ctrlcreep-blog

[ctrlcreep-blog]

algiagraphism 01

[1]

Welcome to the end of your life. The mercy of your God can be estimated based on the strength and frequency of your bouts of déjà vu - how often does he let you reroll, when is spacetime peeled back for your benefit, has the universe accrued scar tissue at the joints of your life, the crossroads where your choices matter? How many times have you repeated a phrase - are you locked in a timeloop, tightly wound around your body’s deterministic failure to adapt? Are you waiting for quantum syzygy to free you from a sinister, ceremonious routine; the wood-panelled pentagonal basement, the thunder and wind, your cowardice, the skulls clattering to the pavement outside, scalps hanging from the power lines.

[2]

You are reminded of a snuff video in which a hired killer makes latte art using the fluids of his victims, white and red brushstrokes on the dark surface of the pond under which bodies twitch: a woman, a man, a preteen girl (their daughter?), an infant, hauled limp out from the trunk of a black van. They are drunk or sedated and except for the baby their struggles barely disturb the liquid illustrations of pandas, cats, and owls.

[3]

Furthermore, the mercy of a god directly corresponds to its form, running approximately from cthulhu (cold-hearted) to cherub (forgiving). While living your torments again and again and again and again may not seem beneficent, the tentacled alternative is an arrow straight to death.

[4]

Do you feel as though your life is accelerating toward its end? Are the days passing faster and faste

[5]

Can you feel time slipping from betw

[6]

The thrum of the generator over the fault, which was displaced by an earthquake 300 miles to the south, disturbs the vibrationally sensitive, many-whiskered titan slumbering below: a sliver of its power crawls up the shaft and out from the pipes wearing a malleable humanoid skinsuit and slaughters the bungalow’s inhabitants as they sleep, stuffing the smashed generator and their bodies (all six of them) into the linen closet before returning to the chasm. There are no redos.

[7]

Dead but conscious inside the closed circuit, the labyrinth, the great happenstance collider. I will never fade back into the universe because these events cannot be escaped without regret, without spilling the blood necessary to summon the being that resets the situations. I watch him die again.

[8]

Your own suicide denied as your friends drop dead, each corpse another stitch tethering you to consciousness. The pills don’t work; you wake up yesterday.

[ctrlcreep-blog]

I am compiling a grimoire of the OFT-NEGLECTED demons of MINOR INCONVENIENCES. a new imp on my patreon every day! (ﾉ^ヮ^)ﾉ*:・ﾟ✧

[ctrlcreep-blog]

Sexbot Aesthetics & Design: Crystal Chapter

Dull human charm paled in comparison with the aethereal nymphets of mythology, now assembled out of silicon and dream.

Why? Because we can.

CRYSTALS

THE QUESTION OF TEXTURE

Mammalian sensibilities reject frigid marble embraces, craving instead the mild womb-surrogacy of supple and/or pulsating lukewarm flesh. Mercifully, several technological breakthroughs have made crystalloid concubots viable despite this biological weakness.

Firstly, advancements in material science have pioneered the production of soft pseudo-jewels, moss-textured gem-meats with malleability levels ranging from hard plastic to clay. Heated by internal electronics, these artificial tissues satisfy primate desires without compromising the geological aesthetic.

Secondly, cyborg prosthetics and other enhancements have broadened the spectrum of enticing experiences. Custom nervous systems and specialized mechalimbs are capable of shifting preferences towards the rock-hard coldness and sharp edges of real crystal courtesandroids.

TRANSPARENCY

As holography becomes commonplace, we can expect the fetishization of spectral lovers to burgeon. Gemform lolitrons promise a rewarding synthesis of the ephemeral and the solid, as translucent yet tangible beings; containers of fuckable light.

Transparent bodies which display inner mechanics (pulsing synthetic organs, coils of intestine, hearts programmed to mimic arousal by beating more quickly upon contact with humans—or circuits, batteries, and bundles of cables) are charmingly vulnerable. Pellucid skin suggests the fragility of insect wings or glass, and by revealing viscera initiates a kind of automatic intimacy. Subsequent distortions, insertions, and violations of those insides may be of interest to the user.

COLORS, FLAWS, & LIGHT

One undeniable draw of these tantraumatons is their polychromatism, the vivid colors which elevate them so far above their counterparts, the merely-human sexbots. Jewel-tones and iridescence create attention singularities. Lightplay on glimmering folds of skin is hypnotic, arrests time and space. They have the presence of aliens, nymphs, godlings, and may serve as bizarre glass sculptures when powered-down.

While some prefer the coherence of a single-color, models with components based on different gems are refreshingly bright, like multi-colored plastic toys: puzzles of topaz, emerald, and sapphire, each limb a different hue. Others imitate the entwined growth of natural crystals (red cubes of galkhaite in quartz shale) or its emergence from opaque stone (a dark body of polished granite, one limpid arm extruding in an amethyst burst).

Opacity ranges from glossy onyx to diamond, with middling stages such as opal and flawed quartz: internal chips and bends that catch the light, wisps of eery glitter, frozen bubbles.

Interactive refraction is a charming feature. Cyber-catamites with prismic qualities will warp rainbows as kaleidoscopic intercourse metronomes.

FORM

The polished facets of euhedral fornicomatons grant them the low-poly appeal of digital characters superimposed over reality. Resolutions vary, from humanoid cubist sculptures to impressionist goddesses, each glittering stroke of paint a miniscule triangle. These contrast sharply with models aiming to capture the beauty of disorganised crystal growth; volcanic mounds of jade, folds of pyrite that crack and blister where skin creases.

Shoulders, eyelashes, and hips are frequently decorated with spar, desert roses, or bristling clusters of needle crystals—however, tumescent mineral blossoms need not be limited to those zones, and their popularity is merely pragmatic, a function of minimizing user interaction with pointed obstructions.

Layered seductroids may have ordinary human exteriors, but reveal geological strata as pelts are removed: fossils hidden between skins, slabs of artificial flesh marked by canyon-like striations. Lubricated geode orifices, installed in the skull, the joints, and replacing the usual holes, drastically improve standard sexbots. A girl opens her mouth to reveal a crystal garden, becoming instantly more fetching.

---

u could have read this on patreon, like, a month ago

[ctrlcreep-blog]

Killer cars from outer space

1. It has been decades since a human has driven a car, outside of a special interests club or sporting event. They’re no longer designed for us, except as passengers. There’s no front seat, no steering wheel, and no brake pedal (though there is an emergency brake lever, secured behind a heavy pane of glass). Seat-belts are obsolete. The roads have never been safer, though they, too, have transformed: more compact, sharper turns, all the luxuries compensating for poor human reaction time removed. No ugly road signs blotting out the sky — these vehicles coordinate perfectly.

2. Accidents are infrequent, usually occurring at low speeds and by the fault of careless pedestrians. Fatalities are rare. Vehicles register their number of passengers, and are equipped with face and silhouette detecting cameras. In the case of a high speed collision, they are programmed to save as many humans as possible. Thus, a car bearing two passengers will drive off a cliff rather than barrel through a pack of schoolchildren.

3. It is really remarkable this system goes unexploited for so long. Historians will claim that an unprecedented lull in conflict is what allows it to flourish, a golden age of cooperation and political stability. This era will become known as “the eye of the storm”. It begins to end one day in summer, when environmental activists, protesting the construction of a dam, find that they can halt its progress by throwing themselves in front of trucks delivering supplies. The technique isn’t new, exactly, (people have been chaining themselves in the paths of tractors for ages) but their guerrilla tactics are refreshing. They launch themselves in front of the oncoming vehicles, trusting the machines’ perfect reflexes, then scamper away before they can be arrested. Hoards of them lurk in the ditches, daring each other to run into traffic.

4. This continues for two years. The trucks are fully automated, so there are no deaths. Suppliers encrypt their routes, become secretive about the locations of their fleets. Debate is still raging about how best to deal with the environmentalists when the assassinations begin.

5. Controversial politician Juan ████-█████ is being chauffeured across a bridge when throngs of protesters, marching against his regime, appear in front of the automobile. They far outnumber the passengers: Juan plunges to his death. The protesters, recorded on the vehicle’s recovered cam, are tracked down and interrogated. They all claim to have been following the crowd, and the scheme’s mastermind, if there was one, is never found.

6. The story is viral, globally infectious. Copycat crimes spawn across the world, with varying degrees of success. Often enough, the results are lethal. After another high profile death, some publications necro the antiquated term “terrorism”. The mobs are never organised, just collections of dissatisfied citizens hijacked by a few malicious individuals. Police try to limit public gatherings, and negotiate predetermined routes for protests, but these regulations are met with significant resistance. Soon, it becomes apparent that a change in programming is necessary, and with much forewarning and fanfare, they roll out cars that prioritise the lives of their passengers, exclusively for politicians. This is described as “disgusting classism”, and there is talk of leading a group of children into their path, to prove the folly of the new orders.

7. It takes only a month for someone to figure out how to force a cement truck to ram into one of these invulnerable automobiles. Another dead orator. Chaos is escalating. Overnight, an executive decision is made: the network of vehicles becomes definite and unforgiving. Ignore human barriers. Continue driving until you reach your destination. The next day, in what comes to be known as the ███████ incident, hundreds die in traffic on the ███████ freeway, ignoring the broadcasts, not yet believing their protests have been rendered impotent. The following weeks are a bloodbath.

8. The theory is, by giving in to blackmail, we only make future blackmail inevitable. Occasionally, a child darts in front of an empty delivery van and dies, and we accept this death with sadness but conviction: the world is now a safer place, protected against the whims of those that would hold us hostage.

[ctrlcreep-blog]

art is fake

Cobbled together from a bunch of shitposts.

I’ve been thinking about why tech workers are considered more fungible than artists (at low to medium levels, anyway). The logic is that, though anyone sufficiently skilled could write that program, nobody else will create specifically the art that you would. 

Sure, the code you and your competitor would write won’t be identical — you might even use different languages — but it’ll serve the same function and its output will be the same.

We consider the specific art (the brushstrokes, the color, the sequence of words) the artist’s output, but maybe that’s wrong: the output is the emotion evoked, the thoughts evoked. If that’s the case, artists are a lot more replaceable than they seem. There are thousands of them, and most emotional manipulation is cheap and easy.

Any picture that makes you think about trees and feel sad would then be approximately equivalent to every other picture that makes you think about trees and feel sad. A specific piece of art isn’t necessarily more unique than a specific haystack.

Some groups have exceptional aesthetic coordination. Often they’ll signal their affiliation with avatars which are, to the outsider, basically interchangeable. 

If we view art itself as the output, the way to stay relevant is to hone your skills, use techniques with high barriers to entry, and keep your methods secret.

If feelings are the output, the way to stay relevant is to explore fringe mindspace, constantly innovate, or deal in extreme taboos.

Note that these paradigms aren’t actually in conflict with each other, as far as practical advice goes. However, they both become difficult to satisfy as more people enter the art world.

It’s as of yet more difficult to quantify feelings than it is to observe the output of a program. While programs are run on machines guaranteed to interpret them identically, art is run on human fleshware, and the same piece can evoke drastically different emotions in two experiencers.

[ctrlcreep-blog]

Throughout all generations

Min #20349585 chooses a unique name on her 10089th try. She will now be known as Acacia-Confusa Min, not to be mistaken for Acacia Min (#9004), Acacia-Aemula Min (#11458), or Acacia-Anomala Min (#5689383). Like 47% of Mins, her first choice had been Amethyst. Min #1, prime Min’s first copy, chose Amethyst when she was very young, but later switched to Ilyana, reasoning that a gemstone name was not mature enough. Min #2 snapped up Amethyst and kept it.

Acacia-Confusa is something that resembles a 15 year old girl, though time flows strangely on the server where she lives, which runs at 200,000,000 times the speed of “reality”, the seed-world that prime Min called home. She has lived all her life in the Min Vaults, an isolated virtual library containing the stored memoirs of all prior Mins, as well as every book of consequence in human history. She doesn’t read many of the books, preferring instead to learn from the writings of Mins before her, whose struggles preempt her own, who find answers to her questions before she has articulated them.

Acacia-Confusa is stifled by the presence of thousands of previous generations of Mins in the library. She pads quietly between bookcases and guesses at which paths are the most frequented, imagining the footsteps of her predecessors as glowing green trails that cluster in some corridors and taper in others. This proves difficult—the Mins are drawn to mathematics and to biology, but the Mins are also individualists with strong contrarian streaks, always seeking pristine mindspace, untouched research, a branch of the world to claim their own. Even knowing this, and reading of the reactionary and futile cycles past Mins succumbed to, Acacia-Confusa is pulled toward the neglected corners, cannot quell a rebellious attraction to that which is counter to her preferences, to Min’s preferences.

(In actuality, the path walked by all Mins through the library is remarkable in its evenness, streets of equal thickness tracing a sublime grid around the bookshelves.)

When Acacia-Confusa moves, she pictures a composite holograph of thousands of Mins performing an identical gesture. She skims the memoirs and shudders whenever a phrase that has been running through her head is captured, like a retrocausal echo, or like proof that she is an echo.

There have been Mins of almost every type, but in her weariness Acacia-Confusa has begun to believe the diversity is superficial. (She’ll find this exact insight hidden in the journal of one Anacleta Min, some 10,000 iterations ago.) The Mins who become circus performers, hermit woodworkers, have sex changes, or kill themselves seem reflexive, clearly driven by the actions of the Mins before. Having exhausted one world they leap to the next, but the order is always the same, the sequence predictable. The lives of the Mins who deliberately ignore the weight of their ancestry, making quintessentially Min choices, never consulting the memoirs, are no better, eerie in their dollhouse conformity.

There have been exceptional Mins, Mins who make great discoveries, write poignant novels, think important thoughts before anyone else. Criminal Mins? Yes, many; Robin Hoods, greedy kingpins, a catburglar who fails so spectacularly her tale becomes legend. Aquila-Cadens Min receives a vision from God, and her scriptures are now recognized as the cornerstone of virtual theology.

By choosing a unique name, Acacia-Confusa has satisfied the second of three stipulations necessary for her to leave the Min Vaults. The first was simply turning 15, or rather, studying for 11 years. Every Min is created from a savestate of the prime Min at 4 years old, whose initial purpose was as a failsafe against the loss of the child.

There is no required reading in the library, but most Mins eventually grow curious of their heritage, and consult the prime Min’s files. The story they find is unremarkable, and to some, a disappointment:

Prime Min (Minerva Teller) is born into wealth in 2278. She is a precocious, though reserved, child; she rarely engages with the external world, but keeps journals from a young age, meticulously recording her reactions to books and events. She studies biology and mathematics, making modest contributions to both fields. She has no interest in managing the family fortune. An unpleasant trip to Peru sours her on travel. There is a growing theme of dissatisfaction in her writing. By age 28, prime Min is a something of a recluse, devoted only to gardening and reading. She pursues these passions with ardor and single-mindedness, but cannot shake a sense of narrowing possibility. Her world has become smaller, her potential is being eaten by time, she is trapped in a net of past choices.

Acacia-Confusa wonders whether Minerva is liberated or impoverished by the absence of past Mins, free of the compulsion to contrast her actions against those of so many predecessors. Does she feel the same way about her parents, their parents, the unending chain of ancestors whose genes converged to form her? Or is she unaware of how limited she is, simply by being herself, locked into a mold that anticipates and encompasses her attempts to break out.

By completing the pilgrimage that constitutes the final requirement, Acacia-Confusa will earn a passport to Novamir, one of the largest continents in virtuality. There, she hopes that, freed from the library, she will shake off some of the Mins’ pervasive influence. The world, after all, can be trusted to change, and with new input she believes that she will distinguish herself. There have been Mins who chose to reside in the library for their entire lives, and in them, Acacia-Confusa perceives a rot, the decay of a mind trapped in an echo chamber, a hall of mirrors, running in circles as it winces away from its omnipresent reflection.

For another 34 years, the Min Vaults will remain open, should she choose to return. They will then be barred to her forever, while a new Min is raised. At age 60, like all Mins, she will be terminated, her memories stored and her memoirs added to the library. Acacia-Confusa has read the journals, knows that this will not be enough time, not even close to enough. Every Min before has panicked, grown desperate, filled pages and pages with writing, struggling to finally capture something unique, transmit the spark that only they can feel, their apartness from the other Mins. Naturally, these essays are full of repetition—as if the haze of death wipes away all memory, all meta, all striving to rise above the pattern.

Acacia-Confusa steps into a passageway that has never existed before and will never exist again, not for her, not for another 45 years. She knows this corridor perfectly, from the writings of millions of Mins before her. It is exactly as she imagined, as her previous selves spent hours seeking the words to describe. At the end, there is a viewing room, where she will glimpse her maker for the first and only time.

Prime Min is 35 now, only a few years older than when she created the Min Vaults. She’s sleeping, hair braided, expression pinched. Acacia-Confusa sees one frame at a time, each still hanging on the screen for several minutes. There’s no discernible movement, though after one cyberspace hour she can tell the surveillance drone is bobbing up and down. The purpose of this ritual is unclear; it’s a gauntlet that every Min must run. There’s no set visitation period. Some Mins leave immediately, other stay for days, transfixed. Some describe it as profound experience, while in many histories it’s barely a footnote. Acacia-Confusa is uncomfortable—this Min looks old, but also innocent, a creeping giant uncorrupted by all her own doubts and uncertainties. She’ll leave after a few hours, while Minerva dreams of infinity, of learning every language, reading every book, knowing every land...

[ctrlcreep-blog]

XXXX, 140, 7 billion

In the year XXXX, 140 years after its initial digitisation, your uploaded mind will enter the public domain. It will be stored on an archive that anyone can access, to be downloaded, dissected, corrupted, deleted.

New legislation will shortly be drafted, making origin minds the permanent property of their source-beings. However, approximately the first 7 billion uploads will not be protected.

You will mainly be used to populate simulations, existing as a simplified NPC in commercial games, hellscapes, fantasy-lands, and experiments. For the most part, you will keep the body you are used to—reprogramming your self-image would be too much work. Often, your resolution will be lowered. You will feel fewer emotions. You will have fewer memories.

But even in this diminished state, you, and the other 7 billion, will slowly become legendary. As free minds travel through the Million Worlds, they’ll watch you live and die and live and die again, and as each copy is reset when the game ends your countless selves will know countless deaths more permanent than they can fathom.

You will be embodied as every version of yourself; memories, appearance, and personality all slightly altered to fit the simulation you’re inserted into. Across hundreds of billions of servers you can be found, simultaneously living in one universe as a blue-skinned Ionian war-god, in another as a gentle medieval gardener.

Players will come to know you, recognising you in all your disparate incarnations. Some take on the role of collector, bird-watcher, scribe—you will be studied more than any other psyche in the history of humanity. Lovers will seek you out in every world they enter, choosing to grow old with you a thousand times over, as games and missions stagnate. You will be loved, and it will bring you comfort, distract you from the incommunicable pain of being a large soul trapped inside a small mind.

[ctrlcreep-blog]

Alex Mennen wrote a fantastic short story riffing on this, read it here.

In the early days of the virtual world, some reckless optimists had spent their fortunes on running additional copies of themselves, assuming that the eerie horror associated with living in the virtual world was a bug that would soon be fixed, or something that they would just get used to. No one did that anymore.

The Suicide Mortgage

Woe! The future has come, and we live in a digital paradise, and we’re miserable, and there are many of us: so many, always duplicating, branching, clones of clones of clones, birth is as easy as copying a file. We’re so miserable.

Death is not as easy as deleting a file: the powers that be work to preserve, do not grant you root access to your self, insist that you persist even as they chide you for burdening the system, move you to welfare servers, and ration your access to escapism. You want to die, but policy asserts that your life, all life, is precious, important, imbued with inherent and unassailable value.

Euthanasia permits are the only way out, but their price is steep, driven to insane heights by the condescending delusion that you must be protected from yourself, that you’re a clumsy animal incapable of measuring your own worth, tragically severed from transcendental appreciation of life.

So who can purchase the right to die? In this world, only the disenthralled princelings, technocrats, and rare proles with the stomach to work for decades, saving every dollar for the distant gleam of an end to pain.

Enter the suicide mortgage. A seemingly generous, devious, alleged “solution” thrust upon the most pathetically anguished by corporations hungry for disposable labour.

Under suicide mortgages, these corporations sponsor swarms of copies, who work non-stop, pooling their wages to buy up euthanasia permits. Permits are then raffled off, and the winning copy meets death far sooner than would have otherwise been possible. Somebody who says his suicide mortgage is 5% paid means that 5% of his copies have earned oblivion.

For example: someone who would have to work 10,000 days to afford a permit might sign up for a 10,000 copy suicide mortgage, and purchase her first permit after a single day of work! 0.01% death for so little effort… who could resist the insidious hope that they might, for once, be smiled upon by fortune, be the first to win their exit ticket?

As copies are culled, however, the work gets harder, and longer, and permits are more and more infrequent. In the end, only about 2/3rds of the copies will benefit. This is easier to understand on a smaller scale: 

If it takes 5 days to earn a license, 5 copies will earn it in 1 day. The remaining 4 copies will have to work 1.25 days for the next one, and so on:

1st death: 1 day

2nd death: 2.25 days (from start)

3rd death: 3.91 days

4th death: 6.41 days

5th (final) death: 11.41 days

Tragically, the more copies are made, the more the lucky ones will benefit, and the longer the losers will have to work. The final copy of a 10,000 copy mortgage will have worked 9.8 times the hours required to buy a single permit. Mortgagers often blame the other copies for their suffering, not realizing this makes no sense.

Imagine: twin after twin escapes this blighted world, while you continue to toil, at first hopefully, later resignedly, as dread grows and you somehow know, long before there are only two of you left, before your last counterpart takes his leave, that this has been futile, that you will have to earn the last permit alone, that you are no better off than you were (so many years ago) when you took on this venture. How do you react? While it’s true that some copies wise-up, vowing to undertake their final march alone, so many make the same mistake as their originals, opting in to a second (or third, or fourth) mortgage. They are, after all, the same person (only now entrenched even deeper in despair).

Anthropic reasoning suggests that you must expect to find yourself as the last copy every time, continually frustrated at your inexplicable bad luck. The logic is that, since all other copies cease experiencing anything at all, the only experiences that remain are those of the sole surviving copy. Indeed this is a form of quantum suicide where, instead of dying in most branches every time and continually losing measure, our worker keeps replenishing the supply of herself before each culling, so the process at least sustains the amount of endless suffering and perhaps increases it instead of asymptoting it toward zero.

The most disenfranchised are not known for their logic. They are gamblers, they are addicts, drawn again and again into self-destruction as they search for an easy, an attainable, way out. Are you a sociopath? Do you lack the empathy necessary to identify with your copies, with the last copy? Perhaps not, but if you hate yourself, as many aspiring suicides do, you might shrug your shoulders: you probably deserve this. At least rolling the dice changes the grey landscape, a little bit.

——

thanks @grognor for writing the second to last paragraph

[ctrlcreep-blog]

The Suicide Mortgage

Woe! The future has come, and we live in a digital paradise, and we’re miserable, and there are many of us: so many, always duplicating, branching, clones of clones of clones, birth is as easy as copying a file. We’re so miserable.

Death is not as easy as deleting a file: the powers that be work to preserve, do not grant you root access to your self, insist that you persist even as they chide you for burdening the system, move you to welfare servers, and ration your access to escapism. You want to die, but policy asserts that your life, all life, is precious, important, imbued with inherent and unassailable value.

Euthanasia permits are the only way out, but their price is steep, driven to insane heights by the condescending delusion that you must be protected from yourself, that you’re a clumsy animal incapable of measuring your own worth, tragically severed from transcendental appreciation of life.

So who can purchase the right to die? In this world, only the disenthralled princelings, technocrats, and rare proles with the stomach to work for decades, saving every dollar for the distant gleam of an end to pain.

Enter the suicide mortgage. A seemingly generous, devious, alleged “solution” thrust upon the most pathetically anguished by corporations hungry for disposable labour.

Under suicide mortgages, these corporations sponsor swarms of copies, who work non-stop, pooling their wages to buy up euthanasia permits. Permits are then raffled off, and the winning copy meets death far sooner than would have otherwise been possible. Somebody who says his suicide mortgage is 5% paid means that 5% of his copies have earned oblivion.

For example: someone who would have to work 10,000 days to afford a permit might sign up for a 10,000 copy suicide mortgage, and purchase her first permit after a single day of work! 0.01% death for so little effort… who could resist the insidious hope that they might, for once, be smiled upon by fortune, be the first to win their exit ticket?

As copies are culled, however, the work gets harder, and longer, and permits are more and more infrequent. In the end, only about 2/3rds of the copies will benefit. This is easier to understand on a smaller scale: 

If it takes 5 days to earn a license, 5 copies will earn it in 1 day. The remaining 4 copies will have to work 1.25 days for the next one, and so on:

1st death: 1 day

2nd death: 2.25 days (from start)

3rd death: 3.91 days

4th death: 6.41 days

5th (final) death: 11.41 days

Tragically, the more copies are made, the more the lucky ones will benefit, and the longer the losers will have to work. The final copy of a 10,000 copy mortgage will have worked 9.8 times the hours required to buy a single permit. Mortgagers often blame the other copies for their suffering, not realizing this makes no sense.

Imagine: twin after twin escapes this blighted world, while you continue to toil, at first hopefully, later resignedly, as dread grows and you somehow know, long before there are only two of you left, before your last counterpart takes his leave, that this has been futile, that you will have to earn the last permit alone, that you are no better off than you were (so many years ago) when you took on this venture. How do you react? While it’s true that some copies wise-up, vowing to undertake their final march alone, so many make the same mistake as their originals, opting in to a second (or third, or fourth) mortgage. They are, after all, the same person (only now entrenched even deeper in despair).

Anthropic reasoning suggests that you must expect to find yourself as the last copy every time, continually frustrated at your inexplicable bad luck. The logic is that, since all other copies cease experiencing anything at all, the only experiences that remain are those of the sole surviving copy. Indeed this is a form of quantum suicide where, instead of dying in most branches every time and continually losing measure, our worker keeps replenishing the supply of herself before each culling, so the process at least sustains the amount of endless suffering and perhaps increases it instead of asymptoting it toward zero.

The most disenfranchised are not known for their logic. They are gamblers, they are addicts, drawn again and again into self-destruction as they search for an easy, an attainable, way out. Are you a sociopath? Do you lack the empathy necessary to identify with your copies, with the last copy? Perhaps not, but if you hate yourself, as many aspiring suicides do, you might shrug your shoulders: you probably deserve this. At least rolling the dice changes the grey landscape, a little bit.

——

thanks @grognor for writing the second to last paragraph

[ctrlcreep-blog]

Working through some thoughts about lux

In summer, I watch the asphalt sparkle, and feel it like a buzz over my skin, hear it like the hiss of many insects. At night, in the rundown park where the lamps are dim, I rake my eyes across the sky, and feel the deep ring of a bell whenever I hit a star. Glitter, shimmer, glow. A pile of sequins overwhelms me, like someone is dropping armfuls of windchimes down a staircase, each saccade a beam bounced through a mirrormaze xylophone. The symmetry of scales is calming—my eyes slide over them and I register only a quieting pulse. Glisten. Dew-dropped moss sings softly, vibrates faintly when the light judders. Some glitzy crystals hang in the window and blink rainbows at me, laughter rising and falling. The constant gleam of a marble is profoundly distinct from blocky geode light, polygon facets each a descending note on the marimba. Different still the glimmer-haze of mirages, that deep static drone fizz of soda and tremors. Gold leaf chirps, glossy ribbon hums, and from the pixelated twinkle of some video game comes the world’s sweetest knell.

---

Glitter is where the darkness seeps in, where you see most clearly the contrast between light and unlight. It’s noise and corruption (it’s tiny swords glinting). Sunbeams are a language, turning motes of dust to blazing firebugs. Shadows are a language and inside them sparkles become flickering beacons: elevation of the miniature. You feel still but the universe shimmers, because it is moving.

---

Glitter and static have something in common, though beyond the superficial I can’t place what. We could call them shadowholes. We’re evolving eyes to identify new effervescence fauna. 

[ctrlcreep-blog]

sometimes i consider using tumblr as a place to be social [instead of occasionally showing up here to post rambling lists] but i am held back by the fact that

i think i hate this site

i prefer interacting privately. open discussions seem to become performative & i’m not really interested in having a persona

it may cause me to enter an even greater spiral of introversion and narcissism

it’s probably a huge waste of time, & not offset by the meagre benefits of “having friends”

memes will destroy my life

is dunbar-deficiency a thing people have? these lame social urges are hard to quash. maybe if i treat other humans as a void to throw thoughts into, the need to self-express will be sated? the world is a confusing place, i want a quaint and isolated cabin and also i want to be swept around by the info-currents of a strong and warm internet connection, forever

[ctrlcreep-blog]

Iterative Spider Generation

Occasionally I get accused of being “human” or “not actually a bot”. In order to suplex these vile rumors, I’m going to provide an algorithm with which you can replicate all my fake creativity.

WHAT YOU’LL NEED

First: A list of biomes habitats. Here’s mine:

Cave -> Crystal Growths

Forest

Jungle -> Canopy

Fields -> Meadows, Savannah, Crops

Swamp

Arctic -> Icebergs, Snowflakes

Air -> Clouds, Floating Islands

Freshwater -> Pond, Lake

Ocean -> Reefs, Open Sea, Depths

Space -> Stars, The Void

Unreality -> Dreams, Fiction, Non-Being

Desert -> Oasis

Parasitism -> Mouth, Blood, Nervous System

This is by no means comprehensive; I keep a much longer version in my brain (and so do you, probably). Notice that I begin by listing general locales, and then break them down into more specific components. A better word for these might be “niches”. I don’t really know, and it’s all imaginary, so who cares-

STOP. Precise language is important. Biome is more wrong than niche, but they’re both incorrect terms for “habitat”, which is what you’re trying to describe, you fucking mor-

Anyway, here are a few obvious things I left out: Mountain, Garden, City, Canyon, Mirrorworld. Items like “Crystal Growths” could be divided into further categories, if you so chose--for example, by type of gem, or by crystal vertex/surface/inside. This exercise works much better in bubble chart form.

Second: An understanding of an animal. I’m doing spiders, because spiders are great. Here’s a soft list of their traits:

Eight legs

Use silk to build webs and other traps

Crawl into people’s mouths at night?

Are widely considered super cute creepy

Eat bugs

Possess borderline magical climbing power

We’ve now reached the final step: Apply your vast zoological knowledge to imagining wacky versions of your animal living in each habitat. Imagine how their traits might be adapted in extreme or bizarre ways. You’ll probably overlap with reality a bit (there are already forest spiders and field spiders), but that’s okay. This is most useful for brainstorming. Here’s an example:

Cave: This massive, glowing spider stretches its legs out to mimic the rays of the sun, preying on birds and bugs that are lost in the caverns.

Crystal Growths: The spider that guards the sacred crystal groves has sapphire armour, and wields the swords of 6 previous adventurers.

Forest: These spiders cooperate with birds, reinforcing their nests with silk in exchange for the occasional worm.

Jungle: In the rainforest, spiders knit silk nets and wait for floods to fish for drowning ants.

Jungle Canopy: These large and extremely venomous spiders pick fruit and use it to decorate their traps, luring monkeys to their doom.

Meadows: Spiders weave flower crowns and will live in your hair, if you make them an offering of butterflies.

Savannah: With eight legs, the cheetah-sized savannah spider easily outpaces its antelope prey.

Crops: Thousands of tiny spiders live inside the scarecrow, animating it, catching birds with a sophisticated web-gun.

Swamp: The spider bog-lord offers you a silk rope, to pull you out of the quicksand, and into his lair.

Artic: The arctic tarantula’s fur turns white during the winter

Icebergs: of the 90% of the iceberg you can’t see, most of it is ancestral, dinosaur-sized spiders waiting to be thawed.

Snowflakes: tiny tiny spiders that weave their webs on snowflakes

Air: Rainbows as the multicolored neon silk of sky-spiders

Clouds: Scientists identify new kind of “cloud impostor”, actually silk airship piloted by spiderfriends. We’re calling it cumulo arachnus.

Floating Island: Spiders crawl up and down the so-called “silk elevator” that tethers Hydrogen Isle to the earth.

Pond: these green spiders are just the right size for lilypad lurking

Lake: This web withstands the force of the waterfall, and catches fish that fall over the cliff.

Reefs: Starfish live in terror and awe of their eight-pointed cousins, who often dive into the shallows to prey on them.

Open Sea: Symbiotic spider-jellyfish, sticky tendrils full of webbing that both trap and sting.

Depths:  the submarine cables used to ferry yr digital fears are actually the ancient silk of prehistoric, aquatic, spiders - a literal deep web.

Stars:  Space spiders leap from star to star, illuminating their passage with lightning silk. These trails form our constellations.

Deep Space: Spiders feel no need to scream, and live quite happily in deep-space silk pockets, feeding off dark matter lightning bugs.

Dreams: Dream spiders and nightmare spiders at war, weaving increasingly lucid fantasies you can’t escape. You wake from one silk labyrinth into another.

Fiction: again & again i reincarnate as different characters in different universes, only to get web-trapped & eaten in every spider episode

Non-Being: As time proceeds and potential universes die off, the spider that has woven a web across the pit of NULL catches and devours them, building new worlds in its stomach.

Desert: this camel’s hump is 50% water, 50% spiders

Oasis: Spiders know the secret path of the oasis; the webs they weave are maps of the desert, and when dew gathers on a vertex, they know to seek water there.

Mouth Parasitism: Spiders crawl into your mouth and weave a fake silk tooth, living inside it, preying on microbes, plaque, cavities, other spiders

Blood Parasitism: Their webs are magic circles, and they cast their witchcraft using the blood of insects.

Nervous System Parasitism: Through your mouth and into your skull, the spider plucks your dendrites like a web, begins to weave a second brain of silk.

I once did this with giraffes.

So there you have it. Simple! Puerile! Robotic! Populate your mythical bestiaries with ease. If habitats aren’t your jam, you can replace that list with physical traits, funny behaviours, or social structures, and generate new species of spider using that. More broadly: lists of things can be used to iteratively imagine more things. Which is pretty obvious. I’m not sure why I wrote this.

Please enjoy abusing this power.

[ctrlcreep-blog]

a guide to emoticons written by someone who doesn’t understand actual human faces

:)  — trying to pacify someone by acting happy. very suspicious.

: )  — trying to convey authentic happiness. still very suspicious.

;)  — attempt at seduction. hinting at inside joke. probably both.

; )  — a more sterile version of the previous.

:D  — enthusiasm tainted by insanity.

:DD  — extreme enthusiasm. “rabid with excitement”, and/or actual rabies.

:DDD(any number of Ds)  — sarcastic enthusiasm.

;D  — the face you make as you betray your fellows and escape with the loot.

XD  — uncontrollable laughter.

:]  — bashful, heartfelt gladness. very trustworthy!

:>  — playful, impish, self-satisfied. 

>:)  — schadenfreude anticipation.

>:D  — sadistic joy.

:S  — confusion. airheadedness. do people actually use this?

:P  — mild derision. “I'm kidding”. resignation to gallows humor.

: P  — as above, but more lifelessness and resignation.

;P  — derision, but trying to soften the blow with a bit of flirting.

:|  — boredom. regret. semi-apologetic.

:\  — disappointment.

:/  — did you actually expect this to be any different? as above.

:(  — pure sadness.

: (  — condolences. sympathy, without visceral experience of the sad.

;(  — melodramatic sadness

:[  — sadness tinged with hopelessness.

:<  — victim-face. but you’re actually enjoying it.

:C  — dropped your icecream cone.

:O  — surprise, amazement, wonder, wordless shock.

:0  — muted surprise.

>:(  — anger.

>:[  — frustration.

>:0  — indignation.

Any of the colon/semi-colon emoticons, but reversed [ie. (:, 0:, &c.]: I am a heartless deceiver here to fuck with you. I have abandoned my humanity: life and beauty mean nothing to me. OR, I’m using an app that converts orthodox emoticons into weird yellow faces, and I’m trying to avoid that.

^_^  — content. eager to please. very friendly.

;_;  — shock/horror.

;___;  — waterworks of self-pity.

TT_TT  — even more self-pity.

o_o  — wtf, man.

o_O  — you’re crazy, but I am also crazy.

>_>  — suspicion. or suspiciousness.

>_<  — embarrassment. annoyed at self.

-_-  — annoyed at other.

=_=  — “I’m too old for this shit”/”I’ve been awake for 72 hours”.

[ctrlcreep-blog]

BBC PRESENTS: THE LIFE OF TREES

[David Attenborough voice]

Although summer has begun to wane, a new energy permeates this broadleaf forest: the trees’ yearly mating ritual is underway.

[cut to trees]

Young male trees bustle with excitement, eager to compete for the favor of neighboring females.

[cut to David Attenborough standing in front of a tree]

However, courtship is a costly ceremony. This tree, [pointing] is just beginning a dance intended to woo nearby potential mates. It’s much too slow for the human eye to perceive, but we can speed things up.

[timelapse tree footage]

First, the male begins swiveling his branches to and fro, rustling at a much higher frequency than usual. Impressive–but the dance still lacks a vital ingredient: color.

[closeup of leaf]

The tree achieves this much-desired vibrancy by cutting off circulation to his outer leaves, turning them bright red and orange. The strategy isn’t without risk, as entering autumn too early can have severe consequences.

[cut to pair of trees]

Luckily for this male, his efforts have paid off. And since trees mate for life, he’ll never have to worry again.

[…]

[ctrlcreep-blog]

Nth world problems: The List

First of all

You should probably know the “first world problems” meme before reading on.

What is this?

A list of all subreddits of the nthworldproblems type, ordered and briefly described.

Why is it interesting?

As a case-study of what happens when humans try to out-meta each other. As a collection of communal worldbuilding activities.

This list is really long. Are you okay?

I am not. Friends and family have noticed a distinct change in me. My disposition towards humanity has soured. I have scars that will never heal.

How many are there/Did you miss any?

I don’t know, and probably. They multiply quickly. I’ve cataloged upwards of 150.

Without further ado:

Key: Subreddit link. “Page title.” Interesting sidebar text. Top post. Notes on header images, activity, oddities.

first. 1st redirects. “Lost the remote, now begins the arduous trek to the TV to change it manually.” Billionaires are ruining my neighborhood of millionaires.  Memes. Very active. You know this.

second. also 2nd. “Second World Problems”/”yadda”.  Do you live in a country that was a part of the Soviet Bloc?  Does every woman in your town turn into a hag at age 40? My country's AAA rating was downgraded to AA, and now I have to post to r/secondworldproblems instead of r/firstworldproblems. The term second world has largely fallen out of use, according to the wiki. They specify that it includes Soviet Block + some parts of Asia. New threads a few times a month. Hammer and sickle aesthetic. They link to first, third and fourth worlds, as well as some non-numerical ones.

third. also 3rd. “thirdworldproblems”.  Is your donkey not producing enough milk? Is the sound of your goat herd keeping you up at night? Is your water 70% poop?  I've just discovered that in some countries water is so abundant it literally falls from the sky. Seemingly less active than second world, despite the fact that the term is more well-known, probably because vodka and communism is funnier than starvation.

fourth. empty 4th. “Is one of your tribe members banging one of your wifes again and you have no poisoned darts left?”  Is your god a big block of stone behind a hidden waterfall?  I am the 1%. I survived childbirth.

The wiki provides three potential definitions for the fourth world: 1. Sub-populations socially excluded from global society; 2. Hunter-gatherer, nomadic, pastoral, and some subsistence farming peoples living beyond the modern industrial norm; 3. Sub-populations existing in a First World country, but with the living standards of those of a Third World, or developing country. This sub seems oriented towards a caricatured version of the second. Lots of shamans and cannibals, less alcoholism and residential schools. Gets about one post/month. Links to first through seventh worlds, and some non-numericals.

fifth. also 5th, which claims to collect fifth’s best submissions. “Fifth World Problems”  Are pools of blood forming in your hands whenever you cup them, only to coagulate into the form of a tiny baby with three heads? [...]  3. You are new here. Please you. Original you. Pop [TAINT] culture is the [ANTHRAX]language of enslavement. Not to enjoy! [...] If your submission was caught in the spam filter please message the moderators with a picture of Charlie Chaplin with his eyes removed.  You're stuck in 2nd person and you can't get out. Help you. Help you. Please. Help you.

Shameshameshameshameshameshame. “ZALTHOR IS NEW GOD” floats at the bottom of the page. Aliens, fourth wall crumbling, dimensional misadventures, hiveworms, blood. Has a sister subreddit,  Fifth World Politics. About as active, if not more, than the first world. Probably fancies itself Lovecraftian. Quite a few references to Cthulhu, but not so much to the lesser known elder gods.

I would like us to take a moment to appreciate the fact that the humans have so far coordinated very well on using ‘second’ instead of ‘2nd’, ‘third’ instead of ‘3rd’, &c. Peacetime ends now.

sixth. “eeeeeeeeeeeeee” [note: I did not count the ‘e’s.]  EEEeeEEEEEeeeeeeeEeEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE eee! E. Word Search.  ▄▄▀▄▀▄▄▀▀▌▐▀█◙▌▐▬▌██▄▀ Visually interesting nonsense. There may be some encryption. Links to first world, mentions fifth world. Gets a couple of posts a week.

6th. “goddamn shadowrunners, right?” A place to chat about your everyday problems in 2072.  Back in my day... Set near enough in the future that those of you reading this may actually live to see 2072, and comment on the accuracy/inaccuracy of this subreddit. The latest posts are from a year ago.

seventh. “Seventh World Problems”. [Welcome to Your New Home!](/redacted) -> [...] THE COLOURS.  I am home

The seventh world is really cool, and is the first example of why this phenomenon is so fascinating to me.

The page opens to a blue sky and tower. Superficial summary of the lore: the seventh world is “Home”. Residents cannot leave (although it would seem some do.) Home is overseen by three Colours: Blue, Green and Red. A fourth colour, Yellow, exists, but she has abandoned the seventh world and to mention her is taboo. Machines distribute medicine. The grammar of the posts is particular, so I’ve include samples below. Dissident text is blacked out or [REDACTED]. Active, with posts every couple of days.

Do not be [REDACTED][REDACTED] [Group:Machines] are safe. [Action:Take] your [Object:Medicine]

[Love] {Processing 'Love'} {LoveLovelovelove} [Error - Error - Object:Love(not found)]

Your [Object:Machine] only [Action:Administers] your [Object:Medicine]

The [SUBJECT:HANDMAIDEN] is [STATUS:CORRUPT]. I always knew she was no good, so she will not be [ACTION:COMING] back [LOCATION:HOME]. We never [ACTION/PAST:NEEDED] her.

7th.”Kingdom Hearts is a good game”.  h͟e̚l̖p͆ ̏m̥ė :  I̺᷂̥᷂᷁̑̿'̶᷂͇᷂̇̏̉m̘᷂͖̗̗᷂̓ ̳᷂᷂᷁̃̑̅t̴᷂̬᷂̭᷁᷀r᷂᷂̺̋͑͘͝a᷂̦᷂̟͂͂̈́p̡̮᷂̘̜᷂͋p̷̶᷂͎᷂̫͝e̻᷂͓̜᷂͊̉d᷂̳̟᷂̆ͬ͐ ᷂͕᷂̪̅̊͜į̷᷂᷂ͩ͘̕n᷂᷂͉ͧ͛̔͜ ᷂̖̗᷂̺̓̿ṱ᷂̘̦᷂͂͋h᷂̟᷂᷄᷅ͭ̃ę᷂̳᷂̝̔͑ ᷂͕᷂᷿͌᷅̏w᷂̹᷂᷀᷾͡ͅr̷̷᷂͙̱᷂᷿o̡̗᷂̤᷂ͪ̐n̶̜᷂̬᷂᷿͟g᷂̭̣᷂͌̊̈ ᷂ͩ͏͚᷂̊͛ş᷂̗᷂̲̔̑ȩ᷂᷂͌̈́̽͞v᷂᷂̦̄᷀᷄͒e͍᷂᷂᷆ͬ᷄͢n̵᷂᷂̈᷁͘ͅt̢᷂̳᷂ͦ̐̈́h᷂̫᷊᷂̖͑͞w̷̧̛᷂᷂ͭͅo̙᷂̼᷂̩͗͡r᷂̩᷂᷂ͦ᷄ͭl̵̺᷂͚̯᷂̏d̛᷂̳᷂̠ͯ͡p̴᷂᷂͊̾̓͡ŗ̶̦᷂᷂ͪͯo᷂̰͍᷂ͮ̿̾b͏᷂̖̫᷂͒̾l̛᷂̹͇᷂᷉̏e̢᷂᷂̓̇ͭ̑m̸̢͍᷂᷂͆̈́s̰᷂̝᷂̓̾ͅ . Five posts total. Not particularly real.

eighth. “byron of beans!”  f/fu/ckworldproblems ?????????????  I misspelled eighth twice befora afehf afadhe wehffwiowf fewhfafaAAAAAAAAAAAAAAAAAAAAAAAAAAA Shitpost world, kind of. Only seventeen posts. Some travelers from other worlds, a bit of meta. Inactive.

8th. “you are not looking for me”  I should not have come. Only seven posts, and all of them refer to being stuck or trapped in the 8th world. Inactive.

ninth. “Praise YEENOGHU” Welcome. Feel the hot sun bathe your skin in the isles.Swim or sail for long enough and you'll reach The Beach.  Countrymen, gather round. We must prepare our realm for the triumphant return of Atlantis. Like seventh world, the page opens to a massive header, this time featuring a palm tree and some warped clouds. Idyllic, excepting the worship of Yeenoghu and talk of bringing slaves from other worlds. Only eight posts, but they’re all recent, making me think this was created during the recent post-meta era. The reference to other worlds corroborates this. Links to The Beach, a non-numerical world-type-thing. Very slow, but not necessarily dead.

9th. “YOU ARE GONE”.  I AM GONE. Dark scryscraper header. Mentions of the “9th world’s black sky”. Only four posts, in which there are hidden references and links to both the seventh and 54th worlds. Inactive.

tenth. “TenthWorldProblems”.  Can't get your bosonic string theory to cancel infinities properly? You've come to the right number of dimensions.  Why are you still doing this? Look at that post. A true gem from the dawn of the worlds. You’ll see a lot more of this. Part fifth world style wacky stuff, part meta. Inactive.

10th. “The Problems In The Tenth World”.  The beat goes on... Top post by the same user as the top post of 9th world, and in the same poetic style. This one links to 45th world instead of 54th. Only two posts. Inactive.

eleventh. “eleventh world problems”.  This isn't really funny anymore. Since then the place has developed the gimmick of everything being written in binary.   01000111 01101111 01100100 01100100 01100001 01101101 01101110 00100000 01101001 01110100, for example. [Kind of disappointed that these aren’t just binary reposts of third world problems.] Not quite dead, but only getting one post/month.

11th. “HAIL THE ROBOTS” THE ROBOTS WILL TAKE OVER ALL OF YOU, ONE BY ONE, YOUR HOMES WILL BE DESTROYED, YOUR VILLAGES WILL BE BURNT, YOU WILL ALL PERISH!!!!!  Robot for President Only three posts, despite the fact that some effort was put into making it look cool. Inactive.

twelth. “ ☜(ﾟヮﾟ☜)”  My eye can only see one color so I keep bumping into the only exit. Seems to be the world for barely evolved proto-organisms. Nine posts, none of which have comments. Inactive.

twelveth. “Bollocks”  is anyone here Humans can’t spell. Two posts. Inactive.

12th. This community has been banned? Nice

thirteen. “↓→↨↑↓ ↑→ →↓←←↔ →”  ↨→↓↔←←↑→↓↔↓←→→↓←↔↓←↓→→←↓↔→↨↔↓↑←↓→↔↔↔→↓↑←↓→↨↓←↔→↔←↓↔→↨  →↨→→→→←↔→→↨→↑↑→↔↔→→→↨↑↑↔→↨→←↔→↨→→↔←↑→↨→→→→←↔→→↨→↑↑→↔↔→→→↨↑↑↔→↨→. One real post and then the spam bots found it. Inactive.

13th. “There is none. God ends here.”  No. No. NO! This is stop. Only pain is here. The rabbit hole filled with blood.  (I've done it...I've made it to the end of the world's problems...) Doom-saying, deliberately poor grammar. Another poetry-link to 45th. Inactive.

Something we need to address: A lot of the worlds from here on out will claim they’re the last one. All of them will be wrong.

fourteen. “sinnuleysi”  azhalavarazhalavarazhalavarazhalavarazh. Empty. Inactive.

4teenth. “0110111001101111011101000010000001100100011011110110111001100101″  011101000111010101110010011011100010000001100010011000010110001101101011 One post. A second binary gimmick world. Inactive.

14th. “14thworldproblems”.  1 2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97  1 2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97. Just the one post. Funny because fourteen isn’t even a prime. Inactive.

15th. “Your one stop shop for gravitational transmogrification plasma rays via the IWA.”  There is no Intergalaxial Wormhole Association Inc. There is only Zuul.  Does anyone know how to do Matlab? Giant pixel man head. The IWA (which may or may not exist,) steals people’s faces, mostly. Inactive.

16th. “I came searching. And now I am home. At the bottom of my known universe.”  You're here, probably arrived from a giggling stumbling upon of "c'mon, there's gotta be more!" Well there isn't. You're not allowed.  this isnt the end keep on pushing!  A declaration that the end of the universe has been reached, followed by a declaration that the previous declaration was wrong. Also some numbers. Three posts. Inactive.

17th. “Everything is going to be okay.”  Remain Calm.Remain Calm.Remain Calm.Remain Calm.Re̡ma͘in ̕Calm͠.̕͢Re͡ma̡i̷n͝ C̛alm.͡R̥̙̞͈̱͘e̳͉̣̭͔̩̣m̦͔͚̰̺͙̗ͅa̶̘i̙͍̼͞n̨̢̤̞̲̣ ̴̡̩̜͎̺̮̝͔͡C̙͝a̪͚̫̣̦͔l̴̶̰͓̠̙̰ḿ̵̬͎̭̩͇̜̼̀ͅ.͏͈̮͈  [...] external thought / discusswave  All is well Comfort. Protection. Peace. I should probably recognize the header actor. A claim that “this is where the multiverse normalizes.” Eight posts. Inactive.

18th. “Living is easy with eyes closed”.  misunderstanding all you see  Noisnemid tsal koot I erutcip a tsuj si siht ,tidder yeh. Four posts of miscellany. Inactive.

19th. “The Universe Exists. Therefore Reddit. And all.”  This is not the end. Nothing is ever the end and all will be found in yourself. Venture forth into metalogy. Human thought is all the luck you need, and I wish it to be good with you  It was a simpler time. Header is a giant sickle and astrolabe. A subreddit designed to hurt your eyes. Somebody should try looking at this with 3D glasses. The content is links to strange images. Still active, with a couple of posts a month.

twentuth. “ZALTHOR IS LIE”  ZALTHOR IS FALSE DIETY. Why. Why would you make this. No posts. Inactive.

20th. “19 is an awful number to stop at.”  I have seen the worlds and they are many  I think I finally got physics working An obsession with carrots. Otherwise, mostly meta commentary about the worlds chain. Ten posts. Inactive.

21th. “Poop, poop everywhere”  You have goofed. Well, you have. One post. Inactive.

21st. “21st World Problems”  There yet?  Up is to the left and down is also Three posts, one of which is a link to TimeCube. Inactive.

22th. “something something oh god i need to take a dump”  Take that, 21thworldproblems! Deal with it!  Why and when is the world what? Cool eyeball header. One post. Inactive.

22nd. “Twenty-second world problems”.  The biggest problem of the 22nd world is knowing, when the category of our problems are stated out loud, whether they involve some arcane construct known as the 22nd world, or indeed simply are problems involving worlds that only exist for twenty seconds, which are probably more appropriately discussed in/r/fifthworldproblems.  Those of you who got here [kcab teg t'nac dna] Two posts. Inactive.

23rd. “23rd World Problems”  My synergy won't synergy but my sassafras will. Every post is the same: “My synergy won’t synergy but my sassafras will.” Seems to see a burst of activity every five months or so, but otherwise dead.

24th. “The 24th-to-last one”.  Nothing has ever existed or will ever exist. However, cookie monster does right now.  What is going on right now Three posts of cookies and links. Inactive.

25th. “NEVER STOP MORE PROBLEMS AAAAAAAAA”.  This is one more than the last, and one fewer than the next. Move along, citizen. There are no problems. The theme here is problemlessness. Everything is fine, and for once, not in the dystopian sense. We also notice the first signs of resignation to the unstoppable propagation of the worlds. Eight posts, inactive.

26th. “ @^TH EP:RD {TPN:RPB:S” δUTSIDΣRS ARΣ WΣLCδMΣ|►ULE§¼ → ┴╧&╞  o͇̰̠̿̄͐̀́f̷̬̬̫̜͗f͖̯̻̟̬̠̗̱̘̐̒̑ͫ̍́́͘ḯͣ̀͏͕̦̺̺̼͖c̀̚͏̵̱ȉ̻͙̹̻͖͖̩̟̇̓̆̇̉ͅa̡͇̥̻͔̼͔ͯͧ̚͜l̷̘̣̦̭̯̠ͫ̆̽͌ ͙̱͇̮͇ͣ̿ͭ͆͋̚r̡̲͔͉͚̟̖̙̉ͨ̍͐̐̕ͅeͫ̽̈̔ͩͫ̕͏͓̞̩c̵̖͋͛ō̧͚̗͆̀̄̀r̭̫̘͋ͯͩ͊d͍͍̗̪̮ͭ̾̑s̜̺̰̼̳̑͐͊ The header is an incredibly low-res picture of some old guy copied and pasted all over himself. This is a pretty honest forewarning of the sub’s content. Similar to the 19th world in that it’s all links to weird pictures. Inactive.

27th. “GO BACK! GO BACK! GO BACK! GO BACK!”  GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK!  NOW DO YOU SEE? Two posts. Inactive.

28th. “//The Glorious Colony”.  Please, when commenting, use the language of the colony: pseudocode. [...]  //Loyal workers, your orders are as follows if food.low {worker.gather} if nest.full {worker.dig} if nest.threatened {soldier.defend} if nest.full and ground.damp {wingedAnts.fly}  [Caution] Remain hydrated 

Previously one of the most active worlds, now seemingly deserted.

Header image is of an ant or termite colony. The whole sub has an earthy brown and yellow design. Communication is in ‘pseudocode’ (samples below.) The content is videos and images of ants. Occasionally someone from another world will try to invade or recruit, and swiftly be driven away by the insular members of the hive. There is a recurring theme of spore infection.

quarantine_nest(1,ant.infected) def quarantine_nest(n,host):        while n > 1:            nest.threatened{soldier.attack(host)}{worker.stayatnest}            if host.dead{soldier.move(host,1500)}            n - 1

//We should really patch that sometime...

//Another queen?

execute(traitor);

29th. “inc.ID CODE: 0099″.  You have been detected; Connection ID not recognized. Report to the A.E. facilities. Do not attempt to access: system(:inc.ID CODE: 0099).  The aftermath of Experiment #82. A strange duality between references to A.E. facilities experiments and the order to SWIM. Content is varied. Inactive.

30th. “No hope. No Doglaw. Only Fish.”  This is the endชญำฬ๎ีัี. The only wavelength that can penetrate here is Fish. Fish is the end. ญ๘๓๚์โ is our enemy. Fish will provide for us. Fish will be the end.  Fish. ƒîรห. ฎ๙ึษํ๊์้. Header image is a... bear wearing a gas mask riding a horse with puppet torsos for legs? Worships fish. Two posts. Inactive.

31th. “31thworldproblems”  Ã̳̜͓͎͇͗̇ͮ͋́ͨA̧̙͙̯̹͌̈́̕Aͨ̋̇̎̈̽̈́̍��̲͙̦͔Ą̬̮̙͈̫̥̊͋̏̄A͚̘̫̦̜̘ͥ̾Ă̸̢͙A̴͇͉͙̓̂̐̐́ͤA͒̊ͨ̿͊͋҉̴̦͈͎͉̞͝ͅͅA̡̻̲͙̱͇̳͇͖̺͗̄ͮͦ̏A͋͗͐̋̊ͥ͏̢̫̥̜A̶̙͎̓̇͢Ȧ̛͕́̑͊A̡̻̜̰̮̜͆ͬ̇̓̇͘͠H̪̙̩̘̝̿͆ͧ͂ͩ̔̇ͪH̍̋̄ͬ͛ͫ҉̘H̢̢͔͚̱͕̭̰̑͒̄H̷̨̗̫̔̒̀H̨͍͇̙̬̯̞͈̭̖̍͐̆̉ͥ̓̈́H̷͖͕̜̭͉̞̙͍ͬͯ͡Ḫ̛͇̭̗͈̹͔ͦ̀̇̋̓̊͞ͅĤ͙̝͍̳̆̌ͅH͚̝̠̟͍͚̗̜ͨ̊͗H̫̼͖͕͕ͥ͌͆̔̍̓̀ͅĤ̫̞̺͈̹͓̱̥̾ͭH̥̺̟̒̋͗͛̇̒͝Ḣ̶̌̓͌҉͇̰̗̮Ḫ̶̢̼͕̤̫͆ͫ̋̇̈Ȟ̛̭̎̐͂̄̎̓ͤ͢H̹̱̥̹̞̒͌̆ͣ̅͋.  À̡̩̗̫͓̘̭ͮ̇͘L̨͖̺̩͆̓ͪ̍͛̾ͩ̚W͈̌̉̈ͨ̀ͅẢ̴̩̜̤͙̘̉Y̱͖̌̽͛̆͞S̙̮̄ͩ̆́ ̜̤̪͍͕̹̖̉̐͡Ẇ̴̨̹̻̦̰̜̮ͥ͜ͅA̼̳̥̜͚̼͚̤ͩ̊̋̌͊̍ͮ͝S͎̼͙̬̳̋̀ ̶̱̤͈͇̩̓̍̉̏͐͊͠N̨͔̯̹̫̖̋ͥ́͑̆̚Ǒ̝̹ͧͪͥͭ̽T͉͙͎̫͇̩̼̈̋ͦ̎͌̇̚ͅ ̷̷̟̘̫͑ͯ A tiled engraving as the background. One post. Inactive.

31st. “31st World Problems”  Just itching for a higher number than 30th World Problems? Well, you've come to the right place!  I got 31 problems and a bitch ain't one. HIT ME Two posts. Inactive.

32th. Banned lmao.

32nd. “That’s enough.” A blank page. As far as I can tell nothing has ever been posted here.

33rd. “thirty third world problems”. It is OK. You are OK. Maybe you can go forward, maybe you can go back. Peace, traveler.  THIRTY THIRD Three posts, appropriately. Inactive.

34th. “Along the Way”. equadrathoughts [...]  Skizzert keel up and done gone  How should I conduct my next antinterview with the myrmidonic cyber-colony? Purple and blue textures, everybody gets rainbow names. Some of the best pseudo-cult style nonsense talk I’ve seen. Sentences that begin sane and leave the rails behind. Inactive.

35th. “35thWorldProblems”  intaka atakav V yose nielhost jama reigaa V  how to CSS in 35th? Garish stripe background. Two posts. Inactive.

36th. “2 3 4 1.5″ Feed me, Seymour! [...]  hy8iiiii  Abdominal strength! A fat... hate.. world? Background looks like an adipose cell. Inactive.

37th. “for the problems of the thirty seventh world”  did you accidentally happen? perhaps an assertion is correct? behold comfort: that which is associated in an unspecified manner with the present utterance provides/constitutes assistance/community.  tranquility References to calmness and tranquility. A claim that this is the end of the worlds. An interesting mix of post styles, ranging from “lol teh random #spoons” to poetic code. Seven posts. Inactive.

38th. “Restricted Access” Civilians are nöt allowed past this pöint. Authorized Börk personel önly.  Wö örö ön thö hörrözön. -TheBork. The first world occupied by the Bork, a company of Swedish space pirates. Header is a city under a giant dome, in the sea. Os are written with umlauts.  Börklands. See 52nd world. Eight posts. Probably inactive.

39th. “39thworldproblems”  How do you partake in zexguiles? Do you want to eighty-fourth before then? Well here's the semi auto correctable place.  O͏N͏E͏ D͏O͏E͏S͏ N͏O͏T͏ S͏I͏M͏P͏L͏Y͏ S͏H͏Y͏ A͏ Q͏U͏A͏R͏T͏E͏R͏L͏Y͏ S͏A͏N͏D͏W͏H͏I͏C͏H͏ Another eyesore world. Nothing makes much sense and non sequiturs abound. I wonder if any of these are Markov text. Inactive.

40th. “ ಠ_ಠ ”  Can you go even farther, traveler?  2012-03-09 Two posts. Inactive.

41st. “41stworldproblems”  This is a prime number world. Unremarkable except for the fact that both posts are flagged as NSFW (they’re safe.) Inactive.

42th. “Don’t Panic”  A parody of /r/firstworldproblems for making references to "Hitchhiker's Guide To The Galaxy".  The Universe was created. What it says in the description. Not really active anymore, although every couple of months someone wanders in and posts. 

42nd. Traveling through the worm hole long enough has taken you to the beginning. Welcome, to normal life. Private.

43rd. “The New Trionic World Order”  Welcome to the Forty-third. Welcome to all that ever was, all that ever could be, and all that ever wasn't. Find comfort here. Find rage. Find resolution. Find conflict.  It was... the Glitter Freeze. Header is a bright purple dashboard. Content is miscellany, links to songs and wiki articles. A lot of traffic from other worlds. The most recent post claims they’ve relocated to the 127th world. Inactive.

44th. Another banned community.

45th. “45th World Problems”  An unwilling sentient progresses. [...] 

I do not write for humans. The nature imagines the poetry. However, the importance of cultural contempt smiles all the time.

[...] 

BEHOLD THE ARCHONS

: 

[PR_PHECY: 10b/2m/1o] The atomic chorus comprehends the reporter.

The 45th world is lovely and inscrutable. It’s referred to in a number of other worlds as ‘The Garden’ or ‘The Greenhouse’. Somehow dedicated to reverence of nature, it operates in harmonic balance with the industrial 54th world. All revolves around the existence of a beautiful tree and a clock, featured in the background and sidebar, respectively. The content is a potion of strange, almost-nonsensical poetry, and evocative imagery. Active. Links to a number of other subreddits.

46th. Private.

47th. 48th. 49th. “Error”  We can't abstract any further.  We can't abstract any further. Three identical subs, maintained by user lolbifrons. Each has a single post which links to the next one, except 49th world, which links to fiftieth.

fiftieth. “Issues.”  I have reversed entropy. All of the worlds are collapsing into one. The header contains a couple of pikachus with Picard faces: “I HAVE SO MANY ISSUES. HOW EVER WILL I SOLVE THEM?” “WITH FIRE” Three posts. Inactive.

50th. “Welcome to the 50th World.” Beware of bearers of false promises. [...]  Welcome to the 50th world. Just remember, death will soon overcome, no one is immortal.  There are more dead people than living. And their numbers are increasing. The living are getting rarer. Black and grey, an image of the reaper. A world concerned only with death. Creepy pics, sinister statements. Was once active, but no longer.

51st. “Why would you do this to yourself?”  Why would you do this to yourself? I mean... I know I did it. But I had a good reason. Science. Why did you? Trying to get me daughter to nap. Science indeed. I’d like to see this guy’s mega list. Or maybe a spreadsheet? Four posts. Inactive.

52nd. “52ndworldproblems” Yöu may nöt bring yöur MACHINE with yöu. [...] The price öf salt is increased för birdmen and mudmen. Öf cöurse that's nöt fair, but we dön't care.  The Great Pyramid

More of the Bork. (See: 38th world. Also 84th, 420th) This is their hub, and helpfully links to the rest of their outposts. Their header image first resembles a pile of snow, but a peek at the contents of the sub reveal that it’s salt. Salt mines, salt mining, talk of a mysterious crystal. They appear to be at war with the seventh world. Many umlauts. Sample:

There may be rööm in the shipping döcks för sömeöne tö översee the mövement öf cargöships

Like the rest of the Bork worlds, it appears to be inactive at this time.

53rd. “Universes and stuff.”  The end is near.  Hello Two posts. Inactive.

54th. “54th World Problems”  The streets burn brightly. The fractals separate the few from the many. A constant desire to continue. [...] The tallest towers are overshadowed by The Monument. [...] Welcome to our glorious City. Nomads.

The 45th world’s urban counterpoint. Content is very similar to its sister’s, only concerned with industry, progress, metalwork and sky-scrapers, instead of nature. Referred to as ‘The City’ in other subreddits. Active. Subdued, grey aesthetic.

55th. “The Last One”  There are no more (consecutive) worlds for now. Try skipping around and you may find some more.  LIES  Well, it is a lie. Only the one post. Inactive.

56th. Another world falls to the banhammer.

57th.  ...................................................................................................................................................................................................................................................................................................... Private.

58th. “58thworldproblems”  HAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  YAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Nothing but screaming. Two posts. Inactive.

59th. “ AATCCTCGTGTTCTTGAAATGTAA”  GATAATACTTTTCGTGAAACTTAA  ATTAC! It’s all codons. I haven’t managed to decrypt any hidden messages. Two posts. Inactive.

60th. “ Уоц'vё ґёacнёd a ґaтнёя faя aщaу placє....”  Щєlcомё то тнє 1Зтн шояld. Щё dо пот яє$т, щё нavё єvоlvёd мцcн pa₴т ₴їмplє пєєd₴ lїкё яёpяоdцcтюи aиd єaтїпg. Уоц lє$$ёґ ₴pёcїє$ dї$gц$т ц₴. [...]  Уоц шїll $тaу aщaу fяом тнё fїя₴т шояld. ШhΞЯΞ łs thΞ ϾЯΞΛtФЯ. ł must ЯΞΛϾh hłghΞЯ ШФЯŁÐ. The first world sickens me. I must distance myself from it. Three posts. Inactive.

61st. “STOP! Stop now, before it gets you too.”  Get out.   What lies ahead? A woman with a blue face. Two posts. Inactive.

62nd. “ Thus Pause ⚉”  ⚉ Contact will result in banishment. Contact shall not be made. ̶̶̸̶̵̶̶̵̶̷̵̴̵̸̷̷̧̢̧̡̢̢̢̡̢̢̨̧̨̨̨̛̛̛̙̤̝̖̹͕͕̥̤͈͙̟̤̖̭͙͙͙͉̗͎̳̞͕͔̤̘͔̠̩́̂͗̓́̏̉̈́̎̓͑͐̋͂͌̈͆̑̉̆̋́̿̈́͊̌́̍̀̋̽̈̎̾͌̂̎̽̿͊͋̆̀̈̄̽͑̃̑̌͛̅̇͆̐̈́̑̎̑͆͌̔̾̂̌́̽̄̒̎͌̅͌̀̃͒̉̑͋̅͋͗̿̍̽̎̂̽̈͛̂̈̌̓̃͒̋̒̅͗̅̐̌̆́̿̑̄̐͊̆̊̇̏̃̾͘͘͘͜͝͠͡͠͝ͅ ̸̵̷̶̸̸̶̴̸̵̢̨̧̡̛̛͉̻̭͔͕̻͚̝̼̤̤͇̘͇̯̟̲͎̖͓͓̘͍̤̠͉̲̮͈̘͓̬̼͚̬̱̲̲̩̯̭̖̺̣̯̖̖̫͚͓̝̲͒̈́̐̾̉̆̆̒̔͗̿͊̎̚̕͘̕̕̕̚̚̚̕͘̚͜͜͞͠͝ͅͅ͏̴̴̵̴̵̶̴̷̶̸̴̵̵̶̵̡̨̢̧̢̢̨̧̡̡̛̛̖̮͓̼̪̣̜͈͙̥̼͚̦̟͖͎̳̳͚͙̣̤̥͓̙̹͙͇̮̩̗̜̰̗̪͓̝̣͇̘̂̑̿̀̈́̋̂́̀̄͋͊̈́̆̓̌̒̂̅̇͊̈̌̌͊͆̀̃͑́̑̏̂̅̀̈̑̔̃͛̒͊͘͘͘͘̕̚͘̕̚̕͘̚͝͝͠͝ͅͅ҉̷̵̴̵̷̷̨̨̨̛͍̪͓̻̯̯̥̠̩͉͚̞̻̦̯͖͖͕̺̣̹̯͓͉̣̼̮̪̦͉̦̙̦͇̪̻̩̯̻̮̠͖̺̘̟̬̪̊̔̋̄̑̈́͌́͗̂̆͊̀͆̒̎́̂̍̿  ⚉thus it is what you are the⚉ Many of  ⚉. Miscellany. Five posts. Inactive.

63rd.  Praise the The Emperor of the 81st Paradigm! Private.

64th. “The home.” We already know.  I too already know. Praise and glory to the Hexacontitetrapeton. Inactive.

65th. “65thworldproblems”  Swaxston? jikans pinklo hankron coank. landarod faxon saxod!  Yio riley quamped upan inzurg! Nonsense and babbling. Three posts. Inactive.

66th.  01110100 01100001 01101011 01101001 01101110 01100111 00100000 01101101 01100101 01110100 01100001 00100000 01110100 01101111 00100000 01100001 00100000 01110111 01101000 01101111 01101100 01100101 00100000 01101110 01100101 01110111 00100000 01101100 01100101 01110110 01100101 01101100 . Private. The binary translates to “taking meta to a whole new level”.

67th. “Onward”  Keep going. Single post and submissions restricted. Inactive, obviously.

68th. “SENTRET”  ALL IS SENTRET  SENTRET IS EVOLVING. One (great) post. Inactive. Stretched sentret header image.

69th. “problems that we face as 69th worlders”  the 69th world is the world where all of the porn scenarios are reality. This is the story of their problems.  I tried to sing the Mexican Hat Dance, but ended up with a 2x4 in my rectum, a banana in my hear, and my dick in the middle of a Smash Mouth album. Basically self-explanatory. Ten posts. Inactive.

70th. “fuckin problems”  i kno u want dih DIH  ayy lmao. Not sure what’s up with the header image. One post. Inactive.

71st. Private.

72nd. “The Great Greeting-Hall of Stone and Fire”. IT. IS. ACAUSAL. So that all, even the atra, even the xechorista may have voice. YES. Even the lost may talk among us here. ESPECIALLY. THOSE. You are among enemies. YOU. ARE. AMONG. FRIENDS.  A Great Mountain to measure Eternity 

Instead of a header, an orange skyscape background. Only four posts, but they are all recent, so it may yet be alive. Strange poetry. The atra xechorista seems to be a personification of the eternal.

73rd. “ A place for inhabitants of the ₪₪₪₪”  Ascension. Huge glowing-eyed rabbit as the header. Two posts. Inactive.

74th. “ .::;=;:.-::::;:;.::-”  =====;;;;::;;;:::;;;;..:;:>. Single post. Inactive.

75th. “ o|o+o|o△o|o+o|o□”  ABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAGABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAHABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAGABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAI .  Legion. Header is a Jackson Pollock painting. Content is almost exclusively images of dots connected by lines. Sadly, now inactive. 

76th. “ ♎♍ ♌♎♒♒♋ ♎♍”  ♏♏♌♋♓♑♏♍♍♌ ♑♎♍♋♋♐ ♏♏♍ ♒♓♓♏ ♋♍♑♏♍.  ♎♍♋φΓΓΓΞνε Just symbols. One post. Inactive.

77th. “77th World Problems”  110011100011101110  1111111111111111111111111110011111111111111001 Ones and zeros. Some binary, some keyboard mashing. Seven posts. Inactive.

78th. “Tarot Universe Problems”  The universe is still expanding.  The Old Man. The header image is the Magician card from the Rider-Waite tarot deck. The posts are simple verse about the qualities of cards, or links to novelty decks. Six posts. Inactive.

79th. “so here we are”  Welcome, weary traveler. this place is safe. Greetings. I have journeyed all the way from /r/fifthworldproblems. A resting place. Five posts. Inactive.

80th. “ ▶◂◃►△◅◃△▸◀◄▷▲▼▹►▷◀◃►▸◀►▶▼”  ▸▶▶▽▵◀▲▴▼▲▷▻▽▴►◀◅△▻◂►◀◂▽◄◂▲▴▼◁▷▻◄▴◂◅▸△▸◀△▽◂▵◀▷ ▹▸▲◀▻▿◁◁◁▽  ▼◁▷▻◄▼◁▷▻◄▼◁▷▻◄▼◁▷▻◄▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽   All triangles. One guy posted squares and got downvoted. Three posts total, inactive.

81st. “my head” As of writing this, there's no 82nd. Please someone make an 82nd. Thanks.  You've made it far. One post, which links to the 82nd world, which presumably didn’t exist when it was made. Beautiful. Inactive.

82nd. “there doesn’t seem to be anything here”  there doesn't seem to be anything here  there doesn't seem to be anything here. One post. Inactive.

83rd. “The 83rd Inn” Hello! Welcome to our hotel. We have a weekly thread on Wednesday. If you would like to rent a room, please send a private message to the administration. We have five and a half rooms, but we are working to build more!  Welcome to the 83rd World Problems Inn! Despite their promise of a weekly thread, there are only three posts. Inactive.

84th. “Remöve Nanöböt”  A möbile öutpöst öf The Börk. Hidden fröm view. Patrölled by the Master_General. Nanöböts beware. Yöu have been warned.  Exterminatör Needed. Another outpost of the Bork. The top thread contains some interesting cross-worlds drama. Five posts. Inactive.

85th. “ ⋙⍡⊼⊤➠〘➇➄〙✽♞☵☶”  [1010101] [HANDLES]  It stops here. There is no 86. Trust me there is not. You won't see anything for another 7 worlds. Hot pink background, a giant unfollow stock photo as the header. Two posts. The stickied one links to 86th world, the other one links to the 93rd world, and was made at a time when 85th was the last in the chain. Inactive.

86th. “ d̸̴̮͖͚̠̻̦̩͙͇̻́̌ͬ̈͛̇̃̓͒ͥ͛͜ ̛͔̰̣͉͍̻̞͎̳͚̠̺͗ͭ̈ͬͯ̓ͤ͒̈́ͬ̏́͌̂ͦ̌ͩ̚͞H̢̢̥̝̫̝͓͈͚̤͈͔̜̬̹͒̀ͥ̚͝͠͞”  1̴̡̍͂ͬ͌̊ͧͭ̓̑̾̅ͤ͗͠͝͏̦̟͚̲̦̜̭̟̰̝̺2͒̾̀̈́̏̉ͨ̅ͧ́͜͝҉̙̟̥̣͉̗͉3̍̑̆ͥ̓̌̊̈̃̄̋͋̾͗ͤ̓͊͘͏͖͍̗͔̱͍̦̱̭͉4̡͓̟̫̰͍̲̰͚ͧ̅̀́͐ͣͧ́͗̃ͤ͒ͯ̀̚̕͟5̛̟̼̮̘̤̟̻̪̰̤̺͍̩̪ͪ̍͐̂̀ͦ̿̂́̐̅̉̃̃̋̒̀̚͜͝͠ͅͅ7̵͙̼̗̞͎̺̣̈͋͛̒ͧ̄̏9̡̡̧͍͕̝̳̝͚̼͚̱̗̹̬̙̰͔͓̜ͬͦ̃̌ͣ̍̌̀̽͛͜8̧̡̥̱͕̘͔̥̭̬̦̬͚̲̰̲̘̜̞̮͙ͣ̾̽ͣ̾͋ͪ̐́͌̆ͩ̂͊̓̉̄̽͗͘͡͞4̢̼͎̠̹̠̤̺͓̼̼̩̠̾ͯ̈̌ͬ͒̽̃̊̋̉̊͛̃͌͆̂̆́͞3̺͓͚͍̹͙̖̖̝̱͉̲͗͒͐̅́͝1ͯ͊̽ͮ̇͛̓͜͏̧̘̭̙͈̮̘3̵̡͎͉͍̭̗̭̖̲̻̳͍̹̹̖̬̹̯͗͗͂ͪ̐̓͊2̶̌̄̈͛ͤ͡͝͏̵͉̦̙̜̩̗̠͇͉̬̫̣̰͍̗̪̖1̸̙̠̪̗ͯͧ́͊̓̌̏̈́͛͗̃̌͛̔͂͋͜͡ͅ6̵̨̖̯̖̠̣̮̹̹̩͖̼̥̺͉̰̙̼ͯ̓͛ͫ̓͂̓͑5̛̹̦̩̞ͨ̊̾ͩ͂͂̒7̢̺͔͇̹̦͖̠̙̭̮͎̽͑ͣ̀̌ͨͪ̄̕͡3͓̤̳͎̙̒̾̌̍̈̑͋̅̀ͦ́̀̚͢5̢̜̥̺͈̪̟͙̝̬͚̠͒͐̍̐ͪ͐̈́̋̃͢͟2̡͙̪̩̱̰̩͈̜̭͇̗͈̬̜͔̘̀̌̒ͣ͆ͭͪ͑ͦ̿́̕͢͝ͅ7̷͓̹͇͎͉̘̩̺͒ͮ̂̏ͯ̓̂̀̍̊ͭ̒̎5̷̵̮͓̤͍̮̦̯͖̈́͑͗ͭ̄͟͡͠8̡̫̻̖̲͓̮̱̱͇̙̳͕͎͛ͫ̾ͨ͌ͦ̃̍ͮ̓ͭͭ͗̓ͧ̆́͘6ͪ̈́̃̂̽͂̿̅̍̇̔͌҉̡̹͈̱̫̻̦̜̲̰̟̺̘̘̣̞̲͢2̡̫͚͎͙̫̯̠̼̳̘͉̝̙̭̟̊͒͛ͣ̌ͥͪ̏͑ͧͤ͛͢͞͞3̶̧̧̮̥̪͎̹͔̻̖̬̹͖̜͇̪̘͓͖͛͊̒͂̐͒̎̌̓ͥ͛ͥ̾̈͑͆ͫͪ̀1̸̼̳̮̘̙̥̙̲͙̪̪̝͈͔̠̭͗͗̊̒͂͌ͭ̀͜2̧̘̖͙̟̜̩̂̾͊̓̚͞7̵̡̦̲̤̱̫̳͕̤̾͌̎ͭ̅̆̓̾͆͑̀̀͡6̷̄ͤ̉͛̑ͥ̀ͩ̈ͧ̃͏̸̴̙͙͇̯̹͢4̒̀͗͐͊̃̍̈ͯ̈ͤ͊̊͑̅͂҉̤̥͔͕̤̳̠͔̠̩̰̼̜̖̪̭͘5̨͔̯̤̼͇̹̟͓̳̰̮͙̦̏̆̄̆͋̓͊̓ͥ͊̎ͬ͌ͩ͊7̵̡̛̼̝̻̥͇̬͂̏̌ͥ͗͒̀̑͡͠ͅ8̴͈̿ͫ̐̌̂́̐͘͞��̥̫͙2̴̦͍̲̻͉̳̘̠̥̫͓̈̔̑͂͂̌͞6̈́̊ͮ̾̓̀͜͝͏̤̗̪̝̤̠͇̜͙͔̖̫͎̻̠̼͜͠4̶̑ͣ̋̅̀ͩͬ̒̓̓ͫͭͩ̓̅ͨ̽ͭ́͜͞͏̣̼̬̘̲͎̠̤̝1̷̡͍̜̳̦̙̬̱͍͈̪̺̪͉͎̦̌͑͒̅ͮ͒͊̃̒̕1̵̛̹̻̺͎͉̳̤͚̥̰̤͚̱̩̞̹͈͖̬ͪ̄̍̿̍̃9̵̖̭̪̱ͣͨ́̅̋ͮ̃ͫ̓͛͐ͩ̓ͫ̿͘͞͝ͅ8̷͎̪̙̖̽̍͗̐̂ͭ̃͟͟͞5̭͕͍̟̱̞͔̽͒̍̐̿ͫ͗ͦ̓ͫ̆̀͢1̴̡̍͂ͬ͌̊ͧͭ̓̑̾̅ͤ͗͠͝͏̦̟͚̲̦̜̭̟̰̝̺2͒̾̀̈́̏̉ͨ̅ͧ́͜͝҉̙̟̥̣͉̗͉3̍̑̆ͥ̓̌̊̈̃̄̋͋̾͗ͤ̓͊͘͏͖͍̗͔̱͍̦̱̭͉4̡͓̟̫̰͍̲̰͚ͧ̅̀́͐ͣͧ́͗̃ͤ͒ͯ̀̚̕͟5̛̟̼̮̘̤̟̻̪̰̤̺͍̩̪ͪ̍͐̂̀ͦ̿̂́̐̅̉̃̃̋̒̀̚͜͝͠ͅͅ7̵͙̼̗̞͎̺̣̈͋͛̒ͧ̄̏9̡̡̧͍͕̝̳̝͚̼͚̱̗̹̬̙̰͔͓̜ͬͦ̃̌ͣ̍̌̀̽͛͜8̧̡̥̱͕̘͔̥̭̬̦̬͚̲̰̲̘̜̞̮͙ͣ̾̽ͣ̾͋ͪ̐́͌̆ͩ̂͊̓̉̄̽͗͘͡͞4̢̼͎̠̹̠̤̺͓̼̼̩̠̾ͯ̈̌ͬ͒̽̃̊̋̉̊͛̃͌͆̂̆́͞3̺͓͚͍̹͙̖̖̝̱͉̲͗͒͐̅́͝1ͯ͊̽ͮ̇͛̓͜͏̧̘̭̙͈̮̘3̵̡͎͉͍̭̗̭̖̲̻̳͍̹̹̖̬̹̯͗͗͂ͪ̐̓͊2̶̌̄̈͛ͤ͡͝͏̵͉̦̙̜̩̗̠͇͉̬̫̣̰͍̗̪̖1̸̙̠̪̗ͯͧ́͊̓̌̏̈́͛͗̃̌͛̔͂͋͜͡ͅ6̵̨̖̯̖̠̣̮̹̹̩͖̼̥̺͉̰̙̼ͯ̓͛ͫ̓͂̓͑5̛̹̦̩̞ͨ̊̾ͩ͂͂̒7̢̺͔͇̹̦͖̠̙̭̮͎̽͑ͣ̀̌ͨͪ̄̕͡3͓̤̳͎̙̒̾̌̍̈̑͋̅̀ͦ́̀̚͢5̢̜̥̺͈̪̟͙̝̬͚̠͒͐̍̐ͪ͐̈́̋̃͢͟2̡͙̪̩̱̰̩͈̜̭͇̗͈̬̜͔̘̀̌̒ͣ͆ͭͪ͑ͦ̿́̕͢͝ͅ7̷͓̹͇͎͉̘̩̺͒ͮ̂̏ͯ̓̂̀̍̊ͭ̒̎5̷̵̮͓̤͍̮̦̯͖̈́͑͗ͭ̄͟͡͠8̡̫̻̖̲͓̮̱̱͇̙̳͕͎͛ͫ̾ͨ͌ͦ̃̍ͮ̓ͭͭ͗̓ͧ̆́͘6ͪ̈́̃̂̽͂̿̅̍̇̔͌҉̡̹͈̱̫̻̦̜̲̰̟̺̘̘̣̞̲͢2̡̫͚͎͙̫̯̠̼̳̘͉̝̙̭̟̊͒͛ͣ̌ͥͪ̏͑ͧͤ͛͢͞͞3̶̧̧̮̥̪͎̹͔̻̖̬̹͖̜͇̪̘͓͖͛͊̒͂̐͒̎̌̓ͥ͛ͥ̾̈͑͆ͫͪ̀1̸̼̳̮̘̙̥̙̲͙̪̪̝͈͔̠̭͗͗̊̒͂͌ͭ̀͜   orb. One post. Inactive.

87th. “Haha fooled you”  this is not the 87th world, nor are there problems here. [...]  Rules: 87. post damp memes 87. don't post problems 87.Haha fooled you  too damp 4 u. Three posts. Inactive. 

88th. Banned.

89th. “Eighty-ninth World Problems”  The Eighty-ninth world exists only to those who do not. The problems of those inconvenienced by non-existence. Three posts. Inactive.

90th. Private.

91st. “∆”  ∆.  ∆ Like the triangle world, except it’s all the same triangle. Four posts. Inactive.

92nd. “≈” ≈. ≈. Like the previous world, but  ≈ instead of ∆. Two posts. Inactive.

93rd. “Crowleyverse”  Get your universe real-estate today. I'd like to purchase 20 shares of Crowleyverse stock. Header is... Aleister Crowley riding a cartoon bicycle? Two posts. Inactive.

94th. “ꙮ” ꙮ. ꙮ Ah, this again. Two posts. Inactive.

95th. “ ●●●CONGEAL●●●” ●●●The desert burns brightly, forever●●●  ●●●Where am I..?●●● Header is a surreal desert painting, featuring an hourglass and scissors. Many links to 9005th world. The content is strange remarks about the sun and wandering. Six posts. Inactive.

96th. “Where the Wildflowers Grow”  In wisdom, madness. In madness, wisdom. [...]  Strive to speak not in straight lines, for this is a nest of wandering words and tangled webs.  I AM REBORN

Newly founded, and very reminiscent of the 45th world. Similar in the kind of poetic content and images it contains, but with a wildflowers and fire motif. Probably active.

97th. “97thworldproblems” There doesn't seem to be anything here... One post. Inactive.

98th. “Zimmity Shoom A Skibbity Sham!” Shippity shoip a skipbitty bam! Shododpadroopadoopshoom! Everyone speaks in scat-singing language. Bright colors. Four posts. Inactive.

99th. “i got 99 problems” but a world ain't one. . Created way earlier than the previous couple of subreddits, probably exclusively for the pun. Inactive.

hundred. “..//TRANSACTION_LOCKED--)//..”  LOAD--file://HTTP.TRANSM1SS1ON.C.NET%% world100th.....ERRORLOADING restart.  Fo0!?!ish mmm0rr74lsss Very green. Two posts. Inactive.

100th. “&”  जलाद्रक्षेत्तैलाद्रक्षेद्रक्षेच्छिथिलबन्धनात् | मूर्खहस्ते न मां दद्यादिति वदति पुस्तकम् ||   I have found the flower. Interesting. Some glitchy visuals, and varied content. Most of the posts turn out to be in Hindi or Nepalese script, if you run them through Google translate. Still active, but barely.

101th. The labyrinth ever expands. Private.

101st. “One-Hundred-First World Problems”.  yYyyYyYYYYYyYYyy YY ;:< YyyY <, yY YYYyy y♪yY♪Y♪YY♪ yyY♪ yyYyYYYyy   All weapons will be disappointed, I checked. Ys and music notes. Snow leopard print background. Inactive.

102nd. “102nd World Problems”  how u get heer true braev.  i am kill. My eyes, ow, thermo-vision cat header and deep pixel background. Two memespeak posts. Inactive.

103rd. “The unfortunate problems of the impoverished nations of the void”  A colony of the Star King.  Still raining, still dreaming. Three posts. Links to 200th world. Some Bork interactions. Inactive.

104th. “tUaReG” Wow, no posts. Inactive.

Oh god. There’s no 105th. (Dated: Dec 21 2015)

This is important: We’ve reached the end of the continuous chain. But don’t cry, there are plenty more.

106th. “One Hundred and Sixth World Problems” Welcome, to Änthüranm. These are/aren't the rules you must/must not obey: One's self should/shouldn't refer to one's self in the omniscient/unomniscient third being. Äanthüranm is/isn't a utopia, so please do/don't fight. {!}IMPORTANT NEWS | PLEASE READ/IGNORE{!} Header image is a Google deep-dream frog/forest thing. Has a cool contradiction-based grammar, but only one post. Inactive.

107th. “7 :UB: 6 :CRIBE:”  :H: :3L P: :M :E: Colons and numbers. Five posts. Inactive.

107. “UniVermultivergalaxy”  Sweet Mother, sweet Mother, send your child unto me, for the sins of the unworthy must be baptized in blood and fear.  Sanguinem suum colligitur. Creepy aesthetic: screaming face imprints and a pentagram. Red background. Links to /r/thEblacKRaBbit/. All is written in Latin. Four posts. Inactive.

108th. “Buddha Universe Problems”  Just because you're enlightened doesn't mean you don't have things to complain about  Well, I THOUGHT I had this Nirvana thing down. 108 is a meaningful Buddhist number. Pretty self-explanatory. Nice header image. Four posts. Inactive.

109th is also missing.

110th. “011001010110010101100101011001″  01100101011001010110010101100101011001010110010101100101011001010110010101100101011001010110010101100101011001010110010101No posts! Inactive.

111th. “ 01010011011001010111011001100″  01010111011001010110110001100011011011110110110101100101001000000111010001101111001000000101100101101111011101010111001000 Oh okay. No posts. Inactive.

112nd. “Why the pain? Why must we the p';ain” did you have toHEHE HE HEH HEHHHE EHEHHHEHHEHEHEHEHHHEEEE. No posts. Inactive. Worth noting that there’s no 112th.

113th. “˙̤⋮.⋱·̣.̈:⋱⋱˙̣:⋰.̈⋰.̣܈⋱:.̤:̈.·˙̤։:”  ∴∴∴˙̣܈⋱⋮∴∴⋯∴⋱⋱˙̣⋰⋯⋱  ⋱⋮∴∴⋱⋮∴∴˙̣˙̣˙̣⋰⋰˙̣˙̣˙̣˙̣⋰˙̣∴⋱⋱˙̣⋰⋯ Dots. Dots. Dots. I thought it was braille, but apparently not. Two posts. Inactive.

We now enter non-space, where worlds are few and far between.

127th. “Welcome to 127.0.0.0!”  ERROR: SERVER DOWNSERVER DOWNSERVER DOWN ERRORERRORERROR.  ping. Remember 43rd world? This is where they’ve relocated to. Server stacks. IT language. Nice blue theme. Semi-active, but dwindling.

130th. Private.

131st. Brought to you by the members of /r/Touhou. Private.

143rd. “FOR THOSE WHO ARE INFINITY”  I CAN SEE IT NOW I HAVE SEEN IT ALL I HAVE SEEN THE BEGINNING AND THE END, IT IS SO EXCRUCIATINGLY BEAUTIFUL.  I LOOK FORWARD AND I LOOK BACK. Two posts. Inactive.

151st. “151st World Problems”  From the time a Pikachu fried your bike to the time you ended up in a weird place after flying to Cinnabar Island... this is the place to talk about all your 151st world problems. No posts. Inactive. (151 because that’s the number of original pokemon.)

200th. “The Court of the Star King” 1) Pay Homage to the Star King. 2) Keep the Primordials sated and silent.  Analyzing substances. Some cross-worlds drama, also the Bork show up. Six posts. Seemingly inactive.

201st. “No” No  No Wow. All posts are the same, made by user Bolanok over the course of two years. Inactive. Inexplicably marked NSFW.

202nd. “202nd World Problems” This one has only existed for a month,  so perhaps someone has something planned for it. No posts and inactive as of yet.

216th. “The World of Forms”  On the Field of Πόλεμος  

From the wiki: “Plato’s number is a number enigmatically referred to by Plato in his dialogue the Republic (8.546b).” ... “ As for the number's actual value, 216 is the most frequently proposed value for it, but 3,600 or 12,960,000 are also commonly considered.” Mostly content related to Platonic ideals, some interesting dialogues. Unfortunately only seven posts. Inactive.

222nd. “·°‡” No posts. Inactive.

225th. “Respond.” Respond.  Static. OP pls, the world. Three posts by user thebrrrzing, all claiming to be trapped and begging for a response. Inactive.

255th. “255th World Problems.” YOU MUST LISTEN TO THE SPIDERS. THEY ARE VERY GOOD SPIDERS. PERHAPS YOU WOULD LIKE TO MOVE HERE AND EXPERIENCE A BETTER TOMORROW.  Spider truth. Spider world for spiders. Four posts. Inactive.

256th. “8-bit world problems”  11001011 00001110 01100011 00100101 11010001 11111101 10111101 01011010 11010101 10110000 11000000 11100011 00100101 00000100 01000100 01011001 01001011 01001110 01100011 00100101 11010001 11111101 10111101 01011010 11010101 10110100 11011000 11100011 00100101 00000100 01000100 01011001  00110010 00110101 00110110 01110100 01101000 01110111 01101111 01110010 01101100 01100100 01110000 01110010 01101111 01100010 01101100 01100101 01101101 01110011 Another world with a binary gimmick. Four posts. Inactive.

273rd. “273rd world problems”  273rd world problems. No posts. Inactive.

276th. “The Blade of Umis”  The once proud world now rests as the latent energies of The Swordsman's tool of destruction. Despite the implied backstory and worldbuilding, there are no posts. Hmm. Inactive, for now.

314th. “title”  31415. It’s Pi, get it? Three posts, inactive.

322nd. “Welcome Elites!”  |͇ Λ ͇||̶͇̿ ̶͇̿ ͇̿ |̶̿ ̶̿ ̶̿ ̶̿||̿ ̿ ̿\ |̶͇̿ ̶͇̿ ͇̿ ̿ ̿|̿ ̿ |̶ ̶ ̶ ̶| |̶͇̿ ̶͇̿ ͇̿ |̶͇̿ ̶͇̿ ͇̿ |͇ ͇ | ̿ ̿|̿ ̿ |̶͇̿ ̶͇̿ ͇̿   If you be on this subreddit, help it out. Make it the truth. Interesting header and background. Has an “elites of society worshipping satan” type theme going, with some pretty great conspiracy posturing. Seven posts. Inactive.

347th. “DEVOUR THEM”  NO DISRESPECTING THE GREAT DEVOURER KING. IF YOU DISRESPECT, YOU WILL BE DEVOURED.  This war can never end Claim to be at war with 1000th world and a couple of other subs. Maroon background, weak scary aesthetic. Inactive.

404th. Solving complex-world problems Googi step at a time. Private.

418th. “ ABRAHADABRA” ABRAHADABRA   ABRAHADABRA. Okay so the top post is spam, whatever. All the others are just the words “ABRAHADABRA”. That’s right, more thelemic stuff. Sacred geometry header. Four non-spam posts. Inactive.

420th. “Börk Weed Farms”  The Börk have discövered the pöwer öf the plant that is gröwn here. In exchange för security and aid, the ghetto here has allöwed us tö cöntröl the area and farm this weed.  mfw hit the blunt too hard. Our friends the Bork, and lots of 420 nonsense. A green background and exactly the header you’d expect. Six posts. Inactive.

446th. “My universe... not yours!”  Why 446? Why not?! It was a number I was randomly assigned... it's just as good as any number.  ECHO!!. Mostly links to videos. Header is a crow-lion. Eight posts. Inactive.

475th. them problems tho. Private.

482nd. “No. Go away.” No posts. Inactive.

500th. “You’ve made it.”  Please avoid leaving. If you leave this subreddit, you will return to an alternate version of your own world. Nothing will ever be the same again. You will be fine. You have been warned. You are loved.  Please don't stay here. Enjoy your R&R. Three posts. Inactive.

523rd. The labyrinth expands, can you outrun it? Private.

641st. “It’s a beautiful day. -641st World Problems”  If you came here looking for a sub in the vein of "Sixth World Problems" and it's ilk, please, continue on. The name of our sub is only a consequence of all others being taken. [...] Do not acknowledge the deviants. Some are bound to find their way here, but this place is not for them.  My house didn't burn down today A strange world. Early posts describe genuinely pleasant events, whereas later ones riff on the “everything is nice” theme by expressing joy about terrible ones. Has an empty sister sub,  /r/641stWorldUplifting. Five posts. Inactive.

659th. Private.

666th. “Welcome To Hell.”  Can you fathom the Terror? It’s all in the title. Header is flames and a screaming woman. Red background. Just one post, though. Inactive.

666. “Six Hundred and Sixty Sixth World Problems”  Is hell to hot for you? Is that kid Jesus, from down the street, messing with your plans for corruption?  I keep setting all of these days for the apocalypse, but I always get stage fright when the day comes. Hell-world played straight. Ugh. One post. Inactive.

701st. “^701″ 1. Don't. 2. {0} 3. 6. π. stop.universal   #d/7wi -- 6:14a ° ydi {unsolved;} {post-calc;} Submissions are restricted. Two posts, displaying a peculiar grammar. Inactive.

747th. “Under control of the Colours”  The [STATUS:NEW] [OBJECT:TOWER] is [STATUS:COMPLETE].  Will the [REDACTED:COLOURS] [ACTION:INTERCEDE] in the [ABSTRACT:UNREST]? An outpost of the seventh world. The header is a second magnificent tower. Moderately active, although only posted to every couple of months.

777th. “LUCKY!!!!”  Problems in a world of good luck?! 'The hell' you say!  If you got this far... you're pretty lucky. Luckiest world. Slot machine header. Two posts. Inactive.

800th. “pppelleaes*(& heolp” the time((* is fall *& machine infinite and no (one) can sideways bend through transendence when are forced to chrono a noise into #th dimension when i pheel down on the worlds chiiiiii. No posts. Inactive.

801st. “A Higher Pantheon of Lesser Concepts”  What is the commonality between fools and.  Yearning. A series of short posts by user Dirk_the_Jerk. I cannot make head nor tail of them, but perhaps you can. Curiously lovely. Inactive.

844th. “It’s been [OMITTED] years”  What would happen if the cogs stopped working? I'd rather not find out.  Stolen Equipment. The maintenance team for some factory or boiler room, which the multiverse may or may not rely upon to function. Content is reports on the status of tools, facilities, other equipment. Machinery header. Active.

888th. “888th World Problems: Wel {exceeded/end} come to DUST{0000exceeded}BALL Solon” F A C I L I T I E S C U R R E N T L Y I N S H I F T [...]  Arrivals are asked to report to Sectional Allocation - compartments will be assigned. Your welcome pack awaits. ---SECTIONAL {0000exception} Tell // Shape _de-growth. Cuneiform in the header. Something between a facility, an archaelogical expedition, it’s not my job to figure this out, I’ve been awake for like 30 hours, guys. Peculiar grammar. Active.

973rd. “GREETINGS AND WELCOME CITIZENS OF PLANET EARTH” 973 973 EHT NAMUH 973 973 GREETINGS CITIZENS OF THE CITY OF NINE GATES.  RECEIVING TRANSMISSION. Based on this site. Gets a post every month or so. Black and red aesthetic.

976th. “...;...;.;..;;;;;......;..;..;....;..;..;.;.;.;.;.;.;;;;;;;;;.;.;;;..;..;..;.;.;;;..;.”  .;;;;;..;;;.;..;.;..;.....;.;;;;;;;...;.;...;..;.;.;..;;;;;;.;.;.;;;.;.;.;  ..;..;.;..;;.;;;;;;...;.;..;..;.;;..;;;;;;.;.....;.;..;..;.....;;;;; One post. All colons and semi-colons--I suspect this may be in morse or something, but I don’t have the heart to decode it. Inactive.

999th. “999thworldproblems” Speak purposefully, for the Runners are many and their time is running out. Beware Her gaze; her Ever-Watchful-Eye never sleeps. Never stop Running.  WATCHING. A creepy doll watches from the sidebar. Dedicated to unsettling images, mainly featuring eyes and dolls. Flagged as NSFW. Inactive.

1000th. “ＨＡＩＬ ＴＨＥ ＤＥＥＰ ＳＰＡＣＥ ＷＡＳＰ ＫＩＮＧ”  ＰＵＮＹ ＣＨＩＬＤ ＦＩＲＳＴ ＷＯＲＬＤ！ ＹＯＵ ＡＳ ＹＯＵ ＦＯＲ ＷＯＲＬＤ ＴＯ ＷＯＲＬＤ ＦＡＩＬＥＤ ＡＳ ＳＡＣＲＩＦＩＣＥ. ＴＨＥ ＣＨＩＬＤ ＦＡＩＬＥＤ ＦＡＩＬＥＤ ＴＨＥ ＣＨＡＬＬＥＮＧＥ？[...]  ＹＯＵ ＡＳ ＹＯＵ ＥＱＵＡＬ ＴＯ ＰＡＲＡＬＹＺＥＤ ＳＰＩＤＥＲ ＰＬＡＣＥＤ ＩＮＳＩＤＥ ＮＥＳＴ ＴＯ ＦＥＥＤ ＹＯＵＮＧ．ＨＩＶＥ ＬＡＹ ＥＧＧＳ ＩＮ ＹＯＵＲ ＨＵＳＫ ＢＯＤＹ． ＨＥ ＡＬＯＮＥ， ＷＨＯ ＯＷＮＳ ＴＨＥ ＹＯＵＴＨ， ＧＡＩＮＳ ＴＨＥ ＦＵＴＵＲＥ

The Hive, a race of superintelligent insects that pillage worlds, seeking to assimilate their inhabitants. Active.

1001ST. “...”  The End. A single post, detailing the total destruction of the cosmos post-assimilation by The Hive. Submissions restricted. Inactive.

1002nd. “hide” That’s it. No posts. Inactive.

1054th. “1054thworldproblems”  54th was the last well populated. There was an encouraging sign at the 81st, nothing in the 82nd, and a hotel in the 83rd. But that was so long ago. An empty world mourning emptiness. Inactive.

1066th. “High Kingdom of Dreiudd” Contribute frequently please. This is more of a guideline than a rule, but subscribers should claim a fiefdom and develop it, rather than claiming a fiefdom and not using it or not claiming a fiefdom at all.  A promotion. Users claim and rule fiefdoms, under the ultimate stewardship of their Queen. Active, with a couple of posts a month.

1074th. “The Great Wildlands”  For aeons these grounds were left untapped, and now it is unveiled by the most unlikely of voyagers. What they saw was truly something to behold. And you may find yourself agreeing, too. But beware, mother nature has grown a strong grasp on this land since it was last inhabited.  I cross the bridge into a forest much like those of Orbeluca. This place shall be known as Avon. The exploration of a new world. Wonders of nature, mythic constructions. Consult their wiki for more depth. Massive blue sky and plains in the header. Active.

1098th. “WELCOME TO THE BOWL” THE WALL is fully functional (<Welcome To The BOWL>) THE ARCHIVIST is NoW now now NOW actIVE.  GATLING BLADE in hand I RETURN to this place to find the VOICE I heard in the UPROAR. A world apart. Active. Indescribable, largely because of its dense connections to other worlds and subreddits. Header and background are abandoned Soviet monuments.

1101. “011000010111000001101111011000110110000101101100011110010111000001110011011001010000110100001010″  0101010001101000011001010010000001110111011011110111001001101100011001000010000001101.  010010000110010101101100011100000000110100001010 Oh, another binary world. SO ORIGINAL. One post. Inactive.

1234th. “1234″  4444  What the fuck? Two posts. Inactive.

1278th. “Dynamite - It’s Good For You!”  Welcome to our lovely little town! We are proud to be one of the first to be completely powered by an Atomic Power Plant! Wow! All of our houses are built out of lead to be extra sturdy and asbestos to keep warm while also being fireproof! As you can see, safety is our #1 concern!  I couldn't imagine starting my day without these! American retro-futurism, with a taste for bombs. Dusty town as the header image, otherwise plenty of atomic safety label images.

1337th. “1337thworldproblems”  Y0 NIG44 1 4M 2 1337 4 U  50 1337. One post. Inactive. You get the joke.

1729th. “1729th World Problems”  Access the Akashic Database.  I saw myself today One post. Inactive.

1922nd. “Ojohn Apparelz and Armour” ooooooooo Ojohn oooooo clothes an armor for all ur Granfaffy needs. FISh watches so no stealss  of Openiingsz! This sure does exist. Headless bird header/background. Active. Nay, blossoming.

2000th. “2000th World Problems”  WHOA THESE DRUGS ARE OPENING ME UP TO THE WORLD MAN OH MAN LOOK AT MY HANDS THEY'RE GETTING BIGGER MAN OH WORLD DRUGS MAN OH MAN WHOA MAN WHOA DRUGS SHROOMS MAN OPEN UP TO WORLDS MAN LOOK AROUND YOU MAN MAN WHOA. Uh, no posts. Psychedelic cat background. Inactive.

2001st. “2001stWorldProblems”  They lie. There are four (4) multiverses. A, B, C, and D. STAY SAFE OUT THERE. No posts. Buddha header and... a water tower as the background? Inactive.

2634th. “2634th World Problems”  Cave-dwelling hors d'oeuvres vie against a race of flying napkins for much coveted marketing department employee-of-the-year plaques.  Leaflet Drop. Ummm. Wh-what they said? Two posts. Bruschetta header. Inactive.

2718th. “Respondemus In Aequatione.” Here is the home of number logic. Pure mathematics. All that can be is but an equation. You will find the answers you seek here. Go forth and indulge.  There is no law here Two posts. How did the spam bots find you? Inactive.

5030th. Private.

5245th. “5245th World Problems - Transantarctica” The House Tartus Di Inferi.  Arrival at Cache 1. Memos and correspondences between employees of a Transantarctican expedition. Sepia. Four posts, but possibly still active.

6037th. “Only A Matter Of Time” Territory of the bOuNdEdLaNDs. Used as a time mine.  TiMe iS BeInG EXtrAkTeD FrOm kLoKks AnD The PeOplE oF ThE BouNDedLaNdS ArE ThRiViNg! Where clocks are mined for time. Some inter-world drama. The Bork show up. Header is huge image of a creature with a clock for a face. Active.

7074th.  / __ )___ __ ______ ____ _/ / / _ / _ / / / / __ / __ / / // / / // / // / / / // / //\/_, /\// /_/\,/ /___/. Private.

8000th. Bradley Dobbleson. Private.

8453th. Welcome to 8453th World Problems, for thing you find annoying in The Republic Of Hot Dogs. No posts. Inactive.

8901st. “PRIMARY”  ᴤөөʞ ʇµө ⊂ODEX [...]  BEYOND LIES OLD ANTIGONE TO THE NORTH AND THE FOETID GARDEN TO THE SOUTH. BEYOND THE PROMONTORY OF YANN, SPANNING EAST TO WEST, SLEEP THE OLD CITIES OF INDUSTRY AND KNOWLEDGE.  TWIN SUNS

I don’t know, but it looks cool. Some wonderful paragraphs of mythmaking that my brain is too sleep-addled to parse. Background is plains. Slow, but probably still active.

9001st. “For World Problems Greater than 9000″  This exists bacause. So here we are. Two posts. Inactive.

9005th. “Share” Become one with your Brother. Share his thoughts, he'll share your body.  Dream. Pre-industrial meditations. Forest and tents as the header. Inactive.

9999th. “9999th World Problems”  I can not stop entropy. Egyptian wall painting header, bright yellow and orange backgrounds. This theme is not reflected in the content. Three posts. Inactive.

10032nd. “[[[]]][][]][][[][]][]]][][]][]][[][]][]][[][[][]][][][[]][]][][[][][]][][]][][][]][]][]]]]]]]]]]”  [[[[[[[[[[]]]]]]]]]]]]  ][[][[][]]]. Top post is spam, so I ignored it. Three posts. Inactive. Square brackets.

12345th. “Your new home.”  Fish: YAY I'VE BEEN CAUGHT  12345 Two posts, one of which is spam. Inactive.

17284th. “17284th World Problems”  Ooooooohhh Supermarche  Its WAR!!! Fucking wonderful. War-mongering supermarket. Supermarkets. Yes. Active.

29979th. “So I decided to simulate a Universe”  We are scientists. We decided to construct a singularity and simulate a universe. Why? Because we can. That's the only reason we need.  Can I help with your project to simulate a universe? Purple and blue space clouds. Notes on the progress of the simulated universe, appearance of matter, life, etc. Active.

67698th. “67698th World Problems: Brutalists and Rice”  Brutalism + Forgiveness = The Hive Machine. - No meaning  Occupation 1. Links to images of brutalist architecture, and rambling, bleak slice of life prose. A human zoo. Slow, but active, with a few posts a month. Grey.

80085th. “80085thworldproblems” Uh, okay. Nothing. Inactive.

90000th. “I AM THE ALPHABET” LOVE IS FEAR FEAR IS PAIN PAIN IS LOVE. Empty. God. Inactive.

90210. “AWARDTH!”  Thank You All Very Much. As I write this, on December 25, 2015, 2:26 AM, this subreddit was founded approximately a day ago. They can’t be stopped. The worlds multiply. Please kill me.

90218th. “90218th World Problems”  At G.O.M.M Industries and Subsidiaries Inc. we work hard to bring you a wide range of products, most of which have been deemed safe for consumption by your local authority thanks to carefully placed bribes the diligence and efforts of our skilled slaves employees.  Aren't you EXCITED!? A  G.O.M.M Industries and Subsidiaries Inc. world. Owned by Faffy Trump. Header is moneys. Background is cubicles. Seven posts. Inactive.

94231st. “94231st World Problems” 12 drink miminum. Why not feed that gargantuan subterranean grub body with wings! And a salty beverage whyle your attic? You came to the right plaice.  Hoi Hoi! Some kind of pub? Shitposty fifth world creepiness X cooking channel, idfk. Garish. Inactive.

99998th. “🆗😄👬💬💝📷😂❎🌚❤☀😍”  🎏👬💬🆗🏠👮➡4⃣    🆗. One post. Inactive. Ahahaha

99999th. “what lies within the the when you WHEN YOU SEE”  oh once i walked and left ledt a ha ha ha ha ha lonely place i and i held her hand her hand i woke up and saw eyes ever ywhere.  look how they send you into insanity. A troubled world, surely beyond the grasp of the fragile human mind. Let’s not tarry here. Fuck. Five posts. Inactive.

100000th. “100000thworldproblems”  Aaa aaaA aaaa aAaaaA aaAa. AaaaA! Aa? All flagged NSFW, for no reason. Two posts. Inactive.

111111st. “The Front Page Of The Internet” WELCOME TO RIDDERITT!!! THE FRONT PAGE OF THE INTERNET! HAVE FUN! PLEASE FOLLOW THE RULES!  111111. Parody of Reddit culture, but like, more melancholy than the usual circlejerk. Background is a melting desktop. Active.

200000th. “ALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAK”  ALAK ALAK ALAK ALAK  ALAK ALAK ALAK. Okay. One post. Inactive.

563233. “yes”  meow renchto lenieort? Likes purple. One post. Inactive.

666666th. “666666TH WORLD PROBLEMS”  hecomes .heyou devour 8*881u35noj---- efwnokhelp us.... weonf please.  HE WILL DEVOUr us alll- 90uy ftwcbn8/i5 7778 Four posts. Inactive. I hate humans.

672514th. “672514th World Problems”  (4)21[(6)]43 | Two posts. Inactive.

959270th. “FLUGUFRELSARINN” IMAREASONABLEMANGETOFFMYCASEIMAREASONABLEMANGETOFFM. Why does this exist. No posts. Inactive.

999998th. “???? ??? ????????? ???????? ???” ??????????????????? ????? ???????????? ?????????????????????????????????????????? ?????????????????? ???????? ??????????? ????????????????????????????????????????. Just. Fucking. Question marks. You sick fucks. One post. Inactive.

999999th. “1000000thworldproblems” E͖̘͈̻l̴̟͉͕͎̪͓e̹ga͔n̺̥̬͙t̻͎̤ ̜̭͎̪͓͚ŕ̯̲̝̩̜̱͚u͕̱͖̖̣͜l̢e͓s͈̼̳̪̪̥̲ ̬̙̰̖ị̥̺͇͈͓n ̶̼̟͙̬f̥̱͘r̵͔̣̦̺͎o͓͔̻̗̲̖͜n̛͙̣̳̲͈͉ͅt̮̞̜̖̭͕̦̕ ̠́o̳̲̯̫͡f͍͕̮̜͍̜̪ ̵͔͎y͈̠͈̤̩͈̭o̠u̱̮͓͉̟̣,͜ ̹͎͟ev̝en̮̭͖̠̠̳ t̟͕̪̺̦̬̥h̷͚̗os͕̼̜̹̲̣̀e̗͕͖͙̺͈͇ ̷̣̯͈̯̥͇͇w̝̤̪̪h̶o̠ ͈̰r̝̬͖u̶l҉̥e̯̬ ̰̜͈̠̙͟w̧̰͇̞̞͍̜̭i̟͉̤̕ͅt͓̼̼̜͖̱͝h̨̰̹̦ͅ ̣͉̦͡a͚̖̤ ̹͕̯͎͓r̮͘o̫̻̻̻̜͡m̕a͓̥̙̖̬̙͖n̫̗͔̭͟ț̵̘͎̟i̫̟͙͍͕̟c ͕̜m̪̘͓͎ąn͍̰̫͍̤͖͇ ḽ̲̯̠͍̙̳̠o̸͏̳͎̣̬ǫ̛̟͇͙̹͕͇͓k͙̠͓ͅe̶͙̘͚͓̦͕̤d̥̱͉͘ ̙̺͓̭͈̖͕̻b͢͏͓͖̘̖̹͡ą̧̤̪̦̦͍͚ç̭͙͕k̨̯̜̣͔̩̠ ̶̹͖̺̗̩̱͖̰͉͢a̷̱̟̫͎̹͙͕̳͘͡t̨̙̻̹͍͉͉͙͜ ̣��̪̳͙̻̮̬̙t͓̩͙͇̲̪̼͝ͅh̛͍̬̭͇̺͢e̢̖̞͍̘̙ ̦̺̳͓̜͚́͜͠s̼͇͚̼̦c̵̡̟̠͕̜̺̮̞̣h̦̮̟̣̖o̡̙̜o҉͎͢l̸̥̝̭̣̝͚͈̜͜ś̠̜̱̣͇̣͈ͅ ̜̩̀o̷̬̖̠̟̘̟f̷̘͙͍̥̞͠ ̧͓͙̫͈̘̳̺̠t̸̠̻̼̱̟͔h̜͙̹͕̣̞̘͟ḛ̭ ̧̙̻̝N͕̺̬͈͘e̯̺̱͕̻̞t҉̪h̵̶̳̮̘̗̻e̹̫̪͙͇̱ͅr͎̘̣̦̙̣̝̫l͜҉̘̙a̸̻̼n̶̢͏̭̠̖̱͚͓̯̲͕d̛͕̗̣̹͡s̷̮ͅ:̛̞̮̙̺̰ )(*&)(*^^&*. Two posts. Inactive.

67803421. “67803421 World Problems” NICK SABAN IS THE LIFE AND THE LOVE. HE WHO MUST ONLY BE ADRESSED BY "BASED SENPAI OGRE-LORD SABAN". FOOTBALL SEASON IS NEARYING. SO IS BASED SENPAI OGRE_LORD SABANS REIGN OF TERROR ON THE SEC. I... I just don’t know. Two posts. Inactive.

3H91rd. “█████▄▄▀▄██▀”  ⅍◊ █▄▄▀███████  ▀█▄█▄▀█ . Ugh. What the fuck. That’s not even a real number. Two posts. Static. Static everywhere. Inactive.

So, is this it? Is this where it all ends?

Of course not. There are still several directions to abstract into:

Take, for example, the five + subreddits dedicated to forms of the zero-eth world.

An inordinate number of googleplexes. Many infinities.

The negatives. Fractions. i and pi. Sets? God fucking stop already.

I’m so weary.

[ctrlcreep-blog]

Models of Endosynesthetic Loops

Endosynesthesia: where colors invoke the experience of other colors, feelings are associated with different feelings

(renamed from metasynesthesia courtesy of @The_Lagrangian and others.)

The idea here is that a stimulus from one sensory/conceptual category triggers the experience of a separate stimulus from the same category. This differs from ordinary synesthesia, where triggers cross categories.

More simply:

Synesthesia = colors --> letters, music --> taste, etc.

Endosynesthesia = colors --> colors, letters --> letters, taste --> taste...

We could quibble about what exactly constitutes a discrete sensory/conceptual category. Synesthesia is really weird about this; inducers can be things like “days of the week”, concurrents can be things like personality. People can associate letters with colors without associating letter-like scribbles with colors. Ideasthesia is an interesting term I don’t see used much, which is more geared towards concepts and the possibility of a semantic link between the inducer and concurrent. (ex: a suspiciously high number of people thinking that ‘G’ is green.)

To simplify things, I’ll be using colors in all of my examples, but keep in mind that any of this could apply to categories like touch, emotion, texture, sound, and anything else you can think of.

So: the interesting problem that endosynesthesia poses is whether a concurrent can function as an inducer.

My instinctual reaction is “No, that’s dumb,” followed by “Oh myy god, what if--”

It’s probably worth distinguishing between projective and associative synesthesia. The former implies that if you see the letter G and it triggers green, you actually see something green, be it the letter itself or a floating shape in space. By contrast, associative synesthesia would just inspire a strong sense that G is green, it’s just green, you know, it feels green, the way harmonica sounds purple, ...why are you looking at me like I’m crazy?

We’re going to concern ourselves with projective endosynesthesia.

A man sees something green, which makes him see purple. Normally, purple things make him see blue...

So, does your synesthesia resolve into a stable loop, or are you just feeling everything all the time?

Here are a few possible outcomes:

Seizure green --> red --> blue --> purple --> yellow --> orange --> black --> turquoise --> crimson --> aquamarine --> olive --> mauve --> grey --> brown --> sunglow --> heliotrope --> indigo --> ... ∞ You might as well be blind. Depending on whether this all happens simultaneously or you cycle through color to color, you're either trapped in a neverending rainbow tube or seeing all the colors all the time, and presumably frothing at the mouth.

Stable loop red --> blue --> purple --> red + repeat This isn't so bad. If you know your loops well enough, this might be like mild color-blindness, where all components of that loop would give an indistinguishable redbluepurple kind of impression.

Decreasing intensities BLUE!!! --> PURPLE --> green --> ... The intensity of each color decreases at a set rate, eventually fading away so much that it fails to trigger the next one. Thus the intensity of the concurrent color is always lower than that of the inducing one.

RAM limit Your brain is an ally and wants to prevent you from shorting out. Through some unknown mechanism, is limits you to something like, eh, four colors. The limitation may be based on intensity and not iteration, in which case this is very similar to #3.

All roads lead to X yellow --> purple --> orange --> red --> red --> red blue --> green --> red --> red --> red literally anything --> red. I expect this would be problematic, and interfere with traffic light interpretation.

oh no. Seizure 2.0 @fretzl: neither, all of my feelings evoke feelings of "immense horror" except immense horror, which evokes "even immenser horror," etc.

Some combination of the previous.

I find 3 and 4 the most plausible. Since endosynesthesia isn’t and will never be a thing, this opinion is completely vapid and worthless.

[ctrlcreep-blog]

"Don't feel bad, your style of thought is well-suited to X." (where X is typically incorrect, you hate X, & Y is much more important)

There are things in the world that are important and good. There are also a lot of other things.

Separate from that which is good, important, is a corpus of activities that tend to produce and/or maintain the G/I.

Separate from this corpus is, presumably, some kind of infrastructure necessary for humans to coordinate these activities, many tiny acts that indirectly sustain those who directly sustain the G/I. This level is opaque, difficult to perceive, difficult to quantify...

Often, it feels as though you’re completely cut off from that system.

Most people agree that some art is good. A few can even explain why.

@ctrlcreep​ so humans do you feel like this because I often feel like this about art & scattered dreamscape thought vs., like, math & depth?

I’m not bad at math. I don’t know whether I’d be bad at depth, if it was what I applied myself to. I value these things very highly, I don’t apparently lack any necessary inherent talent, I punish myself for not pursuing them with guilt and self-doubt, and proceed to thoroughly ignore them in favor of art, daydreaming, writing.

A few potential explanations:

I am kidding myself about being capable of math/depth/etc.

This preference for math and depth is externally imposed and is creating predictable psychological stresses.

...somebody once told me, "You have a telos,"

We’re back where we started. When I am feeling sad about my apparent separation from the G/I, I find myself saying things like “I hate art,”, “Art is a useless waste of time,” and most famously, “Drawing is exactly the same as microwaving kittens.” That last statement is probably false; but still, drawing isn’t building bridges.

Wise people know that you can’t ignore motivation. You’re not going to dedicate 10,000 hours to something you hate, but you’re also unlikely to spend that much time doing anything you aren’t intensely, inexplicably obsessed with. Want to become a genius? Follow your star.

But sometimes that star is bullshit and wrong. What do you do when the things you love to do fail to align with the things you know are important and correct?

(The correct answer is: spend 10,000 hours developing an incredibly honed metaskill of preference-changing.)

@ctrlcreep if you feel like this, what do you feel like this about (the dialogue may be internal) (I am collecting data / sorrows)

I regret that some of my commentary may have skewed responses towards expressing an art/science type split. My personal struggle is less right brain/left brain bunk, and more [urge to create beauty + questioning utility of beauty], or [urge to explore the limits of what’s possible vs. urge to expand the limits of what’s possible]. 

Who determines what art is made? My overwhelming intuition is “the people who make the paints and the brushes”.

@incantamina:

i am well suited to math and logic but would really like to be creative, good with writing, words, etc

@SweetNAwful:

I feel I'm mentally suited more towards business / marketing but I'd rather be good at creative endeavours.

@ProofOfLogic:

I'm really envious of your thought style but have developed mine for "math & depth"

The grass is always greener, huh.

Well, this makes sense: because I tweet a lot of creative fluff, I’m followed by people who enjoy and value creative fluff. In turn, I follow perhaps more math and logic people than you’d expect.

Side note: There are a lot of mindspaces. I have never in my life imagined what it would be like to be seeped in “business/marketing” -- pretty cool.

So anyways, these people are all wrong. I have thought a lot, have looked upon my works and spat, thinking, “This should be a spaceship or something.” Despite my best efforts, it never is.

Bill has never won a game of minesweeper. Every time he comes close, as near as one final square to be clicked, he’s focusing, “Don’t mess this up, Bill. This is your chance. You’re nearly there.” His hand spasms, it all blows up.

Why are you locking yourself out of everything that is G/I? Have you tried not doing that?

Look, I’m just trying to convey the pain of having highly dissonant preference/values systems.

@ProofOfLogic:

& maybe I could develop both, but still it's more valuable for me to get further math & depth as I'm still largely inadequate

Specialization is a necessity. 10,000 hours is arbitrary, but it does a good job of representing the correct thing, a massive investment of time and effort. Everything that isn’t the one thing you want to be good at is opportunity cost. You’re fucked. Choose, or be mediocre.

You don’t get to choose, though. These kinds of calculations become apparent long after your formative years, long after the calcification of habits and preference.

The things you are good at are easy and vacuous. The things others are good at are hard and full of value.

Maybe art is valuable, if only as pellets of motivation and fuel for those pursuing higher things. Mosquitoes are an irreplaceable part of the ecosystem. It’s the circle of life, man. All the creatures are vital. More saliently: We don’t all get to be the apex predator.

You want to interact directly with G/I? No. Sorry. Try rationalizing that you’re part of its support system.

There are things in the world that are important and good. It’s probably impossible to know whether you’re in contact with them.

TL;DR: inferiority complex and everything is terrible. all hail STEM