#updated 5/8/24

[flugame-mp3]

no longer post limited :D

theo, they/he/ze/whatever, in my 20s

tags + blinkies + more under the cut :)

blinkie/stamp IDs in alt! ^^

[seizetheheartless]

Hi !

See strawpage for (general) info :-) - > https://seizetheheartlesss.straw.page

This is my only blog so I throw everything here like god would’ve wanted o7

I used to go by variations of 900_2fm on all of my platforms, so, any artwork I have posted under that name is mine!

[jtl-fics]

Surely Masterpost (Part 1)

Chapter 1 (Sprite & Grenadine): ( 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15)

Chapter 2 (Cherry 7UP): ( 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - 20 - 21 - 22 - 23 - 24 - 25 - 26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 37)

Chapter 3 (Roy Rogers): ( 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - 20 - 21 - 22 - 23 - 24 - 25 - 26 - 27 - 28 - 29 - 30)

Part 2 Here

[ask-the-completely-sane-clown]

WELCOME FOOLS!

Hello, I am mod Microwave but you can just call me Micro :) run by: @ilikemicrowaves

I am very slow and sometimes I'll just not post for a while

TAGS

Note: these tags my be updated later on.

[ ooc ] - post not related to the story

Mail - ask towards the characters

[ Scribbles ] - extra art I've scrapped or simple sketches for this blog

[ updates ] - post to fill you in on something new or explaining were I've been

Guidelines and Pointers

What can we affect?

You, are Kaufmo's Imaginary Friends (I.F) he made up to cope with his situation. In the digital circus, I.F's hold some control. You can communicate with multiple or specific players, spawn objects, and yourself for a limit period of time. (Preferred 5 asks) You can also spawn notes for players to read or find later. Magic anons are welcome, I'll just be picky

Rules

▪︎ I prefer that you'd do NOT send explicit or inappropriate asks, but if it's like a joke then I may consider it

▪︎ do not bring shipping drama to this blog [ the only ones I will look into is Kaufax and ragapom ]

■ you can ship the abstracted characters as you like, just probably won't be canon to the story

▪︎ please send one ask at a time, you can send as many as you'd like, just separately

Characters unlocked

Kaufmo ✅️

Abel ✅️

Queenie ✅️

Silly-string ❌️

Rett ❌️

Spike ❌️

Mops ❌️

/@×°¿ 🔐

[endthestarlight]

Tags: #endstarlight art, #endstarlight ocs, #endstarlight writes (only sometimes)

@ending-star : reblogs and ramblings

Links: artfight | toyhouse

❤️🖤🤍💚

art trades and requests open!!

I take requests but only for things that I like (twisted wonderland, ronpoi, my OCs.... I'm probably forgetting others lol). I'm fine with anything for art trades tho (in other words let me draw YOUR OCs/blorbos, tell me all about them even)

[newsfrom-theworld]

Sudanese gfm

These are some Sudanese gfm that need your attention and their profiles; i will update the post if I find new fgm for Sudan.

FAMILIES WHO NEED TO FLEE THE WAR

1: Help Aalaa's family escape to safety

Aalaa's twitter accaunt

2: Help Abudjana rebuild after war

3: Help Mohamed leave Sudan

His twitter accaunt

5: Help Asjad and her Family Escape War in Sudan

Her twitter accaunt

6: Help Randa's Family flee war in Sudan

Her twitter accaunt

@rnd8

7: Help Asala and her family evacuate from Sudan

8: Support a community in Sudan

Twitter accaunt

9: Help support families in Kassab IDP camp

10: Help Jameela and her family escape the war in Sudan

11: Help a family escape the war in Sudan: one member suffers from Dystonia

12: Help Sai's family escape the war in Sudan

Twitter Accaunt

13: Help a family of eight to escape the war in Sudan

14: Support South Sudanese Evacuation from Sudan

15: Emergency funds for a family

16: Support Sakina's Family's Journey to Safety

Twitter accaunt

17: Help a mother and her two children escape the war in Sudan

18: Help-15-families evacuate El-Fashir, Darfur

19: Help a Sudanese family escape from war

Twitter accaunt

20: Help Ahmeds family to escape warzone in Sudan

His Twitter accaunt

21: Help a sudanese family with two autistic children escape war

22: Help a family of six escape Sudan

23: Help a family with two children evacuate from Sudan

Twitter accaunt

24: Help Rama Haran's family escape the war in Sudan

25: Help two sisters escape the war in Sudan

26: Help Family in Sudan Find Urgent safety

27: Help a Sudanese medical student finish her last year of med School.

28: Help Sudanese students become the future doctors

SUPPORT PEOPLE ON THE GROUD

1: Support Families impacted by the war

2: SUPPORT THE KHARTOUM KITCHERN

Twitter accaunt

3: The Save El Geneina initiative which aims to provide services to all Sudanese

4: Help  Eman Abdel Rahman rebuild his life after his home was destroyed (@emooz-8)

Twitter accaunt

5: Help a family rebuild after war

6: Help Displaced Sudanese Families Pay for Food and Medicine

7: Assist a Sudanese family in covering basic needs

8: Support a Community Stuck In Sudan

9: Help Save AlGineina’s health clinic in Adré Refugee Camp

10: Support Sudanese organiser to secure housing

11: Support survivor of sexual violence in Sudan

Venmo: BSonblast

SUPPORT REFUGEES

1: Help Sudanese refugees stranded in Olala forests, Ethiopia

2: Help a young Sudanese woman avoid eviction

3: Help Sukina's Father's Fight Against Cancer

IF YOU CAN'T DONATE PLEASE REPOST, THEY NEED TO GET OUT

Keep Eyes On Sudan

GFMS FOR OTHER COUNTRIES PLS CHECK

Palestine

Yemen

Congo

All the countries ( my most important post)

Haiti

Hawaii

[mavigator]

(UPDATED!!!) here are some people that have reached out to me recently with their fundraisers. LINKS IN NAMES. status as of 09/19/24. i've checked that all fundraisers listed here are vetted.

Abedalrahman Alhabil (€83,683/€120,000) -- Abedalrahman, his parents, and his five siblings were displaced when an Israeli attack destroyed their home. Abedalrahman's father is in urgent need of evacuation and surgery, as he suffers from chronic heart disease and high blood pressure. (@abdullahgaza) 69% of goal reached. INCREDIBLY SLOW PROGRESS.

Asmaa Ayyad (€20,911/€45,000) -- Asmaa and her family of eight were displaced when their homes were destroyed by Israel. They need funds to evacuate to Egypt before they suffer any more loss. (@asmaayyad) 46% of goal reached.

Hashem Al-Shawish -- (€10,097/€45,000) Hashem's wife, Samer, recently gave birth to their baby, Omar, in a tent. Omar has already needed emergency medical attention as a result of poor living conditions. He, along with Hashem's mother, wife, four brothers, and two sisters need funds to evacuate. (blog terminated. can't find new one.) 22% of goal reached. INCREDIBLY SLOW PROGRESS.

Doaa Jad Al Haq -- (kr212,156/kr300,000) -- Doaa and her 5-year-old autistic son, Omar, evacuated to Sweden, but Omar was extremely traumatized by the horrors in Gaza. He needs treatment so he can recover. In addition, evacuation funds are needed for the members of Doaa's family that are still trapped in Gaza, including 11 children and her father, who has been incapacitated by a stroke. (@doaaomar1234) 71% of goal reached.

Aya Alanqar -- (€12,831/€15,000) Aya and her husband Jihad need funds to evacuate themselves and their three young children (Abdelrahman, 7 years old, Jori, 5 years old, and Adam, 2 years old). Their home was destroyed by Israel and they have been forced to move over thirteen times. (blog deleted. can't find new one.) 86% of goal reached.

Muhammad Shehab -- (€10,514/€25,000) Muhammad desperately needs funds to evacuate himself and his sons, Zaen and Yahya, from Gaza. They have already been displaced nine times and are at risk every day. (@zeanyahya1) 41% of goal reached. INCREDIBLY SLOW PROGRESS.

The Shehab family -- (€55,957/€85,000) This family's original goal of 50,000 has been reached, but has now been raised to 85,000 as the family has added more people to their fundraiser (as they can't make their own), including a 3-month old baby. Please continue to support this family!! (@danashehab) 66% of goal reached.

Mahmoud Al-Sharif -- ($10,503/$60,000) Mahmoud's wife, Soha, just gave birth to her and Mahmoud's fourth child on 8/12/24. Please please help this family of six, including the newborn, get to safety. (@mahmoud-sharif) 17% of goal reached. INCREDIBLY SLOW PROGRESS.

SHARE AND DONATE !! remember that even a small amount can go a long way.

[soaps-mohawk]

Summary: Task Force 141 operates successfully without an omega, at least that’s what Price has been saying since its formation. Two alphas and two betas balance the pack just fine, and they have the numbers to prove it.

It works for a while, until the Omega Initiative is born and the 141 find themselves having to adjust to the sudden addition of an omega to their pack. Fresh out of an institute, you’re hardly fit for their secretive, dangerous world, or so Price thinks. 

As each member of the team gets closer to you, things begin to come to light, not only about you but about the decision to force you into their lives.

Maybe, just maybe, Price was wrong and the 141 does need an omega after all. 

Pairings: Poly 141 x reader, Price x Gaz, Ghost x Soap

Warnings: Alpha/Beta/Omega dynamics, NSFW content, explicit smut, fingering, oral (m and f receiving), knotting, biting, claiming, mating cycles, Alternate Universe, a/b/o typical classism and sexism, age differences, military inaccuracies, canon typical violence, blood, weapons, language, no use of Y/N, brief torture, hurt/comfort, let's be real this is so unrealistic but it's a/b/o you're not here for accuracy.

Chapters containing smut are marked with a *

Updates are posted on the weekends, either Saturday or Sunday PST

This fic can also be found on my Ao3 -> HERE

I will no longer be using a taglist for this fic, please follow THIS BLOG and turn on notifications

**This fic is currently in progress**

NAVIGATION PAGE CRCB DIRECTORY

Part 1 - The Omega

Chapter 1 - The Introduction Chapter 2 - Adjustments Chapter 3 - Speak Their Language Chapter 4 - You Can Be Useful Chapter 5 - What I Want *

Part 2 - The Bond

Chapter 6 - One Step Closer * Chapter 7 - Sweet Strawberry Chapter 8 - The Thing About Ghost Chapter 9 - Save Me Chapter 10 - Treat Me Gently*

Part 3 - The First Heat

Chapter 11 - It's Coming Chapter 12 - Fire In My Veins* Chapter 13 - Piece Me Back Together* Chapter 14 - The Aftermath*

Part 4 - The New Normal

Chapter 15: Bonnie* Chapter 16: Big Brown Eyes * Chapter 17: Alone Chapter 18: Don't Let Me Go Chapter 19: Daddy Issues Chapter 20: The New Normal * Chapter 21: Crime and Punishment * Chapter 22: I Won't Be Gentle

Part 5 - A Pack of Five

Chapter 23: Regrets Chapter 24: The Last First Time * Chapter 25: Animals * Chapter 26: Fuck * Chapter 27: Drown In It * Chapter 28: Two Is Company, Three Is A Party * Chapter 29: There's Something Wrong With My Omega

Part 6 - The Tragedy

Chapter 30: Butterfly's Wings Chapter 31: Forced Proximity Chapter 32: The Tragedy Chapter 33: Ghosts of the Past Chapter 34: The Whole Truth

Part 7 - The Aftermath

Chapter 35: Threads Chapter 36: To The Sea Chapter 37: The Silence Chapter 38: Shattered

Title card made by the beautiful @141wh0re

[sashasspace]

MUST-HAVE MODS FOR LOVESTRUCK 💕

MODS Cupid corner recolor Attraction overhaul Custom Preference mod (needed for custom preference mods) Improved Turn-on Turn-off Romantic Boundaries set in live mode Lovestruck auto breakup tweaks Choose turn-on turn-off live mode Teen Cupid's Corner Attachment Styles Cupid's Corner refresh cooldown Digital Romance Kiss and Make Up Scan the room fix Sims 3 to Sims 4 romance update Love Language mod

CC Lovestruck Add-ons Lovestruck top recolor Lovestruck Add-ons Game box recolor Functional Dumbbell

Override Jacaranda Tree CC Wrench override

new mods/ cc /overrides I found since this video 1. Zerbu Cupid Corner Tweaks 2. Additional In-Date Choices 3. Lovestruck: Romantic Satisfaction Metric Only for Officially Committed Relationships 4. 7 wild dates tweak 5. Hide relationship with multiple sims 6. Hair add-ons 7. Colored UI attraction 8. Base game loc add-on 9. DEVIANT Accessory Harness 10. Love hard add-on 11. Taxi override 12. Ciudad Enamorada snow 13. Lovestruck wall recolor 14. Selfie override 15. Recolor of Lovestruck 16. Recolor part 1 / Recolor part 2 17. Small Lovestruck mods by Down-in-Simsland 18. Basic breakup bed clean 19. Background replacement for Cupid's corner 20. Personality mod got updated to include Lovestruck 21. Hopes and Fear got lovestruck wants 22. lessromancediscoverymoments 23. costumefunctionsforalldressers 24. datesocialsspeechbubblesaddon 25. nocupidscornernotification 26. customrelationshiplabelsforallages

27. Lovestruck add-on part 1

28. Lovestruck add-on part 2

29. Lovestruck dress recolor

Romance mods I've posted in the past: ONE TWO THREE

Thank you so much for all these amazing mods 💗

[pitflight]

list of palestinian fundraisers from people who have reached out to me- each has a name, tumblr @, amount raised/goal, gofundme link, verification, and any additional info. please donate if you can and share these families’ fundraisers. additionally, visit their blogs and gofundmes and read their stories in their own words. all of them have persevered through so much, and as many of them have said, it’s not easy to ask for help- take some time to listen to them. this post will be edited regularly with updated information and additional fundraisers. please check the original post and reblogs for updates and share the latest version.

version date: 9/16/24

30 FUNDRAISERS (1-30) BELOW THE CUT ⬇️, 18 AND 26 MORE IN ADDITIONAL REBLOGS- PLEASE SHARE FULL LIST OF 74

1. dina @dinamahammed99 $5,985/$15,000 gofundme pinned post verification

2. karam al nabih @karamrafeek £45/£7,000 gofundme pinned post post with verification new gofundme (previous had problems, stopped at €13,880)

3. mohammed salem @save-salem-family2 €5,284/€10,000 gofundme pinned post with verification

4. fidaa @fidaa-family2 $30,837/$75,000 gofundme pinned post with verification

5. bilal @shadowyavenuetaco £5,480/£50,000 gofundme main post verification nephew of @/yasermohammad, current short term goal of £5,500

6. mahmoud ayyad @mahmoudayyad €5,701/€55,000 gofundme pinned post verification

7. asmaa ayyad @asmaayyad €20,509/€45,000 gofundme pinned post with verification

8. muhammad imad abdel latif sharab @d-mohammed and @adham89s €4,628/€100,000 gofundme main post verified by 90-ghost on prior blogs that are now inactive

9. motaz @motaz225 kr58,229 SEK/kr250,000 gofundme pinned post verification

10. ahmed jehad @ahmad-syam-blog $4,557 CAD/$40,000 gofundme post with verification

11. sara hussein @sara-97a €1,342/€50,000 gofundme post with verification

12. asmaa @asmaamajed2 $9,809/$50,000 gofundme pinned post verification (90-ghost reblog)

13. mohammad @yasermohammad €22,493/€35,000 gofundme pinned post verification bilal @/shadowyavenuetaco’s uncle and family, frequent short term goals

14. salam @save-salam-family €23,281/€40,000 gofundme pinned post verification (90-ghost reblog)

15. marah baalousha @freepaleatine95 $10,086/$50,000 gofundme pinned post verification

16. falestine @falestine-yousef $22,284/$40,000 gofundme post with verification and her family's other gofundmes, including doaa and tahrir (below)

17. ola @olagaza $49,351/$85,000 gofundme pinned post with verification (vetted list links match)

18. ahmad @ahmad-gaza $5,601/$35,000 gofundme post with verification

19. khaled smeer @khaledgazacity $758 AUD/$60,000 gofundme main post no verification yet but gofundme is donation protected and very new and reverse image search is clear

20. amal @amalgheelan and @amalgaza99 $1,945/$5,000 gofundme pinned post verification

21. doaa @dodoomar12345 and @free-gaza2 kr208,147 SEK/kr300,000 and $6,616/$12,000 gofundme 1 gofundme 2 pinned post 1 with verification pinned post 2

22. hanaa @hanaa-yousef and @hanaa987 £17,876/£50,000 gofundme pinned post with verification

23. aseel @aseelo680 $25,987/$50,000 gofundme pinned post verification and art raffle

24. tahrir @tahreer-199 and @tahreer-1990 $9,310/$65,000 gofundme pinned post verification

25. nabila @nabila58 and @nabelamohamed $3,580/$10,000 gofundme main post verification

26. safaa asaad @safaa18mero $15,381/$75,000 gofundme pinned post verification

27. hashem @hashemsh12 and @hashemsh92 €9,860/€45,000 gofundme pinned post verification

28. ahmed @ahmeddahlancampaign €168/€35,000 gofundme main post no verification yet but likely legit

29. youssef @yousefjehad3 $8,427/$15,000 gofundme pinned post with verification

30. anas al-sharfa @anasalshrafa €8,396/€50,000 gofundme recent post no verification yet but likely legit

[lqfiles]

PAY THE PRICE — smau

after getting evicted out of your old place, you're left with no other choice but to look for a cheaper alternative. which is how you end up becoming neighbours with lee haechan, who has a passion for music and disturbing whatever peace and quiet there is.

or in which you found yourself a very nice apartment, the only issue? your neighbour is your friend's somewhat ex-situationship who won't stop playing his guitar at 2 am in the night.

neighbour!haechan x fem!reader

genre ; enemies to lovers, angst, fluff, probably slow burn, humour, neighbours au.

extras ; haechan is kinda an asshole | boy next door + likes everyone but you trope-ish | profanity and death jokes because they’re silly! | probably romantic tension | some mark x reader here and there | renjun and jaemin having their own e2bffs moment | probably inaccurate depiction of how someone would get evicted pls don’t shoot me 😅

notes ; i love haechan i love haechan i love haechan i love haechan i love haechan i love haechan i love haechan i love haechan <333 idk i got nothing better to do now so i’ll just start this because i know i won’t be posting any of the other long fic wips any time soon 😭

PLAYLIST ; She , Tyler The Creator — For The Night , Chloe Bailey — IDK WHAT TO TELL YOU , Bktherula — Surprise , Chloe Bailey — I Wanna Be down , Brandy — Suite Life , FLO — Is It A Crime? , No Guidnce — Round&Round , NCT U .

STATUS ; ongoing and hopefully regular updates.

profiles (1) profiles (2)

intro

1 ) jaehyun’s trophy wife

2 ) free cookies (not really)

3 ) midnight disturbance

4 ) attempted murder?

5 ) THIS IS FAMILY

6 ) haechan’s second identity

7 ) kiss buddies and useless complaints

8 ) critically acclaimed idgaf veteran

9 ) founders keepers..?

10 ) yangyang’s new interest (y/n)

11 ) a late welcome party

12 ) invest in a cage jaemin

13 ) cat fight (REAL)

14 ) the cure to a lack of sleep = cup pong

15 ) who said quiet guys can’t be freaky?

16 ) you got a girlfriend?

17 ) i DO have a girlfriend

18 ) this is life, i love life..

19 ) nah. they fucking.

20 ) let’s play apex?

21 ) whole house mad

22 ) drunken regrets

23 ) he’s got to be fucking with me..

24 ) a sincere apology letter (kinda)

25 ) are we cool or not?

26 ) we’re good (for real)

27 ) a personal guitar lesson

28 ) LIVE TWEETING YNHAE MOMENTS

29 ) a moment of vulnerability

30 ) friendly q&a between friends

31 ) that’s strange.. that’s weird..

32 ) solution to job loss = family guy (???)

33 ) what has jaehyun done for society?

34 ) ynhae bonding activity hours

35 ) an unwanted double date with yangyang

36 ) an overwhelming realisation

37 ) the universe can kill itself

38 ) a “what are we” conversation

39 ) i got that hair too, kinda

40 ) reviewing haechan’s tweet and new issues

41 ) diagnosed with the crush disease

TBA . . .

BONUS:

TBA . . .

TAGLIST is closed

[jirsungs]

DRUM ME, STUPID! ☆ p.js

pairing: drummer!jisung x fem!reader

drum me, stupid! synopsis: a story about a college student enjoying her life in school perfectly fine, until one of her friends drags the group along to watch their school's band perform. little did she know that day would be marked as the day her whole world turned upside down because of a particular, nonchalant, and difficult drummer boy. a drummer boy who spilled his entire drink on her brand new outfit at a party and never came back.

genre: college au, social media au (some chapters will be written though!), music band au, slight enemies to lovers, unrequited love (for a bit), whole bunch of fluff, angst, mutual pining, silly humor

warnings: explicit language, college partying, alcohol consumption, A LOT of banter between characters including sexual/kys/death jokes of the sort, reader's kind of an ass (in the beginning), jisung ends up being a lover boy once the "nonchalant" wears off, yeonjun flirts like 24/7, overwhelming feelings that the characters can't handle

author's note: hi! since i've always enjoyed reading smaus and always get writers block with full on stories, i decided to make my own :] please excuse my bad knowledge on any of these majors or experiences and none of this reflects the real lives of the kpop idols! this was written solely for entertainment and fun! enjoy!!<3

comment if you wish to be tagged for the story's updates!

profiles #1 ☆ profiles #2

chapters will be added once they're posted!

episode 1: i did NOT agree to this gc name!

episode 2: costumers of ningcreates?!

episode 3: the universe is out to get me

episode 4: p.y.t (pretty young thing) (written)

episode 5: jisung's a coward, we all say in unison

episode 6: the latte lounge incident (written)

episode 7: hating each other era

episode 8: future uncles and aunt

episode 9: apologies & new beginnings

episode 10: what a lover boy!

episode 11: love like the movies (written)

episode 12: super obvious, but still not a confession

episode 13: my wonderwall, at least i hope so (written)

episode 14: she's going ghost mode on me

episode 15: ain't no way a girl got you like this

episode 16: i missed you

episode 17: i missed you (too) (written)

episode 18: finally mine!

episode 19: ningcreates (expanded) fan club

episode 20: she fr got him liking musicals

episode 21: drummer's girlfriend duties

episode 22: i fear yeonjun's loyalty to latte lounge finally paid off

episode 23: first mistake: letting y/n out of your sight wtf

episode 24: you maam caller

episode 25: wym drummer boy has a driver's license??

episode 26: only losers make wishes at 11:11

episode 27: pussy boy stand up

episode 28: no girls allowed at rockway rehearsals! (written)

episode 29: crashed ynsung's date lol

episode 30: ning bag that shit

episode 31: drummed her stupid!

END! started: 06.23.24 finished: 09.03.24

BONUS CHAPTERS:

#1: close to you (written) tba. . .

#2: the not-so-silly apple or orange juice debate tba. . .

#3: finally meeting the parents? tba. . .

© JIRSUNGS. ANY TRANSLATIONS/REPOSTS/PUBLISHES OF MY WORKS ON ANY PLATFORM ARE STRICTLY PROHIBITED! ALL COMMENTS, REBLOGS, LIKES, & FEEDBACK ARE GREATLY APPRECIATED! THANK YOU SO MUCH! I LOVE YOU, MWA! <3

[dykesbat]

1st masterpost of palestinian fundraisers i'm spotlighting on my blog + verifications

last updated: july 22, 2024 second masterpost

1. Doctor Moath Abu Samra & Family Evacuate Gaza - $20,880/$50,000 [SLOWED] verified by Operation Olive Branch - row 85 individual reblog post here

2. Urgent Appeal: Save Little Yusuf and His Family Amidst Gaza - €41,596/€85,000 [SLOWED] ***has only received €25 in the past 24 hours verified here by el-shab-hussein. follow the fundraising organizer here on tumblr @/ahmednabubak individual reblog post here

3. Mohamed Hamad and his family dream of reaching safety - £10,301/£50,000 [LOW] [SLOWED] verified by here by el-shab-hussein. follow mohamed on tumblr at @/mohamed-hamad individual reblog post here

4. Saving My Family from the Horrors of War in Gaza for Firas Salem - €34,065/€65,000 [SLOWED] ***has only received three donations in the past 7 days verified here by el-shab-hussein. follow firas on tumblr at @/firassalemgaza individual reblog post here

5. Help Sana’a and her family evacuate from Gaza - £55,246/£70,000 [SLOWED] verified here by el-shab-hussein follow sujood on tumblr at @/sujoododeh individual reblog post here

6. Help the Qanou Family - £4,336/£55,000 [LOW] verified here by nabulsi. follow raghad here on tumblr at @/rhq274 individual reblog post here

7. Help Nahla and Amal Family to Rebuild their life - €3,671/€80,000 [LOW] [SLOWED] ***has only received one donation today verified here by nabulsi. follow the fundraiser on tumblr at @/jrk85 individual reblog post here

8. Helping Ahmed's Family: Escaping War to a New Life - €34,928/€39,500 verified here by nabulsi. follow ahmed on tumblr at @/ahmedabuyamin. individual reblog post here

9. Help the Abu Shammalah Family Find Safety and Rebuild - €10,798/€100,000 [LOW] ***has only received 3 donations in the past two days verified here by el-shab-hussein. follow ahmed (fundraiser's organizer) on tumblr at @/ahmed8311. individual reblog post here.

10. Help Ahmed family to travel to a save place - £6,765/£30,000 [LOW] verified here by nabulsi. follow ahmed on tumblr at @/ahmed-ziad. individual reblog post here.

11. Please help Shamaly family SURVIVE Gaza & start a new life! - $24,135 CAD/$90,000 [SLOWED] ***this fundraiser has only received 4 donations in the past 7 days verified here by fallahifag. follow the fundraiser on tumblr at @/familydeea. individual reblog post here.

12. Help Alaa family to travel to a safe place - £25,622/£56,000 [SLOWED] ***has only received 2 donations today number 99 on el-shab-hussein and nabulsi's spreadsheet. follow alaa on tumblr at @/alaaalkhateeb. individual reblog post here.

please donate/share if you can! fundraisers marked as slowed have had little to none donations.

[todayisawthewhxlewxrld]

Digital Display

you’re what i’ve been waiting for

synopsis// maybe it wasn’t your smartest idea to fall for the guy your friends introduced you to, who’s also trolling you online—but, in your defense, how were you supposed to know they’d end up being the same person?

status// finished!

updates// everyday unless said otherwise

warning// no curses!au, streamer!au, friends to lovers?, inumaki is just a strange strange silly (cringe) man and lowkey rich???, kys jokes bc comedy, and also rlly cringe and corny jokes bc comedy, n if anyone is ooc take that up with the universe not me!

☆ this smau wasn’t inspired by a song but the title was!! ‘twas inspired by digital display by ready for the world, but yeah besides the title and lyrics on here the song holds no relevance :) ☆

to raise my low score

so excuse me if i start to play

round 1. annoying x2

round 2. twinsies

round 3. desperate

round 4. why nobody gaf

round 5. gold digger

round 6. i keep it 99

round 7. ignorance is bliss

round 8. weakest link

round 9. not going well

round 10. i love science

round 11. biblically accurate angel

round 12. pucker up

round 13. normal and mildly responsible

round 14. just a coincidence

round 15. sleeper agent

round 16. one step ahead

round 17. big and greedy

round 18. strangers to lovers

round 19. poet

round 20. doing a bit

round 21. i rebuke you

round 22. taken care of

round 23. shaking in excitement

round 24. extremely nonchalant

round 25. i got you

round 26. hope not

round 27. get pranked

round 28. last hope

round 29. silent or silenced

round 30. 3 vs 2

round 31. step on it

round 32. romance is everywhere

round 33. sick work

round 34. do it scared

round 35. what are the odds

round 36. beautiful emo prince

round 37. why waste time

round 38. you or nothing

round 39. stay mad

round 40. romantical tension

round 41. normal human things

round 42. middle school relationship core

round 43. no pressure

round 44. government spy

round 45. troll a little

round 46. enjoying the view

round 47. the vibes

round 48. stop light

round 49. it’s so over

round 50. what about us

round 51. we’re good right?

round 52. i no no wanna

round 53. FINISH HIM

round 54. gtg

round 55. GET OFF STREAM

round 56. keep up

last round. falling for me again

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[stil-lindigo]

link

on twitter, a viral thread started where people around the world shared their translations of “If I must die”, the last work of Dr Refaat Alareer also known as "the voice of Gaza". A beloved poet, teacher and life-long activist for Palestine, he was recently assassinated along with members of his extended family by a targeted Israeli air strike. His loss leaves a hole in the heart of palestinians all over the world.

Below the cut, I’ll be posting the translations of his poem, with links to the original posts. Unfortunately, tumblr limits posts to a maximum of 30 images. I will update when I can.

Arabic (Refaat’s mother tongue)

--

2. Spanish

--

3. Irish

--

4. Dutch

--

5. Greek

--

6. German

--

7. Vietnamese

--

8. Tagalog

--

9. Serbian

--

10. Japanese

and the traditional japanese calligraphy version

--

11. Nepali

--

12. Tamil

--

13. Bosnian

--

14. Indonesian

--

15. Romanian

--

16. Italian

--

17. Albanian

--

18. Urdu

--

19. Turkish

--

20. Polish

--

21. Norwegian

--

22. Galician

--

23. Swedish

--

24. Jawi

--

25. Bengali

--

26. Russian