out, nodding his head as he swallowed thickly.

“Yeah,” he muttered, nodding more determinedly. “Yeah, alright. Bradshaw, Guppy. You’re with me. Everyone else, stay put until I get back.”

You were shocked that he picked you and Bradley, certain he would have chosen Javy or Natasha. You didn’t say anything as you followed him and Bradley towards one of the lifeboats. Natasha already stood by the railing, waiting for the captain to approach.

“You’re leaving me behind?” She challenged as you all approached, Javy descending the stairs at the same time. Jake raised his chin at her, a grimace pulling on his lips.

“I trust you and Javy to look after the ship while I’m away,” he explained. “But, I still need people I can trust with me—people I can depend on if this goes south. Bradshaw will act as my muscle, and we’ve seen how things react around Guppy.”

Natasha mulled over his words for a moment before nodding in agreement.

“Be careful out there,” she implored. “We’ve already had one crew member mangled by something magical.”

Jake shot her a grateful look before turning his attention to Javy who had saddled up behind her. The two shared a silent exchange before clasping their forearms and pulling each other in for a one-armed hug. The two pulled away at the same time, and Javy offered the captain a nod.

“Good luck,” he said. Jake nodded back at him before turning back towards the lifeboat. He let out a long, weary sigh before stepping forward with you and Bradley not far behind.

The fog clung to your skin, giving you the feeling of walking through water as the sand shifted beneath your feet. Jake and Bradley had hauled the boat up out of the water and further onto the beach before the three of you set out to find the spot where Davy Jones would be waiting.

The wind whipped around you, ruffling your clothes and sending a chill down your spine. You ignored it, knowing what lay ahead of you already had a frigid feeling coursing through your veins as the sky began to grow darker. Jake’s pace began to increase as the clock counted down, his hands clenching and unclenching as the three of you continued on.

“Do you know where we’re going?” Bradley asked, peering at the captain from the corner of his eye. Jake’s frown deepened as he shot the brunette a sharp look.

“Yes,” he snapped, stopping suddenly. “This is the place.”

You looked around, noting the cliffs that hung just above your head, the grass swaying in the wind as the waves crashed against the rocky shore. Bradley looked around as Jake stared down at his feet. You perched atop one of the rocks, bringing your knees up to your chin as your attention flickered between the two men.

“Did we miss him?” Bradley prodded, hands in his pockets as he walked around in a circle. “Shouldn’t he be here already?”

“I don’t know Bradshaw,” Jake snapped once more, an irritated glint in his eye. “We didn’t exactly exchange letters on what time to meet.”

A familiar hum prickled at the back of your neck, your back straightening as a knowing feeling overcame you. You twisted your neck to the right, looking down the beach towards the opposite way you came. In the growing shadows and through the fog, a tall figure began to emerge, their coat billowing behind them.

“Look!” You exclaimed, scrambling to your feet as you pointed a finger at the figure. Jake and Bradley turned to where you gestured, postures alert and on guard as they spotted the figure too. The humming grew in intensity as the figure drew closer, but there was no sense of danger that accompanied it like there had been with Thetis, the sirens, and the serpent. No, in place of danger, there was only the sense of familiarity, and confusion tickled at the back of your mind.

The fog and shadows obscured the figure as it stopped by some rocks a few yards away. You squinted, trying to make out any discernable features, but you couldn’t help but feel you knew the person who stood in front of you. A soft scratch sounded as the figure struck a match, the small flame illuminating his face as he lit the pipe that hung at his lips. Shock coursed through you as you recognized the blue eyes and weathered face that stared back at your group, the embers of tobacco letting out a puff of smoke as he exhaled.

You blinked, not quite believing what you were seeing, and you knew Bradley’s expression must have mirrored your own in that moment.

“Tom?”

A/N: Wooooooooow! I can't believe it's finally here, y'all! What do we think? How are we feeling? What on earth is going to happen next???

It feels so good to finally get this one off my chest, I've been sitting on it for sooooooo long! Like...the amount of times I almost slipped up and told y'all everything is embarrassing, quite frankly.

As always, reblogs and comments are greatly appreciated. I no longer do taglists, so if you would like to be notified on when I post, please follow my sideblog ( @sailoraviator-library ) and turn on post notifications! You can find me and my works on AO3 under the username sailor_aviator. Until next time!

[5sospenguinqueen]

Bedtime Stories Pt 2 | Daniel Ricciardo x Author! Reader

Summary: Daniel made a silly little comment that lost him everything. Over a year later, he tries his hardest to fix his mistakes.

Warnings: Swearing. A tiny smidge of angst but mainly fluff. Redemption for Daniel.

Female reader with various faceclaims (pics found on pinterest). Takes place in 2023. For the purpose of this, Daniel has been with AlphaTauri the whole time.

Main Masterlist

prev.

━━━━━━ ༻𖥸༺ ━━━━━━

28•05•2023

danielricciardo just posted

liked by redbullracing, YourUserName and others

danielricciardo monaco, always a delight. P11. so close to the points but racing through your streets feels like being on a podium

4,337 comments

landonorris and whose attention are we trying to grab with that sexy last pic 👀

→ danielricciardo only yours, mate 

→ User1 don’t act like you’re not dying inside because y/n liked this 

→ User2 relax, they never unfollowed each other 🙄

maxverstappen1 you’ll get them next time, mate

→ danielricciardo fancy giving me a tow?

→ maxverstappen1 never

→ User3 i love their friendship so much

User4 um, did anyone see that y/n liked and then unliked this post 

→ User5 omg yes! sis was caught stalking and we love her for it 

→ User6 i too would thirst over my ex if he looked like that 

kellypiquet we were watching the whole time

liked by danielricciardo

→ User7 what a weird comment to make?

→ User8 who’s we, kelly? 

→ User9 what does this mean? 

 

━━━━━━ ༻𖥸༺ ━━━━━━

04•06•2023

Tweet 1

User10 @ kikiki babe did you hit your head? is that why you were in the ER? they broke up

User11 @ kikiki maybe ask them to do a head scan whilst you're there 'cause ain't no way you saw here there

→ User12 literally. like why would she even be in spain right now?

Tweet 2

User11 i think we might have to apologise to @ kikiki

→ User10 can we really trust the wag page though? They did report that Lando was having a secret love child the other week..?

Tweet 3

User13 asking the real questions because she's not even hinted that she’s been writing so it’s not like she’s on a book tour or anything?

→ User14 some people are saying she could be on vacation but please, why would mother choose a holiday destination during a time that she knows is a GP?

User15 guys, guys, I think our sacrifice circle worked 

→ User16 please, please, 🕯️🕯️

User 17 how poetic would it be though if they got back together  during the spanish GP when they broke up at the spanish GP a year ago 

User18 shouldn’t you know these answers, and that she was in spain, if you're her so-called updates page

━━━━━━ ༻𖥸༺ ━━━━━━

22•08•2023

YourUserName just posted

liked by maxverstappen1, charles_leclerc and others

YourUserName some big news approaching 

6,349 comments

kellypiquet i can’t wait, my beautiful girl 

→ YourUserName thank you for being my #1 support

→ kellypiquet thank you for letting me help plan

→ User1 what does this mean? 

→ User2 miss piquet stop being so cryptic on socials 

maxverstappen1 i’m very excited 

→ YourUserName did kelly force you to write that because i could feel the excitement oozing through the screen

→ maxverstappen1 i wanted to say something worse 

→ YourUserName i hope she leaves you

→ kellypiquet behave, you two! 

→ User3 i live for max and y/n terrorising each other, even without danny ric being around to encourage it

bloomsburypublishing we look forward to the end result

User4 i’m sorry but is this a soft launch?

User5 who is that in the last slide, miss y/n?

→ User6 the inspiration behind a new romance we hope

User7 don’t be shy. tag him 

User8 soft launches have recently become my least favourite thing

charles_leclerc are you perhaps writing my next plane read

→ YourUserName depends how long the flight is 

→ User9 confirmation of a new book ya’ll!! everyone say thank you charles

User10 i like to be edged by her books, not by her hiding her man

User11 don't try and distract us with news of a new book, we wanna know who the feet belong to!

━━━━━━ ༻𖥸༺ ━━━━━━

01•09•2023

danielricciardo just posted

liked by maxverstapen1, yukitsunoda0511 and others

danielricciardo ciao a tutti. lovely sightseeing in beautiful Italy

6,445 comments

User12 you’re telling me that i’m currently in the same country as THE daniel ricciardo?

kellypiquet i’m still trying to recover from that hike

→ User13 kelly and max went on a double date with daniel and the new girl?!

→ User14 omg please be y/n. i can’t imagine kelly agreeing to it otherwise

User15 i know he's trying to distract us with his beauty but we see the last slide, daniel. we see it

pierregasly so you’re telling me that you were in milan and didn’t bother to come and see me? that’s it. i'm ending our friendship

→ danielricciardo i’m sorry, mate. i was doing more important things

→ pierregasly clearly ;)

User16 someone check on y/n, please

→ User17 babe is clearly having the time of her life in italy (yes, i'm delusional)

User18 does nobody find it odd that he’s posting a soft launch not long after y/n posted a soft launch

→ User19 i know! it’s only been three weeks since hers and he’s posting one

→ User20 i can’t decide whether they’re soft launching each other or he’s trying to make her jealous by flaunting a new relationship as well

→ User21 it HAS to be each other or i will die

━━━━━━ ༻𖥸༺ ━━━━━━

15•10•2023

lando.jpg just posted

liked by YourUserName, danielricciardo and others

lando.jpg so i attended this event… and no, it’s not mine before you all freak out

8,223 comments

charles_leclerc it was a beautiful day ❤️

alexandrasaintmleux i’m so thankful to have been a part of such wonderful memories

kellypiquet the most beautiful bride i have ever seen

maxverstappen1 this was a nicer caption than i expected from you

→ danielricciardo agreed

→ landonorris i take offence to that

User1 guys do we think kelly and max got married? they’ve both comments on this?

→ User2 yes but so did charles and alex so…

→ User3 plus, i know kelly is stunning but do we really think she would call herself the most beautiful bride in 3rd person?

georgerussell63 i’m surprised you remember much after the state you were in

→ landonorris excuse you but most of that was just pure happiness

hulkhulkenberg an amazing day

estebanocon so happy to have been a part of this

alex_albon how’s the hangover, mate

→ landonorris i didn’t drink that much!

→ georgerussell63 tell that to the bouquet that you puked on

→ landonorris i caught it so it was mine anyway

carlossainz55 beautiful photos. she’ll love those

→ User4 who’s she?!

lewishamilton🤍🩵

fernandoalo_official congratulations to the happy couple

User5 the entire grid are commenting on this post, clearly having been in attendance. who IS IT?

pierregasly c’était une belle mariée

liked by YourUserName

User6 guys, y/n’s name on socials just changed from y/l/n to ricciardo

liked by danielricciardo

━━━━━━ ༻𖥸༺ ━━━━━━

03•04•2024

YourUserName just posted with danielricciardo

liked by kellypiquet, maxverstappen1 and others

YourUserName my husband helped with this project. baby ric coming aug 2024

9,550 comments

kellypiquet you will be the most beautiful mother. i’m so honoured to be part of this with you 💕

→ YourUserName stop you’re going to make me cry. you’ll be the most perfect godmother

→ kellypiquet i still think you should've married me instead

maxverstappen1 i call godfather

→ landonorris no you don’t get to call godfather! you already got to be a groomsman

→ maxverstappen1 yeah because who helped get them back together

→ YourUserName kelly

→ danielricciardo me

→ YourUserName no, babe

danielricciardo and before you all ask, no I haven’t stopped crying since she told me

→ kellypiquet me too, dan, me too

maxverstappen1 on a serious note, i am very happy for the two of you. y/n will be a wonderful mother, and daniel, he’ll be there also

charles_leclerc i am so excited. alex keeps telling me to stop buying baby things for you guys but i just don’t listen

→ YourUserName well at least you can safely say that uncle charl bought little mcqueen’s love

→ User7 uncle charl!!!!

lewishamilton congratulations, you two. y/n looks amazing

fernandoalo_official how lovely 💚

User8 omg it WAS their wedding lando attended!!!!!

hulkhulkenberg baby ricciardo!!

pierregasly congratulations. i can’t wait to be uncle GASSLYYYYYY

alex_albon welcome baby ricciardo

→ lilymhe it’s not an alien, alex. you don’t have to greet it so formally

redbullracing we’re all so excited for the upcoming grid baby. working on a racer stroller right this minute

→ mclaren you stole our gift idea!

→ redbullracing you stole our driver!

carlossainz55 congratulations y/n and daniel 😄

mercedesamgf1 what wonderful news 🍼

landonorris i’m just so glad i can go back to calling you mum and dad without daniel wanting to drive his car into the barrier

━━━━━━ ༻𖥸༺ ━━━━━━

Please don’t hate me for this! I did say from the beginning that Part 2s would be redemption.

I’ve had this planned and written since before Part 1 was published so when half of you then asked for her to get with another driver/move on, I was like noooooo I’ve already planned their baby 😂

As always. Requests welcome. If you have requested, I promise I’m not ignoring it, it’s been added to my queue

Baby Fever Angst Part 1s

Max’s Version | Lando's Version | Lance’s Version

Charles’ Version | Oscar’s Version

Tag list

@bibissparkles @barcelonaloverf1life @rlalliehayes @dullypully @softtina @callsignwidow @lav3nder-haze @minkyungseokie @luvrrish @fall-bambi @evans-dejong @sadsierra2 @justdreamersdream @spookystitchery @dark-night-sky-99 @majusialikesfastcars @luckyladycreator2 @bborra @mrosales16 @reguluscrystals @tvdtw4ever @alwaysclassyeagle @gigicisneros @spanishcorndogs @thecubanator2 @goldenharrysworld @awritingtree @jxnellat @sbrn0905 @hc-dutch @buckybarnessweetheart @ironmaiden1313 @dreamercrowd @yourbane @reguluscrystals @peachiicherries @g-l-o-b-e-w-h-o-r-e @weekendlusting @leclercsluvs @hannannannannannah @lifeless-firefly @sinofwriting @exotic-iris13 @imperfect-paragon @dan3avocado @barcelonaloverf1life @avillagesperson @hard4ndsoft @justzluv @laneyspaulding19 @danielshoe @chocolatefanunknown @redcrescentmoons

Sorry if I missed anyone!

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[bluebeary-jay]

Damage done

Pre/No-outbreak!Joel Miller x f!Reader

Summary: during a fight with Joel, he unknowingly sends you into a panic attack caused by your previous experiences. he deeply regrets it. (based on this wonderful ask!)

Tags: heavy ANGST, hurt/comfort, angst with happy ending (there's also fluff), established relationship, petnames, soft!Joel (he's trying his best fr 🥺). Several years pre outbreak. please read the warnings carefully

Warnings: fighting, talk and mention about previous abusive relationship, panic attack, emotional distress, self-destructive thoughts

Word count: 4K

A/N: i wrote it partially based on experiences with my own panic attacks, but i know everyone's is different. if there's a warning i missed, please let me know. also i want this man to take care of me so much 😢 anyway, stay safe, darlings, and as always: happy reading and i hope you'll enjoy!! 💕 comments and feedback are greatly appreciated 😌

It had been a rough couple of weeks. Things at your work were rocky to say the least, what with your boss firing several people every week and cutting your salary. Joel didn’t have it much better – from what you understood, two clients suddenly canceled their order, and Tommy got himself thrown into jail, again, breaking his longest record to date. On top of that, little Sarah went down with some kind of flu that was raging in schools recently, and for the last two weeks one of you had to be home with her almost all the time.

So it was probably no wonder that the tension and stress became too much at one point, and you both snapped.

It was about the play at Sarah’s school.

“You promised her, Joel! She was talking about it for the entire week.”

“It’s not my fault we have to go out of town on this date,” he answered through clenched teeth, pinching the bridge of his nose and not looking up at you. “I tried to reschedule, but the commissioning party refused. I can’t help it, for fuck’s sake.”

You were glad Sarah wasn’t home right now to listen to your fight. You dropped her off earlier at her friend’s house because she wanted to practice lines for the play they were doing next week. The play that Joel was apparently planning to miss.

You adored Joel – god, you loved him with all that you had – but he could be so stubborn sometimes, it was driving you up the fricking wall.

“It’s your kid, Joel–”

“Yeah, it’s my kid!” he raised his voice, only now lifting his head. His stare was cold and hard, so unlike how he usually looked at you. “Not yours.”

“Are you kidding me?!” you shouted, hurt by his words and the tone he used. “I’ve been taking care of her, loving her– She is like a daughter to me!”

“But still not yours,” he repeated harshly. That was a low blow, especially when he told you so many times that you might not be Sarah’s biological mother, but it’s obvious you love her like she’s your own blood.

“You’re only saying that ‘cause you know I’m right,” you snarled angrily, and Joel huffed a humorless laugh.

“Of course. You always know better, dont’cha?” He stood up, towering over you, but you didn’t back down. If anything, it only made you more mad, as if he was doing this to intimidate you. “I’m sorry I’m such a terrible father in your eyes, but I have to think about earning money. Especially since it’s only a matter of time ‘till that asshole boss of yours will fire you, too.”

“What the fuck’s that supposed to mean?! You really think so lowly of me to say it won’t be long until I get fired?”

“I don’t– Christ, you’re puttin’ words in my mouth again.”

“Again. Of course.” You spat out and took your sweatshirt from the couch, done with him and this conversation. “I’m going to my home,” you told him dryly. Joel’s nostrils flared and he took a step forward.

“No, you’re not.”

“Fuckin’ watch me,” you muttered under your breath, but loud enough for him to hear.

“We are not finished!!” Joel screamed, his booming voice echoing throughout the house.

It felt like a slap. In one second you froze, all your muscles seized up and a feeling of coldness gripped your heart and throat, sending panic flooding your veins. The sweatshirt you were holding slipped out from your stiff fingers.

Joel has never raised his voice at you like that. Never with such anger and fury. There was a bite to his tone that you couldn’t explain, but which you knew very well – the telltale sign that you went too far, and the other person’s patience was at an end, that now you were going to pay for it.

Your previous boyfriend taught you what it means. It meant bruises and split lips, and screaming when you started crying…

Joel noticed the shift in your behavior right away, and his anger immediately ebbed, replaced by confusion and concern.

“Darlin’?” he murmured the pet name, though it rolled off his tongue heavily and with difficulty.

He was still furious at you and your refusal to understand what he was going through, but it all died down when he saw how wide, how empty your eyes were. Your knees buckled, and you looked like you could fall down at any moment.

Joel didn’t have any idea what was happening with you – but knew that whatever it was, it was his fault.

You, in the meantime, felt like you couldn’t breathe. The man in front of you – you weren’t even sure anymore who that was – took a step forward with his hand lifted, and you quickly backed away, stumbling in the process.

“No! N-no, no, please, I’m sorry–” you started blabbering and sobbing, wrapping one arm around your middle to protect all the main internal organs. “I’m sorry, I didn’t mean to–”

“No, you didn’t…”

“Please… I’m sorry, I swear,” you cried, trembling at this point, but not daring to escape the room. “I’ll be better, just don’t… Please, don’t…”

Joel’s heart broke when he saw you bursting into tears and trying to make yourself as small as possible. All his anger disappeared in a cloud of smoke, replaced by the overpowering need to comfort the girl he loved.

But you seemed so scared when he wanted to come closer… And he didn’t know how to proceed.

“You didn’t do anything wrong,” he repeated in an even softer tone, his eyebrows scrunching in worry. “Sweetheart… M’not gonna hurt you.”

He took another slow step forward, but that seemed to already be too much, because the trembling intensified and you practically slumped against the wall, one arm around your stomach, and the other squeezing your throat tightly. Joel feared to know the reason why you would do that to yourself.

“Stop, plea– I can’t– I’m sorry, I’m sorry…”

“No, it’s okay, my baby, it’s alright…”

He fell down to his knees next to you and reached to take you in his arms, but you started shaking your head violently, backing away and squirming out of his reach.

“No, no, please, I’m sorry! Don’t– don’t touch me!!”

A bile rose up in his throat, and he retreated his hands, holding them low in front of him to show he’s not going to do anything.

“It’s alright, babygirl,” he muttered chokingly, feeling completely helpless and lost about what to do. “You… you’re safe.”

You were crying uncontrollably now, though it seemed like you tried to stifle the never-ending sobs and tears flowing out of your eyes, in result making your entire body shake. You flinched – actually flinched – when Joel opened his mouth, and your fingers around your throat tightened their grip.

“No,” Joel said decisively, breaking your wish and grabbing your wrists, moving them away from your neck where red crescents started to form. “Baby, please, don’t.”

“Let go!!” It was hard to distinguish the words from between your cries, but the message your body language was conveying was clear as day. “No, don’t… me…” You sobbed again, quickly weakening despite your efforts. “I’m sorry, I’m sorry…”

“Come ‘ere,” Joel whispered in a voice full of pain, carefully shifting closer and wrapping his arms around you, though being careful not to make you feel too crowded or trapped. “Shhh… it’s Joel, darlin’, m’here.”

Surprisingly, you let him hold you – maybe it was just because you didn’t have strength to resist and fight back anymore, Joel thought, but maybe you recognized him. Maybe it was both. But the tears didn’t stop. No matter how gently he stroked your back or whispered reassuring words, you couldn’t seem to stop crying.

Several times in the next couple of minutes you tried to grasp your neck or arm again, but every time he delicately, though firmly, moved them away. You still babbled half-intelligible apologies and pleas, and each time your voice broke or hitched on another fearful word, Joel’s heart was shattering into a million pieces all over again.

“I’m sorry…” you sobbed again, trembling in his arms. “I’m sorry, don’t hurt me, p-please–...”

“My darlin’...” Joel held you closer and more securely in his arms, rocking you back and forth. “Sweetheart, my sweet, sweet girl… I’m never gonna hurt you, I swear.” He planted soft, delicate kisses on your hair. Even though he wanted to hug you tightly, to show you how much he loves and cares about you, he restrained himself and tried to keep his touch as gentle as possible. “I swear, my babygirl, m’sorry, so sorry for screamin’... Didn’t mean to.”

You were still crying, albeit weaker now, in his arms, clinging to him like your life depended on it. Joel could feel your nails digging themselves into the skin of his back, but it was the furthest thing on his mind – hell, he could start bleeding and still it wouldn’t be as important as comforting you at this moment. Better him than you.

“I love you s’much, my babygirl, my life,” Joel continued murmuring into the top of your head, feeling close to crying himself when your tears seemingly couldn’t stop flowing. “M’so sorry. I won’t ever hurt you like that again, I swear���”

His words, though full of love and compassion, rolled off you like water off a duck’s back, and you still couldn’t locate yourself, couldn’t tether your being to this world and make sense of the difference between what you knew should happen, and what was actually happening.

Your whole body was hurting, yes, but it wasn’t the pain of being repeatedly hit. You could barely hear your own cries, but it wasn’t because of vicious and cruel words being thrown at you. You knew it was Joel you were clinging to, and he never hurt you in this way, but… but you also were never so angry at each other. You never fought like this – and experience taught you that crossing that invisible line will carry certain consequences.

You weren’t angry now. You were scared. And confused.

“Joel,” you whimpered between gasps, struggling to breathe through your rapid sobs. “I’m sorry. Please, don’t– don’t go.”

“M’not leavin’ ya, babygirl.” He spoke into your hair, closing his eyes. “M’not goin’ anywhere.”

You were calming down a little now, the sobs wrecking your body and breaking Joel’s heart dying down, though you were still shivering. Joel continued to hold and soothe you the best he could.

And wondered who must’ve hurt his darling so much that you’d react so badly.

“I’m sorry,” you whispered after a while, sniffling into Joel’s chest, but trying not to get snots on his shirt. Joel sighed sadly, but his hold on you just tightened.

“No, babygirl, my darlin’...” He pressed his lips to your hairline, stroking your back with his other hand. “You have nothin’ to be sorry for, I swear. It’s okay.”

“It’s not,” you whimpered pitifully, unable to stop another wave of tears from falling. “I’m sorry I reacted like that. I know… Joel, I know you won’t hurt me. Baby, please.” You took his head in your hands, searching his eyes with fear painted across your face. “I’m so sorry, wasn’t thinking and…”

“Hey. Love, it’s fine.” He placed his own hands on your cheeks, stroking lightly your damp skin with his thumbs. “Don’t say that. M’not angry at you and would never be because of that. It’s… it’s okay.” He petted your hair, trying to relax for your sake, but his chest remained tight. “It’s gonna be okay, I promise.”

You nodded weakly, though you weren’t sure if you believed him. Joel swallowed heavily and nodded after a while, too.

“Okay. I… I’ll run you a bath,” he whispered, but you held his hand tighter and shook your head with tears gathering in your eyes again.

“No, no! Just s-stay with me, please.”

Joel took your face in his hands, but you closed your eyes, feeling too vulnerable and exhausted to even try to maintain eye contact.

“I’m here, baby. C’mon, just hold onto me.”

He waited until your arms were around his neck before slowly standing up and tucking you securely in his arms. You hid your wet face in the crook of Joel’s neck, breathing in his soothing smell and trying to calm your breathing, which you still found difficult.

Neither of you said anything when he took you to the bathroom, sat down on the toilet seat and started to fill the bathtub with water and soothing oils. You just watched him, wiping your nose every once in a while.

Still remaining silent, Joel extended his hand and helped you stand up. Then, almost with fearful hesitation, he touched the hem of your shirt, sending you a questioning look. You just nodded, not having strength to undress yourself, and lifted your arms, letting him take your clothes off.

You didn’t let go of his hand even after he guided you to sit in the tub. You couldn’t bear being alone with your thoughts right now, and Joel, being as wonderful of a man as he was, stayed by your side as the warmth from the water seeped through your tired bones.

Another several minutes passed before he finally asked the question that was gnawing at him since the very beginning. You must’ve subconsciously known it was coming, cause it didn’t even surprise you.

“Who was it?” he asked quietly. His hand was still caressing your palm with the gentlest of touches, but his eyes were like ice, full of hidden rage and hatred. “Who did this to you, darlin’?”

You wrapped your arms around yourself, not sure whether to answer or not. Ever since you got to know him, Joel has been nothing but kind and understanding, never pressuring you into doing or saying something you didn’t want… but you had a feeling he wasn’t going to let the matter drop.

And honestly, you were afraid to tell him. To admit how your previous relationship looked and what exactly happened to make you act so strongly about something so small. Because… what if he’ll realize how broken you are, how much effort it’d take to put up with you, and he’ll leave? Even if he was willing to take care of you, it was really unlikely that he’d stay – even if he says that now.

You were doing good until today. You managed to hide the issues you had with yourself and all the pain you carried inside, never letting Joel know that something was wrong with you. But now he… he will…

You didn’t want him to leave. He made your life so much better and you loved him to pieces with all your heart, as weak and broken as it was.

You couldn’t lose him.

“Oh, baby…” Joel’s hands cupped your cheeks so carefully and lovingly that you almost started weeping again. “M’not goin’ anywhere. I love ya so much. You’re never gonna lose me.”

You didn’t realize you said those words out loud, but even so, somehow his affirmations didn’t make you feel any better. You wanted them to comfort you, but if anything, they just made you feel sick.

“I’m afraid you’re gonna leave someday,” you whispered hoarsely, keeping your eyes on the slowly disappearing bubbles. “I know I’m being selfish, but I don’t want you to. You’re the best thing that ever happened to me, Joel. I…” Tears spilled from your eyes again and you shook your head. “I know I’m too much. And… and broken. And I know it sounds like I wanna guilt-trip you, but I’m not, I’m just–” You choked on a sob, and wrapped your arms tighter around yourself, hugging your knees to your chest. “I don’t– don’t know what’s wrong with me.”

“Sweetheart, look at me, please.” Joel’s hands were rough to the touch, but so incredibly gentle when they guided you to meet his eyes, and a big pit formed in your stomach when you saw how they shone. He was on the verge of tears, too. “Don’t say things like that. Nothin’ is wrong with you. Who…” He sighed again. “Who made you believe such things?”

You didn’t answer at first, but Joel kept staring at you, and – finally – you relented.

“My previous boyfriend. The one I didn’t want to talk about. He– Look, I know he was a horrible person.” You let out a short laugh, but without any joy – or emotions altogether – in it. “And I hate him so much, but he… he was right. About some things.”

“He’s not.” Joel didn’t back down, feeling despair growing inside his chest as he saw the girl he adored with his whole heart put herself down like that. “You’re… fuck, you’re perfect, darlin’, and you didn’t deserve to be treated or talked to this way. M’so sorry it happened to you.”

He brushed some of your hair to the back and sighed silently. He seemed so lost and sad, it made you feel even worse.

“What can I do?”

That stopped the train of your thoughts, and you looked up.

“What?”

“What can I do?” he repeated softly. “To prove t’you that I’m not goin’ anywhere.”

Your lips parted, and you were unsure what to say. Joel took your hand in his, delicately tracing patterns on the back of it.

“Babygirl, listen to me. You’re the most precious thing t’me. I don’t care what this asshole told you, but… but none of this is true. And it’s not gonna drive me away from you. Nothin’ is gonna make me leave,” he repeated more firmly, never taking his eyes off you. “Because I love you. More than anythin’ else in the world”

Joel sounded so sincere and desperate, tugging at your heartstrings with his gentle, sad eyes and loving words. The water became cool some time ago, but your insides felt like they were on fire – as if the next breath you were about to take would be your last.

“I’m sorry for everything I said.” You took a shaky breath, trying to keep your voice steady. “I don’t think you’re a bad father. I think you’re the best and most amazing dad Sarah could ever ask for. I didn’t want…” You sniffed and your shoulders started to shake again with silent cries. “I didn’t want to hurt you, I’m so sorry, I didn’t–”

The sob that you tried to stop with all your might suddenly escaped you, and Joel’s forehead scrunched in worry. He pulled you closer, leaning over the edge of the bathtub. Neither of you concerned yourself with water dripping off your skin, only feeling relieved from each other’s closeness.

“I know, babygirl. M’not mad.” Joel left a lingering kiss on your tearstained cheek, and then a second one on your forehead. “I’m sorry, too. For how I acted and for–” he sighed heavily into your shoulder, “for shouting at ya.”

“You couldn’t have known,” you mumbled, but he shook his head.

“That’s no excuse. I shouldn’t ‘ave done it in the first place.” He relaxed in your arms, and somehow it made your muscles less tense, too. “I’ll see what I can do about that job. So that I can see Sarah’s play.”

You nodded and let your eyelids drop, giving in to the feeling of calm and security that always came with being with Joel.

“Can I sleep here tonight?” you asked quietly. You still were a little afraid that he’s going to turn you down after what happened, but you really didn’t want to stay alone. “With you?”

“‘Course you can. D’ya want to go now?”

You nodded again. Not bathing seemed like a big waste of water, but you didn’t feel strong enough to actually wash your body. And Joel didn’t pressure you – he just bent over and wrapped his strong arms around you, practically pulling you out of the tub by himself.

His clothes were completely soaked when he put you down and reached for the fluffiest towel you had, wrapping it around you like a little cocoon. He got rid of his wet shirt, kissed your head gently and, without a word, scooped you up into his arms again.

“I can stand,” you offered when he started walking towards the bedroom, forcing you to wrap your hands around his neck for support.

“I want to take care of you.”

“But your back pains…”

“I’m not that old yet, sweetheart,” he answered with a half-smile, slowing down and gazing into your eyes softly. “Let me take care of you.”

You brushed his cheek with your fingertips tenderly, eyes flickering across his face. “But you’re always taking care of everyone, Joel.”

His throat bobbed and he almost immediately looked away. It was clear what he was thinking – that according to himself, he wasn’t doing a good enough job. Because you got hurt. Because he was the one who unintentionally hurt you and sent you into a panic attack.

He was silent when he put you down on the bed with care, turning around to fetch one of his shirts from the closet. During this whole time you didn’t say anything, either. Your mind was still a little closed off from when you tried to separate yourself from the painful memories that started to haunt you, and despite Joel’s efforts, it was still difficult to move past the experience.

But your head snapped up when Joel, after helping you put the shirt on, knelt in front of you, took your hand in his and leaned forward to kiss your knee gently.

“M’sorry,” Joel whispered with pain tinging his deep voice. “I’m sorry for sayin’ all those things about you and Sarah. I know you love her.” He pressed his lips to your knee again, and lifted his head, revealing how misty his own eyes were, which in turn made your heart ache even more. “My sweet girl. I swear I won’t ever hurt you again.”

“You didn’t hurt me,” you answered quietly, but Joel shook his head and took a deep breath.

“What can I do?” he repeated his question from earlier, and this time you knew exactly what you needed him for.

“Can you… can you hold me?”

Without missing a beat, Joel raised from his position and enveloped you in his embrace, making you feel safe and protected like never before. You sighed heavily, breathing in his scent and feeling like just by touching you with such love that only he was capable of, he helped you to lift some invisible load from your shoulders.

Despite the headache from all the crying and your chest still tightening with every shallow breath you took, you felt a little better now. You didn’t feel alone.

You knew you were safe with Joel.

It took some time for you to fall asleep, but even when you did, Joel could not find peace in the silky darkness of the evening.

Before you dozed off, Joel vowed again and again how much you mean to him, how you and Sarah are the best things that ever happened to him, and how he’ll never let anything happen to any of you – and he could clearly see that you believed his every word, and that you weren’t mad at him. You weren’t flinching when he rocked you back and forth, or later when he pressed small kisses to your forehead.

But you still were quiet and your face miserable, and several times Joel tucked you in closer to himself when he felt you shaking and sniffing. There wasn’t anything else he could do but hold you and whisper soothing promises into your hair. Once your eyelids started to drop, he began humming a familiar melody he knew you liked, and you nuzzled your face into his neck, curling up in his embrace.

And you whispered ‘I love you’ before you drifted off to an uneasy sleep in his arms. And before he could even answer, you thanked him for loving you.

When he heard it, he had to keep himself from breaking down with the last bit of his strength.

“You mean everythin’ to me, love. Everythin’,” he murmured after a couple of seconds, not even knowing if you were still awake. The guilt in his chest made it hard to breathe, but he pushed through it, and then he softly kissed your forehead, making a promise to himself.

He will find time to go to Sarah’s play with you. And he’ll make it right.

[astonmartinii]

into the arms of another part two | max verstappen social media au

pairing: max verstappen x reader

part two to this !! part three

yourusername

liked by arthurleclerc, maxverstappen1 and 661,230 others

yourusername: winner winner chicken dinner !! congrats maxy i’m so proud of you always

view all comments

user1: i know charles’ head is hot right now

user2: i hope netflix are taking notes cause this tea is steaming hot

maxverstappen1: thank you baby, helps when i have the prettiest cheerleader in the world

yourusername: i am the sexiest sargent in all of the orange army

maxverstappen1: too right you are

user3: i miss when y/n was the head of the tifosi the red monochromatic fits ate so hard

user4: i need charles to pull his head out of his ass and apologise so we can reclaim her before monza

user5: do not even bring up the fact we may not have custody of her for monza

danielricciardo: leave some for the rest of us maxy

yourusername: no actually i think it’s illegal for max not to win sorry

danielricciardo: will that change if charlie apologises?

yourusername: considering that hasn’t happened and doesn’t look to be happening any time soon - no.

user6: CHARLES PLEASE DO SOMETHING

user7: he doesn’t have to do anything, she’s just bitter cause she’s always been the bridesmaid and never the bride. we ALL know she’s always loved charles and she can’t handle that she’s not the centre of his attention it’s kinda pathetic

maxverstappen1: what made you think you know any of us enough to comment something like this? what told you that you even had a right to talk about y/n like that? she’s everything you could ever wish to be and more and she will never ever deserve the things you people are saying about her. charles would be lucky to have y/n in his life platonically or romantically but it’s his loss

user8: boyf of the year right here

user9: charles take note ^^^ this is how you’re meant to defend your best friend

landonorris: i am once again asking for photo credits i’m not gonna be your personal photographer for free

maxverstappen1: i literally paid for your dinner

yourusername: you’re literally a millionaire

landonorris: i don’t care a man still likes to be wined and dined

yourusername: just to make it clear we are not looking for a third

user10: i promise i can change your mind give me a chance

f1tea

liked by user11, user12 and 2,349 others

f1tea: charles leclerc caught liking this tweet about the situation between him and y/n. seems like he won’t back down on this. what do you think?

view all comments

user13: i need this mans head on a spike i’m so serious

user14: i want to play pinball with the single marble in his head

user15: i think ferrari have genuinely caused real head rot in him cause no way he thinks this is a serve

user16: let's be real charles' biggest rivals are ferrari and himself

user17: not this man at his BIG AGE is liking shady tweets about his best friend

user18: i think it's safe to say they're not best friends any more

user19: also "biggest rival" my ass max and charles are fucking friends now so this whole narrative is complete horse shit

user20: i'm so bored of charles playing the victim bro YOU ARE THE INSTIGATOR YOU ARE THE PROBLEM

user21: the way charles is liking shit like this but max is writing whole ass essays in the comments defending her

user22: and that''s why i'll always back that she ended up with the right man

user23: max is so far in the lead in the championship i need him to take charles out for the narrative

user24: are we in high school? like seriously this is so fucking petty i cannot wait for media day this weekend

user25: he's either gonna be the funniest man in the world or he's gonna bite someones fucking head off

user26: and i'll back it either way

user27: i know y/n is about to have her revenge dress moment in the paddock someone get kym illman ready STAT.

f1wagsupdates

liked by lilymunhe, carmenmundt and 4,530 others

tagged: yourusername

f1wagsupdates: REVENGE DRESS MOMENT !!! y/n y/ln enters the paddock in monza in this stunning black dress, showing the world what a catch she is, oh and that is max holding the umbrella for her, what a gentleman.

view all comments

user28: mother came to slay i cannot even

user29: this right after max came for charles in the press conference is PERFECTION + NO RED IN MONZA !!

user30: i see lily and carmen in the likes in knew they'd be on the right side

user31: girl i don't think anyone is on charles' side

user32: yall see the stink eye from the red bull garage when charles walked past they have y/n's back LOL

user33: the red bull garage been ride or dies for max so it defo makes sense that they would extend that to y/n

user34: christian was defo waiting for a question about it in the press conference

user35: someone on twitter got a clip of him putting his arm around fred going out of the paddock and telling him to get his driver under control

user36: yall are we on the kardashians what the fuck is going on

user37: people may hate christian but he defends his driver so much that he's inserting himself in the relationship drama

user38: i don't even follow f1 but whoever this is this serving oh my

user39: this is so exhausting like i need charles to just apologise so we can get cute y/n x max x charles content

user40: torturing myself thinking about how cute that dynamic could be

f1

liked by yourusername, maxverstappen1 and 1,203,457 others

f1: max verstappen clinches his tenth win of the season at monza, joined by sergio perez and oscar piastri. home heroes charles leclerc and carlos sainz came together at turn one, awful showing for ferrari in monza

view all comments

user41: this narrative is so so poetic

user42: i feel bad for the tifosi at this point y'all get your hopes up every season

user43: charles you aimed the wrong way if you wanted to take max out

user44: the way max kissed y/n after winning god they're so cute

user45: also the way christian got everyone to move so y/n could get to the front to see max

user46: even marko looked happy about it what is going on?

user47: y'all we knew it was gonna be bad for ferrari y/n wasn't wearing red, call me superstitious but every time she's worn red charles has either won or been on the podium

user48: well that's just what he gets for not appreciating her

user49: as fernando would say KARMA

user50: someone check charles' blood pressure please

maxverstappen1

liked by christianhorner, yourusername and 1,304,662 others

tagged: yourusername

maxverstappen1: winning on and off the track, some of you can't relate.

view all comments

user51: parents omg

danielricciardo: fighting words maxy, not pulling your punches

maxverstappen1: i do my fighting on the track, not my fault people can't get past turn one to give me a real battle

danielricciardo: i need to be inside your brain

maxverstappen1: no there's images of y/n in my brain that no other man will ever see

danielricciardo: you crack me up maxy

yourusername: woah who's that fine ass piece of woman

maxverstappen1: she's taken sorry

yourusername: that's a shame, i hope that man is taking care of her

maxverstappen1: i don't believe she's got any complaints

yourusername: wow you sound like a gentleman, she's a lucky woman

maxverstappen1: believe me i am the lucky one.

yourusername: awwww maxy you're literally the sweetest person in the world

user52: if i was charles and i saw this after that race you'd have to restrain me i'm so serious

user53: i'm happy for y/n and max but i need them to stop being happy in my face

alexalbon: ur welcome for that first picture btw

yourusername: lily taught you well

alexalbon: so no thanks?

yourusername: i joke thank you very much sir albon

user54: so like all of the twitch quartet are on y/n's side? awkward.

yourusername

liked by maxverstappen1, georgerussell63, 706,835 others

tagged: charles_leclerc

yourusername: charles and i have been best friends since i knew what the word meant and it really hurts that is has gotten to this point. when charles got his first girlfriend i chalked it up to the excitement of the experience, but when he routinely got in and out of relationships and falling back on our friendship once scorned, i started to question what he really felt about our friendship. i overlooked it every time even when it made me doubt my worth and hoped our friendship meant more. however, the cycle continued and after being left stranded at a beach in a country i do not know i decided it was the end. i have reached out to you so, so many times and want nothing more than our friendship to work and so we can be life-long friends that we can tell our kids about. but i guess it's not worth that much to you and that's something i'll have to reconcile with. the only positive coming from this the fact that it pushed me to the love of my life, so thank you for that.

comments are turned off.

charles_leclerc

liked by joristrouche, pierregasly and 1,305,783 others

charles_leclerc: i've already got my trophy, sorry not sorry.

view all comments

user56: WHAT THE FUCK

user57: my brain is actually scrambled

user58: charles' must be as well cause no way he thought this was a good idea

landonorris: so this is a low blow

charles_leclerc: since when were you the reference point for morals

landonorris: damn dude, you're in the wrong but go off i guess

user59: why do i actually want to cry for y/n right now? she did this whole ass heartfelt post with no comments so people wouldn't be able to speculate and he replies with a pic of his gf's ASS

danielricciardo: not cool dude

charles_leclerc: i see you all took her side and our friendships mean fuck all

danielricciardo: kinda ironic you bring up respecting friendships

charles_leclerc: spare me the lecture

maxverstappen1: you're a child. but this is the closure she needs. cheers to being an asshole.

charles_leclerc: so you managed to get some of my sloppy seconds, you're welcome

maxverstappen1: she's not sloppy seconds and i can't believe you'd refer to her as that. but if you wanna talk sloppy seconds you can hold the 100 point gap between us in the championship. and y/n will never say this so i'll say it for her GO FUCK YOURSELF

user60: SHOTS FIRED

user61: men are so confusing

yourusername added to their story

[caption: taking some time for myself. thank you for your kind words and know i have an amazing support system around me now]

f1wagsupdates

liked by user65, user66 and 5,430 others

tagged: charles_leclerc

f1wagsupdates: charles leclerc spotted outside y/n y/ln's office with flowers this afternoon. idk at this point, any time i report on this man i lose more brain cells.

view all comments

user67: lol even wag page admins are done

f1wagsupdates: he gives me a lot of content but damn he needs to sort his head out

user68: lol this is gonna be an all time apology tour i can't wait

user69: i honestly don't want y/n to forgive him he doesn't deserve it.

user70: yeah max has proven ride or die for y/n so i know who she should stick with

user71: i need him to donate his brain to science cause in what world is a measly bouquet of flowers gonna cover all of this shit ?

user72: legit he's systematically ditched his best friend, let randomers on the internet drage her name through the mud and then liked it and then flaunted the fact that he didn't care about their friendship for everyone to see

maxverstappen1: lol nice try

user73: my petty king i love him so much

user74: i know y/n is taking a break from social media but i hope she knows how much love she's getting

user75: for real we're all on her side i hope she slammed that door in charles' face

user76: i hope that bouquet ended up in the bin

maxverstappen1 added to their story

[caption: special delivery for a special girl]

note: i know this was heavily requested so here it is!! i really like it and it's defo open for a third part if yall want charles and y/n to reconcile? thank you for reading xx

[wholoveseggs]

Rules {Part Five}

18+ ---- {Masterlist} {Tag-List}

Part Five

It was never a good idea, falling in love with the enemy. But how were you supposed to know how it would all end up?

♡♡ THANK YOU so much for all the love for this series!!! I had so much fun reading all your comments and inbox messages. Enjoy! and please don't hate me for the ending...♡♡

10.7k words {sorry not sorry} - Warnings: salvatore!sibling reader, smuttttt, Elijah being the sexiest middle-part menace he can be, secret affair, forbidden romance, KLAUS, a little Katherine cameo, ritual sacrifice, death, murder, pain, pain and more pain...

{Part One} {Part Two}{Part Three} {Part Four}

♡♡ Tag-List ♡♡

Trying to fix my tags! I re-added all of you, and now you will be posted at the top!

If you no longer wished to be tagged just shoot me a DM {I won't be offended} xoxo~

@gorgeouslydangerous @starkleila @lydia1369sworld @notleylaaa @vampiresluv

@myanmy @xflowerbombxo @maryvibess @always-and-forever-daydreaming @criminallminds @rosemarypotion @spnaquakindgdom @amournoir @meeom @damienmorton @wickedmuse @sunkissedebony97 @idk00sblog @savannaounana @cs-please @complicatedandconfusing-25 @youcanhavemybuckanyday @akala6670229 @yeaiamme2 @itsjulzandmydiamonds @spideysbabe @witch-of-letters @elijahstwink @rosecentury @sekaishell @ziayamikaelson @amanda08319 @starshipcookie @li-da-savage @veggie-eggrolls @spideybv28 @loving-and-dreaming @fancycassie-stayfancy @hcqwxrtss123

Information, of all things of value in this world, is most precious. Katherine had learned that the hardest of ways.

She had been trying to keep tabs on everyone, especially the Salvatore brothers, who were the cause of her most recent headaches. Dwelling on the irony of that made her skin itch, considering the amount of time she had spent causing them grief.

She was sipping on a glass of bourbon, trying not to think about how her plans were crumbling. She hoped to charm Elijah, get him to protect her like he did last time.

But when he found her, he wasn't the same. He didn't have the same softness about him, the gentleness in his eyes. He was harder, angrier, more ruthless. She supposed that was her fault, she wondered how her life would have turned out had she trusted him...

She didn't regret her choice, she knew it was worth it, she always chose her freedom first, nothing else mattered. 

And she had almost gotten away, if only she had a little more information.

But now, here she was, back under the thumb of the man who had taken everything from her.

Klaus.

"Please, just...kill me. I've told you everything that I know," she pleaded, not sure why she was bothering.

He never showed her mercy, but she couldn't help but hope he would spare her, if not for old times sake.

"You see, I believe that you believe that, but what would you not know? What could they be keeping from you? Hmm? Anything? Tell me." He said, his voice was calm as he compelled her to speak the truth.

"When I was at the Salvatore house, I saw their sister, drugged and unconscious. They were keeping her that way,"she said, her voice trembling, she couldn't control the words that came out.

Klaus smiled, the wheels turning in his mind, "Any theories on why they would do that to her?"

Katherine had an idea, but she had no proof. She had no idea what Damon was up to, but he always had a plan.

"I don't know," she said, shaking her head, she didn't like where this was going.

"C'mon, you have always been a clever little minx," Klaus purred, his hand coming up to caress her cheek, it made her feel sick. 

"The only reason I can think of is to stop her from doing something," Katherine said, her mind racing, thinking back to everything she had seen, and the things she had missed.

Klaus grinned, his hand moving down to her throat, he began squeezing the air out of her.

"You can detect weaknesses like a bloodhound can sniff out a fox, so tell me, sweetheart. Is this your best guess or are you holding something back?" He asked, his fingers tightening.

She struggled, clawing at his arm, desperately trying to loosen his grip. "She's... Loyal to a fault, to those she loves, she tried to kill me in the 1800s for messing with her brothers,"

He raised an eyebrow, his face a mask of amusement, "So you think she's shifted loyalties? To whom?" He let go of her throat, and she collapsed to the ground, coughing and wheezing.

"I don't know... The only other players in town are the wolves... There's no reason for her to side with them..." She paused, her mind racing.

"There's only one other option," she said, her face contorting into a grin.

"Who?" Klaus growled, his patience was growing thin.

"Elijah.”

You woke in a strange daze, unsure of how much time had passed. You didn't feel rested, in fact, you felt sluggish.

You sighed softly, trying to gather your strength. Your mind was slightly hazy and you felt hungover. Your limbs were not responding to your commands, causing you even more panic.

Your eyes finally opened, adjusting to the light. You were in your own bedroom, laying on your bed, the soft hum of your ceiling fan was the only thing you could hear.

You had a horrible sinking feeling in the pit of your stomach, you slowly looked around. There was a pile of empty blood bags on your nightstand, a cup full of vervain, and a half-empty bottle of bourbon. It was clear that someone had been here taking care of you and keeping you sedated, judging by the empty bottle it was most likely Damon.

You rolled out of bed, stumbling across the room. Your legs were weak, and you were still groggy. You managed to make it to the door and pull it open.

It was eerily quiet, the ticking clock in the hallway was pounding in your ears. You walked towards the stairs, leaning heavily against the wall, hoping to make it all the way down without falling.

As soon as you made it to the bottom, you were overcome with a wave of nausea and dizziness. You grabbed the banister, closing your eyes, waiting for the spell to pass.

Fuzzy, half formed memories came flooding back to you. Elijah was gone, your brothers had stabbed him, and then they had drugged you, so you couldn't wake him.

You remembered Damon coming into your room, holding a blood bag up to your lips, forcing you to drink.

You remembered Stefan, sitting on the edge of the bed, brushing the hair off your forehead, telling you to sleep.

You remembered Elena, cleaning your face, her voice low and gentle, she had been crying, apologizing.

Someone had carried you outside, then Elena invited you back in. The house was under her name now, a new defense measure added. You wondered who they were trying to keep out, had Klaus finally come to town? Fear suddenly gripped you... Where was everyone?

You slowly made your way to the basement door, taking the steps one at a time, trying to ignore the overwhelming need to puke.

Once you were down in the basement, you looked at Elijah's body, lying in the same position you left him. His clothes were now charred and tattered, the pillow and blanket were gone, probably burned to ash.

You moved closer, collapsing on the floor next to his body. He looked the same, gray, his eyes closed, his hair in disarray. You brushed his hair back, leaning down and kissing his forehead.

"lijah," you whispered, reaching out to hold his hand. "I know we agreed, if anything happens, we would say goodbye and walk away, but I can't, not this time. You're a part of me, I don't think you even realize how much you have come to mean to me."

You looked at the dagger in his chest, weighing the consequences of pulling it out. You didn't know what would happen if he woke up, he could rip you to shreds, or he could pull you into his arms, and hold you until you stopped crying.

There was a fifty-fifty chance he would do the latter, and that was good enough for you. Your fingers curled around the blade and you pulled it out. Then you dropped it onto the floor, letting it land with a metallic thud.

Nothing happened.

Elijah was still.

You leaned down and pressed your ear to his chest, listening.

Nothing.

"Please," you said softly, kissing his cold cheek. "Please wake up."

You returned to laying your head on his chest, your fingers curling in the fabric of his suit.

You closed your eyes, tears running down your face, holding in a breath. Waiting, waiting, waiting…

Suddenly, his heart sprung to life, beating rapidly. You sat up quickly, looking down at him, his eyes were open.

You could hardly believe it, he was looking up at the ceiling, his chest heaving, his mouth open. Then he sat up, gasping for air, looking around the basement wildly.

He was in clear agony, struggling to breathe, he looked at you with anguished eyes, the color returning to his face.

"I can't...I can't be in this house." He rushed to his feet, falling over himself, stumbling his way to the exit.

You limped out of the basement and upstairs, racing after him. The moment he got outside, he collapsed on his knees, taking in deep breaths.

You knelt in front of him, safe behind the threshold of the doorway.

"I'm so sorry," You said, your voice shaking. "I had no idea. They drugged me and I couldn't..."

"Y/n," He interrupted, his eyes finding yours, they were full of pain. "I...need a moment,"

You nodded, holding back tears that were threatening to spill. He looked awful, his clothes were ruined, and his skin was gray and dull. He was clearly starving.

You took the dagger and rolled it past the threshold, it hit his knee and he grabbed it, holding it in his hand. He glared at the blade, then looked up at you.

"Thank you," he said, his expression softening. "So much for rule three,"

"You would have done the same for me," you replied, a hint of a smile on your lips.

He slowly got to his feet, his skin still a bit gray, his face tired and worn. He held his hand out, inviting you to step over the threshold, which you did, allowing him to pull you into his arms.

You closed your eyes, enjoying the embrace, your arms wrapped around his neck, you buried your face into his shoulder.

"This is a bad idea," he said, his voice rumbling in his chest.

"I know," you said, squeezing him tightly.

He didn't respond, simply holding you against him, his breathing steadying.

"Do you want to get out of here?" You asked, looking up at him, a sad expression on his face.

"That is an excellent idea,"

Your phone would not stop ringing.

You had been ignoring it for the last few hours. Elijah had taken you to a luxury hotel the next town over, far enough from Mystic Falls so you didn't have to worry about anyone showing up unexpectedly.

You were sitting on the bed, eating some room service, watching him try on some suits he had compelled the concierge to bring to the room.

"Who keeps calling?" Elijah asked, looking at you over his shoulder, buttoning a shirt.

"Damon and Stefan," You replied, sighing, "they are probably worried."

"Why haven't you answered?" He asked, frowning.

"Because... I'm mad at them," You admitted, picking at the food on your plate. "After what they did to me,"

"They were protecting themselves, and you," he said softly, putting his suit jacket on, and smoothing it.

You were surprised by him defending them, considering they had literally killed him.

"It doesn't matter, I can't face them right now," you said, shaking your head, "I'll just ignore their calls, it's the best I can do."

A text from Damon popped up on your screen, in full capital letters, it read:

‘WHERE THE HELL ARE YOU?! ANSWER YOUR PHONE.’

You grumbled and picked your phone up, ready to block him when you got another text. This one was from Stefan:

‘Klaus is in town, in Alaric's body. Please just let us know you are okay,’

Your breath caught in your throat, and you froze, staring at the message.

Elijah had been looking at you and saw your reaction, "What's wrong?"

"I don't know, maybe nothing," you said, showing him your phone, his face darkening when he saw the texts.

He looked at you for a long moment, like he was contemplating his next words very carefully.

"What?" You asked, wondering what was going through his mind.

"We can't do this," he said, shaking his head. "It's too dangerous."

"What?" You said again, standing up and walking over to him.

You placed your hands on his chest, sliding them up to his shoulders. He was avoiding your gaze, but his arms moved around your waist, pulling you against him.

"What's wrong?" You asked, searching his face, but he still wouldn't look at you.

"Rule two, darling," he said softly, pressing his forehead to yours, his hands caressing your back.

"Don't do that," you said, your voice breaking, your chest ached, you were holding back tears. "I don't care about the rules, I just want you,"

"You don't know what you're asking for," he said, his breath hitching, his voice low. "If Klaus finds out about you and I, he will kill you,"

"Why? Why do you want to kill him? Who is he to you?" You asked, wanting answers, your hands curled into fists on his chest.

"I've known him since I was a child, he's my brother," he said, pulling back, so he could look you in the eyes.

You blinked, not believing what he was saying.

"But..." you stammered, not sure what to say.

He swallowed hard and began telling you all about his life. His family, what life was like in the viking age, being turned vampire, learning his mother had been unfaithful, that his beloved brother was a bastard.

"I never saw him any different, none of our siblings did," he said, his voice wavering.

You could tell this was a difficult subject, you squeezed his hand, reminding him that you were there.

"We learned of our mother's infidelity in the worst way possible..." He trailed off, his voice shaking.

"You don't have to," you said, scooting closer, wrapping your arms around him and resting your head on his shoulder.

He leaned his head against yours, his fingers stroking your arm. "I've done many terrible things, but what plagues me the most is what I did to Niklaus,"

"What did you do?" You asked, lifting your head to look at him, his brown eyes were watery.

He shook his head, unable to vocalize it, and you didn't push him. You held him, waiting, knowing it would take time.

He eventually continued, his voice low, filled with shame. "My mother was a powerful witch, she cursed him. She bound his werewolf side, made him weaker, unable to turn. She used the full moon to make it possible to break the curse."

You frowned, thinking over what he was telling you. It didn't make any sense, Klaus was a vampire, not a werewolf.

"I thought..." you said, hesitating. "I thought he was a vampire,"

"He is," Elijah said, nodding, "he's also a werewolf, but that side of him bound,"

He continued his story, explaining how Klaus was different, that he was a hybrid. The first and only of his kind, half vampire, half werewolf.

He told you how Klaus was angry and resentful, and that he had good reason to be. That he and Klaus had spent many centuries trying to break his curse, to free him from his chains.

"So the ritual isn't about werewolves or vampires being freed from their curses," You said, the realization hitting you.

"No, it's not," He admitted, frowning. "It's about my brother,"

You were quiet for a long time, processing all of the information. So Klaus had no intention of freeing the werewolves or the vampires, he just wanted to be free.

"So why do you want to kill him?" You asked, looking at Elijah.

He sighed, rubbing his face, clearly struggling.

"I have other siblings, and he took them from me," He said, his tone was strained, the words catching in his throat. "I've searched for decades, and I can't find them,"

You squeezed his hand, encouraging him to continue.

"I've lost all hope of ever finding them," he said, his jaw clenching, he looked at you with his dark tear filled eyes. "All I have now is my revenge,"

You nodded, understanding where he was coming from. If you lost your brothers, you would burn the world down to avenge them.

"What is the ritual supposed to do?" You asked, curious, wanting to learn more.

"He has to kill a werewolf, a vampire, and a doppelganger. Their blood is necessary for the ritual," he explained, his fingers gently running along your arm. "When it's complete he will be weakened, then I will kill him."

"Elena is innocent... Elijah I'm sorry but you can't let him hurt her," you said, frowning.

He looked away from you, his brow furrowing, "She has to die, but not permanently,"

"What do you mean?" You asked, confused.

"A few centuries ago, there was another doppelganger, I grew some affections for her... I found a way to keep her alive," he said, his tone was flat.

"Katherine," you said, the name leaving a bad taste in your mouth.

He nodded, "I will give Elena the elixir I acquired for Katerina. It will save her,"

You let out a sigh of relief, at least Elena would be safe.

"To kill your brother, it's not an easy thing to do," You said, leaning your head against his. "Are you really prepared for what it means?"

"The full moon is in three days," He said, changing the subject, his expression was grim. "The ritual will happen then,"

"Yes," he said, without a moment of hesitation.

You sat in silence, neither of you knew what to say.

"Sometimes there's honor in revenge," he said, his hand resting on your leg. "And sometimes you just need to put down a rabid dog, no matter how much you once loved him."

"Eli-," You started, but he cut you off with a kiss, his lips crashing against yours.

You melted against him, forgetting what you were about to say. He had this way of silencing you, and it drove you crazy.

"No more talk of the ritual," he said, his fingers gently brushing over your cheek, his eyes gazing into yours. "I want to enjoy the time we have left,"

You didn't know what to say, so you nodded, and he kissed you again.

Elijah watched you sleep, the sheet barely covering your naked body. His fingers traced patterns along your skin, his touch light as a feather.

He was trying to ignore the dread, the sinking feeling of guilt in the pit of his stomach.He needed to plan, to prepare for what he had to do, but the only thing on his mind was you.

He should have known better, he was foolish to have ever gotten involved with you. When he came to Mystic Falls he told himself no weaknesses, no distractions, and yet here you were.

"Stop watching me, it's creepy," you mumbled, rolling over, the sheet falling off of you, revealing your naked form.

"Apologies," he said, unable to help the smirk that tugged at his lips.

"I forgive you, I know I'm irresistible," you said, yawning, stretching, your body arching.

He chuckled, leaning over, kissing you. You wrapped your arms around his neck, pulling him closer.

He broke the kiss and pressed his forehead against yours, "If I asked you to do something, would you do it?"

You gave him a curious look, your fingers tangling in his hair, "That depends,"

"Would you stay here, and not interfere with the ritual?" He asked, his brow furrowing, his tone was strained.

"Elijah-," You said, sitting up, the sheets pooling around your waist.

"Please," he begged, his eyes softening.

"But Elena-," You tried to protest, but he cut you off with a kiss, his hands cupping your face.

"Your brothers will keep her safe, but if you were involved... I would lose my mind with worry," he admitted, his eyes filled with turmoil.

"I thought this was just physical?" You teased, hoping to ease the tension.

He smiled and shook his head, his thumb caressing your cheek. "I love you," he said it so softly you barely heard it, his voice cracking.

You looked at him, searching his face for any signs of a lie, but there was none. He wasn't lying, he was telling the truth, the sincerity in his words and his eyes was evident.

Your words caught in your throat, a lump forming. You couldn't bring yourself to say it, you wanted to, but it was like there was a block.

You pressed your lips to his, your tongue sliding past his lips, kissing him deeply, trying to pour all of your emotions into it.

He broke the kiss and pressed his forehead against yours, his fingers tracing your jaw, "Say it,"

"I can't," You whispered, your voice wavering.

He tilted your chin up, his dark eyes meeting yours. "I love you miss Salvatore, and it frightens me more than anything ever has,"

"Elijah," you said, cupping his face, your heart aching. "I... I love you too,"

He pulled you into a kiss, his arms wrapping around your waist, lifting you into his lap, your legs wrapping around his torso.

You were panting, the kiss was heated, needy, your fingers digging into his shoulders. You felt his erection against your inner thigh, hard and ready, and you ground against it.

"I love you," you repeated, his hands grabbing your ass, pulling you closer.

"I love you," he replied, his lips attacking your neck, sucking, biting, marking you as his.

You reached down, wrapping your fingers around his length, sliding your hand along his shaft, positioning him at your entrance.

You lowered yourself down, desperately needing to feel connected to him, his fingers dug into your hips as you sat fully in his lap, taking him deep inside of you.

He moaned, his eyes closing, his head tilting back, you leaned forward and kissed his neck, your fangs scraping along his skin.

You rolled your hips, slowly, taking him in and out of you, his breath hitching with each movement. You grinned against his skin, loving how you were making him react.

"That's it, take what you need," he said, his hand coming up to cup the back of your head, keeping you close to him.

"I love you," you breathed, your voice a soft whimper, as you sunk your fangs into his neck.

His blood flooded your mouth, warm and sweet, and you sucked, feeling his pulse beating against your lips. He tasted like pure power, it was unlike anything you had ever experienced.

He moaned, his fingers tangling in your hair, gripping it tight. You were riding him, moving your hips in a fluid motion, grinding down onto him, feeling his cock hit that perfect spot deep inside.

You pulled back, his blood dripping from your lips, his hands were on your ass, guiding your hips. He kissed you, biting down on your bottom lip and tasting you. Your blood mixing together, it was the most erotic thing you had ever done.

"That's my girl," he whispered, his voice ragged, his eyes dark with lust. "So beautiful, and mine,"

"Yes, all yours," you moaned, grinding down harder onto him.

You felt his hand moving between your ass cheeks, his finger finding your puckered hole, slowly pressing into you.

You gasped, your eyes fluttering closed, it felt so good, him inside of you like this.

"I want you to cum for me, my sweet little love," he said, his voice soft and gentle, his finger moving deeper.

You moaned, clutching at his chest, your nails raking along his skin, drawing blood. The combination of him filling you, his finger, and the taste of his blood in your mouth sent you over the edge.

You let out a long, low moan, against his lips, your walls clenching around him, milking him for everything he had.

He grunted, his eyes fluttering closed, he bit his lip, trying to muffle his moans, and he came deep inside of you.

Your body was trembling, his arms wrapped around you, holding you close to him.

You pressed your face into the crook of his neck, his skin slick with sweat, the smell of sex and blood hung heavy in the air.

You pulled back and kissed him, his hand cupping the back of your head, his fingers tangling in your hair.

"After this is all over, will you come with me?" He asked, his hand stroking your cheek.

"Where would we go?" You asked, smiling.

"Anywhere, preferably somewhere with a beach and sunshine," he replied, his fingers running through your hair.

"It's a date," you said, nuzzling his neck, breathing in his scent.

"A date?" He chuckled, his fingers tickling your sides, you giggled and squirmed away from him. "That's new for us,"

You grinned, looking down at him. "I like the sound of it,"

"As do I," he agreed, his hand stroking your cheek.

"When I first met you, I never would've thought we'd end up here," you mused, running your fingers along his jaw.

"Neither did I," he admitted, his lips turning up into a small smile.

"So, tell me about this beach trip, what would we do?" You asked, wanting to keep him talking, not wanting to leave his side.

"Hmmm," he said, thinking for a moment. "I would find us a quiet little bungalow, right on the water, with a private stretch of sand for us,"

You closed your eyes, listening to the smooth timber of his voice, imagining the soft waves and fresh ocean air.

"And we'd have our meals brought in by servants, we'd lounge on the beach, swim, and make love whenever the mood struck us," he said, his fingers dancing across your back.

"I could live with that," you said, sighing contently, enjoying his warmth.

"I'm glad," he said, leaning down and pressing his lips to yours, a soft, gentle kiss.

You broke the kiss and stared into his dark eyes, his thumb brushing across your bottom lip.

"If anything happens to me I want you to know, I don't regret a single second of it," he said, his voice soft.

"What?" You asked, giving him a worried look.

"You need to know, in case I fail, and my brother ends me before I can end him," he said, his face serious, his eyes clouded with fear.

"Elijah-," you started to protest, but he cut you off.

"Promise me," he said, his voice pleading. "If this ends badly, you will remember rule three,"

"I thought we had given up on the rules," you said, trying not to let him see how afraid you were.

"Not this one," he said, his voice cracking.

"Why? You can't seriously expect me to-"

"Please," he said, his dark eyes locked on yours. "For me,"

You sighed and nodded, leaning into him, his arms wrapping around you.

"Thank you," he whispered, his fingers stroking your back, his lips brushing against your hair.

"Just come back to me," you said, trying not to cry.

"Always,”

The problem, Damon: you talk a good game but you don't actually know anything. She'll never forgive you. And never for a vampire...It's a very long time.

Elijah's words had been echoing around in Damon's head since that morning, the smugness in the older vampire's voice made him want to put his fist through the wall.

He had made a mess of things, but he couldn't admit that to anyone. The feeling he had when he learned that today was the day of the sacrifice, the day that he would lose Elena... He simply couldn't handle it. His desire for action was overwhelming.

He didn't like everything being out of his control, so he did what he had to do. And now his brother and Elena hated him. Elijah being right was the cherry on top of his shit sundae. 

In times like this, when he hit rock bottom then fell a little further, he turned to his oldest friend, his closest confidant, his beloved sister. 

But you weren't picking up the phone, despite Elijah's assurances you were alive and somewhere safe, it didn't soothe his worries.

So he tried one last time, and this time you actually picked up, and his heart nearly leapt out of his chest when he heard your voice.

"If you are calling to lecture me on love, I will remind you that you are no better," your voice made his throat constrict.

"I know, I'm not," he said, his voice sounding strange to his own ears.

"Are you okay?" You asked, a little softer.

"No," he answered, his voice shaking.

"What happened?" You asked, concern creeping into your tone.

"Everything's gone to hell," he replied, his voice strained. "I gave Elena my blood... Well actually I made her drink my blood,"

"Oh Damon..."

"I had no other choice,"

"She's going to hate you,"

"I know, Elijah told me,"

"Damon... He's right,"

"I know that too,"

There was a silence on the other end of the phone, he could hear you moving around, like you were packing a bag.

"I'm on my way," you said, finally. "Partly to kick your ass, partly to give you a hug,"

"Always the multitasker," he joked, his voice cracking. "But do not come home tonight, I just need to know you are safe,"

"I'll do what I want," you said, and he could almost see the pout on your lips.

He smiled, he had missed your stubbornness, and it was the closest thing to normal he had felt all day. But he couldn't risk you being involved, everyone was already in the crossfire, and the thought of you being added to that mix was too much for him to bear.

"Sister," he said, his voice firm. "Please, please, listen to me, just this once, and stay away,"

You let out a long, irritated sigh, "I'm so bored, and I'm getting hungry,"

"Well then go find someone nice to eat and watch a movie," he suggested, chuckling.

"I can't concentrate, not when everyone I love is in danger," you grumbled.

"Does that love extend to Elijah?" He asked, trying to keep his voice even.

"Yes," you said simply, and his heart ached.

He had known, of course, but hearing you say it aloud made it real.

"Why him? Like seriously..." Damon asked, he was genuinely curious, and he needed something to distract him from the shit show he had gotten himself into. "How did you even meet him?"

"I was hunting," you answered, sounding amused. "He found my methods to be entertaining, and I found him to be a challenge,"

"Did you know who he was? What he planned for Elena?" Damon asked, trying not to sound judgemental.

"Yes, I knew who he was. But we had rules, to keep things from getting complicated," you explained.

"That didn't really work out did it?" He teased, smiling.

"No," you admitted, laughing.

There was a long pause, and he could feel his emotions starting to get the best of him.

"Damon, promise me you won't die for her?" You asked, your voice wavering.

"You know I can't do that," he said, his voice low.

"I know," you whispered. "Just please, try to survive this,"

"I'll do my best," he promised, knowing he couldn't really promise anything.

"I love you big brother," you said, and his eyes started to water. "Tell Stefan I love him too,"

"I will, I love you too," he choked out, and he heard the line go dead.

Damon stared at his phone, the picture of you, him and Stefan was staring back at him, his heart aching.

"I hope I see you tomorrow, little sis,"

The town you were hiding out in was quiet and a little boring, but you didn't mind. It was the first time in a long time you had had a few days to yourself, no drama, no life or death situations. Just perfect mundanity.

You were lounging in a café, enjoying a cup of coffee, and watching the locals, wondering what their lives were like. You envied them, their simplicity, their happiness. You imagined you and Elijah in a little house, in a place like this, with a garden and a view of the ocean.

You were lost in your own world, dreaming about the impossible, when someone cleared their throat. You looked up, a smile playing at your lips. Dinner had just arrived. 

He was handsome, with curly hair and blue eyes, he had a sharp wicked glint in his eyes that sent a thrill through you. You always enjoyed a good meal with a bit of bite.

"Mind if I sit?" He asked, grinning.

"Not at all," you purred, gesturing to the chair.

He sat, and ordered a coffee, and he turned his attention back to you.

"I don't mean to be so forward, but you are downright striking," he said, his gaze running over your body.

"Thank you," you said, giving him a flirty smile. "It's a bit of a family trait,"

"Is that so? Mine as well, if you can't tell," he said, smiling.

You laughed, enjoying his company.

"You aren't from around here," he observed, sipping his coffee.

"Neither are you," you said, tilting your head.

"I'm just visiting, on vacation," he replied, grinning.

"Same,"

He was charming, and handsome, and you could feel the hunger starting to rise within you.

"I'm staying at the Inn down the street," he said, giving you a hopeful look.

"I'm staying there as well,"

"Well then, may I escort you home?"

"You may,"

The walk back to the Inn was short, you enjoyed his company, he was easy to talk to, and funny.

"Would you like a nightcap?" He asked, flashing you a crooked smile.

"That would be lovely," you said, grinning.

His hand came to rest on the small of your back, guiding you into the room. You usually enjoyed playing with your food a little before you ate, but you were committed to Elijah now, and you didn't want to stray.

As soon as you entered his room, he pinned you to the wall, moving in to kiss you. You politely dodged by pressing your lips to his neck, breathing him in.

"You are a vision," he said, his hand sliding up your arm, and into your hair.

"Thank you," you murmured, your fangs grazing his skin, his pulse racing beneath your lips.

He moaned, and gripped your waist, pressing his hips against yours. You could feel him, hard against your thigh, and you went to bite down.

Suddenly, he pulled your head back by your hair, hard. With strength you hadn't expected, he forced you back, pushing you hard into the wall, the plaster cracking behind you.

"I see why my brother is so taken," he growled, his eyes darkening.

Your heart dropped into your stomach, "Klaus,"

"The one and only, love," he said, smirking.

You tried to pull away, but his grip on you was too strong.

"Don't worry, love," he purred, his hand stroking your cheek. "I won't hurt you,"

"Fuck you," you said, glaring at him.

He smirked, and kissed you, hard, his teeth cutting into your lips.

"You're a feisty little thing," he said, licking his lips. "Even wilder than your brothers,"

You hissed and tried to struggle, his hands tightening around your arms, digging into your skin. "If you hurt them..."

"Now, now," he said, tutting. "Let's not make threats, especially when you can't back them up,"

You bared your fangs at him, but he only grinned.

"I've been wanting to meet you," he said, his thumb brushing across your cheek. "Elijah's little distraction,"

"I'm more than a distraction," you growled, struggling against his hold.

"Hmmm," he hummed, leaning in and nuzzling your neck. "I know,"

You were too frightened to speak, your whole body trembling.

"It's what I'm counting on dear,"

Klaus had been dragging you through the woods for what felt like hours.

Your fear had turned into anger and you began to try and fight him. It seemed to amuse him for a while, he'd let you run only to catch you with ease.

"Why are you doing this?" You growled, his hand holding your arm tightly, leading you through the trees.

"To be reborn, as I truly am," he said, his expression thoughtful.

You rolled your eyes and let out an annoyed sigh, he was a narcissist, the kind of man who enjoyed the sound of his own voice.

"Do you know how long I've waited for this?" He asked, looking down at you. "One thousand years,"

 "I know," you sighed.

"Of course you do," he said, smirking. "Elijah loves to spill his heart out after a good bedding doesn't he?"

You didn't answer him, he was trying to get under your skin, and it was working.

"My brother has always been the strong, self righteous type, with an unbreakable moral code," Klaus chuckled, picking up his pace, dragging you along. "That is... Until he gets his face between a pretty pair of legs,"

"Fuck you," you spat, anger boiling up inside of you.

"You have a smart mouth," he said, his fingers squeezing your arm. "I think I'll like to see how you use it later,"

You freed yourself from his grip and slapped him hard across the face. No man was allowed to speak to you in that way, and you certainly weren't going to tolerate it from this monster.

His expression changed from amusement to anger in the blink of an eye. He slammed you against a nearby tree, the twigs and branches impaling you.

You cried out, blood pouring from the puncture wounds, and he grabbed a fistful of your hair, forcing you to look him in the eye.

 "That was very, very stupid,"

His words sent a chill down your spine, and a fresh wave of fear washed over you.

"What's the matter?" He asked, his tone taunting. "No more choice words and acts of violence for me?"

"Don't kill me," you said, tears starting to run down your cheeks.

"I won't," he assured you, his lips brushing against yours. "But I will kill everyone in Mystic Falls if you don't do what I say. If you don't believe me... Just ask sweet little Katerina about it,"

Your blood ran cold, you knew what he was capable of, and you had no choice but to obey him.

Through the trees you could see a circle of fire, and you felt dread sink into the pit of your stomach.

"No," you pleaded, trying to pull away.

"Stop being so dramatic, love," he said, rolling his eyes.

He pulled you into the clearing, throwing you down on the ground next to the three women sitting in their own rings of fire.

You could see Elena, a terrified look on her face, along with her aunt Jenna and a woman you didn't recognize.

"Hello my lovelies," Klaus said, grinning. "Are we all ready?"

He gave you a swift kick, then grabbed you by the hair and pulled you to your feet. "I brought an assistant with me,"

He pushed you forward, leaving you to stand there as he walked to the altar, handing the moonstone to a witch standing nearby.

You looked at Elena and Jenna, they were beyond scared, their eyes full of tears, and you felt your stomach twist, you didn't know how to help them.

The witch had begun to chant, a mixture of Latin and something else, the moonstone began to spark, then it exploded into nothing.

"Bring me the wolf," Klaus demanded, looking at you with a wild, manic look in his eyes.

You shook your head, your whole body trembling, you refused to let him hurt someone else.

"It's either them or the entire town, love. That includes your brothers," he growled, his jaw clenched.

The thought of losing Stefan and Damon made your stomach clench, and tears started to run down your face.

"Bring her. Now," he growled, his tone brokering no argument.

You walked towards the first ring of fire, to the terrified woman who was writhing in pain, her cries echoing through the trees.

The ring disappeared as you approached, and you lifted the girl into your arms. She was whimpering and shaking, the transition having begun.

"I'm so sorry," you whispered, carrying her to the altar.

"Good girl," Klaus hummed, taking the wolf from your arms, and laying her on the stone.

Klaus kneeled over her, looking down at her with an evil grin, his eyes were filled with a mix of desire and madness, and he plunged his hand into her chest, ripping her heart out.

Jenna and Elena screamed, watching Klaus hold up the wolf's heart, his expression triumphant.

"I'll make it quick, I promise," Klaus said, grinning. "They will barely feel a thing,"

You looked over at Elena and Jenna, their screams piercing the air, the witches chanting growing louder.

Elijah was looking up at the night sky, watching the moon slowly make its way across, his thoughts on you. He couldn't stop thinking about your smile, and the way your eyes lit up whenever you saw him.

If tonight went smoothly, he had so many plans with you, the first was taking you to Paris, a city that was sure to dazzle you. After that he would whisk you away to Rome, where you could visit the many art museums and eat all the food you wanted.

He wanted to spoil you, shower you with everything you could ever want, and then some. It had been nearly sixty years of searching for his brother, trying to uncover the rest of his family. He felt like tonight was the first chance he had to truly mourn, then he could finally move on and spend the rest of his time with you. 

He had spoken with Stefan earlier, before he left with Bonnie to go stop Klaus. He liked Stefan, he was an honorable man who respected the choices of the ones he loved, even if he didn't agree with them.

Elijah hoped he and Stefan could be friends one day, once everything settled down, he knew that would make you happy. To see peace between him and your brothers. Damon would be a more difficult task, he reminded him of Klaus, cocky and impulsive, and that was a difficult combination.

The waiting was beginning to make him antsy. He had to wait for the right moment to strike, but there were so many factors outside of his control, he didn't like the feeling. He needed to distract himself, keep his mind from wandering too far.

He thought about his siblings, of sweet Rebekah, wild Kol, and serious Finn. What would they think of him killing Klaus? He wished he could have saved them, he wanted so badly to see them again.

He let out a long sigh, steeling himself for what he had to do. Klaus was no longer his brother, he had been twisted into a monster, and he had to be put down.

It was time, he could see the moon hanging high above him, it was time to end this. 

You watched Klaus squeeze the wolf's heart over the altar, the blood dripping into the fire, igniting it.

"Next, the vampire," he said, grinning.

You stood, frozen, watching him, as a wave of guilt crashed over you.

"Bring me Jenna, go on,"

You shook your head, tears stinging your eyes.

"No," you said in the smallest voice. 

You could hear Jenna and Elena, talking to each other, they were saying their goodbyes and it broke your heart.

Klaus turned, and walked over to you, his eyes were dark and cold, and his jaw was clenched.

"Are you offering yourself in her place then?" He growled, his hand coming up to grab your chin.

You didn't answer him, you were staring over his shoulder at Jenna and Elena.

"I'll take that as a yes,"

You let him drag you to the altar, and push you down onto the cold stone, he forced you to kneel. You didn't fight him, you had lived for many decades longer than sweet Jenna and Elena, the old should always give their lives for the young.

Klaus let out a hearty chuckle and kicked you over, his hand gripping your hair.

"I don't recall you being on the guest list," Klaus yelled, looking into the dark forest. 

You heard the sound of footsteps as someone approached, it was Stefan. His expression was calm, but his eyes were furious.

"What can I do for you, Mr. Salvatore?" Klaus asked, amused.

Stefan looked at you, a concerned look on his face.

"Well, I figured you could start by letting my sister go," Stefan said, his voice firm.

"Hmm," Klaus said, looking down at you. "I don't think I will, she's quite the little spitfire, and I rather enjoy her company,"

"Let her go, I'll take her place," Stefan offered, taking a step forward.

"That's quite noble of you," Klaus said, smiling. "But, I think I'd prefer my original plan. I rather appreciate the symmetry of three women...Three goddesses sacrificed at nature's altar."

He grabbed both you and Stefan and dragged you towards the rings of fire. Throwing you both down next to Elena and Jenna. 

"Quite the predicament. You know, it's funny, all this talk about preserving family, and here's Stefan, granting your wish," Klaus said to Elena, smiling.

Stefan and Elena were looking at each other, a silent conversation passing between them.

"Oh, don't look so glum," Klaus said, looking between the two. "There's actually no choice,"

Klaus took a stake and plunged it into Stefan's spine, causing him to yell in pain, unable to move.

You and Elena both screamed, you got to your feet to strike Klaus, but he grabbed you by the throat, squeezing hard.

"Let them go," Elena pleaded, tears running down her cheeks. "I understand that I have to die, but they don't,"

Klaus ignored her and looked into your eyes, his hand tightening around your neck.

"Bring Jenna to the altar, or I'll kill Stefan," he growled, his fingers digging into your skin.

You nodded, tears welling in your eyes, you couldn't lose Stefan.

"Please," you whispered, your hands clawing at his.

He let you go, then walked back to the altar.

"Bring her, now," he ordered, pointing at the ring of fire surrounding Jenna.

You stood, walking slowly over to the fire, the ring disappeared and Jenna looked up at you with tear filled eyes. She looked so afraid, so helpless.

"I'm so sorry," you said, your voice breaking, as you helped her to her feet.

You walked her over to the altar, Klaus waiting patiently.

"Jenna, I'm so sorry," you whispered, your hand brushing the hair from her face.

She was sobbing, her body shaking, and you held her close, stroking her hair.

"Please Klaus, just use me instead, she's innocent," you begged, tears running down your face.

"You Salvatore's are so predictable," Klaus sighed, rolling his eyes.

Klaus walked over, and pulled Jenna from your arms, he threw her down onto the altar. Everything seemed to blur, you could hear Elena screaming, the chants of the witch, the cracking of the fire. You saw Stefan reaching out to Elena through the flames, and then, it was quiet.

Klaus plunged a stake into her heart, Elena's wails were all you could hear. Jenna's lifeless body was lying on the altar, her face frozen in fear. You had brought her to her slaughter. You had killed her.

"Such a wonderful assistant," Klaus cooed, he grabbed your chin, his bloody fingers digging into your skin. "Be a good girl and bring me the doppelganger,"

You looked into his cold eyes, his mouth twisted into a smirk.

"Now," he growled.

You nodded, then walked over to Elena, tears were running down her cheeks, but she put on a brave face as the last ring of fire disappeared.

"Elena," you whispered, tears welling in your eyes, your whole body was shaking. "I'm so, so sorry,"

"Don't," she said, her voice shaky. "It's not your fault. It's nice to have a friend here at the end,"

She held your hand as you helped her walk over to Klaus. You looked at Stefan, he was struggling to free himself, his eyes filled with worry.

"Elena," Stefan called, his voice breaking.

"It's okay, Stefan," she said, her grip on your hand tightening. "I'm ready,"

You helped her up onto the altar, and Klaus looked down at her with hungry eyes.

"Thank you Elena," he said softly, pulling her against him and moving her hair away from her neck.

"Go to hell," she said, her voice strong.

He chuckled and sank his fangs into her neck.

Elena didn't fight, she let death take her, her grip loosening on your hand, as her last breath left her.

You were shaking, the sound of Klaus drinking from her filling the silence. You had lost two friends today, and the world was suddenly a lot emptier.

When the last bit of blood left her body, Klaus dropped her to the ground and the fire in the altar went out.

You knelt next to her, brushing her hair away from her face, then you looked back at Stefan who was writhing in pain, crying at the loss of Elena.

Klaus staggered a bit, the full moon peeking out from the trees. He groaned, and started to change, his bones cracking as he stumbled forward, his expression a mask of pure bliss.

"It's happening," he moaned, his eyes turned gold, and he was overcome with pleasure. "I can feel it,"

You couldn't stand this any long, all this pain and death. You needed it to end.

You moved down the steps towards him, grabbing a branch off a nearby tree, snapping it in half.

"Come on, sweetheart," he taunted, turning to look at you, his eyes shining. "I'm indestructible,"

"I don't care," you snarled, lunging for him. "You still feel pain,"

You charged at him, striking him across the face, your rage blinding you, making you miss his fist, as it collided with your stomach.

The blow threw you across the clearing, and you landed on your back, the air leaving your lungs, the branch now lodged in your side. 

You saw Damon come running out of the woods, he first looked to Elena, then to Stefan, but when he laid eyes on you, he ran to your side.

"No, no, no, no," he said, his eyes filled with panic, he pulled the wood from your side. "You're not supposed to be here,"

You could hear the concern in his voice, and you smiled up at him, cupping his face. He helped you to your feet, your wounds healing, then he pushed you behind him.

"Damon," you said softly, trying to stop him.

"Bonnie is here, it's okay, let me handle this," he said, his tone stern.

Klaus was standing there, laughing maniacally, a mad grin on his face, then his body began to shake and he fell to the ground.

Suddenly his laughter turned to screams, as Bonnie came striding out of the trees, chanting a spell, she raised her hand, causing Klaus to scream in agony. The fire returned to the altar and spread into the trees, her magic all around them as she channeled every ounce of power she possessed, bringing the hybrid to his knees.

Then she choked on her words, gasping for air, looking around for the source.

"Get the witch!" Stefan yelled, pointing to Klaus' witch, still standing at the altar, her hand outstretched.

Bonnie raised her hands, trying to focus her power, but she was struggling, and you could see the strain on her face.

The witch threw Bonnie into the air, knocking her out, her body hitting the ground.

Damon ran for the witch, and tackled her, his teeth sinking into her neck. He killed her instantly, her body going limp in his arms.

The fire disappeared, the flames extinguishing, the magic disappearing. A deadly quiet settling over everything.

Suddenly, you felt a hand in your hair, dragging you backwards, the pain making you scream.

"Elijah!" Klaus roared into the woods, "I know you are out there, show yourself!"

You saw Elijah walk out of the trees, and into the clearing, his expression unreadable, but his eyes were locked on yours.

Klaus's fingers dug into your scalp, and he pulled harder, forcing you to your knees between them.

"What a sight," Klaus mocked, grinning at Elijah.

"Hello, brother," Elijah said, his eyes still locked on yours.

"You've come to kill me?" Klaus said, chuckling. "How is that working out for you?"

He pulled you back to your feet, your whole body trembling.

"Actually, I've come to make you an offer," Elijah said, taking a step closer, his hands clasped behind his back.

"Oh," Klaus said, amused. "An offer, I wonder what that might be,"

"Spare them, and I will pledge my loyalty to you," Elijah said, his voice soft, his eyes never leaving yours.

"You're lying," Klaus growled, his hand wrapping around your throat, his fangs grazing your skin. "You're only offering yourself, so I won't kill her. That's not true loyalty,"

You saw Damon lift Elena's body into his arms, carrying her to Stefan. Then he pulled the stake out of Stefan's back, allowing him to move again.

"Elijah," Stefan called, his voice shaky. "You need to finish this,"

"I can't," he said, shaking his head. "Klaus will kill her,"

Damon rushed to Bonnie's side, trying to wake her up, and Klaus laughed, his lips pressed against your ear.

"Run to your love, if you make it I'll let you live," he whispered, shoving you forward.

You stumbled, your legs barely able to support you, then you started running towards Elijah, tears streaming down your face.

You made it to him, and his arms wrapped around you, holding you tight, he was murmuring soft words into your ear, his breath tickling your skin. And you finally felt safe again.

"Are you okay?" He asked, pulling away to look at you, his fingers brushing the hair from your face.

"Yes," you said softly, your hand gripping his jacket.

You were staring up at him, his brown eyes were warm and full of worry, and you had forgotten how much you missed him.

"Good," he murmured, pressing his forehead against yours.

Your lips met his at the same time you felt something strange in your back. An odd pressure that made you gasp into his mouth.

You pulled away from Elijah, there was a strange look on his face, his mouth falling open, and he looked down at you, a look of pure terror in his eyes.

For the first time in centuries, you felt cold, the world was spinning around you. You knew what was happening, 

Your hand pressed against his chest, you could feel his heart beating against your palm. You looked up into his brown eyes one last time.

"Rule three, my love," you whispered, before your life faded away, and your body fell against him.

Elijah looked down at you, your skin rapidly turning gray, your eyes vacant. Then he looked up at Klaus, who held your heart in his hands.

"This is for betraying me," Klaus said, dropping the organ at his feet, the blood running down the stone steps.

Elijah stood there, his arms wrapped around your lifeless body, his whole world was crumbling.

He could hear Stefan and Damon screaming, but it sounded far away, the own beating of his heart drowning out the rest.

Klaus grabbed Elijah by the neck, forcing him to drop your body, and shoved him to the ground.

"Look at her, the way she's staring up at the stars, it's quite beautiful, isn't it?" Klaus mocked, as Elijah watched you, lifeless on the cold stone. "And it's all because of you,"

Elijah looked away, a tear falling down his cheek, his brother's words cutting into him.

"You're pathetic," Klaus hissed, his hands gripping Elijah's jacket, your blood staining the fabric. "To think you could beat me,"

Elijah closed his eyes, trying to block out his brother's words, but it was no use, his mind was replaying every moment with you. Knowing he would never taste your lips again, or hear your laugh. You would never fall asleep in his arms.

He looked over at Damon, who had rushed to your body. He was holding you, rocking you back and forth in his arms, with Stefan by his side, his face stained with tears, a look of anguish on his face.

Elijah's world was fading away, as he was overcome with rage and anguish, a darkness consuming him, and Klaus just kept talking, his voice becoming more and more distant. 

Then something within him snapped, a creature that was lurking underneath his skin came bursting through, a monster taking the place of the gentleman.

He turned his attention back to his brother, and Klaus froze, the fear clear in his eyes.

Damon watched as Elijah pushed Klaus backwards, causing him to fly across the clearing, skidding along the dirt, landing a few feet away.

Elijah walked in a slow, deliberate pace towards Klaus , his expression devoid of any emotion.

"You're right, Klaus," Elijah said, a cold smile spreading across his face. "We are not the same,"

Klaus tried to stand, but Elijah shoved him back down, he grabbed Klaus leg and twisted it until it snapped. Klaus howled in agony, and Elijah smiled, twisting the other leg, and his brother's screams were echoing through the night.

"You want to be a beast?" Elijah growled, pulling Klaus into the air by his neck, his hands wrapped around his throat. "Let me help you,"

Damon felt a gentle hand on his shoulder, and Bonnie was standing there, her eyes full of sorrow.

"Damon," she whispered, tears running down her face.

"Go, help Elijah," he said, his voice hollow. "I'll stay here with her,"

Bonnie nodded, she stood up, her body trembling. Stefan jumped to his feet to help her stay upright, and she began to chant once more. 

The altar burst into flames for a third time, illuminating Klaus and Elijah in a ring of fire as they struggled against each other.

"What is this?" Klaus yelled, pushing Elijah away, trying to fight the pain. "What have you done?"

"Something that should have been done centuries ago," Elijah growled, rushing towards his brother, knocking him down, pinning him to the dirt, his hand raised.

"In the name of our family, Niklaus...," Elijah said, plunging his hand into his brother's chest, curing his fingers around Klaus's heart. "In the name of her..."

"I didn't bury them at sea!" Klaus yelled, his hand trying to pry Elijah's away. "They are safe, I swear,"

Elijah looked at him, a flicker of hope in his eyes.

"I can take you to them," Klaus pleaded, his hands gripping Elijah's wrist. “Their bodies are safe. If you kill me, you'll never find them,”

"Elijah, don't listen to him," Stefan yelled, walking towards them.

"Brother, please," Klaus begged. "She wouldn't want this, please,"

Your beautiful face flashed through Elijah's mind, and he looked back at Damon, who was kneeling there, tears in his eyes, clutching your body.

"You're wrong, Klaus," Elijah growled, his hand squeezing the organ in his grip. "She would want this,"

Then he tore Klaus's heart from his chest, and watched the life fade from his brother's eyes.

Klaus's body dropped to the ground, his heart still beating in Elijah's hand, and the flames died down, leaving the clearing in silence. 

Bonnie walked up to him, looking down at the flames. 

"Good," She said, her voice hoarse.

Elijah looked back at Stefan and Damon, they were kneeling next to your body, Stefan's hand caressing your cheek. 

Elijah rushed over to you, looking down at your peaceful face, you almost looked like you were sleeping.

Elijah brushed the hair from your face, his hands were shaking. He couldn't understand how something so beautiful could be snuffed out so easily.

"Don't touch her," Damon said, pulling you away from Elijah.

"You did this," Damon snapped, glaring at Elijah. "It's your fault she's dead,"

Elijah nodded and stepped away, Damon was right, it was his fault.

"Damon," Stefan said, reaching for his brother.

"No, he has to answer for this," Damon said, getting to his feet, your body in his arms.

"It's over Damon," Bonnie said softly, looking up at him. "It's over,"

Damon looked down at you, and tears started to stream down his cheeks. He was shaking, and Stefan reached for him, the two of them clinging to each other, your body between them.

"I think it's best you leave," Bonnie said, her eyes filled with sadness. "Please, go,"

Elijah nodded, his heart breaking as he looked down at your lifeless form, knowing this was his fault.

"Where will you go?" Stefan asked, as he wiped his eyes.

"I need to find my siblings," he said softly, looking away from the sight. "With Klaus dead, everyone he compelled will be free, I'll follow the clues they left behind,"

He looked back at you, and his heart shattered.

"Will you be okay?" Stefan asked, his hand on Elijah's shoulder.

"One day," he replied, turning to look at him, a small smile on his face.

"Thank you," Stefan said softly.

Elijah gave them a small nod, then disappeared into the trees, heading far away from Mystic Falls. His heart forever bound to yours. 

~Epilogue

Time changes all things, this was something Damon had the basics of understanding, but nothing could prepare him for how it would affect him when he became human again.

He was an old man, something he never expected to experience, and yet there he was.

"Are you ready?" Elena asked, her hand on his arm.

"Always," he answered, his voice weak, but his smile was genuine.

She leaned in and kissed his cheek, her eyes still as bright and beautiful as the day he met her.

The walk to the Salvatore family crypt was slow, and the pain in his joints was unbearable. He hated getting old.

They entered the stone building, and Damon let go of Elena's arm, making his way over to your stone. He placed his hand on it, the smoothness soothing his calloused hand.

"Hi sis," he said, smiling down at the stone. "It's been a while, i've been so busy,"

He took a seat in the chair next to your grave, he had brought it decades ago. He was a man who liked his comfort, and he spent hours talking to you, catching you up on everything that had happened since the last time he was there.

"I have grandkids now! Can you believe it? They are the cutest, I even named a boy after you, well, the closest we could come, but, yeah," he said, a wide grin on his face.

Damon looked over at Elena, who was laying flowers at Stefan's grave. She was the only one left, and he was so grateful for her.

"I miss you and Stefan so much," Damon said softly. "But it won't be long now until I see you again,"

There was an awkward cough and Damon looked up to see a delivery boy standing in the doorway, looking uncomfortable.

"I have a delivery for Miss Y/n Salvatore," he said, walking up to him, a bouquet of flowers in his hand.

"She's not exactly up for company," Damon said with a chuckle, gesturing to your stone.

"I know, this actually isn't my first time doing this," he said, a smile spreading across his face. "Actually, the guy who use to deliver along this route said that he's been delivering here once a week for his entire fourty year career,"

Damon stood up slowly, his bones protesting the movement. He held his hand out and the boy handed him the flowers.

"Thanks, kid," Damon said, sitting back down, there was a note tucked in with the flowers.

The boy gave him a little wave before disappearing.

Elena came to sit next to him, her hand on his knee, she gave him a sad smile. "What does it say?"

Damon pulled out his glasses, and read it out loud, a tear rolling down his cheek.

For a thousand years, I had never known love, until you, and for a thousand more, I will wait for you. 

-Elijah

Rule one: When we are together, it will just be us, no one will know.

Rule two: No talk of business or family, don't get personal.

Rule three: When it's over, it's over.

{Part One} {Part Two}{Part Three} {Part Four}

♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡♡~LOVE YOU GUYS

[scoutswritingcorner]

Deerly Beloved PT.2

Alastor x GN!Deer!Reader

Part 1

TW:NONE

A/n: Cause some people asked for this. 

-🦌 Starting where I left off last time: Eskimo kisses are the only kisses he will give out in public or in the hotel. It’s just become routine for you both to do it to one another. He’ll bend down, tilt your head up by your chin and just give you little eskimo kisses before he leaves.

-🦌 If he’s actually going to kiss you, it will be behind closed doors and away from private eyes. He can’t get enough of it.

-🦌 He’s very suave. But he’s also equally as awkward. Like he can flirt with you all day but then you flirt back and he’s just standing there eyes wide and confused. 

-🦌 More awkward Alastor? He has trouble reading the room sometimes so he just kinda stands somewhere. (honestly me too bud-)

-🦌 If you have horns he’s either laying his chin on your head between them or trying to balance things on them. Please sit still, this could go on for hours. The last thing he could get on there was a marshmallow. (He cleans your horns for you don’t worry)

-🦌 This man is stuck to you like glue. Like- You could be doing your job around the hotel and he’s hugging you from behind and carrying you around. Charlie has to tell him to let you work. He gets grumpy.

-🦌 Sometimes he just stares off into space and he’s unresponsive for a bit. Prime time to get him back. Hang something on his horns and act like nothing happened when he clocks back into reality. 

-🦌When he gets mad at you for something? He stomps his hooves and walks off. It’s his way of throwing a tantrum without causing too much a scene. 

-🦌 He’s not up to date on modern slang at all so if he gets on your nerves bamboozle the old man with some weird slang and he’ll be confused for an hour or so until someone tells him.

-🦌 Fall asleep somewhere and he’ll sit by or near you to watch over you, he’s usually reading but he makes sure everyone in the room leaves you alone.

-🦌 He loves having you sitting on his lap, it’s solely because he likes comparing your hooves together. Like- you could be asleep and he’d be talking still about your hooves. He doesn’t take offense to you falling asleep while he talks, he’s grateful his voice soothes you.

-🦌 Like anything- he has deer tendencies. Like grooming you, he loves to help brush your hair and fix your clothing. He lets you do the same to him. It helps keep down his more animalistic urges. 

-🦌 I 100% feel like he knows how to braid, wash and help brush any type of hair. Whether it’s curly, wavy, straight, coily, thick, anything. If you ask him, he will help. His Mama taught him well.

-🦌 If you get self conscious of your horns falling out cause it does happen he’ll help in anyway he can. He will make a joke about you missing something though. Be aware.

-🦌 Once again, he loves playing silly little games with you. Like in my last post, a fucked up game of tag where he’s chasing you around the hotel cause he can or play fighting with you cause its fun. His other favorite game of his is hiding your things around the hotel.

-🦌 (Don’t imagine him in a white shirt, suspenders and trousers. Don’t do it gang.)

-🦌 Once again. He will pick you up if you take too long with something and he will be unapologetic. He’s got a busy schedule! (He’s getting restless).

A/n: This turned into me thinking about silly things he does and I’m so sorry. I got way off track..ENJOY!!

[barcaatthemoon]

guard dog || lucy bronze x reader ||

lucy cheers you up when the internet has it out for you.

"i think i'm gonna go lighter with my hair."

you had no idea the trouble those words were going to cause you. lucy had tried hard to keep you out of the spotlight, but it wasn't as easy as when you first started dating. you'd been with lucy since college, and over the years, fans had taken notice of you frequenting lucy's games. it wasn't until the euros, however, that lucy had finally confirmed your relationship.

it wasn't good for you to be on any social media when it felt like every other post was about you. you had dealt with a bit from fans before, but this was worse than you could have ever imagined. it was one thing to be accused of cheating by strangers, but it was the constant affirmations of things that you already thought about your relationship and yourself that got to you.

lucy was amazing, and you had never felt like you were right for her. she was always too smart or too ind for you. she was out of your league attractive. lucy bronze was too good for you, and it felt like millions of people agreed with that.

"hey, are you okay?" lucy's brows furrowed as she watched you lean forward. you were starting to hyperventilate as the world felt like it closed in on you. lucy rushed over to kneel beside you and tilt your head to look at her. "hey, what's going on?"

"i didn't cheat on you, i swear." it was something lucy already knew. you knew that she was well aware that you would never even think to do something like that, but it was all you could say. you needed to reassure her in case she saw the pictures and didn't recognize herself.

"i know that, i never said you did." lucy would have laughed if you weren't obviously so upset. "talk to me, what's going on?"

"the pictures after you got your hair done, when we met for lunch. i took your car, and they don't know what the other looked like. your hair was different, they think i'm cheating. they know that i don't deserve you," you rambled. lucy pulled you into her arms and held you against her chest. she ran her hands through your hair as she pressed gentle kisses to your temple.

"hey, it's okay. i will get this sorted out, i promise. can you go downstairs and pick out a takeout menu for us? i know that you were gonna cook, but not if you're upset. i want you to just relax for the night," lucy said. she gave you a squeeze before she let you go downstairs.

it wasn't easy, but you managed to take your mind off of everything after lucy hijacked your phone. lucy ordered your favorite takeout, even if she knew a few places that served the same thing that she liked better. you were truly pampered in a way that you hadn't been in a while. lucy was a busy woman at barcelona, not that she had ever been anything else. this was just different, and things often took up a lot more of her time than either of you expected.

"am i done with phone jail?" you asked lucy as the two of you laid out on the couch the next afternoon. lucy had helped you with breakfast in the morning, although you didn't let her lay a finger on your coffee. the two of you had spent most of the day catching up on the american sports that you had been missing out on.

"i don't know. do you promise not to make fun of me if you see anything too sappy?" lucy asked you. she looked a bit ashamed of herself, as if she had done something hastily last night. you knew that lucy could be fiercely protective over you. she had nearly beaten up one of her teammates when the two of you moved here and the girl had gotten too friendly with you for lucy's taste.

"that depends on what you did. lucy please tell me that you didn't say anything to get yourself in trouble." you stared at lucy, who just handed you back your phone. she tried to shift away from you, but you threw your weight down more securely on top of her. you opened up instagram to see that lucy had tagged you in a post. "aw baby."

you swiped through the pictures, each one from a different milestone in your relationship. they weren't necessarily your favorite pictures, but you knew that they were lucy's. there wasn't a single one where one of you didn't have a lovestruck look on your faces. most of them were lucy staring at you, but you definitely took note of the few thrown in where you looking at her like she was your everything.

"shut up," lucy grumbled. you looked at her with fresh tears in your eyes, and lucy just sighed to herself. "fuck, this wasn't supposed to make you cry."

"i love you so much," you said as you cupped her cheeks. lucy let you kiss her, but she tried to hide her face immediately once you were done. "you're so sweet. thank you for this."

"just stay off of twitter for a while," lucy told you. you nodded your head, but as soon as you went into one of your text chains with the few of her teammates you had befriended over the years, you saw what she wanted to hide from you. lucy was a woman of few words most of the time, but when she had something to say, she made sure to get her point across. you thought she was being a bit harsh, but lucy's message was sure to shut everybody up about getting at you.

[gemissleeping]

Sea Foam

Theodore Nott x Siren!Reader

Summary: One night a month, you’re unable to control the abilities you inherited from your siren Mother. Taking refuge at the Black Lake, you hope for that night to pass in peace. Until Theodore Nott discovers you sitting by the edge of the lake just as the full moon rises.

Length: 1.5k

Notes: Brash Theo (heart eyes), angst (i live for the drama), no proof read, slight allusion to cannibalistic desire. Not smutty just saucy. Keeping you fed with my niche day dreams. Short series please let me know if you’d like to be added to the tag list.

Salt wafted through the air as the sharp cliffs of the rock below you cut through the thin cotton of your nightdress. It felt as though you may as well be wearing nothing at all. The breeze was picking up now. Full moon approaching the midnight sky. You dreaded this night each month, when the moon would rise in its completeness and you would lose all reins you had on your mind. It had been that way since you had turned thirteen, and it hadn’t ever stopped since.

You let out a sigh as goosebumps erupted across your skin and your toes made contact with the dry sand. It was the pits of winter and the sand always felt closer to ice chips than anything else this time of year. The moon continued its unrelenting rising and you knew it was only a matter of minutes now.

One foot planted in the sand, you readied yourself to approach the shoreline before the sound of footsteps behind you caused you to falter. You glanced back to where the sounds were emanating from anxiously. Hair falling over your near-bare shoulders as you searched the darkness, the distinct feeling of being watched making your throat tighten. No one else should’ve been out near the Black Lake this time of night.

“You shouldn’t be out here,” a deep voice echoed your thoughts from the shadow ridden tree line of the bank.

You blinked back at the shadows until a red glow became visible. At first you weren’t sure what you were looking at, but as your eyes adjusted you found yourself studying the end of a lit cigarette. It wasn’t a particularly helpful clue, half of the school smoked like chimneys.

“Neither should you,” you called back softly to the figure, still lurking in the tree line. “You need to leave.”

Urged by the pull you felt from the Lake’s depths tugging at your chest, you glanced hurriedly back to the moon where it was inching closer.

“Please.”

You turned back, eyes brimming with swallowed fear as you silently pleaded with the figure, who had now stepped out from the tree line. He was tall, hair falling in messy brown curls around his face.

Theodore Nott’s dead-eyed stare only made the material of your nightdress feel thinner beneath his calculating gaze. A cigarette hung lazily between his curious lips as he watched you, leaning against a tree.

“Why’s that?” He breathed in a cloud of smoke; cigarette mixed with chilled air.

The pull tugged at you again and your grip on the rock tightened momentarily. Something he clearly didn’t miss from the way his eyes dragged downward.

You clenched your jaw, knowing no answer you could give would satisfy him and that time was escaping you. You tried to keep your voice even but the shudder was audible.

“Because I asked nicely.”

Theo frowned at the shake in your voice, taking note of the fear that had leaked through your eyes. He took a step towards you, and the motion propelled you, pushing you off of the rock.

You spun to face him, stumbling back towards the water’s edge. Unsteady as the pull became more unbearable, urging you to the lake as you pressed your heels into the sand.

“Please Theo,” your voice sounded fragile against the wind, control dwindling.

“You didn’t answer my question.” He took another step towards you, discarding his cigarette with a curious frown. Hands shoved deep into his pockets against the chill as the wind made your nightdress dance.

You glanced behind you, where the water was trying to lick at your skin. Fear crawled its way up your throat, alongside desire.

The crunch of sand ahead of you drew your attention back to Theo. In your distraction he had found his opportunity, now standing before you, only a breath away. His movement startled you, and you took one, thoughtless, step back into the lake.

A sharp inhale was all it took before your lips had parted and your eyes had snapped up to his. Feeling all semblance of control unraveling as he watched you curiously.

Your fear melted into something far more dangerous as irregular breaths frantically tore through your chest. Fighting glazed eyes, you latched onto his from where he studied you. You could feel yourself slipping away slowly, body in control as you became aware of yourself taking another unsteady step back into the lake.

Theo’s eyes darkened with concern as you fled further. The water lapped at your legs, staining the bottom of your white nightdress. Feeling nothing but need burning through you as the moon took a hold completely, eyes blown out.

His hand found your wrist as you stepped back from him again, further into the Lake. A strange mix of confusion and longing in his unrelenting gaze as he stared, tall above you. Clouds of your breath dancing across one another’s cheeks as he grew nearer.

It was too late for the both of you. The water was drawing you in the same way you were now unwillingly luring him. He made no attempt to resist as you backed further into the lake. Instead letting you lead him, unable to tear his eyes away from yours. You could feel yourself trying to break through, to tell him to run. But that part of you was buried deep now, instead you waded further.

The wind picked up, a surge heading towards you as the lake grew rough. It brushed across your waist, bringing you to a stop as Theo closed in on you. With each wave you felt your mind washing away, filled only with him and the need to be deep below the surface of the lake. To drag him down there with you.

Theo’s hand released your wrist gently, traveling down to your fingertips as his other slid around your waist. You were both frozen for a moment, chests heaving as you were utterly transfixed by the other, before you crashed your lips against his.

Hands snaking around his neck to thread viciously through his hair as he lifted you, pressing your chest to his. You were hungry for him, a kind of hunger that you knew wouldn’t be eased by a kiss. His lips moved against yours with equal fever as you consumed each other, unable to breathe unless it was him.

Your bodies pressed against each other with urgency as you felt him gasping into your mouth, hands tangling in the fabric of your nightdress. The water pulled you again, as Theo pulled at the fabric, tongue slipping past your lips. Both came undone.

As Theo unknowingly led the two of you further into the depths of the Lake, you felt your skin changing. Scales sewing themselves across your skin as your legs gave way to fins. His lips not leaving yours for a second as your kiss only grew more desperate. Teeth tugging at his lips, you pulled at his bottom lip. Eliciting a breathy groan from the boy, which was muffled as he kissed you back roughly.

The water was at your chest now, and if he had noticed the sudden change to your body he gave no acknowledgment of it. Continuing to hold you tightly to him as you drew him further into you, the torn remains of your nightdress floating to the shore. Arms pressed against the back of his neck as you leaned back towards the surface.

Just as the water was about to swallow you both, one of his hands came to rest against your cheek. It was gentle, careful, and the feeling of his rough fingers trailing across your skin hit you like a rush of air. Eyes flying open you clawed your way back to the surface of your mind. Both of your hands falling to his chest and pushing him back roughly.

He surged away from you in the water, stumbling back and blinking with confusion. Both of you staring at one another in shock as he took in the water around him, the sight of you before him as though he was seeing it properly now. Breathing the harsh winter air in half-breaths as you both desperately tried to fill your lungs.

You could feel your eyes glazing over, and you did your best to fight the feeling as the guilt set in. Lips quivering slightly, you tried to blink back the grip the moon had over you as you floated a few steps away from him, struggling to remain on the surface. But it was no use, this wasn’t something you could simply control.

It took your last remaining strength to push yourself away, disappearing beneath the surface of the lake with the flick of your tail and the force of the moon bearing down on you. Leaving Theo above, his shirt see-through and half unbuttoned in the water. Lips swollen with desire and panting with confusion.

Read Chapter Two here

[sugarnspice630]

Fancall Fiasco - Hongjoong

"Fan service my ass! Guess I’m going to have to remind you exactly who you belong to, hm?"

•pairing: meandom!nonidol!hongjoong x idol!fem!reader

•word count: 4k

•tags: reader has an idol stage name that they go by, established relationship, mdni, smut, dirty filthy pure smut, possesive and MEAN hongjoong, degradation, name calling (whore, slut, cheater, etc), hair pulling, oral (m&f receiving), deep throating, belt restraints, spanking, slight spitting, edging, overstimulation, biting/marking up (f receiving), slight cnc(?)...did I miss anything? probably

Summary: Being an idol, you have to provide fan service to your loyal followers, however your boyfriend thinks you went a little too far with this one male fan and decides he needs to remind you who you belong to.

A/N: Phew howdy this is FILTHYYYY! Longest fic I've ever written too I think. After my call with Hongjoong, I couldn't stop thinking about if the roles were reversed and he got all jealous and possessive...Definitely need him to treat me this way. Please be sure to drop a like, reblog if you enjoyed it, and comment your favorite part! Happy reading!

─── ･ ｡ﾟ☆: .☽ . :☆ﾟ. ･ ｡ﾟ☆: .☽ . :☆ﾟ. ･ ｡ﾟ☆: .☽ . :☆ﾟ. ･ ｡ﾟ☆: .☽ . :☆───

Your group recently had a comeback, and to promote album sales and meet your amazing fans, you were doing 2-3 fancall events every single day. It was exhausting to see some familiar faces and having to talk to the same person multiple times in one day, but as an idol, you have to put up with that kind of stuff and just do your job.

The outfit your stylist put you in was super edgy and went with the concept for your recent album. It was a little revealing, but you didn’t mind too much cause you felt pretty. A black crop top with a metal o-ring right in the middle of your chest, a hooded top with the shoulders exposed that had grommets and rings down the arms, and connected to this ring on the hoodie top were two belt-like chains that went down your sides and hooked together in the back underneath the hood. Many of the fans you talked to today, mostly men, but occasional female fans, complimented you and said how beautiful you looked today. It was always refreshing getting to talk to the fellow female fans, as it felt more like girlhood than the male fans just trying to get in your pants. Although there was this one fan in particular, that was unbelievably handsome. After the staff member removed the paper from the camera, you were met with a gorgeous man, around the same age as you, you assumed.

“A-ah! H-Hi Hana!” He waved to you and seemed slightly nervous.

“Hi there-!” You quickly glanced down at your note, sitting next to the album you were supposed to sign for the fan. “Felix! So nice to meet you!” You said with a smile and waved with your free hand. You stared back at the fan with sparkling eyes, and your head tilted to the side as he waved back to you.

“I’m so excited to talk to you today…ah sorry, I’m so nervous.” He covered his face with his hands but left his eyes visible so he could stare at you.

"Ahh, don’t be nervous; I’m excited to talk to you too. Actually, you’re very handsome.” You said with a smirk and leaned closer to the camera. You watched as the fan lit up with excitement and heard a tiny gasp come from him.

“Oh- t-thank you so much. Y-you’re very pretty too.”

“Oh am I~? That’s so nice to hear. Thank you so much.” You continued to smile and bat your eyes at the fan, enjoying how flustered you were making him.

“Y-yes, I actually had a question for you, if I can ask.”

“Yes of course!” You took this opportunity to look down at the album, pick your favorite picture from this specific version of the album, and place your signature in the corner, along with a couple hearts for some fan service. The fan asked their question while you were signing.

“I was wondering how you came up with your stage name?” Ah yes, the question many fans ask you because they love to hear the clever response that you came up with.

“Ahh actually, so the number 1 in Korean is "hana,” and it has a lot of importance to me. It’s my favorite number, I was the first person to join our group, and I know I’ll always be the number 1 in your heart.” You took your time saying your response to drag out the time, looking around the room to pretend you were thinking about it, and then at the very end flashed a finger heart and a wink to the fan, to which he melted and covered his face with his hands again.

“Wow…you’re so cool Hana and so pretty.”

“Thank you so much!” You covered your smile with your hand to act all shy and cutesy. As the fans say, the company's rent was due, your fan service today has been insanely good. You heard the familiar sound of the timer going off, meaning the call was coming to an end. “Aww I’m so sorry Felix our time is up.” You said with a pout and brought your hands to a praying motion.

“Aww okay. Bye Hana! Thank you so much!” He waved to you and smiled.

“Bye handsome! Thank you!” You winked one last time as you waved, and the staff covered the camera with paper and ended the call. You made sure the call was done before you let out a sigh of relief and dropped your smile. The staff member that was helping you out for the day just smiled and chuckled the slightest bit.

“You were working hard there.” She said as she grabbed the album from you, placed the sticky note with the fan's order on it, and set it off to the side.

“Ahh yeah, he was cute though! Very sweet boy. It’s fans like that that make me love my job.” You took a couple sips out of the water bottle the staff provided for you and relaxed for a few seconds before the next call started.

–

The events were done for the day, and exhausted was an understatement. You bowed to the event staff and thanked them many times before making your way out of the room and following your manager back to the designated room for your group. You quickly glanced at your phone and saw a message from your boyfriend.

Your blood ran cold. He sounded so serious. What could you have possibly done? I guess you were going to find out when you got back to your apartment. You and Hongjoong had plans to meet up after your schedules today anyway.

–

You got back to your apartment, finally wearing some comfortable clothes. You walked into the front door, took your jacket off, and started to kick your shoes off before shouting out to your boyfriend, who was hiding somewhere. 

“Hongjoong! I’m bac-!” Your words were cut off by Hongjoong pressing you against the wall. His one hand grips onto your shoulder to keep you against the hard surface, and the other hand holds his phone and shoves the screen in your face.

“What the fuck is this?” He said lowly and through gritted teeth. You glanced over at the screen, breathing heavily, and saw a familiar-looking face on his screen. The video was from one of the many fan calls you had today. Specifically the really nice looking one. What was his name? Ah right, Felix.

“I don’t understand…”

“Don't play dumb with me Y/N! You’re practically fucking him through the screen!”

“N-no Hongjoong..what? L-let me see.” You reached up, took the phone from his hand, and read the post the fan had made to yourself.

The attached video had no sound, but subtitles were provided. You reviewed the video and smirked to yourself, watching the fan get all nervous and flustered again at your fan service. That’s exactly all it was. Fan service. You scrolled through some of the comments that had been made on that post by other fans.

Waahhh, omg you’re so lucky!!

SHE IS SO IN LOVE WITH YOU! IMAGINE BEING CALLED HANDSOME BY HANA? GOD YOU’RE SO LUCKY

Ohhh she wants you fr fr

You smirked again and lightly scoffed at the various reactions from your fans. When you looked back up at Hongjoong to hand him his phone back, his arms were crossed, his breathing was deep and heavy, and he stared at you with aggressive eyes.

“B-baby it’s just fan service.”

“Fan service my ass!” He snatched his phone back from your hand and shoved it into his pocket. “Guess I’m going to have to remind you exactly who you belong to, hm?”

“Hongjoong no, you don’t have to do that. I-I know that-.” Your words were cut off again by Hongjoong pushing you back against the wall again and slamming his lips onto yours. The grip he had on your arms was enough to hurt a little bit, and you squirmed at the uncomfortable feeling. “J-Joong.”

“Shut the fuck up cheater, or I’ll shove something in your mouth to make you shut up.” His behavior was so left-field for you, and you didn’t know how to feel. If you wanted to be truly honest, his possessive nature was making your pussy ache and damp.

“I didn’t d-do anything wrong!” 

“Didn’t do anything wrong….listen to yourself!” He yelled slightly and slid his hands down to grab both of your wrists, then slammed them up against the wall. He pressed his body frame against you, so you were completely against the wall. His face is right in your face, leaving no room for personal space. “I fucking own you; you got that? You’re mine, and when I see you flirting and undressing your fans with those seductive eyes of yours..I get a little…pissed off. So now, I have to make sure you haven’t forgotten exactly who you belong to.”

“Hongjoong I-.” Your heart was beating rapidly, and you did not know what else to say or do. He waited for you to try to say another smart remark before he took your hands held above your head, held them in one hand, and pulled you along as he started stomping toward your room. “Stop! What are you doing?”

“Teaching you a fucking lesson.” He threw his arm forward, which resulted in you stumbling forward and dropping down at the edge of the bed. He stepped back and ripped his shirt off over his head and, with one hand, threw it to the side of the room. You were propping yourself up with one arm and leaning back onto the bed as he walked closer to you. He grabbed the bottom of your chin and forced your face to look up at him. Taking a few seconds to look at your face and smile slyly. 

“Are you scared of what I am capable of, Y/N?” You shook your head from side to side in response. “Use your fucking words slut.”

“N-no!” You stuttered out.

“You don’t sound so confident~.”

“I’m not scared of you!” You retaliated, but he just smirked at you. 

“Guess I'll have to make you scared of me then.” Not a moment passed before he grabbed you by the hair and pulled you off the bed, down on your knees, onto the floor in front of him. You winced from the pain as he dragged you down. You tilted your head up to look at him, hoping your expression would fill him with remorse. “Pathetic really. You think looking at me like that will make me forget what you did today? Think again.” As he spoke, his free hand fought with his belt to get it off. He snapped the belt to the side, almost like a whip, and squatted down to be in front of you. You dared not to look at him, but you could feel his eyes piercing into you. You felt his hand release from your hair. He tenderly traced his hands along your arms and brought them together, holding your wrists together again with his hands.

“I don’t want you fucking touching me, so this is how I’ll fix that.” He took the belt and tightened it harshly around your wrists, pulling the belt tought and wrapping it a few times, allowing the end of the belt to stick out as a grip for him to hold onto. He stood back up and pulled your arms up with the belt. Your head rag dolled with your arms being pulled up. At this point, you had given in to him and were ready to accept whatever punishment he was giving you right now. 

Your eyes followed his hand, which was not holding your restraint, and your eyes were led to the zipper on his pants. He pulled the zipper down and shimmed his pants down just barely past his hips, enough for him to be able to whip his cock out. 

“Open up whore.” He demanded, and you found yourself quickly obeying. He raised the arm holding your restraint a little higher before shoving his cock directly into your mouth. Pushing himself all the way in, not allowing you to prepare yourself at all. Your eyes immediately filled with tears, and you tried your best not to gag. Hongjoong had an average-sized cock, but that doesn't mean it was easy for you to take him. You heard Hongjoong groan above you, and you glanced up at him to see the look on his face. His head was tilted back slightly, and his mouth was agape just the slightest bit.

“God I’m gonna fucking ruin you. Gonna fuck this little throat of yours so good it’ll be hard for you to sing at your precious music show tomorrow.” You whimpered at his dirty talk, but also because your voice is an extremely valued asset to your group, and if you can’t perform at your best, it will definitely not go unnoticed. He shoved himself further inside your mouth, and you couldn’t help but gag so hard that you started to cough. You pulled yourself off and back away from him, and you continued coughing until you felt better. Hongjoong scoffed at you.

“Unbelievable.”

“Joongie please…” Your voice is nearly above a whisper, still trying to come back to you after having his dick deep in your throat. Your eyes are now bloodshot and watery, looking at him hoping he’ll feel some sympathy and realize he's going a little too hard on you.

“You should have thought about the consequences before flirting with that fan baby.” He shrugs and dismisses your cry for help. You braced yourself, thinking he was going to shove himself back inside your throat, but to your surprise, he pulled you up by the belt restraint, so you were standing up. He steadied you by placing his free hand on your shoulder and looking at you deep in the eyes. “You’re lucky I actually give a shit about your career. Be thankful I don’t completely ruin your fragile ass.” He tilted his head while talking to you, smirking at the end of his sentence.

“Y-yes, thank you.”

“Shut up. That wasn’t an invitation.” He unexpectedly let go of the belt, and your arms fell down in front of you, hitting the front of your crotch. You whimpered at the impact and felt the blood rush back into your arms. He placed his hand on your shoulder and pushed you, so you fell back onto the bed. Letting out a grunt when your back made contact with the mattress. Hongjoong stepped closer to the bed and gripped onto your sweatpants. 

“I don’t want to hear another sound out of you, got it?” You opened your mouth to agree, but quickly closed it and nodded your head instead. "Finally, you got some sense knocked into you.” He pulled your sweatpants down, and you heard a soft chuckle come out of him. “My my, you’ve made a mess down here already.” You wanted to squirm, but his grip on your legs prevented you from doing so. Your struggle must have said enough because he took two of his fingers and placed them on the wet patch on your underwear. The room was quiet enough that you could hear the squishing sound of your wetness spreading even more, completely soaking your undergarments.

“You like me treating you like this, huh?” He said as he pushed his fingers into you harder. You bit your lip to suppress the whimper that so desperately wanted to come out. His two fingers finding your clit through your underwear and massaging it delicately. You squeezed your eyes shut and bit your lip harder. You arched your back slightly and tilted your head into the bed.

“Look at you getting all needy for me now. Bet you were not thinking about me when talking to that boy toy of yours.” His tone was so condescending. You had really pissed him off, and he was going to make sure you knew and remembered who you belonged to. He removed his fingers from your clothed pussy and pulled them down. Completely removing those and your sweatpants in the process. You felt the cold air of the room blow across your bare area and got cold chills on your body. He harshly gripped your thighs and pulled your legs further apart, completely exposing yourself to him. You felt his warm breath against you as he leaned in closer. He pushes your legs apart a little more, and you whimper at the pain of being overstretched. Hongjoong hears your whimper and slaps the side of your leg with his hand.

“I thought I told you to stay quiet.”

“S-sorry.” You muttered and felt Hongjoong slap your side again, harder than the last time. Next thing you know, he dives his tongue straight into your pussy, licking and sliding his mouth everywhere. His warm tongue collects all of your juices that have recently come out. He swirls your fluids around in his mouth and spits it right back out onto you, licking and lapping it up all over again. His nose is pushing right onto your clit. You so badly want to take your hands and grip the side of his hair, but with your hands tied, you can’t. Your body writhes and squirms underneath him, and with every movement you make, you feel him pushing that side of you back down to keep you secured to the bed. He continues to lick and tongue-fuck you, too enthralled in your pussy to notice all of the soft whimpers and moans you have been letting out. You feel a knot begin to form in your lower stomach, but just as you are about to go over the edge, Hongjoong pulls away from you. You tilt your head down to look at him, breathing heavily and wondering why he stopped. He looks back at you and uses his tongue to lick your excessive fluids that have built up around his lips. Pulling his tongue back in and letting it rest against his teeth as he smirks at you, looking at him with desperation and confusion.

“Oh I’m sorry. Did you really think I was going to let you cum that easily? This is your punishment whore. Nothing good will come out of this, you hear me?” 

You pouted and wiggled your arms to try to prop yourself up. You just wanted to cum so badly and get this punishment over with. Hongjoong takes this time to grab your sides and flip you over onto your stomach. Your legs are still dangling off the edge of the bed, and you feel him spread your legs apart a little bit with his hands and nuzzle himself in between. He glides his hand up your right thigh and caresses your ass cheek.

“Such a pretty ass, but it’ll look even better with my handprints all over it. Wouldn’t you agree?” You wiggled your hips to agree with him. He firmly grips your cheek before pulling his hand away and forcing it back down onto your ass. He watches as the skin, fat, and muscle recoil from the slap. You push your head into the bed to muffle any sounds that might come out of your mouth. Hongjoong not being satisfied with his work yet, lifted his hand up again and smacked your ass harshly for the second time. You started to feel the stinging and burning feeling. Your ass was now a pretty shade of pink, but Hongjoong was still not satisfied. He lifted his hand one more time and put all his effort into slapping your ass again. You heard him grunt as he swung his arm down. Putting all of his force into smacking you. You pushed your hips back, unintentionally asking him for more.

“It’s funny you think I’m going to give you what you want. Really? After what you did today?” Hongjoong massaged your stinging and red cheek as he said this, and you softly moaned at the feeling. Finally being able to feel some comfort after a couple minutes of pain. Hongjoong flips you around again and leans down, placing his arms on both sides of you to support himself. He reaches for the belt restraint and takes it off of you.

“This is not an invitation for you to touch me, got it?”

“Y-yes sir.” You whispered as you nodded, looking him straight in the eyes. He smirks for a second and tosses the belt to the side of the room. He places one arm back at your side while the other hand touches his cock to guide himself into you. Instead of slamming himself inside of you like before, he slowly inserts his dick into you. Your walls swallow him, and you can feel every vein on his cock. He removes his hand from his dick as he goes further in and places it beside you on the other side.

“God dammit you’re so tight.” He growls through gritted teeth. Pushing himself all the way, slowly. You squeeze your eyes shut as he fills you nicely. Happy to finally have his cock inside you after him edging you. Your arms were sprawled out to the side, unsure of where to put them since you can’t put them on Hongjoong like you normally would.

“I’m gonna drill myself so far into you that you’ll still feel me inside you days later. So you can never forget me. Huh? Remember? You’re mine Y/N. You’re my toy to fuck and play with. Think about that the next time you want to whore yourself out to your fans. I bet he couldn’t fuck you like I could. No, he couldn’t. Cause if he even remotely got close to you, he’d be gone in seconds. No one touches you except for me. You got that? Mine…you’re fucking mine!” Hongjoong spouts off, getting increasingly louder and harder with his thrusts. He has fully leaned his body down onto you, so you are chest to chest. His dick keeps drilling inside you, and your head is spinning. His dirty and possessive words go straight to your core.

“Hongjoong-”

"Yeah, fucking say my name. Who’s fucking you this good?”

“Hongjoong!”

“That’s right you slut!” He thrusts himself into you harder and faster. You feel your orgasm building up again. You so desperately want to grab onto his arms and hold onto him as you’re cumming. Hongjoong dives his head into your neck and kisses and nips at your skin, surely leaving little marks on your skin.

“S-stop! Tomorrow…schedule!” You plead, trying to tell him not to mark up your skin since you have performances to do the next day.

“No! I’m letting all of your precious fans know you’re already taken, and there is no chance of them being able to get with you.” He mutters seductively against your neck. A few more thrusts and neck kisses, and your release bubbles out of you. You cry out his name, each one louder than the last, as you cum all over his cock. “Fuck! Yeah that’s right. I’m the only one capable of making you cum this hard.” His thrusts are getting sloppy, and you can tell he is close to his release. He is still pounding into you, which is overstimulating you. Muttering “yeah” and “fuck” to himself quietly over and over again, grunting and groaning. Eventually, he fills you up with his load. Tilting his head down and panting as he tries to calm himself down. He pulls himself out of you, and you whimper. Completely fucked out and brainless at this point.

“Just to check…who do you belong to?”

“You Hongjoong…o-only you.”

“That’s right. Don’t forget that ever again; you got it?”

“Yes Hongjoong.”

Tags: @pre1ttyies @isiloiale @moongoddess1982 @yeosangsbbg @sanipan @10nantscompanion @xuchiya @bunnyluvr25

[pedrospatch]

to do the right thing l part ii

Post Outbreak! Joel Miller x Pregnant! Female Reader

series masterlist

summary: Joel has a hard time dealing with things as the pregnancy progresses; you and Joel ask Bill and Frank for the favor of a lifetime.

warnings/tags: 18+ ONLY, MINORS DNI. BOSTON QZ ERA. ((TW)) PREGNANCY, mentions and references to adoption, angst, asshole Joel, mentions of Sarah, softer Joel towards the end.

word count: 7.9k

a/n: i actually spent more time writing this second part, so hopefully it is a bit more well written than the first one that i wrote in an hour in the middle of the night. T_T

February, 2020

“Well, can I just say that we are just so incredibly thrilled that you two could finally come and join us for dinner this evening,” Frank beamed, grinning from ear to ear as he burst into the dining room with a bottle of his favorite red wine in one hand and a bottle opener in the other.

Bill snorted, stabbing his fork just a little too aggressively into his cut of chicken breast.

“Speak for yourself,” he grouched under his breath before taking a bite. Although he’d quit bringing his gun to the table, both you and Joel knew he had the pistol tucked somewhere nearby. You were willing to bet it was tucked into the waistband of his khaki trousers, but Joel would probably argue that it was in a less obvious place, like strapped to his ankle.

It really seemed as though Bill would never allow himself to get used to you, Tess, and he especially wouldn’t allow himself to get used to Joel. He knew it was the smart, logical choice, keeping you three around for the sake of trading supplies and resources when needed, but overall, it wasn't all that necessary. He and Frank had been doing just fine for years before you all had come into their lives after Frank had met Tess over the radio one afternoon. Or at least, that’s what he liked to believe despite the fact that during your very first lunch together, Joel had easily pointed out several flaws around the perimeter of their neighborhood—weak spots that could be vulnerable to raiders if they ever came along. You and Tess joked that Bill put Joel at the top of his shit list the moment he pointed out that their fence only had about a year left to hold strong. He’d been on it ever since.

Having you all around at this point was more for Frank’s benefit than anything. Bill would do just about anything to make Frank happy, and much to his chagrin, you, Tess, and even Joel, made him happy—having friends made him happy. Bill could do without socializing for the rest of his natural born life, but Frank, on the other hand, would lose his sanity. 

“Oh, don’t mind him. He’s just been in a bad mood because we had a massive roof leak the other day after that huge thunderstorm," Frank explained, rolling his eyes. Being the attentive, gracious host that he always was, he quickly made his way around the dinner table, pouring everyone a generous glass of wine to enjoy with their meal. “He spent hours up on that roof trying to patch it up and then damn near broke his ankle coming down when he missed the last two steps on the ladder. Can you believe that?”

“Thought I noticed a limp,” Joel remarked with an amused smirk.

Frank nudged Joel in the shoulder as he poured his wine. “I had told him to wait for you, Joel, what with you having been in construction before and all. But Mister ‘I don’t need anyone’s help’ decided to do it himself even though he has never patched a roof before in his life.”

“Tell you what, next time we’re over for lunch, I’ll go up there and check it out. Make sure he did it right ‘cause I highly doubt he did.”

Bill glowered at him.

You roughly smacked the side of his thigh underneath the table.

Joel, please, You thought silently. We need to stay on his good side.

Frank chuckled as he fell into step beside your chair. “That would be very helpful if you did, actually. It would definitely give me a bit more peace of mind, especially since the rainiest season of the year is approaching fast.” He offered Bill an apologetic smile. “I’m sorry sweetheart, but we really should let an expert take a look at it, just to be on the safe side. Joel knows his stuff, after all.”

As he reached for your glass, you quickly placed your hand over the top of it and lightly shook your head. “Oh, none for me tonight, thank you,” You declined politely. The wine was normally your favorite part of any meal they hosted, seeing as Bill and Frank, who were both quite the wine enthusiasts, knew how to make the most heavenly of pairings. It really was a fucking shame that it would be at least a few more months before you could drink again. Lord only knew you could use the alcohol after all of the bullshit that had been going on lately with Joel. “May I have a glass of water instead, please?”

“What? You don’t want any wine?” Frank frowned and reached out with his free hand, pressing the back of it against your forehead. “Are you feeling sick or something? Should we be worried? Bill, where’s the reader—?”

You chuckled at his usual dramatic little antics. “No, I’m fine,” You assured him. “I’d just rather stick to water tonight if that’s okay.”

“That’s really fucking weird of you, but alright,” he sang over his shoulder as he disappeared into the kitchen. He returned a minute later with a tall glass of clean, filtered water in his hand and set it down on the table in front of you before taking his seat next to Bill. He picked up his red cloth napkin and draped it gingerly over his lap. “So, tell us again why Tess couldn’t make it tonight?”

“She, uh, she had a few things she needed to take care of back in the QZ,” Joel explained to him briefly before popping a piece of roasted rosemary potato into his mouth. The truth was that Tess had opted to stay behind and sit this one out, stating that the conversation that would eventually take place tonight would be between the four of you. She didn’t need to be there, nor be a part of it.

“Well that’s such a shame. I really miss her,” Frank lamented between bites of his garden salad. “It’s been a while since we’ve all gotten together for a meal. Hell, this is the first time we’ve seen you in what, a couple of months at least, right Bill?”

“Felt like a lot less than that. But sure, let’s call it a couple of months.” Bill eyed Joel suspiciously. “Sounded a bit urgent when you radioed in and let us know you had to come see us tonight, Joel. More so than usual. I’m guessing that you two must really need something from us.”

You and Joel exchanged a silent glance.

“Jesus Bill, can you please not be so rude to them for once?” Frank scolded, waving a hand dismissively at his partner. He smiled apologetically at you and Joel. “Again, please don’t mind him. It seems to me that we still have some work left to do with his manners.” He paused just long enough to take a delicate sip of his wine. He set his glass down, then picked up his fork and knife. “But, if you do happen to need anything, you know that we are more than happy to help you out as best as we can if we have the supplies and resources to spare.”

“Which we don’t,” Bill chimed in, earning himself a light smack to the shoulder.

Joel ignored him and instead focused his attention on Frank. He was the one to win over out of the two. “That’s awfully kind of you, Frank. You know that we always appreciate your warm hospitality,” he remarked, and although he was laying it on a little thick for the sake of getting into his good graces, there was an underlying sincerity in his tone. He actually happened to like Frank—it was hard for anyone not to like him. Joel lifted his glass of wine to him in a toast. “Of all the people we could’ve come across on the radio that day, we’re grateful that it was you.”

Frank touched a hand lightly to his chest. He then picked up his own glass, clinking the rim against Joel’s. “Well, cheers to that.”

“I think I’m gonna be sick,” Bill grumbled, shaking his head.

Joel nudged your leg under the table as if to let you know it was time.

On the way up to Lincoln, he had suggested Bill and Frank would be a lot more inclined to agree to yours and his pending request if it came from you. Joel could butter Frank up well enough, but Bill hated his fucking guts, and you probably had a better chance of winning the survivalist over than Joel did.

You cleared your throat lightly, garnering everyone’s attention. “I have some news to share. Well, actually, we have some news to share.”

Bill raised a thick, bushy eyebrow. “What kind of news?”

“News? Is everything okay?” Frank asked, suddenly worried. “Wait. Is it Tess? Is she alright? Did something happen?”

“No, it isn’t anything like that at all. Tess is perfectly fine,” You quickly reassured him, causing him to sink back against his chair in relief. You held your breath for a moment before exhaling it softly through your mouth and announcing, “I’m, um—I’m pregnant.”

Bill nearly choked on his chicken and Frank gasped, both hands flying to his mouth in complete shock. The seconds passed in silence, and the room had gone so quiet that one could have heard a fucking pin drop on the floor. You felt the heat flood to your face and nervously shoved a forkful of baked chicken into your mouth, deciding it would be best to just give them a bit of time to process the news before moving onto phase two. However, Joel wasn’t there to waste any time and decided to step in.

“Listen, I know that this is probably a lot to take in, but we didn’t exactly come over here to share that with you just for shits and giggles. As much as it pains me to say it, Bill is right,” he admitted reluctantly. That was one phrase Joel Miller could do without saying ever again. “Truth is, we do need somethin’ from you two. We’ve got a favor to ask you both, a big one at that.”

That had been enough to slap Bill back into reality.

“Oh no, stop right there! I can see where this is going from a fucking mile away!” He jumped up from his chair, furiously shaking his head as he wagged his index finger at you and Joel. “Listen here, we have been as generous as we can possibly be with the two of you, and with Tess—but there’s got to be a line drawn somewhere and this is it! There is no fucking way in hell that we’re taking you into our home, into our neighborhood! This place belongs to us, we built it, we secured it! We worked our goddamn asses off for all that we have and just because she’s pregnant does not mean we will allow you to—”

“That’s not it.” Though your voice was smaller, softer, it managed to get through to Bill over his angry ranting. “That’s not it at all, Bill. We’re not trying to move here or invade your space like that, I swear it.”

His hand dropped down to his side. “Really?”

“No. Of course not. We know you have boundaries, and so does Frank. And whether you choose to believe it or not, we do our best to respect them as much as we possibly can.”

“Oh.” Bill slowly sank back down to his chair, looking relieved. “Then what is it that you two want? You need baby clothes or baby blankets from the boutique or something?”

“Not exactly,” You mumbled. You took a quick minute to think it over in your head, wondering if there was any correct or tactful way to ask what you were about to ask of them—there wasn’t. It didn’t matter if you spun it a million different ways, Bill was still going to blow a fuse again no matter what. “We wanted to ask you and Frank if you would be willing to take the baby into your care once it’s born.”

And just like that, Bill’s temporary relief vanished.  “I beg your fucking pardon?”

You turned to Joel, saying tightly through your teeth, “A little fucking help here, please?”

“Look. Boston ain’t no fuckin’ place for a child,” Joel started, lifting his hand in an attempt to keep Bill calm this time. “Too much shit’s been goin’ on there lately. Violence has escalated, supplies are gettin’ harder to get and costin’ us more than ever before. So we want to know if you and Frank are willing to take the baby after it’s born. It would be better off here with you two than with us in the QZ.”

Bill didn’t need to think twice about it. He answered Joel with a stern, “Absolutely not.”

Joel let out an irritated sigh and dropped his fork. The utensil clanked loudly against the white porcelain plate. He dropped his face into his hands, rubbing it harshly. “Fuckin’ knew he wasn’t gonna make this easy for us.”

You chewed anxiously on your bottom lip, an overwhelming feeling suddenly washing over your entire body from head to toe. It was strange to feel this way, considering the fact Bill and Frank’s place had always been something of a temporary escape for you. Their neighborhood, their home, it usually brought you a sense of peace and tranquility—you felt comfortable whenever you were here. But between Bill’s angry outburst, his instant decline to your request, and Frank’s wide, shocked eyes still fixed intently on you, you suddenly found yourself wishing you were anywhere but in Lincoln.

“You’re pregnant?” Frank’s incredulous voice broke the silence that had fallen over the dinner table. Part of you wondered how much of the conversation he had even heard or if it had just gone in through one ear and out the other. “You’re really pregnant?”

“Frank,” Bill said his name warningly. “Don’t even think about it.”

Frank ignored him, his attention still on you. “How far along are you?”

You glanced at Joel before turning back to him. “It’s just an estimate, but we’re thinking at this point that I might be about four and a half months, maybe almost five?” You replied with a small shrug of your shoulders. “We aren’t too sure, though.”

“And it’s yours?” Bill questioned, eyeing Joel in disbelief.

Joel glared at him, his aggravated silence speaking for him.

“Oh, Bill.” Frank suddenly turned to him with a hopeful expression. “A baby!”

There had been a couple of different occasions where, while sitting outside on the front lawn enjoying a glass of iced tea in the sunshine, Frank had confessed to both you and Tess of his desire to have a family one day. He acknowledged the chances of that ever happening were virtually impossible, but he admitted that it was something he had been dreaming of since meeting Bill. He wanted to be a father. He wanted a child, and here you were, with one that you couldn’t keep.

“Frank. No.” Bill stared at him, unable to fathom how he could even think that taking in a child could possibly be a good idea. “I’m sorry. You know I try to give you everything that you ask for, but I have to put my foot down this time. I have enough trouble keeping you safe as it is! We’ve had raiders come and try knocking at our door before—”

“And you’ve fought them off,” Joel reminded him. “Successfully.”

“Not to mention, think of all the things we would have to do in order to raise a kid, all the supplies and resources we would use up in just the first year alone—”

“Bill, we know this is a lot to ask of you, of both of you,” You somehow managed to chime in. “We know that a favor like this is one we would never be able to repay you for, not in this lifetime. But it’s this child’s only shot. What kind of life would it have where we live? What kind of future would it have in the QZ?”

“Hm. Sounds like not our fucking problem,” Bill quipped. “Sorry.”

Frank’s eyes left his partner’s and met yours across the table before they fell down to your midsection. “You said you’re about four and a half months?”

You gave him a small nod.

Bill might not have been on board, but you still had Frank.

He was your only hope. 

“Yes, but again, it’s an guess. We don’t want anyone else in the QZ knowing that I’m pregnant, so I haven’t been to see a doctor. But we think it’s a pretty close guess.” Suddenly, an idea came to mind. You hesitated, at first, but knew it was your best shot at finishing the job and reeling Frank in. You slowly stood up from the table and with trembling fingers, you started to unbutton the flannel jacket you were wearing—Joel’s flannel jacket—and showed him the swollen belly you had been hiding underneath it. It was on the smaller side, but still quite prominent underneath a snug-fitting, cotton blue tank top.

“Oh!” Frank breathed out in surprise. He rose to his feet, rushing over and around to your side of the table. He excitedly lifted his hands, but then stopped himself, glancing at you for permission first. “Would it be alright if—?”

“Of course, go right ahead,” You encouraged with a tiny smile as you continued holding the jacket open for him.

Frank sank to his knees in front of you. He lightly cradled the small bump in between his palms, looking up at you with a look of absolute wonder on his face.

It felt bizarre, not only showing your midsection to someone else, but having another set of hands besides your own on it felt foreign as well.

As soon as you’d started showing, Joel had refused to go near you—the way he tried painfully to ignore it caused you to keep it hidden away underneath oversized clothes, even in the privacy of your own quarters.

During the first few weeks of your pregnancy, he’d been just fine. Well, as fine as he could be. But once your belly had popped, it was as if it had all suddenly sunk in and really clicked for Joel—this was one hundred percent fucking real now and that was his baby growing inside of you. Since that moment, he hadn’t quite been himself, at least not with you.

Joel still looked out for you, of course. He didn’t dote sweetly on you and shower you with affection, but he did take responsibility in the ways that mattered. He made sure that you were taking the prenatal vitamins Tess had found for you, he made sure that you were eating enough, and if he ever noticed that you were still hungry, he would shovel his own portion onto your plate without asking and head off to sleep on an empty stomach. He helped you out whenever you were assigned to the same work detail, taking on an extra load of work on top of his own if it meant sparing you from even the slightest risk of straining yourself or over exerting your body.

Sure, he still cared for you. He wouldn’t do any of that if he didn’t.

But that didn’t mean things between you hadn’t changed.

They had.

Drastically.

Joel kept his distance from you, physically. He hadn’t fucked you, kissed you, or so much as even touched you in the last couple of months. He’d even started sleeping on the couch, leaving you to sleep alone in your once shared bed. Whenever he spoke to you, he stood at least a few feet away, and his eyes always remained trained on your face—he took especially great care to not look at your growing stomach. You could briefly recall one morning when you’d squeezed past him in the kitchen to grab a mug from the sink while he’d been making his morning coffee; when your belly accidentally brushed against his hand, he had cringed, snatching it away from you as if he’d touched something unpleasant. Deep down, you knew this was his own twisted, fucked up way of coping with how he was feeling, but it still didn’t stop you from wishing that he’d quit acting as if you and the baby were the fucking plague.

 As much as you tried to deny it, the way Joel had been treating you lately hurt you. It cut you deep, down to your very core. You put on a good front for him and Tess, though, acting as if none of it bothered you. But the tears that you shed on the nights they left you alone to go out on their runs were endless.

“Oh Bill,” Frank glanced pleadingly over his shoulder at his partner, his hands still on your stomach. “Please.”

“Frank—”

“Please.”

Bill couldn’t refuse Frank a majority of the time. But this was bigger than anything he’d ever asked of him and it was going to take more than his usual amount of convincing to get him to agree.

Bill scoffed, narrowing his eyes at you. “Let me guess. You want us to take this baby in and you want us to clothe it, feed it, and protect it. You want us to do the real work of raising it, using up our supplies and resources. And then what? You two come along to play mommy and daddy whenever you fucking feel like it?”

You shuffled from foot to foot, wincing slightly at his harshness. “No, of course not.”

Joel wasn’t all too fond of Bill’s tone towards you. He leaned forward, throwing him a warning glare across the table. “She’d like to visit,” he informed him, keeping his temper under control. He knew better than to go off on Bill, not when you were still trying to convince him to do you both the favor of a fucking lifetime. “Every now and again, just to see the kid. But we think it’s best if we do a closed adoption, if you wanna call it that. You and Frank are the parents, and we’re just a couple of friends who come by and visit daddy and daddy every now and again for lunch.”

“Right, and you really want me to believe that there’s no chance she’s going to be attached to this baby after carrying it for nine months?” Although Bill was facing and speaking directly to Joel, it was obvious he was indirectly grilling you. And here Joel thought the man might have had something of a soft spot for you. “Think about it, Joel. You don’t think one day she might waltz in here and decide she wants to take it back? Break Frank’s heart when he has to give up a child he’s going to undoubtedly fall in love with?”

Anger simmered underneath your skin, bubbling in your veins at the insinuation that you could ever do something to hurt Frank. “First of all, stop talking about me like I’m not in the fucking room, alright? I’m standing right here, so fucking look me in the face if you’re going to talk about me.” You seethed. Frank stood up and placed his hand on your shoulder in an effort to calm you, but it was too late. “This isn’t a fucking game, Bill. This isn’t a decision that we made on a whim or that we’re taking lightly. Me and Joel are just trying to do right by this child. If you and Frank agree to take it in as your own, it’s all yours. I’m not going to take it back,” You practically spat. “Once it’s done, it’s fucking done.”

“Alright, alright. I’m going to need you to just take a deep breath and relax before you bring on early labor in the middle of my dining room.” Frank gently guided you until you were sitting back in one of the chairs and handed you your untouched glass of water. He waited patiently as you took a few sips and then took the glass from your hand, setting it back down on the table. “Listen, before we decide anything, I just have to ask—is this really what you want to do? This is a decision that you made, right? No one is making you do this?” He noticed Joel raise his eyebrows at what he was suggesting, and before he could chime in, Frank quickly added, “I just need to hear it from her, Joel.”

“This is what’s best,” You answered honestly, feeling a dull ache in your heart that had become all too familiar. “I have spent so many long nights lying in bed just thinking this over. We don’t have any other choice, not if we want it to have a chance at a decent life. That is what I want, Frank. For it to have a chance at a decent life.”

“This child is gonna grow up and want to know who its parents are,” Bill pointed out. “Thought about that at all?”

“Use your imagination,” Joel remarked before taking a quick sip of wine. “Make somethin’ up. Lie. Tell it you found it in a basket floating down the fuckin’ river. Whatever it takes. We don’t ever want the kid to know it’s us.”

“Going to be kind of hard if it comes out looking like your clone.” Bill gestured to you with a nod of his head. “Or hers.”

“It’ll be a long, long time before this child is even old enough to notice things like who he or she looks like,” You released a little scoff, tired of him using any reason he could think of to stand against it. “Bill, please. Can’t you at least think about it for the next few weeks and at least consider it?”

“No.”

Your face fell. 

Motherfucker really wasn’t going to budge.

“Well now, wait just a second.” Frank walked over to him and put his hands on his burly shoulders. “Bill, think about it. This is our chance.” He squeezed his shoulders. “To have a family. A real family.”

“Family? It’s not our fucking kid—it’s not a part of me or you.”

“But we’ll love it like it is! Blood isn’t what makes a family. Love is,” he reminded him softly.

You swallowed back the lump that had risen in your throat.

Bill might have been a stubborn jackass, but you knew that Frank would show him how to be a good father. He had already shown him how to be an amazing, loving partner.

“So?” Joel prompted. He crossed his arms over his chest, leaning back into his chair.

Bill scowled at him. He said nothing as he reached for his glass of wine, chugging every last drop in one long gulp before he stood up and stalked out of the dining room.

Frank had his answer.

And so did you and Joel.

As the next several weeks turned into months, pregnancy—and your ever ongoing attempts at hiding it from everyone in the Boston QZ—had really started to take its toll on you, physically, mentally, and emotionally. Joel had given you all but his entire wardrobe, helping to keep your condition hidden as well as possible, but it was taking a hell of a lot more than just his jackets and shirts to keep it a secret. When you entered your third trimester, you were starting to struggle immensely with work detail, finding it more and more difficult to keep up with what authorities expected of you. Everything ached—your feet, your back, and even the hairs on your fucking head were hurting, and yet you were forced to carry on with your daily duties as best you could to avoid raising any suspicions.

“Frank said it might be best if you gave birth at their place,” Joel commented over dinner one night. Tess was out doing a solo run, and it had just been the two of you for the last couple of days. Lately, you almost wished she would stop leaving you alone with Joel. Ever since that night at Bill and Frank’s, he had been acting a lot colder towards you, more than ever before. He could hardly look at you most days. Before, he could at least stand to look at your face. Now, there wasn’t a single part of you that his eyes could meet. “As soon as you start feelin’ off, we’re gonna need to get you over to them. Frank talked Bill into lettin’ you stay for a few days if it comes down to it and you need some time to heal.”

You simply nodded, your gaze fixed on the torn paper napkin in front of you. “Okay.”

He bit into his piece of jerky, his eyes also glued to the table. Out of his peripheral vision, he could see that you’d finished your portion already. He reached out, dropping his piece in front of you onto your napkin. “Need to eat more,” he grumbled. He picked up his glass of whiskey, polishing it off before pouring himself another. 

You couldn’t stand it.

You couldn’t fucking take it anymore.

“Joel.” You said his name in a smaller voice than what you had been aiming for. “Can we talk?”

He racked his brain for the first bullshit excuse he could think of. “It can wait. S’real late and we need to get to bed soon. We got early work orders tomorrow.”

“No, Joel, actually, it can’t fucking wait.” Your heart was pounding at a rate that felt far too fast for your body and you tried to remind yourself to remain calm. You knew you needed to keep your emotions in check, or else your distress could cause distress to the baby. “We need to talk. Now.”

Joel drew an impatient breath. “Talk ‘bout what, exactly?”

“About how you’ve been acting over the last few months.” Your voice trembled and you almost kicked yourself for it. The last thing that you needed to do was fucking crumble. “And about the way you’ve been treating me, too. You’ve been keeping your distance from me, acting like I’m some kind of—I’ve seen you cringe a lot less when dumping the infected bodies into the fire pits, let’s just put it that way.”

“Those pregnancy hormones,” he released a short, bitter laugh. “Got you bein’ all dramatic.”

“I am not being dramatic.” Your hands curled into tiny fists. “You won’t talk to me. You won’t touch me. You won’t even fucking look at me anymore! I’m sick of it, Joel.”

“It’s nothin’,” he replied dismissively, shrugging his shoulders. He looked down into his whiskey, feigning a sudden interest in the rich amber hues in his glass.

“Nothing?” You repeated, flabbergasted. “Then why haven’t you slept in our bed with me? Hm? Oh that’s right, because you can’t fucking stand to be that close to me! You’d rather break your back on that old fucking couch rather than sleep next to me.” 

Joel’s jaw clenched, his grip around his glass tightening. “Listen, I ain’t doin’ this right now, alright?”

“Joel.” You hesitated. If you crossed this line and pushed one too many of his buttons, there was no fucking going back. “I know that you’re afraid, okay?”

“I ain’t afraid,” he countered through gritted teeth. Finally, he brought himself to look up at you, his eyes meeting yours—that same emotion that he’d just denied was right there behind them as clear as the fucking stars in the sky outside. Joel wasn’t made of stone. He wasn’t any kind of special exception to having normal human feelings. He hid everything pretty well, and because you cared about him, you were willing to put up with his asshole façade because he needed you as much as you needed him. Still, even after years of trying to take the wall he’d built down brick by brick with your bare hands, you hadn’t gotten very far and you wished the man would help you out every now and again and throw you a fucking hammer. “Ain’t no reason for me to be afraid. I ain’t the one who’s fuckin’ pregnant.”

“It’s yours too! This is your baby too, Joel. Your child. It is part of you, just as much as it is a part of me. And ever since day fucking one, you have been scared shitless of it,” You confronted him, another trembling edge coming to your voice. “And I know why, okay? I know that what happened to Sarah—”

Joel froze, going rigid in his seat. His free hand had curled into a fist, his tight knuckles turning ghost white.

It was something of an unspoken rule. 

Nobody talked about Sarah.

Hell, the only reason you even knew about his daughter was because you’d accidentally stumbled upon an old polaroid of her while washing his jeans in the kitchen sink one morning. You had found it in one of the back pockets while cleaning them out, the photograph heavily creased as if he spent ample amounts of time folding it open and then folding it closed again. Sarah’s name had been scribbled on the back of the polaroid. Her smile, her nose, it was all Joel, and it had taken you less than sixty seconds to realize the young teenaged girl posing goofily in the picture had been his daughter.

When you’d handed the picture to him while his jeans dried, it was like a silent bomb had detonated. Although it’d been a mere accident on your part, Joel had been so incredibly angry with you, as if you had gone snooping through his past life on purpose. For weeks, he hadn’t said a single word to you unless it had something to do with work or a run.

He’d lost her. He hadn’t told you that, but you’d guessed it.

Whether it was to infection or something else, you didn’t know. And you knew better than to ask him. All you knew was that losing her had done something irreparable to Joel Miller. Whoever he’d been before losing his daughter was dead too.

“Don’t,” he warned, his voice strained. “Don’t you fucking dare.”

“Joel, please,” You whispered. “Whatever happened to her, you can’t possibly keep it to yourself for the rest of your life. You can talk to me about Sarah—”

Joel slammed his curled fist down onto the table, startling you. He then turned in his chair and flung his glass at the wall behind him, the sound of it shattering into hundreds of pieces echoing throughout the small apartment. Jumping to his feet, he pointed a threatening finger in your face. “Don’t you ever utter her fuckin’ name ever again! You understand me?”

“But Joel—”

“Do you fuckin’ understand me?”

“I understand.” You hardly recognized the squeak that left your lips.

“Go to bed. Now,” he ordered, whirling around on his heel. “It’s fuckin’ late.”

Without another word, Joel stalked over towards the couch and dropped onto it, rolling over onto his side so his back was to you.

You pulled the neckline of his shirt that you wore over your mouth and pressed your palm against it in an effort to muffle a sob.

A few hours later into the middle of the night, Joel had awakened and stood up from the couch only to find you sitting there in the exact same spot where he’d left you at the table. Though it was dark in the apartment, the moonlight that shone through the torn curtains over the window illuminated your face and he could see you hadn’t stopped crying since he’d fallen asleep.

“Y’need to go lay down,” he told you quietly.

You knew this tactic all too well.

His way of apologizing for losing his shit on you without actually apologizing.

“I’m fucking fine right where I am,” You snapped stubbornly in response, quickly dabbing at your damp eyes with the back of your hand. That was a downright lie. Your lower back was on fire from having sat in the chair for so long.

Joel sighed, hanging his head. He knew he’d fucked up. He’d been fucking up for the last several months. He pulled a chair around in front of yours and sat down, his knee touching yours lightly. That alone was enough to send a chill throughout your body. “Sittin’ in that chair for too long ain’t good for your back,” he stated. He waited to see if you would speak and when you didn’t reply a couple minutes later, he sighed again. “Look, I’m real sorry about earlier, alright? Hell, I’m sorry for everythin’. You were right, I’ve been treatin’ you like shit and you definitely don’t deserve it.”

Stunned, you looked up at him.

“I was angry, but I shouldn’t have lashed out on you the way that I did. Much less while you’re in this condition.” He paused, reaching up to rub his face tiredly with one of his hands. He then let it fall back down to his thigh with a loud slapping sound. “It’s a sore spot for me, alright? Always has been and always will be. Nothin’ or no one is goin’ to change that, not ever. Not even you,” he admitted, shoulders sagging as if the realization had just come to him. “You know you mean somethin’ special to me. You know I care about you, and you know you’re what has kept me goin’ these last few years. I’d do just about anythin’ for you. But I need you to respect that I don’t wanna talk about her and I don’t want you bringin’ her up. She is from my past and that is where I need to leave her.”

“But why?” You frowned, wiping a stray tear that had fallen away from your cheek. “That’s not fair to you or to her. She doesn’t deserve to be forgotten about.”

“That what you think it is? That I’m tryin’ to forget about her? Impossible. Not a single day goes by that I don’t think of her.”

You placed your hands down onto your lap and started wringing them together anxiously. “It’s not that I think you’re trying to forget about her, Joel. But you refusing to talk about her, it’s erasing her memory, whether you think of it that way or not.” Noticing him wince at your words, you wanted nothing more than to reach out and touch him—stroke his cheek, hold his hand. But you were finally getting somewhere and you knew better than to move too fast, so you willed yourself to keep your hands to yourself. “And besides that, you aren’t doing yourself any favors by keeping her story a secret. You’ve been carrying the weight of whatever happened to her on your shoulders for what, almost two decades now?”

“It’s my burden to carry, alright?”

“You shouldn’t have to carry it alone.” Your expression softened. It dawned on you. You’d thought you knew how much pain Joel had been in for all these years, but the honest truth was that you didn’t have the slightest clue. You didn’t know how bad he was actually hurting—and that killed you inside. “You need to talk about it, Joel. Maybe not today, maybe not tomorrow. But someday.”

“No. I can’t—”

“Don’t you trust me?”

Joel almost seemed offended that you’d even ask such a thing. “Of course I fuckin’ trust you.”

“Then why won’t you let me in, Joel?” A fresh batch of tears brimmed your eyes, and you blinked them back furiously before they could fall. “After everything that we’ve been through together. I’m carrying your fucking child for god’s sake.”

He didn’t answer. Tearing his gaze away from you, he looked straight ahead at the wall in front of him.

“Joel.”

Silence.

“Joel. Come on. Can you just fucking look at me, please?”

Nothing.

You let out a long, sad sigh of defeat. So much for getting somewhere. “Alright. Fine.” You placed a hand on your stomach and stood up from your chair. “I’m heading to bed. See you in the morning.”

As you padded over towards your mattress, Joel’s voice stopped you dead in your tracks. “Sarah was my daughter.”

Slowly, you turned around, your lips parted slightly.

“Pretty sure you knew that already though,” he chuckled in spite of himself. “She was fourteen years old. Her mom walked out on us when she was just a baby. I spent her entire life raising her by myself. Tommy, well, he was around too, but he was more of a bad influence than anythin’ and sometimes it felt like I was lookin’ after two kids instead of one.”

You walked back over to him, placing a gentle hand on his shoulder.

Joel reached up and took your hips in his hands, carefully pulling you down to sit on his lap.

“No Joel, I’m way too heavy.” Embarrassed, you quickly tried standing up.

“You think you’re heavy?” He snorted lightly, holding you firmly in place. “If anythin’, you could stand to have a bit more meat on your bones bein’ almost nine months pregnant and all.”

“Blame my nutritious, nourishing diet of jerky and stale crackers.” The sarcasm dripped from your tone. 

He let out something in between a snort and a laugh.

You couldn’t help but smile a little and draped an arm around his shoulders.

How you’d missed this. Missed him.

You leaned into him, resting your head in the crook of his neck. For the next several minutes, Joel just held you.

Just when you were beginning to wonder how long the silence would last, he broke it.

“I’m not ready to talk ‘bout what happened to her,” he explained, quietly. “Might not be ready for a long, long time. Not sure if I’ll ever be ready, if you want the honest truth. Sarah, she was my sweet little butterfly. The absolute love of my fuckin’ life. Losin’ her was the worst fuckin’ thing that has ever happened to me. It’s a wound that’s still raw as hell, even after all these years. Might even be one of those wounds that just never heals, you know?”

You lifted your head from his shoulder, your hand going to his hair. You ran your fingers through it, amazed how even after going days without a wash, it always stayed so soft. “I know you don’t want me to say that I’m sorry—”

“I really fuckin’ don’t,” Joel confirmed with a shake of his head. “Won’t change shit. Won’t bring her back. Sure as hell won’t make me feel any better.”

“Then I won’t say it.” You brought your hand back down to your lap and leaned forward. You pressed your lips against his forehead, letting them linger. He stiffened, and you could feel him restraining himself from completely melting into your touch. You knew things would take a little time and you were willing to be as patient as you needed to be for him.

“Losin’ another child—” Joel trailed off, voice hoarse. “I just—I can’t.”

“I know,” You soothed him. “Which is why we’re doing the right thing and letting Bill and Frank take him.”

“Him?”

You offered him a small, tired smile. It really was getting late now and the exhaustion was creeping in. “I haven’t had the chance to tell you. But I think it’s a boy.”

“And how the hell could you possibly fuckin’ know that?”

You shrugged. “Just a gut feeling. Tess thinks it’s a boy too. She says with the way I’m carrying, it must be—” You stopped, doubling over in pain. “Fuck. Ouch.”

Alarmed, Joel’s hand found the small of your back, the other was in front of you, making sure you didn’t fall over off of his lap. “What? What is it?”

“The baby just kicked me.” You grimaced, leaning back into a sitting position. “Right in damn the ribs too. And there goes another one.” You exhaled sharply, the discomfort radiating throughout your body. “Jesus. He must take after you with all the violence.”

Joel seemed a bit stunned. “This the first time it’s ever kicked?”

“No. He’s done it a few times before. But never this much in one sitting. Or this hard.” You winced. “He’s really fighting in there.”

Joel just stared at you, something that looked a bit like awe in his eyes.

Through the slight pain, you raised an eyebrow at him. “Do you want to feel him?”

“Oh I don’t think, uh, I don’t think I should—”

“It’s not going to fucking kill you, Joel.”

He hesitantly lifted his hand. “Where—where do I put it?”

“Here.” You took his hand in both of yours and placed it on the side of your round midsection. “Just give it a second. You’ll feel it right here.”

You watched his face carefully. He jumped slightly once he’d felt the fluttering motion against the palm of his hand, his dark eyes going wide.

Even before the outbreak, Joel never thought he’d feel something like that again in his life.

“He’s strong,” he murmured. “Real strong.”

“I know. Wonder where he got that from,” You joked lightly.

Moving his hand away, Joel placed it on your thighs and awkwardly cleared his throat. “It’s, uh, it’s pretty late. You really do need to get some sleep.”

“Okay. But on one condition.”

“What condition?”

“Will you come to bed with me?”

“‘Course.” He stood up, letting out a small, labored grunt as he lifted you up into his arms.

“I told you I’m heavy,” You reminded him with a laugh. “Joel, put me down. This cannot possibly be good for your back.”

“Oh, shut up.” Joel walked over, gingerly placing you down onto the mattress. He waited for you to get comfortable before climbing in behind you, pulling a wool blanket over both of your bodies. He pulled your back against his chest and draped his arm around you, his hand subconsciously—instinctively—resting on your stomach. His lips found the delicate spot behind your ear and he pressed his lips gently against it, sending a small shiver up your spine.

“Joel?”

“Hm?” He mumbled into your ear. He was already falling asleep.

They were right there, right on the tip of your tongue, those three words that you had been aching to say to him for years.

I love you.

“Nevermind.” You sighed softly. “Goodnight.” 

“Mm, g’night,” he murmured, nuzzling his nose into your neck before allowing his sleep to consume him.

[itwasntimethatdidit40]

You look like a fun place to sit.

Gif credits

Pairing: Neighbor!Frankie Morales x f!reader

Words count: 2667

Rating: + 18, MDNI

Summary: You decide to enjoy a night at the movies, your neighbor Frankie ruins it all. Or maybe not?

Tags: pov second person, no use of y/n, fluff, sort of romcom vibes (?), smut, enemies to lovers, age unspecified but they are both full grown adults, Frankie is annoying but also cute and lovely and fucking gorgeous, reader has hair, breasts and vagina, other than that no other description of her is given, fingering (f receiving), sexual acts in public places (again? Again. I'm not even particularly interested in doing that irl I don't know what to say to you, please forgive me), pet names (honey, baby, princess), arguing, kissing, no use of Spanish because I terribly suck at it and I don't want to butcher another language LOL. If by chance I realize I forgot something I'll add it right away.

It’s my first Frankie ff and I’m so incredibly nervous to post it you all! I really hope it doesn’t sucks because I had so much fun writing it today in one sitting ‘cause I’m just an impulsive impatient mess. (Leo sun and Aries moon, what do you expect from me if not chaos? I had nothing a few hours ago, I even skipped WIP Wednesday and btw thanks for the tag @almostempty 🩷)

Title comes from a gif of Karen Walker from Will and Grace that I saw last night, it made me laugh a lot and this thing was born LOL

As usual, English is not my first language so please be gentle, no beta and no proofreading, it’s tiny and it’s all my fault, I’m sorry 💀 Thanks to anyone who will read this!

“Excuse me, you should stand up, that’s my seat” 

Frankie turns, looking at you with a surprised expression “I don’t think so, you’re wrong” he replies. 

Ugh, your neighbor.

Frankie lives two houses away from you. Last winter you had a fight at a neighborhood meeting because you pointed out that he keeps forgetting to put the recycling bins back in, and he told you to mind your own business and called you an hysterical witch.

A stupid fight that ended up with you not saying hello to each other and various other arguments about your flashy Christmas lights or his overgrown yard. You and Frankie fight constantly, about everything. And now he's here.

You glare at him “I’m not wrong at all, look” and you wave your ticket under his nose “P10, see? It’s my seat and you’re rude”. 

A grin spreads across his face “listen, honey, I don’t know where you got this ticket, you probably made it yourself, I bought it a moment ago and it’s the same seat” 

He takes a card out of his pocket and hands it to you, remaining comfortably seated with a large popcorn box. 

You look at the ticket, him again, the ticket again “how the hell is that possible?! I booked it on their website a week ago” 

He sneers “I told you! It must be a system error, I don’t know, I’m not getting up from here”

You are furious. The theater is filling up and you absolutely don’t want to leave, you have been waiting for this movie for months and you have inspected the theater map choosing a seat that would guarantee you the very best view.

“I bought it first, so I have more right to be here than you do,” you say firmly and Frankie laughs. 

“Where are we, elementary school? Listen, honey, go buy yourself another ticket and leave me alone.” He replies crunching on popcorn.

The way he calls you “honey” irritates you deeply, it sounds like an insult.

“I’m not going anywhere, YOU get the fuck out of here” you hiss. 

“No” he simply replies and then he turns back at the screen pretending you’re not there. 

“Truly a gentleman, as usual. I have no words.” you roll your eyes and search for an usher to ask for help. No one is there. 

The movie starts in 5 minutes and you don’t want to miss anything you paid for. If you went to the box office right now to complain it would take forever to get back in. 

“Fuck” you exclaim and sit down next to him huffing. You are sure that someone will make you get up very early and it pisses you off.

Frankie continues to nibble on his popcorn and looks at you with an extremely amused expression, it seems like the show has become you.

“Why do you care so much about this movie anyway?” he asks you. “Does any of your relatives happen to be in it?“ 

You’re fuming. 

His teasing tone, his vaguely Spanish accent, his smirk, the sound of him chewing, everything bothers you.

“No. Shut the fuck up” you tell him with a death stare. 

You won’t tell him that your favorite actor stars in it, that you have every photo from the set of this movie saved on your phone, that you’ve read every article about it, and that you couldn’t wait to enjoy it on the first day of screening.

You can already hear his raucous laughter. No, you would never tell Frankie anything like that.

“You're not one of that guy's crazy fans, are you?” 

“What guy?” you ask him, pretending not to know what he's talking about. “Gladiator is one of my favorite movies, that's all. I just wanted to watch the sequel in peace. Someone is stopping me, though” 

“That guy, I bet you like him, what’s his name? Paul Pascal?” he stares at you searching for every little involuntary movement on your face that might give you away. 

“Oh for God’s sake, what are you doing here anyway? Do you even know what you're about to see? They are Paul Mescal and Pedro Pascal, two different people, you uncultered swine.” You yell. This guy is impossible.

“Yeah, whatever, so which one do you fancy?”

“Fucking nobody” you lie “I just want to watch a movie after a horrible week at work, okay?” You try to play on his guilt. If he has one, you think.

“Well, I've had a rough week too, okay?” he shrugs without stopping to give you that annoying little smile. “And it's not my fault that this theater is having problems with its computer system.”

You glance at him, wondering if he's telling the truth, it's impossible to guess from his face.

People keep sitting in the front rows and you start hoping that luck will be on your side and that no one will make you get up.

“Okay, look, now we're going to watch this movie and then we'll go our separate ways, please don't bother me anymore"

“As you wish, princess” he replies ironically.

You don't even answer him, you're too busy checking that no other people come in.

Finally the opening credits start to roll and the doors close with a dull thud.

You made it, despite this unbearable guy, you feel victorious.

You begin to relax in your chair and you don't know why you turn to look at him, lingering on his face for the first time in months.

His eyes are fixed on the screen. In the dim light you observe his raven curly hair tucked under his baseball cap, his dark eyes, the line of his prominent nose, his scruffy beard, his mustache, just above a pair of lips that seem made for kissing.

Really, truly, gorgeous.

You're so busy arguing with him all the time that you never realized how handsome he is.

He's wearing a grey t-shirt and a pair of jeans, you can’t help but admire the way the fabrics hug his body so deliciously. 

He’s just your type, built up in all the right ways, you find yourself unable to take your eyes off him until the last second. Then the movie starts and you look away.

He’s still your number one enemy, what the hell were you thinking?

When Pedro first appears, you shift in your seat, crossing your legs.

“FUCK” you scream internally “here we go”

Unbelievably stunning in his armor, you’re basically drooling. 

You try to stay as composed as possible but Frankie is next to you and notices.

He comes closer to you and whispers in your ear “So it was all about this guy… the fuss before” You feel one of his large hand brushing your arm that is resting on the armchair and you try with all your strength to remain still even if he causes a storm inside you and especially in your panties. 

“Shut. Up.” You hiss, without moving your gaze. You feel his breath on your skin and it’s intoxicating. 

He chuckles “Yeah, that was I was thinking” and throws another popcorn into his mouth.

Your cheeks burn and you're thankful you're in the cinema, in the dark.

“What’s so special about this guy?” Frankie approaches again “is his penis platinum by any chance? All my female colleagues at work are crazy about him”

You turn to look at him with the desire to slap him “Shut. The. Fuck. Up.” 

“Okay, okay, I was just asking”

You hate people talking at the movies. You wonder if you could have a more annoying guy than Frankie next to you. Probably. 

Hotter? Probably not.

This dude hits on your last nerve but he makes you horny at the same time. 

Terrible combination. 

Frankie settles back into his seat and resumes watching the film.

You can't help but look at him from time to time and your desire grows. even if you're offended that he didn't even offer you his popcorn. Rude. 

His mouth pouted and his eyebrows furrowed as he seems all focused on the movie makes you want to cup his face and kiss him.

You can still feel the warmth of his hand on your arm and his breath on your neck.

Concentrate, you tell yourself, it's the neighbor you hate, the neighbor you hate, the neighbor you hate. Fuck. You want him so bad. This revelation drives you crazier than Pedro half naked on screen.

At a particularly bloody scene you involuntarily turn around and hide your face on his shoulder.

You feel his arm around you “hey, it’s okay. I’ll tell you when it’s over” and he holds you tight the whole time.

He smells clean and fresh, like citrus and sage with a light hint of cigarette that you assume he smoked right before entering. 

Your mind goes fuzzy and your pulse races at an impossibly high rate. 

“You can look now” and it takes you a few seconds too long to register his words. 

“Th-Thanks” you mutter, shifting back to your place. 

Halfway through the movie the lights come back on and Frankie bursts out laughing looking at you. “What?” you ask him with wide eyes “what is it that makes you laugh so much?”

“Your face” he grins “it's clearly painted on it how much you want that guy. He turns you on, huh?”

You roll your eyes “Oh my God! Can't you go sit somewhere else? Two rows down, look how many free seats there are”

“I like it better here” 

You cuss, there’s no way to get rid of him.

He has something magnetic that destabilizes you, your eyes fall involuntarily on his neck, slide along his broad chest and stop at the crotch of his pants. From the way he sits you can clearly see that he is quite big.

“What are you looking at?” he asks you amusedly. 

You immediately look up. “Nothing” 

“Nothing my ass. Did you like what you saw?” 

Fuck. He noticed. You're done for. You hate to make him understand that after all, yes, you like what you saw. He seems pleased, proud, you would so much like to wipe that little smile off his face. As much as you struggle to admit it to yourself, you like him.

“Well, maybe…after all, you look like a fun place to sit” 

You can't believe you actually said that.

Frankie's response is not long in coming, his eyes immediately darken and his smile twists in a mischievous way.

The lights go out again and you feel him tug gently on your arm “come here, pretty”

He sits you down on his lap and as the movie starts again he whispers “was that what you wanted the whole time? Were you offended that I didn’t invite you?” you can clearly feel his smile spread across your skin just before he places his lips on your neck.

You would like to say something back but his closeness makes you confused and excited.

He sucks your skin like he's hungry and you moan in the dark "shh baby you gotta stay quiet while I give you what you want”

You don't know how but you find the strength to reply, "God, you're so arrogant.”

He tightens his hands on your hips, pulling you towards him, now you are practically sitting on his cock. You feel it pressing against your ass, trapped in his pants.

A rush of pleasure wets your pussy and you bite your lips to hold back another moan, you hear his hoarse voice in your ear “Maybe. You like it though” You hate to admit that he is right. 

The heat of his body envelops you pleasantly, he raises a hand to one of your breasts and squeezes it over your shirt. You like his hands. They are big, expert and eager to touch you, they make your head spin. 

You completely forgot about the movie, which seemed impossible to you, if they had told you you would have laughed in their face. In no universe would you have expected this.

“God” you whine “oh my God” His hand slides under your shirt and reveals your breast pulling down your bra, it is still covered but now you can feel his skin against yours. His fingers gently grasp one of your nipples, pulling and twisting it.

“Open your eyes, baby. Watch the movie like a good girl” his voice sounds authoritative, it irritates you and another rush of pleasure floods you at the same time.

“It’s not that easy” you mutter between your teeth as you feel his other hand dangerously approaching the hem of your skirt. He slowly goes up, as you try to hold back and make sure no one notices what he’s doing to you. Luckily, everyone seems enthralled by the film.

At this moment you don't even know why you started arguing so fiercely, if you had known before you would have tried to smooth things over a long time ago.

His fingers reach your panties, you feel them barely touching you and you already feel yourself burning with anticipation.

They move under your skirt, pushing your panties aside, grazing at your outer lips and then dipping inside you “Fuck, you’re soaking” 

He moves them up and down between your folds, gathering your wetness towards your clit.

You feel his heavy breathing on your neck, his tongue running over your skin and his teeth nibbling on you.

“Fuck, Frankie” you cry 

“Eyes to the movie”

You want to turn around and straddle him but there isn't enough room and Frankie holds you firmly anyway.

He applies pressure on your clit just right, starting to move two of his thick fingers in circle over it, the motion of his hand is partially hidden by the fabric of your skirt and your moans die in your throat one after the other. Frankie is rubbing away your sanity, you feel possessed and delirious under his touch.

Your last shred of control is torn by his fingers entering inside you, claiming your cunt as his, curling and scratching at your spongy spot.

Your eyes are still fixed on the screen but your vision is totally blurred, you see nothing, you understand nothing, you only feel Frankie pumping incessantly inside you while continuing to rub your clit with his thumb.

You feel the soft reverberation of his voice behind you, close to your ear “good girl, you're taking me so well”

The subtle Spanish accent in his voice now seems to you the most erotic sound in the world, sweet, melodious, addictive.

He takes you to the edge, you throw your head on his shoulder, shutting your eyes so everything goes black and you only feel him, until even biting your lips doesn't help anymore. He covers your mouth with his hand as you explode in a devastating orgasm, you moan against his skin, between his thick fingers that have just left your breast and you already miss them, feeling full and satiated by him.

He uncovers your mouth and kisses your neck, pressing his hand to your hip to keep you from slipping off his lap as your body trembles against his.

“Shit” you mutter “Frankie…oh my god”

“Do you think we can stop arguing all the time now?” He playfully says as he nuzzles at your hair.

“I don’t like being told what to do unless I’m naked, you know, I’m just like that” you reply, grinning and turning around to finally fix your eyes on his. 

“I noticed it”

You take off his cap laughing and put it on backwards and before he starts to protest you kiss him deeply, licking into his mouth, tasting butter and salt on his tongue.

“Take me home”

“The movie isn't over yet,” Frankie observes, and you reply, “that means you'll have to take me to see it again and you’ll pay”

“Fine to me, princess” 

[yuyu1024]

Fate

Pairings: Yoongi × y/n

Genre/tags: Arranged marriage

Warning: 🔞🔞🔞 mention of blood/violence/drugs/trafficing, trauma, mention of killing, kidnapping, gun, mention of food/eating/weight, cursing, sensual touching, making out smoking, smut (but not this chapter)

~~~~[lmk if i miss anything]

Words: 5.2k

Disclaimer:

- this story is just made up

- english is not my first language, please be nice 😊

Note:

Until you (mini series)

Part 1 - Prisoner

Part 2 - Escape

Part 3 - Twilight

Part 4 - Fate

A/N: again... im really sorry for being a slow writer/update for this mini series🙏🏻 i can't help it. 😭 I do get msgs asking for updates & i feel bad... so sorry 🥹 I try my best to have time to get into the story/characters whenever i have free time. I work full time and have a 2nd job too so it takes all my energy. I'm really... really sorry.😭

But yeaah, thank you for everyone liking my yoongi fanfic. 🖤🫶🏻 thank you for the patience😭

I hope this chapter is okay ♥️

****

(Prologue/Flashback)

"Sshh..." she covers your mouth for you to stay quiet and not make any noise. She reminds you constantly to keep it together or else they will find you. "Just a little bit more, Yoongi." She whispers. "Calm down..."

You try your best to do what she says because you want you guys to survive this. To escape. However you are a kid and you are terrified. And you can't stop yourself from shaking like a twig. Also you are rapidly breathing through your nose. Tears even start to fill your eyes as you look into her eyes.

"You'll be fine..." she says to you. "Noona, will protect you."

"I'm scared..." You whisper grabbing onto her long braided hair.

You two are a few inches apart. If she could only embrace you, she will. However there are metal bars between you two and she is.... injured.

"Me too." She wants to cry to as she must be as scared as you or maybe, more. But since she's the eldest between the two of you she have to be brave for you. "Just go to sleep... I promise... the moment you wake up...when the sun is shining after the storm tonight... we'll be safe... we'll already be at home..."

"P-promise?"

She tries her best to not break down because she knows that she's promising something that's very unrealistic in your situation right now. Both of you are held captives, kidnapped and waiting to be saved.

"I promise." She sniffs "Just hold onto this for now..." she meant her hair and then reaches her hand to you slowly even it's causing too much pain for her. "Go to sleep... Noona will be right here..." the tip of her fingers barely touched your cheek. "I will protect you..." she adds

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

[Present]

The silence between you two is very deafening. Even the staffs at the mansion notices how both of you are very distant to each other.

Odd right? They should be used to this situation since Yoongi is the silent type or the one who does not talk that much especially to you.

However for you, maybe this is out of character as every one is not used to you being like this. Well THIS silent anyway.

You usually talk and greet them or make small talks with them or Yoongi even if it's just a random question to make him just...talk. You do anything to make him speak to you. You make small efforts to chase his attention just to get him look back at you per say. Like a dog.

But now, since he made sure to leave you the moment you got vulnerable with him during sex and mentioned a feeling you have, which in the first place you had no idea you have, really hurt you this time. Big time. It is a rejection that you never thought would bother you this much.

"You two are awfully quiet." Mrs. Min says as soon as she puts down her cup of coffee on the table. "You two are both quiet originally... I know... but..." she looks at you and Yoongi back and forth twice. "Did you guys had a fight?"

No one answers.

"Guessing...silence means yes?" Mrs. Min looks at us again, hoping someone will speak up. "What did you do?" She asks Yoongi.

But he didn't open his mouth to speak. He just continued on chewing on his breakfast while his eyes are glued to you.

He has been eyeing you since the two of you left the mansion. He have been silently watching you move along, react and walk from your back. You don't notice it as you are trying to achieve to ignore him completely today. And so far, you are a gold medalist at it. You don't even bat an eye on him.

"Fine... not gonna ask anymore questions..." Mrs. Min gives up. "Anyways, after this lunch... I'll have a meeting with Hannah."

Yoongi flinches, finally reacting and gets interested to whatever his mother is saying. "What for?"

"About the private resort project that she is building... she wants my opinion about what brands to use for the decorations. She have a final lists of candidates of brands and she wants to know my say to it."

"Really...."

"Yes... and as soon as it opens... she says you two can go there... and celebrate... as her gift. Since she missed going to your wedding."

"Celebrate?" You finally spoke after how many years. Even Yoongi whip his head to look at you.

"Yes dear," Mrs. Min smiles so brightly and holds your hand. "You're 2nd anniversary... next month... right?"

"Ah, yes... right." You try to smile it away. But deep inside, you are not looking forward to it.

Why would you? Last year Yoongi didn't even greeted you Happy Anniversary. He probably didn't care back then so why would he care now and celebrate this year? This marriage is nothing to him.

"Is she coming here?" Yoongi asks his mother, changing back the subject to Hannah

"No... I am meeting her at her office."

You are holding on for dear life on your gold medal for 'Ignoring my husband award'. You are so curious to look at him. To see his beautiful face, how he reacts when they talk about her. Hannah. The girl you saw more than a year ago. The girl you saw on the driveway, talking to your husband while she hooked her arms on his'. The girl that Yoongi seems interested about. The girl he seems to.... like.

"How about you guys? What are your plans today after our brunch?" Mrs. Min asks

"Hmm.." he sighs heavily and then takes his phone from the table. "Probably fuck my wife " Yoongi answers nonchalantly making you and Mrs. Min almost choke on nothing. That sentence made you even look at him with wide eyes and red cheeks.

"Omo..." Mrs. Min is too stunned to even comprehend what she just heard. "Well... okay... too much information but..." she then takes a sip of her coffee. "You do you."

"I'm sorry..." you apologize to your mother-in-law.

You are embarassed. This topic should be a private matter. Everyone in the mansion already seem to have the idea what you two do on a regular basis but you do hope that outside, no one has to know.

It's not that you are embarassed of having a sex life. It's normal. Yes. But to have to talk about it to his parents, oh dear god, no.

"Why are you apologizing?" Yoongi's face looks so damn serious. "We are husband and wife right?"

You scowl at Him. You don't like how he acts or portrays like sex is just a hobby for him and it's nothing to be embarassed about. Especially in front of his mother while you are present. He really does not treat you like you have any feelings. He is evil.

"Okay... children...children... don't fight about this... it's okay. You already have issues before we got here so... it's fine." Mrs. Min tries to sooth the situation up.

She's so nice to try. Though she does not know the real reason why there is a huge distance between you two today. It's not that simple. You don't even know if she knows how his son treats you.

***

"Sir." Mr. Kim bows as both Yoongi and you arrives at the driveway, about to leave Mrs. Min's property.

"Get in." He orders you

You glare at him then roll your eyes away. You are in no mood now. You have scowled at him earlier already so why not do it more now that he is irritating you.

"Hold on..." he suddenly grabs you by the arm, stopping you from getting in the car. "Did you just fucking roll your eyes at me?" He scoffs

You try your best to pull your arms from his grip but he is stronger than you. "Let me go." You grunt

"What are you doing?" He asks, "You've been.... acting up lately..."

"I don't know...what you're talking about..." you finally freed yourself from his grip.

"Don't act innocent on me... I know you."

"Know me?" You snap. "How? We barely talked these past two years... You only look for me when you want something done and someone to fuck...besides that, I am nothing to you. So how the fuck will you know me?"

Finally! You've said something. However you can't lie to yourself how terrified you are right now. Your legs are shaking. You have never risen your voice like this before. Not with him. Plus Yoongi is so freaking silent. There was no reaction from him not like Mr. Kim who just coughed because of the sudden tension.

Is he in shock? He must be surprised to hear you speak out after all this time. He had never heard you talk like this before. You can't even read his expression. He is just looking down at you, straight on.

"Ahm... Sir... Miss... I'll leave you two... alone." Mr. Kim finally broke the awkward silence. "Just message me if... we're going home."

You glance at him and bow. Also giving an apologetic look since the situation got a bit serious.

And as soon as Mr. Kim is gone from our sight, Yoongi takes a step forward closer to you, making you back up and your behind bumping on the car. "Is that... what you think?"

You glare up at him. "Yes."

"You think... I don't know you?"

"Yes."

He chuckles. "I know you more than you know..."

You frown. "You only see me when you are horny... you don't even talk to me unless to I ask you... unless you tell me what to do and what not to do... so, how would you know anything about me...?"

He scrunches his face. He looks irritated "I see you more than you think." He mumbles. And then he took a step back and looks at you and watch you tremble,"Do you regret it?" He asks

"W-what? Regret what?"

"The sex... do you regret it?"

"W-what? What do you mean...?"

He then puts both his hands on the car, trapping you between. "Just answer the question... do you hate and regret the sex?"

You look away. "No...."

"Do you want us to stop fucking?"

You sigh heavily. "Why are you focusing on the sex?!?" Your brows are furrowed. You are really showing your frustration. "It's not about the sex, Yoongi! There is nothing wrong with the sex... what I just want is... I just..." you look back at his face and you see an empty expression from him. Does he not get what you are saying or is he ignoring the other parts of what you told him. That the only thing he thinks about is your sex life. "Never mind..." you lower your gaze. "It's not like my opinion matter..."

"Y/N..." Yoongi begins. You look back st him waiting for whatever he's about to say. You think he was about to response to you or maybe say what is on his mind as well. (Maybe.) However, both of you got suddenly distracted by the honk of a black sedan car entering the property.

You have seen that car before. It is familiar. And then when it stops and someone steps out of the car...

"Yoongi?" The woman that came out of the passenger seat, is Hannah. "What are you doing here?"

She is smiling ear to ear. Her smile is as bright as her tear drop pear earrings that is perfectly shown under her tucked bob hair. She's... so pretty.

"Oh... Hi..." she waves at you when she finally notices you

"Hi." You try to smile as brightly as you can.

"You must be Yoongi's beautiful wife." She is sweet. She looks like a friendly and easy going person. "I'm Hannah by the way... I'm Yoongi's friend since we're... toddlers..."

"Nice to meet you." You bow

"What are you doing here? Mother said..."

"Ah... yes... we we're supposed to meet at my office but I just came from another meeting and since we will pass by the house I decided to just meet her now..." she explains

"She must be in her room now.. preparing to meet you."

"Oh. I see... well, I guess I'll just surprise her." She grins. "Are you guys leaving?"

"Yeah... we just had brunch with her..."

Fuck. What is going on?

Just a second ago, you're having a serious confrontation with your husband. You guys are about to talk about the situation between you two. Yes, it may not be the ideal 'talk' but it is a start. But then, here you are. Hannah arrived and stole his full attention. Literally, she have all his eyes and ears. You suddenly became a shadow.

Then you are also hearing Yoongi converse. You are hearing how is he when he's not alone with you. You are hearing a side of him that you are not familiar with. 'Fuck Y/N, stop it.' You say yourself

Maybe, you just need to stop. Just stop complaining about his attention and him not liking you. Maybe he is not the problem. Maybe.. it's you? They forced him to marry and got stucked with you. YOU are the problem. You are NOT the person he wanted to marry. You just got selected just because.

You are the problem. As always. Like what everybody says to you.

"I'll just email you my thoughts after..." Hannah says

"Why not discuss it now?" Yoongi suggests

"Hmm...but you're about to leave..." she glances at you

"It's okay." Yoongi then pulls out his phone and messages someone. "I asked Mr. Kim to come... wait for him... I'll be quick." He says to you

You look at him for a second before you turn your back on him. "Sure." You sound lifeless. You sounded like you've given up already.

"Y-yoongi... you're going to make her wait?" She whispers to him but you care definitely hear it

"Let's make it quick. I don't want to work over the weekend."

He's more worried of working on the weekend but not making you stay and wait all alone.

They start to walk away. You could see their reflection through the windows of the car.

They left you alone.

He left you alone.

Then as you are standing there, waiting for Mr. Kim to come back, you slightly bend over your torso, holding onto the yourself as soon as you felt a little uncomfortable feeling on your lower abdomen. It's not painful but it is a bit of discomfort.

"Fuck..." you hiss under your breathe.

You should be careful now. Atleast until it's fully confirmed. Yes, you are pregnant. Well, that's what the PT told you a few days ago.

You took the test, in your bathroom, scared and shaking like a twig. You have never felt this terrified in your life. Ever. And the freaking 3mins of waiting felt like forever whilst you are in there, sitting on the floor.

But yeah, after the torture of waiting, the test did show two lines. It was a faint but it is positive. And during that moment, your world suddenly stopped spinning. You had to gather your thoughts and emotion within the span of 30mins that you have. (Because your maid will enter your bathroom to help you get ready after 30mins). That was one other toture you had to endure. And to add more spice on this never ending problem is that you were all ALONE. You had no one to hold hands or hug for moral support.

You are, all by yourself.

After testing, you did processed the result in your mind and managed to get back right to reality and decide by yourself to be... okay. To take it as another good day. Because this is not something bad. It is a miracle. It's a life.

Though, you can't lie. It was a whirlwind of emotion. And you don't know what to feel yet about it. You are not even sure if you are able to share it with anyone, even Yoongi since you still need to see a doctor to really confirm it.

Confirmation.

You fucking need that final 'yes you are pregnant'. Because your further decisions in life will revovle around that one thing. Decisions that might affect this marriage and basically affect your whole life. So, you really have to find a way to get a doctor's appointment in secret. For now...

"Miss?" Mr. Kim arrives and sees you slouching, "Is everything alright?"

You turn around, stands up straight and smile. "Yes..."

"Are you hurt?" He asks

"I'm fine... but I just think... my stomach feels heavy a bit from eating... I did ate quite a bit." You lie.

"Okay, let me bring you home quick so you could rest." He says

"Thank you."

****

[Yoongi's side]

Yoongi can't sleep. He got home earlier just an hour after Y/N got home. He asked the maids to call her, to have dinner with him, but unfortunately Y/N was already fast asleep.

He waited for her to wake up from what he thinks is just a quick nap. But whenever he asks the maid if she's up, they just shake their head and say sorry.

They fought. He thinks. It felt like they fought. It's his first time hearing her talk to him like that. She have been always timid and her patience with him is very long. However, she finally have had it.

How can you make your wife, who is clearly showing you that she's falling in love with you, start to hate you?

Well, Yoongi knows what he did and is doing to her. He is very controlling, cold and distant. And these are the traits that can't be part of your life especially of you are married. However, this is how he is. As a child no, but ever since the incident happen fifteen years ago, the trauma and the life he had to put through made him, This.

Outsiders might call him as the devil or the punisher of the Min Family because of all the work he is doing inside the office and outside. He is a fighter and his hands are always covered with blood. Though what he's doing is not a crime. The Min's business is not illegal. They control everything that they can do end everything that is illegal in the most legal way possible. If that makes sense.

They were just a business before. A typical rich family. But yeah, since what had happened to them years ago, they changed their rules and how they do it now.

And that's why Yoongi have this cold exterior. He needs to show to everyone who's watching him that he can't falter. That no one could try to even break him like how those monsters break his father. How those monster took them and made them hostages.

10 million. That's all it takes, for some uneducated humans do the most horrendous thing in this world. To hurt and kill an innocent child. A 16yrs old girl and a 14yr old boy.

Their parents were willing to give the money and even more, just for them to surrender their children. However, the fear in them when they know that the children saw their faces, made them decide to end it all.

Yuna, his older sister, sacrificed her life to save Yoongi. She is one brave young lady. She managed to push his brother just in time to fall on the edge, to roll down small hill and get away through the woods. She got shot and died on the spot. Yoongi saw everything but didn't had the time to grieve then and there because he had to survive yet. To run.

It took two more days before he was found. How he survived? No one knows. But since that day, the happy and cheerful little boy grew up and became the cold Yoongi everyone knows now.

He knows that what he have been through is not an excuse to treat his wife so coldy like this. She was only forced the marry him. She didn't even know him. Which is his fault as well because he didn't allow her to enter his bubble. Up to now...

However, through all the times that he have been with her little by little, as per his therapist's words, 'You are slowly breaking.' She said.

She said that before, whenever she asks him about his wife. He is usually nonchalant or indifferent. Like he's just talking about someone he randomly met. But then one day, the therapists said, she saw a glimpse of change in his eyes the moment she asks about his wife. His expression is the same but his eyes started to shift like he's thinking about it more before he speaks.

'You care. You just don't know how to show it' she said to him.

At first, When Yoongi heard that from his therapist, he got worried. Not because He is starting to have this feeling for his wife. No. His wife is never and will never be a bad thing that happened to his life. He is worried because, what if he breaks his cold exterious and somewhere out there in the world takes advantage of it and what happened years ago will happen again?

That is his only concern. That is why, he added more men. That's why Y/N can't leavr a house alone. That's why he always tracks her phone wherever she is. That's why he can't sleep without know if she is fine or not.

If only... he never had these issues, these traumas from the past, maybe... it's easier.

"Please... don't quit on me..." he says out loud as he closes his eyes, imagining the smiling face of his wife. "Don't... leave me..." he mutters

****

After what it seems like a very, very long day for you you're finally home. You are so tired that the first thing you did after getting changed is sleep. It feels like this is the longest you've slept in like forever.

You keep turning and waking up every now and then but your body kept forcing you to not wake up. It's like its telling you that you needed this. After all of the worrying you have been having these past few days. This sleep is for you.

But then maybe after hour five of sleeping, you felt something cold touch your skin. It didn't sting. It oddly felt good.

Slowly opening your eyes, you see a blurred figure in front of you. He's so close that you could actually smell his scent. The smell of baby powder.

"Yoongi?" You ask softly as your eyes slowly adjusted to the little light of your lamp shade. But no one answered back. You then rub your eyes to wake yourself up a bit more. Just to be surez you saw what you saw.

No one. There's no one there.

"Did I... just dream about him?" You ask, looking at the ceiling. "But I swear..." you trail off. "How funny... even in my dream... I see him..."

But you swear you smelled his scent. Your imagination of him is getting stronger. Your memory of him is getting move vivid. Even the smell now. That's how longing you are of him.

You miss him. Even though he is there  you miss him. Oddly, you miss the time that both of you are just sitting down together in his home office and just reading. You miss casually asking him questions. You miss hearing him talk even though he's talking about his work and not to you. You miss him even though you just saw him earlier. Even though... he hurt you.

His scent. The scent you really, really like. His smell whenever you two have sex. It's not strong but it's there. Whenever you close your eyes and drift away from the high, you know you are okay as long as you could smell and hear him.

Fuck. Is this how being in love is?

Just thinking about him makes you want to cry. You are frustrated at him but at the same time frustrated to yourself as well. Why is communicating is so hard? You know that's the issue. Both of you are not good with talking nor expressing yourselves. Well, that's what Taehyun told you earlier.

Yeah, you went on a side trip earlier before going home, to meet your friend at his work. You needed someone to talk to and you know Taehyung is always there ready to listen to you.

You poured your heart out earlier, crying and all. You were sorry for disturbing him at work but you needed that cry and that hug. You had to told him your feelings about Yoongi. You have to say it out loud for you to truely understand the situation and yourself.

You needed someone's opinion to point out the obvious so it could stick in to your brain.

Growing up to a family where your opinion does not matter took a toll on you as well. Especially to an adoptive family. A family that only needed you for money.

To them, you always feel left out and does not deserve a voice. They always tell you that they only gave you a roof above your head and food to eat because you are what they needed. A piggy bank.

Your parents died in an accident years ago, when you are just 12yrs old. There was a police chase in the highway that rainy day. Every one is on high alert and giving way. But well, the criminals weren't exactly running away and trying to avoid cars. They hit quite a few vehicles during the chase and one of them was your parent's. The crash caused an explosion, killing them in an instant.

And like any drama stories on TV, yout aunt took you in because of your parent's insurance. They are not big but it is a decent amount. However, they could not actually touch it since it is saved for your education that's why the first month of you staying with them was torture. They beat you, make you work and starve you from time to time because they said, 'you don't deserve to eat unless you work for it'.

One reason why starving yourself was easy for you when you need to.

But then things changed a bit when someone knocked on the door one day and gave your adoptive parents a good amount of money. You remember the man saying 'this is for the trouble and lost we caused your family during our battle for saving our children.' You do remember you aunt, being a good actress that day, crying and all. You even saw them be in a good mood. Everyday because of that money. So since then, whenever you have a part time job or one good seasonal job, you save up and give it to them.

You do this not because you want them to be happy. You do this because you wanted peace for yourself. They will not hurt you if you give them what they need.

This is one reason too why you accepted this marriage. Even though, you know you will have trials too. But atleast you know, no one is going to hurt you physically anymore.

Though, you are having troubles now too.... it is still different. Like you said, it is the communication.

Is it all Yoongi's fault? No. Taehyung said that maybe, since I'm very submissive and him being very dominant, grew up giving orders or not listening to anyone because he is who he is, it affected the talking part in the relationship. Though he cannot say that it is a hundred percent fact. Because he explain, everyone have different stories of growing up and these affects every facet of their whole being when they get old.

Well, that's what you got from all his talk. Half of it, you are numb from all the crying and can't hear properly.

Though that talk with Taehyung,you needed that. Now all you have to do is talk to Yoongi.

If.... you have the courage too.

It is so hard to start a conversation not knowing how he feels about you. It is scary and a risk. But you are hoping it will turn out good especially now that you are expecting.

"Oh, right! The result!" You got up immediately and grab your phone.

You visited Taehyung in the hospital and he got to help you get a blood test to confirm. You forgot to talk to him about the result because you two are busy with doing friend therapy. He said, he'll just email you the result.

But then as you were scrolling scrolling through your emails your stomach growls. "I'm hungry..." you mumble and pause. "Taehyung said that if I am really pregnant... I need to eat properly now..."

And you haven't eaten dinner since you just slept since you came home. You need to eat.

Looking at the time it's pass 10pm already. Everyone must be asleep now or getting to bed so you must go and make yourself food yourself.

"Just one toast." You say as you push your blanket away. "Or two..."

You walk along the hallways as quietly as you can and then take the stairs instead of the elevator, going to the upper ground, so you could not disturb anyone.

There is still minimal light coming from the kitchen area. 'Maybe someone is still there?' You thought to yourself and hoping it is one of the maids so they could help you grab the things in the pantry. Since you don't really know how they organize it.

But then the second you turn to the corner, to enter the doorway

"Ah!" You hit your head first at something. Or at someone

Then after collecting yourself from bumping on someone, you look up to see who it was. "Sorry, I wasn't looking at--"

Fuck! It's not Yoongi nor anyone of the staff.

You tried to run back and scream but it was too late. He was quick to cover your mouth with a cloth. A scented cloth. The smell quickly pierced your nostrils and immediately made you feel dizzy and sleepy.

You are barely awake but you know he carried you over his shoulder. You could see the floor and the lights slowly to flicker. You are about to loose it.

'Help... Someone.... Yoongi... please...' You say to yourself before totally loosing consciousness.

-----

Taglist based on the replies last post 🖤

@gaby-93   @goodbyetwenty   @baechugff

@amyz78   @qeen123   @armystay89   @bangtannie7 @daisies-and-dandelionpuffs @corruptedmistress @ot72025 @cheezwiz

@xkh0  @eli-deville

[ponderingmoonlight]

How JJK men act in and after a fight part ll

Part l with Gojo, Megumi and Nanami here

Pairing: Geto x reader, Choso x reader, bonus: Yuji x reader

Word Count: 3k

Warnings: my lil baby Yuji simply can't start a fight so it's more like a fluff fan service for y'all, Choso and Geto being a little mean, not proofread

Tags: @satoruukisser @sanicsmut (I just know you've waited for this one hehe) @ifuckfictionalmen

Suguru Geto

“Hey love, how you’re feeling?”, the sweet voice of your boyfriend talks through the speaker of your phone.

Oh, how much you’ve missed him. Since Suguru became a special grade sorcerer, he’s got his hands full with work. Day in and day out, his life is occupied by exorcising curses. So him finding time to call you is a really rare occacion and puts a bright smile on your face immediately.

“I’m okay, my mission went well. Working with Utahime isn’t that bad”, you explain briefly.

“How are you? What a nice surprise that you’re calling!”

“Yeah, about that…”

He clears his throat uncomfortably, leaving you waiting on the other end of the line. What is wrong?

“Listen (y/n). There’s a very important mission for me and Satoru from Tengen-sama himself. I’ll be gone for a few day, need to leave the city…”

“Oh great, I’m coming with you!”, you announce.

Will it be hot wherever you’ll go? Maybe you can pack some nice dresses, after all you aren’t there for work. When was the last time you went on vacation with Suguru? You don’t even remember anymore. All you know is that you ha-

“There’s absolutely no chance you’ll come with me, (y/n). Come on, don’t be ridiculous, this is a mission after all. Also, Satoru will be there with me.”

Your heart sinks for a second, his words slightly hurting you.

“I’m sure Satoru wouldn’t mind! And like that, I’ll get to spend some time with you. That would be great, right?”

“(y/n), this is not the place for a grade 2 sorcerer. And I don’t want to spend time with you on a mission”, he instantly replies, voice dead serious.

Wow. You let his words sink in. No, he didn’t mean it like that, right? He didn’t just say that you are weak, that he doesn’t want to spend time with you…right? Your thoughts are racing. Why would he say something like that? You train your ass off day and night, always trying to get better at anything you do. And why does he not want to spend time with you on a mission? You’re a jujutsu sorcerer yourself after all. And he doesn’t seem to mind working with Satoru…

“I didn’t mean it like that”, he interjects after a few seconds of silence.

“Please don’t worry.”

“I just don’t understand why”, you breathe out.

“You love working with Satoru, though. Why not working with me?”

“(y/n), please don’t cause a scene right now. Satoru and I are the strongest, so it’s only logical to let us carry out that mission. You might be skilled, but not skilled enough.”

‘Not enough’, ‘don’t cause a scene’. His words cut through your heart like a knife through butter. Yes, you might be sensitive, you might overreact, but the way he speaks to you with this unknown stone cold voice and not very well picked words leaves your mind racing.

“I just thought this would be a perfect opportunity to spend some time together. The last few weeks we-“

“(y/n)”, he interrupts you harshly.

“I don’t have time for that bullshit now, okay? We’ll talk tonight.”

And with that, he hangs up, leaving you standing in the rain with trembling lips and eyes that threaten to overflow. What has gotten into him? You asked him really nicely, never pushing him with any of your words. Why did he leash out like that?

C’mon, it’s not even that bad. Maybe he was in a rush, maybe he is too overwhelmed by that important mission maybe-

You do your best to suppress your ruminations with good and logical thoughts desperately, but still…

Maybe he doesn’t want to spend time with you.

Frantically, you wipe over your falling tears, trying to calm yourself down in the middle of Tokyo. Maybe you should just get home, drink a tea and wait for Suguru to return. Yes, after all he told you you’ll talk this out in the evening.

And so you waited. Minutes, then hours, long after midnight without a sign of him. Dead worried that something might have happened, multiple unanswered calls on his and Satoru’s side. This isn’t him, it doesn’t match your boyfriend’s style at all to leave you standing in the rain. Something must have happened, something really really bad, something-

“Hello *hicks*, ‘m back”, his voice suddenly announces.

You squint your eyes, gaze fixed on the way he stumbles into the living room with his face redden in a way you’ve never seen before and orbs roaming around with no aim.

“Where have you been? I was absolutely worried about you. And you didn’t even answer my calls…”, you begin, your voice as soft as ever even though you feel like dying from the inside.

Even from afar, it is obvious that he’s drunk. Anger begins to rise in you, almost making you lose your cool temper. He can’t be serious about that.

“Yeah, had no time for that. Was out with Satoru”, he remarks.

“Yeah. Nothing new”, you comment dryly.

“You mad?”

His figure stumbles towards the couch, almost crushing you under his body weight in the process. No, the thought alone of having him near you right now drives you insane. You pull away, creating distance between your bodies.

“Huh, where are u goin’?”, he questions.

“I tried to call you this whole evening. Do you remember that you promised we would talk things out tonight?”

You desperately try to not sound hurt and vulnerable, but you simply can’t help yourself. Suguru is what you considered the best boyfriend walking on this earth, always respectful, always looking after you. But today, you’ve seen a very new side of him – a side that seems to don’t give a damn about you.

“Oh, that’s why you’re so mad…”

“I always knew and respected that Satoru is your best friend, but that you’re choosing boy’s vacation over a little bit of time with me after the two of you’ve been together the last weeks while I’ve waited at home for you just doesn’t make sense to me. But not only that, you called me weak, you made me feel as if I’m worth nothing. I don’t know, maybe I’m overreacting, maybe I’m being ridiculous like you’ve told me, but it…it just hurts me, Suguru. It hurts me that you’ve treated me this way”, you blurt out.

“I’m scared, (y/n).”

His sudden words catch you off guard, eyes glued to you with so much gravity that you forget about his drunkenness for a second. He’s scared? Where does that come from? You can’t help but scoot a little closer, his facial features looking as lovely as ever in the moonlight.

“Why are you scared, Suguru?”

“This is something really treacherous and I’m not sure if I’m able to take it. If something goes wrong, we might have to fight Tengen-sama himself or worse, you’ll get hurt in the process. I don’t want you to be in the line of fire. I’m truly sorry if I hurt you with my words this afternoon, but the thought of you getting injured on this mission alone killed me from the inside. You are way too precious to get into something like that, especially because it scares the hell out of me myself.”

You grab his hand gently, looking deep into his chocolate brown eyes. No, this isn’t the time for pride. Now you understand why he acted so strange, why he came home this late and why he’s sitting in front of you full to the brim. It shatters your heart to know that these thoughts are occupying his mind – more than his words this afternoon.

“Don’t let these thoughts eat you up alive. How did you say that afternoon? You and Satoru are the strongest. If you aren’t able to complete that mission, nobody is. I believe in you with all my heart, darling. No matter how hard the mission seems, no matter how dangerous is get. I just want you to know that I’ll always stay by your side”, you mumble, arm gently wrapped around his shoulder.

“I don’t deserve you, darling”, he hushes against your ear before embracing you in a tight hug.

God, how much you needed that, how much you longed for his touch this whole day.

“I’m sorry for saying all these things to you. It’s just…I don’t want you to get involved in this…”

“You don’t have to explain yourself, I get it. And I overreacted a little. Don’t think about it too much. Let’s go to sleep, okay? You probably drank a lot and tomorrow is another day.”

“I love you, (y/n). Forever and always.”

You smile at him softly, fingertips tracing along his jawline. Even though he smells like sake and his drunk eyes roam around your face with no aim, you love this man with all your heart.

“I love you too, Suguru.”

Choso Kamo

“C’mon, stop acting like a dick”, you demand, mouth twisted into a pout.

Choso signs while rolling his eyes in pure annoyance. How long have you been sitting here, trying to convince him to take you with him to Shibuya? It sure feels like an eternity.

“Stop acting like a fool, then. This isn’t the right place for you to be. I have a very important mission to fulfill, (y/n)”, he demands.

The dangerous glistening in his eyes scream in your face to stop, to just let it slide and wait for him to return. But this is not fair. Fuck, you’re a mighty jujutsu sorcerer, you are really able to help him. But what does he do instead? Working with some of these hilarious curses.

“And I’m a very important juju-“

“ENOUGH.”

The way he yells into your face makes you back away in an instant, usual so bored eyes filled with nothing but thick anger.

“Don’t you understand that I don’t need you? This is very important to me, I seek revenge for my brothers. This isn’t a game, (y/n). You’ll stay here and wait until I return. Do you understand?”

You defiantly cross your arms over your chest, gaze glued to the floor.

“Do. You. Understand.”

“Yes”, you bark back.

“Good. I’ll be back this evening, my love. Don’t be too mad at me.”

His fingers gently caress your cheek before he walks away, into the fight. You cry out in frustration, a new wave of fury washing over you. Why would you be in the way? It’s not like you’re reincarnated yourself, a skilled jujutsu sorcerer for more than 150 years. Fuck, maybe you’re even on the same level as Choso. He might be your boyfriend, that doesn’t mean he can boss you around.

Yes. You are your own chef, always doing whatever you want. A cheeky grin is plastered on your face. Why would you stay at home when slaughtering some jujutsu sorcerers sounds so fun?

Without thinking twice you sprint away, into the dark night, into the train station of Shibuya Choso told you he’s stationed in. Where is he? What is he doing? Maybe you’re even able to help him killing these brats that are responsible for his brother’s death. Yes, what a joy, what a fun!

Your eyes dart around the empty area, not even a single curse in sight. Huh, that’s strange. You thought there would be more resistance, more fights. But instead, you are greeted by empty hallway over hallway, running around like a lost puppy.

Until you stop right in your tracks. Until you can hear his beautiful voice loud and clearly. Your feet carry you his direction instinctively, soon greeted by a merciless fight that lays itself out in front of you.

“Oh, what a coincidence to see you here!”, you greet your boyfriend, aiming a punch at the pink-haired boy in front of you without even knowing who he is.

Choso’s eyes widen in pure horror, forcing him to forget abou the presence of Yuji Itadori for a moment.

“(y/n)”, he breathes out.

You smile at him widely, confidence dripping from every poor.

“I told you to stay away”, he hisses through gritted teeth.

“And I didn’t listen”, you reply.

With a swift motion, he pins you against a nearby wall, eyes darted at you in a way you’ve never seen before.

“I’m starting to lose patience with you, (y/n).”

“I’m here to help you out, love. Why would you have to do this on your own? I love killing people and I’m also seeking revenge for your beloved brothers. After all, they were my family too and everyone who hurts you automatically hurts me too.”

He pants heavy, gaze wandering between your eyes and lips. You’re not sure what’s going on, his mimic not telling you a single bit about his feelings. Is he mad, disappointed, absolutely furious? You can’t tell. But you meant every word you said. When will he finally realize that he’s never alone as long as he has you? You are his girlfriend, after all. It’s your job to be on his side.

“Do you really mean that?”, he mumbles, still holding onto your shoulders tightly while distracting the boy behind him with his blood manipulation.

“Of course I mean that. We’re a team, right?”

You don’t know what’s happening, too stunned by the way he suddenly wraps his arms around you so tightly that it’s hard to breathe, head hiding in the crook of your neck.

“You don’t know how much that means to me…”

It’s like you’re air and he can’t breathe, the way he holds onto you for what seems like dear life. You can’t remember a single moment he ever showed his affection towards you this passionately. But oh how much you enjoy it, closing your eyes to feel his touch even better.

“You are suborn”, he breathes out, taking your face between his hands and pressing his forehead against yours.

Are these tears glistening in his eyes? Your usual so cold and calculating heart feels as if it’s drowning in emotion, absolutely mesmerized by the way he shows himself so vulnerable around you.

“And absolutely in love with you”, you reply, running your fingertips through his hair.

“Wait here until I give you a signal. You know what you have to do”, he instructs you before pressing one last kiss at your demanding lips and turning away.

“Hell yes I do”, you response immediately, face of determination readier that ever.

Bonus: Yuji Itadori

“Can you stop breathing so damn loud?”, you spit at him.

God, he’s so annoying. Everything is so annoying today. The way the birds sing, how your lunch tasted, your training session. Everything just sucks, including your boyfriend.

“Did I really breath that loud? Sorry babe”, he replies instantly, holding his breath in consequence.

“Urgh, can you scoot over? I need more space”, you grumble.

“Of course!”

Without thinking twice, he slides against the wall so you have more than enough space. Really, is he serious about that?

“Are you keeping safe distance to me or what?”

“Absolutely not, I just thought you need space…”

“Do you need space from me? You want me to leave, huh?”

“N-no!”

Yuji just looks at you through his doe eyes, mind racing in a desperate attempt to understand your feelings. Did he do something wrong? Actually no, you always love to literally sit on him while watching TV, telling him over and over how much his slow breathing calms down your tingling nerves. What is different today? He looks into distance, thinking of every possible thing that might be wrong until…

Oh, you might be on your period.

Even though your mood swings were never this bad, the timing and general mood would be fitting. But asking you is way too dangerous, maybe you’ll lose it completely if he brings that up. No, he’ll just stay nice and give you what you need at the moment.

“Do you even love me anymore?”

He comes closer, gently taking your hand into his much larger one while smiling widely at you.

“Sure, you’re the love of my life after all! Just tell me if you need something, I’m always there for you, okay?”

Your stomach is killing you, it feels like getting kicked by the horse over and over again. Deep within you know it isn’t fair to let that out on Yuji, but at the moment, you simply can’t control yourself. But when he’s looking at you like that, gently smiling at you with so much affection in his eyes…

“Maybe you can bring me some pain killers?”, you mumble.

“Will be right back!”

In the matter of five minutes, he returns with pain killers and chocolate in one hand and a hot water bottle in the other. Your heart melts away. God, how is this boy so precious? Is this really your boyfriend?

“Oh Yuji, thank you so much…”, you breathe out, tears stinging in your eyes.

He’s just too good for you. You treated him so badly, and him? He treats you like a literal princess.

“Everything’s fine, (y/n). I do that with pleasure!”, he reassures you, gently wrapping his arms around you while whipping your tears away.

“I’m sorry for lashing out on you like that and causing trouble”, you sniff against his chest, immediately regretting your words from earlier.

“No need to be. We all have a bad day sometimes! And now open up the chocolate and choose a movie."

Your orbs gaze up at him, admiring his loving eyes. Is it even possible to start a fight with this boy? It seems like he understands you like no other, always saying the right words. He is simply a blessing, a true sweetheart.

“Yeah, sounds good”, you reply, placing a small kiss on his cheek.

What a precious boy you are able to call your boyfriend.

[senseichaos]

Hey, same anon asking about yandere stuff. I'm so glad to hear!! Of course if you want to, may I please request yandere Vox with the reader? Like how they try to run from him? Perfectly fine with it being a female reader as I am one. And I don't mind how you write it. Do whatever you please! I love seeing others' interpretation of the characters 🖤 No rush!

YOU CAN'T RUN. HELL, YOU CAN'T HIDE EITHER.

thank you lovely anon! I love the concept of Yandere Vox! Hope this is good :) let me know your thoughts in another ask if you'd like! Lots of love!

Summary: Vox doesn't often fall in love often, no. Well that was until you came around- and you wanted a job with Valentino of all people? No. That would never fly with him. He'd make you work with him instead, like an intern or something? Hell, anything to make you stay near him. Anything to get him as close to you as possible.

Genres: Angst with a small amount of sexuality

NOT PROOF READ (yet)

Warnings/Tags: Yandere Vox, Insecurity, Reader is naive, manipulation, mind control, exploitation, creepy behavior, masking, contractual agreements, reader lacks hell experience, Vox is violent, Vox lacks empathy, angst, swearing, overall kinda depressing (LET ME KNOW IF MISSING ANY)

Pt 2

_______

You can't believe your eyes when you step into that tower, the pink glass adorning the outsides making your eyes shimmer. You have a job interview with Valentino today, after waiting for (probably too long) to get a job somewhere.

You see, hell worked slightly differently to earth. Where things in earth worked in a more of a 'work and make work' sort of way, Hell is more 'work, make work, and fight'

You'd managed for the past months to live in a small apartment that happened to be owned by someone who got killed in an extermination. It wasn't your plan to impersonate a sinner and squat in their home, but you have to get by somehow, right?

Well- it also wasn't your plan to be a porn star. But no where else seemed to want to take you. You're small, too weak to be taken by anyone else. People on the street told you that you were made for the screen, that your body was perfect. Some even tried to pay you copious amounts of cash just for you to suck them off. And you hate it.

At least the elevator of the building is cozy.

Vox on the other hand was having the best day of his life: or in his definition, a day where Valentino doesn't have a stupid breakdown that Vox doesn't have to solve.

He loves to watch his people as they indulge in his technology, he loves to watch everyone become obsessed with him and his media, he loves to be in control of all of these people. He'll watch every screen around him with focus, taking in their reactions as he bottle feeds them content.

Could he be with his boyfriend, Val? Yes. Does he want to? Hell no. He doesn't love Val. Plain and simple in his eyes. He has Valentino to get his business along. To make him more powerful. He'll do what he has to to be the most powerful he can be. Even if it means toying with people around him.

Val doesn't think he's capable of falling in love with anyone in this horrible underworld he inhabits. Everyone here is fucked. he is fucked. Plus, he doesn't know anyone here who he'd connect with anyway.

Or well that's what he did think until right now. There is a girl in the central elevator that looks awfully out of place, causing Vox to turn the entirety of his attention onto her. She looks like a regular old sinner, yes- but still she stands it like a sore thumb against the few people also in the central elevator. Where everyone's boring physique was her own enticing one stands. Where everyone else's two tone personalities stand her own colorful and bright one shimmer in his 2-D irises.

And then comes that odd feeling in his chest, this weird bubbling feeling of emotions that causes his eyes to tear up ever so slightly. This feeling, it's addicting. He wants to grind her up into a smoothie and drink her up, making the feeling sit there forever.

Something is wrong with him: he thinks.

With bated breath vox looked at the floor the elevator was approaching, figuring out where the girl is exactly going. There are only few reasons a sinner shows up at V tower anyway: to get a job with Valentino, or to turn yourself in if you'd wronged them. The elevator number reads '10'. She's going up to the business floor where Valentino currently is.

A sudden twist finds its way into his stomach, a horrible twist that makes his head burn with anger. Who does Val think he is? Having a girl such as her working for him. He. Couldn't let this happen, no no no no no no no. Why would he even want to exploit such a girl? She's supposed to be loves and cherished for everything she is.

The only reason she'd want to work with Val is because she has no other thing to do. He needs to offer her a job- or something to keep her from giving herself away to Valentino. Something to keep her as close to him as possible- like an intern or an assistant or anything.

Anything: Vox thinks.

Not often is Vox so reckless, not often at all. He likes to think he's decorum and well-adjusted. Likes to think he's a figure of this time. Of his time.

But right now, all he wants is this beautiful fucking girl to look at him in his eyes. Is it selfish? To want something so bad you feel like you could to horrible things to get it? Probably. But this is hell. And as an overlord of hell he can take what he wants. For once he doesn't care.

--- 666 ---

You take a step from the elevator, looking around the rather nauseating long and rounded hallway with squinted eyes. You can barely remember where you're supposed to be going anymore. You're supposed to meet Val inside one of these many, many studios. But soon enough as you start to venture through the halls on light, unsure steps you find yourself unable to read the words and numbers on each door.

Something is wrong, and you're unable to focus. There's this buzzing sound in your ears, a very faint but obvious buzzing that's causing your brain to go fuzzy. You can't feel your body anymore, it's just walking down the hallway in painful circles.

Suddenly that tether in your brain snaps with a loud crack, and your face to face with a television. You're still standing, in this long hallway, but now you're looking into the dark eyes of a TV screen. Wait- Eyes?

"Oh, Hello there sinner, are you looking for Valentino?" He asks, voice weirdly distant yet close all at the same time. His smile is large, almost devilish looking as he stares down at you.

You feel on edge, and your head still has a very faint buzzing lining itself.

"Oh, erm, Yeah.. I can't seem to recall what room-" You flinch as he hooks an arm around your neck walking you down the hallway once again with a smirk. There's a weird edge to him that you can't pin down, this whole interaction almost seems.. forced? Oh, there you go again, putting labels on things. Stop overthinking!

"Don't worry your pretty head about it! I'll take you to him," he says, unhooking his arm from your shoulder; only for him to rather sensually drag his hand across your shoulder blades until it's claws barely rest against your shoulder.

"But you know," Vox begins, swinging himself around so he stands in front of you, hands resting on either of your shoulders. You have to stop yourself from bumping into his chest. "You don't have to work for him." He says, his voice turning slightly more TV like and distant as he speaks.

"What do you mean..?" You ask, pushing his hand off of your shoulder with a painful twist of butterflies. A type of butterflies that you can't understand.

"Well, you seem like the type of gal to enjoy.." he looks you up and down, moving his hands from your shoulders as he grins. "Taking orders," you tilt your head at his words, confused. He shakes his head to himself, looking away for a moment with a slight frown before staring back, smiling brightly.

"No, I mean that you could be my assistant! You can.." He thinks for a moment, tapping the bottom of his screen as if it were his chin. He shrugs, smiling awkwardly with furrowed brows. "Bring me drinks and such! C'mon.."

He leans down to your level again, looking into your eyes. You suddenly feel that wave of disorientation go through you again, the only thing seeming to make sense to you being.. Vox.

"You don't want to be exploited by him, do you?" He says, and you feel his screen radiating heat on your skin. The buzzing becomes more loud as he goes on, all you seem to be able to hear being his words as they drip from his vile tongue. "C'mon dear, He'll break you."

"And you don't want to be broken, Right?"

He is right. You don't want to be broken by Valentino. You don't want to be exploited. But you don't have any other choice-

Until now, that is. You have an opportunity.

You should take it, right?

The headache and buzzing dissipate, taking a chunk of your psyche along with it. You feel your feet begin to give out beneath you from the exertion, lacking balance as you wobble softly. Not wanting to faceplant into the carpet, you reach out to something, anything to hold you. It just so happens to be Vox's chest, grasping onto the fabric of his coat as you begin to slip down to the floor.

"Hey, Hey, it's okay, What's got you out of sorts?" He asks, grasping you by your waist as he lifts you back to your feet. You blink, looking around for a moment with a nervous breath. Those butterflies, again. You hate them.

"I- uh.. I dunno.." You say stutter, pushing yourself away and scratching that back of your neck.

"You're feeling better?" Vox says, dipping his lids as he tilts his head rather attractively.

You nod, looking down at the ground with a nervousness inside of you.

"Good, good.." he turns away, looking at the ground and pacing for a short amount of time "good.." he says softly to himself, turning back around and clasping his hands together as he grins.

"Now how about you follow me and we can get you set up, yeah?" He says, pressing his hand against the space between your shoulder blades as he turns back to the elevator. You look up at him, and for a moment he seems to be in his own world. At least he is until you speak.

"So what's your name, Mister?" You ask, fiddling your fingers against each other nervously. He grins, lids upturning with the smile as well. He leans down again, poking a blue claw on your cheek as buzzing blurs your brain.

"It's Vox, my dear," He says, and your brain goes soft and mushy with an emotion you cannot describe. It feels as though he's making you melt.

"Keep that in your head for me, will you princess?" He asks softly, pulling his claw up the side of your face with a manic grin.

With a sudden movement he pulls away, shrugging his hands.

"Now darling, let's get back to it, shall we?"

Something is off, and part of you wants more of it.

--- 666 ---

Mister Vox's office is large in size, walls lined with screens displaying different things across the entirety of the pride ring. You wonder what Vox may do here all day, seeing the singular seat between it all that doesn't even seem that cozy.

You assume he watches, broadcasts, does meeting, and.. does what he's doing right now, perhaps?

"What do you do all day, Mister Vox?" You ask, looking wide-eyed at the television lined walls of the area. He flinches, grinning awkwardly before bringing back his confident demeanor.

"Me? Oh, you know.. this and that- I go to meetings.. I sign paperwork, I go to meetings.." He laughs to himself, shaking his hand dismissively as he sits in his seat, spreading his legs in a man spread. You turn away from the screens, looking over at Vox as he scans the monitors with narrowed eyes. You wonder if he was doing something important before he found you.

"Uh, Mister Vox, what do I do now..?" You ask, taking a small step towards him. He tilts his head towards you, smiling as he swings his chair to face you completely.

"oh, you? You can just sit there and look pretty.." Vox looks you up and down with narrowed eyes, face blank for a long moment before bringing a small smirk onto his face. He leans back in his chair, clicking his fingers as a bundle of clothing finds it's way into your hands.

"Perhaps prettier, change into that for me will you dearest?" He says, leaning his head on his fist as his voice becomes slightly more distant. You look at him, confused as you clutch the blue and red clothing to your chest.

"Okay.. Where do I change, Mister Vox?" You say, fiddling with the collar of your shirt as your body feels hot. Vox rolls his eyes playfully, pointing a clawed finger to the floor as he shifts his chair back to the screen. "Just change here my dear, no one will see you," He says, looking at you with a side glance. It's almost condescending, in a way.

"right here? But-"

"Here is fine, dear. Hell, here is more safe to change than anywhere else in this building," He laughs. You get this off feeling like you should trust him. I mean, he's one of the people owning this building anyway, right? He would be the one knowing a lot about it rather than anyone else. you should trust him.

"Okay Mister Vox."

You can't see his grin.

Every piece of clothing you peek off feels like this weird symbolism for losing yourself. Off comes your shirt: a piece is lost. Off comes your shorts: a piece of you is lost. And then more clothes come onto you, building something new. On comes a skirt: a piece of you is molded. On comes a blouse: a piece of you is molded.

And then there's this watch, a mobile one with 'Vox Tech' plastered across the side. With a shrug you put it on, struggling with getting it to tightness but ultimately managing to win the battle with the finicky strap.

"Good, good, how great you look!" He says, outstretching his hands with a grin.

You feel yourself blush, one half of you from his compliment and the other half from the fact he's looking completely in your direction. Does that mean he was watching you the whole time?

"Actually my dear, do you think you can grab me a coffee?" He asks, clicking his hands as a streak of blue energy shoots inside of the watch; this causes a mao to appear on the screen, showing where you are currently. "That map should tell you where to go, the assistant there should give you the coffee the way I like it,"

You shouldn't ask it, but you feel your bones ache too.

"How do you like it?"

He grins, tilting his head.

"Sweet with a strong flavour," He states, waving you off.

--- 666 ---

The first week as Vox's Assistant goes by smoothly, or as smoothly as it could working with an Overlord of hell. A rather odd seeming one at that.

Everything feels on edge with Vox, you feel like at any moment he could do something drastic. You've no idea what said drastic thing could be either, which makes it a whole lot more anxiety inducing. Hell, Vox is attractive. That's probably why you're on edge. That's what you keep telling yourself anyway. You're probably in love with him or something.

Vox had even given you housing as close to the building as possible, insisting he pay the rent. Not that you complain, no; less walking for you it seems. The Vox Tech watch he gave you tells you pretty much everything that you need to do. When you wake up in the morning it goes off, alerting you like an alarm, it has a to do list that blares when you're in the office, it maps out the whole space, it even acts as Vox's messaging system towards you.

You do wonder how he controls it, even in the comfort of your own home. Well, he is an overlord, right? He's capable of things even outside of your grasp. You cannot even fathom what he could do with that power.

And that's just the way Vox likes it.

Actually, you haven't seen Valentino around the building the whole week either. Even in a meeting you accompanied Vox to. You'd expect to see him more often with all the prowling in and out of the building you do.

It's as if he's vanished.

"Princess, grab me a coffee will you? Maybe even grab one for yourself while you're at it, on the house," Vox asks, swiveling on his chair to face your own, which sits just off to the side of his own with a small desk in front of it. You'd been doing some paperwork for him for the past hour, mostly reading through stuff, asking him questions, and singing them for him.

"Yeah, sure.. um, I was just wondering.." You utter softly, causing Vox to raise a brow as he leans back on his chair with a confident grin. He tilts his head in question, saying: "What's on your mind, (N/N)?"

"I haven't seen Valentino around the building, I was just wondering if something's up with him?" You ask, looking down at the ground as you begin to regret yourself even questioning. Vox laughs, flapping his hand in dismissal.

"Oh, just that? Don't worry about it! He's just.." Vox pauses for a moment, shrugging his shoulders. "Doing his own thing," He finishes, smiling rather oddly as he begins moving his chair back to face his computers. You intercept.

"His own thing..?"

Vox turns back to you, grinning widely with a manic look in his 2-D eyes. Once again, the buzzing fills your brain. And you fall to your knees against the ground with a painful 'thump'. Vox harshly grips your chin, pulling you closer to him until all you can see is that blaring red eye of his as he speaks.

"As i said,"

You feel yourself wanting to let go.

"Don't worry about it."

He lets you go of your trance, leaving you teary eyed as he smiles softly, brows furrowing in a sort of mocking empathetic way. His eyes drip with affection you find.

"Now, grab that coffee, okay?" He finishes, placing a cold kiss against your forehead before letting go of your chin, leaving yourself to gather your bearings.

It's not often you feel the want to defy someone. But as you stand from the floor, dusting off your skirt and walking to the elevator; you feel that need to be defiant. You'd figure out where Valentino is. He has to be somewhere in the building, right? You just have to find.. him..

In these hundreds and hundreds of doors. You would have to find him. And you can't take so long, otherwise Vox may suspect something.

You'd find someone to tell you where he is, you'd find him, and you'd stop worrying if Vox is going to do something drastic because he hasn't lied to you. Simple as that, simple as that. Right?

As it just so happens, as you begin walking through the studio halls you find yourself bumping into a spider individual, of whom you remember being a popular porn star.

So with an anxious breath you asked him. He explained that Valentino was in studio B-40, but he doesn't recommend finding him. And once again you go against someone's wishes. Plus, you were just going to stick your head in the door. It's nothing to worry about.

So what are you so anxious when you find yourself getting closer to the door? Why does your throat feel so tight? Why do you want to run in the other direction? Why does every step feel so heavy?

Taking another small step to the door, you wonder if you should listen to your conscious. It's supposed to do you good , right?

No, that's baby talk.

You aren't weak. You aren't letting the people in hell get you down! You are going to open the door!

You push yourhand towards the door handle and-

"Ouch! Fuck-" You yelp, an electric shock going through your body, causing you to fall backwards onto the hard floor below. Your whole body is on fire, you can't feel your tongue. You can't feel your brain.

A hum accompanies Vox's words.

"You're not going in there." He says, leaning over you as you push yourself to your knees, pressing yourself to the wall. Your head is throbbing.

"I'll beat him to a pulp if he sees you, you know?" Vox laughs, that sickening pseudo-empathetic look covering his flat features. You feel your stomach twist, this time in an awful way, it's like he's draining you of your soul. You want to disappear.

"I don't want to be aggressive," Vox begins as he grips your face harshly, causing tears to well into your eyes. "But your fucking mine, you got that?"

"And I won't let that sleazy prick get his greedy eyes anywhere near you!"

"W-what?" You whimper, pushing his hands from his face and backing away meekly. Vox laughs to himself, red dripping from his two dimensional mouth. He humors you with that gaze of his, eating alive any part of your confidence that may still linger.

"Oh, don't you get it, my dear? You sighed the paperwork," Vox leans down so his eyes can bore into your own, his gums showing in that prideful smile of his. "You belong to me now."

You choke on air, standing to your wobbly feet.

"W-what? I don't un-"

The paperwork. The paperwork you signed to get the job. You didn't read it! You idiot. You fucking idiot! You've ruined your own life. You belong to him..

To Vox.

"You- Shit-!" You turn around on your heels, almost slipping as you speed off into the hallway. You hear his voice echo in your ears.

"You can't run. Hell, you can't hide either!"

This was a mistake, this whole thing was a mistake. You want to die. You want to disappear. You want to get as far away from him as possible. You don't even take the elevator down, you run down every single flight of stairs jumping down a couple to save time.

The slip beneath your feet almost makes you topple over as you clutch onto the railing, swinging yourself onto the next flight of stairs. You have to be close to the bottom, right. Right? Yeah. This is fine.

And you were, right, surprisingly. You can almost see the entrance outside. You just have to make it out of this lobby. You just have to make it out of this huge fucking stupid ass lobby! You have to.

All of the sinner's eyes bore at you as you run at top speed to the door. You can't be here. You need to leave immediately. He can't find you If you're far away, right? Just go somewhere without a camera.. it'll be fine.. everything will be fine.

You're so close! Just a few more steps, a few more heavy, headache inducing steps.

You can make it. You just have to believe in yourself, and it'll all work out. Everything will be fine. It just has to be. Hell can't be this cruel, can it?

You're so close to the door you can smell the outside world, hear the cars as they pass, hear the charter hear the-

You choke and fall.onto the ground, a heaviness around your neck and wrists. It buzzes against your skin, making you go light headed. You can barely see it, but it's there. There are handcuffs around your wrists. And a collar around your neck. All of which glowing and buzzing with that electric blue of Vox.

He is right.

You can't run, you can't hide, you can't do anything.

He owns you, he has you. You can't do anything.

You made a mistake.

Maybe hell really is this cruel.

Keeping you forever tethered to this man.

Who knew one mistake would ruin the rest of your eternity.

Serves you right for being so naive.

"Alright now, are we done with our tantrum?" Vox asks.

"Yes mister Vox." You say.

[nicohischierz]

one in a million: luke hughes

tagging: @ivy-34, @francesfarhadi, @hzstry8, @cixrosie, @itsnotgray, @estapa94, @trevs-swiftie, @heartz4hischif you want to join the taglist let me know!!

he searched for you at every gathering, the saving grace and the only incentive he needed to attend anything.

the two of you would often hide away from the rest of the party. consumed in a world where it was just the two of you.

a world with no responsibilities and no comparisons.

luke understood you and you understood him.

“i’m gonna miss this when i’m gone,” luke whispered.

you smiled up at him, snuggling further into his chest. luke was your calm during the storm. the one person who always put you first.

both of you wished everyday could be like this.

“so you’re going to jersey? straight after frozen four, win or lose?” you asked.

he nodded.

when the game was over, luke only searched for one person. he found you almost immediately. to him, you stood out in the sea of faces, wearing his ntdp jersey.

luke tried changing as fast as he could to meet you but the devils representative stopped him. "I'm sorry but they want you on the plane immediately," the guy explained.

"i need to see her," luke fought.

the guy shook his head. "i'm sorry kid," he ushered luke away, giving the boy a solemn look.

walking into the locker room, you noticed the sour looks on everyone's faces. but at this point, you were only looking for one face and he didn't appear to be there.

erik portillo saw you first.

he initially came to tell you he was signing with the kings but when he saw your frantic nature, he knew he had to tell you about luke's departure.

the tall swede ushered you outside, making sure you were away from the media commotion before whispering "he left sötis,".

you almost let out a laugh before looking at erik. "that's not funny erik, where is he?" you asked.

erik's eyes were a giveaway that he truly wasn't lying. luke had left without so much as a goodbye.

your breathe was shaky as you looked around the hallway, tears filling up your eyes once again.

once you were back in your hotel room, you did what any sane person would do. you texted luke, telling him what a coward he was for leaving you like that.

lukie pookie: call me

that text alone sent you into a spiral.

obviously, you didn't call him. he was the one who left without saying a word so he should be the one to pay for the pain he caused you. a pain that rivalled what you felt with the pressures of the world.

it was obvious to everyone who knew you and luke that something was going on.

the once energetic duo, now barely had the energy to say hello.

after luke left the others started to leave one by one.

nolan joined a team in russia.

the seniors said their last goodbyes before going off.

mackie signed with the panthers.

and when erik left you felt as if things were changing too fast.

you followed the swedish boy to california and stayed with him until you wrapped your mind around what was going on.

alex turcotte was shocked to see you when he arrived to training one morning. well, he was shocked to see the shell of the girl he once knew. the chicago native immediately texted jack that you were in california and asked what happened.

“sötis, you can’t hide here forever.” erik prompted. he was currently trying to find flights for the two of you back to michigan so that you could spend summer with your family.

you ignored him and ate your soup dumplings. “i’ll pay the rent cost while i’m here erik. please don’t make me go back,” you begged.

but alas, erik had enlisted the help of alex who had brought trevor along with him. both older boys had their bags packed and tickets in hand as they reached the apartment.

“listen y/n/n, we’re not taking no for an answer. now either you pack your things and follow us or we pack for you and you get stuck with whatever we choose,” trevor gave the ultimatum.

rolling your eyes, you walked into your room as the three boys followed. they smiled as they watched you pack, happy that their slight threat worked.

erik drove the three of you to the airport and gave you one big hug before whispering “stay there for two weeks and if you don’t like it, i’ll buy you a ticket to sweden,”

you nodded. now you just had to get through two weeks and complain that it was a horrible experience.

“but you’re not allowed to make yourself hate the trip,” erik added. you hated how well he knew you.

that’s how you found yourself waiting for jack to pick you, trevor and alex from the airport.

jack ignored his two best friends as he ran over to you. engulfing you in a hug, spinning you around. “i missed you squish!” he exclaimed.

you smiled into jack’s shoulder. “i missed you too rowdy,” the middle hughes held onto you a little longer before greeting his friends.

the car ride to the lake house was silent in your part as you furiously texted erik about your dislike for his plans.

upon reaching the house, you were greeted by your fellow michigan classmates. they all yelled in delight at your presence and swarmed you into a hug.

“we thought we lost you to sweden!” dylan exclaimed, his arm around your shoulder.

you chuckled and looked to alex and trevor. the two boys wearing cheeky grins as they grabbed you bags. “well if it weren’t for these two i might’ve gone with erik,” you answered.

luke looked from a distance. pain and hurt in his eyes as he watched you interact with your friends and his family.

once everyone was done greeting you, you looked up at luke and smiled. the boy smiling back at you but no words exchanged.

you didn’t talk to luke until the boys first party.

just like every other party, you were hiding away on the roof. it didn't take long for luke to find you but once he did, he was glad.

the two of you sat in silence until you spoke up. "you didn't say goodbye," you murmured.

luke's heart broke as he heard your voice crack.

"they didn't let me bubbles. i wanted to come say bye to you but the guy said I needed to get on the plane. then my phone died and I didn't get any of your calls. when I tried to call you back it didn't go through," he ranted.

at this point, you were turned to luke. tears in both your eyes as you finally spoke about your feelings over the past two months.

"you're my best friend luke and we promised we'd be there for each other. you promised you'd never leave me and you didn't say goodbye," you raised your voice slightly.

more tears were streaming down your faces. your chest rose and sunk furiously as you tried to remain calm.

when luke didn't say anything more, you made your way back into the house. you glanced at him one more time before reaching his door.

"you weren't at my debut," he exclaimed.

you stilled and turned to him. "i was there luke. i bought the first available ticket to new jersey and the first ticket i could get my hands on for the game." you confessed.

luke's eyes softened. he ran over to you and brought you in for a hug. your face was nuzzled in his chest as both of you cried in each others arms.

"i don't want to lose you again bubbles," he whispered.

"you never lost me lukie,"