athodyd

[athodyd]

Favorite scenes from "Dirtbike Summer" (1986)

Everyone remembers where they were when they first saw campy cult classic Dirtbike Summer-- I myself had just been told my grandfather had passed away, so this fresh, fun film about the importance of believing in yourself and your dirtbike really resonated with me. I was particularly taken with the character of Max "Rad" Wheels, the enigmatic "guru" who takes a young Todd "Gnarly" Connor (unforgettable catchphrase: "Dude, that's gnarly!") under his wing. In later years I was in frequent contact with Gerhard Schwacht, the East German character actor whose appearance in Dirtbike Summer marks his only appearance in big-budget non-pornographic Western film.

When Schwacht died last summer, it was like losing my grandfather all over again, although my grandfather died of mesothelioma and not from what I am told IV drug users refer to as a "hot shot" allegedly prepared by Rocco Siffredi. Until the dispute with Siffredi and Vivid Video is resolved, here is how America and I best remember Schwacht as a performer, a character, and a dirtbikist.

[Todd and Max are straddling their dirtbikes after Todd's initial disappointing performance at the bikedrome.]

MAX: You have the talent to be a champion dirtbikist, Todd. The problem is that you lack the commitment.

TODD: Commitment? I've been training two hours every day, man!

MAX: Two hours is nothing, Max. I am hard pressed to find two hours--even two non-contiguous hours, even one-hundred-and-twenty minutes--of any day where I am not training.

TODD: Dude, that's gnarly! What am I supposed to do, eat with my dirtbike?

MAX: You must eat with your dirtbike. You must sleep with your dirtbike. You must live and breathe and think as if you and the dirtbike are one and the same.

TODD: You sleep with your dirtbike?

MAX: I have not slept in several years.

[After learning that love interest Holly has a hidden fascination with the art and science of dirtbikology, Todd shares his renewed enthusiasm and determination to become "king of the dirtbikes" in the annual Viscounts of Dirtbiking tour. Max disapproves.]

MAX: Who is this girl, this Holly? Why is it important now that you dirtbike to a higher standard, when before you boke dirt out of the pure love of dirtbiking?

TODD: Boke dirt?

MAX: I have spoke to you before of the importance of conjugation.

TODD: Dude, I... like, Holly is this totally special girl, but her dad's the richest mayor in the country and it seems like every time I see her that Chip dude is all over her. When I was dirtbiking at the library and saw her checking out all those microfiche back issues of The Dirtbike Literary Quarterly I figured, you know, maybe I have a shot. Maybe all of us poor kids from the big city projects who still listen to old-fashioned rock 'n' roll in our blue jeans have a shot.

MAX: You wish her to be part of your audience. You wish her to be part of the gross agglomeration of spitting, screaming cattle.

TODD: I guess, yeah.

MAX: I have boke dirt before millions of people and have not had cause to remember a single face. I have boke dirt for the King of Siam and his court and I have boke dirt for the generals who would come to replace them. At no point were they more than a nagging distraction.

TODD: I think you mean Thailand, dude.

MAX: I did not err when I spoke of Siam and its king. I boke dirt for King Mongkut and the English woman Anna Leonowens. She chose to omit the event from her memoirs, a slight that would lead me to refuse to dirtbike at her funeral.

TODD: ...Dude, how old are you?

MAX: I will entertain no further questions until you can do the trick where you can dirtbike backwards.

[The town of Dirtbike Falls is embroiled in scandal after Chip videotapes Max and Holly having sex in the abandoned crab boat Max uses as a dirtbike shrine. Todd bursts angrily into the hold, littered with the odd crab sculptures Max has fashioned out of dirtbikes that he feels have "died the heroic death of the crab." Max is, as always, straddling his dirtbike.]

TODD: DUDE!

MAX: I understand that you may consider my behavior objectionable and I caution you that I do not care.

TODD: I can't fuckin' believe this man! I told you that I had a crush on her and you gave me all this shit about the King of Siam and then you show up at Holly's house with that stupid dirtbike medal that you wouldn't even let me see--

MAX: The Pour le Dirtbike Merite is not a bauble to delight the blinkered eyes of a fool. Holly demonstrated a knowledge of dirtbikosophy that proved she would appreciate the medal in a way you would not.

TODD: She doesn't even ride a dirtbike!

MAX: She appreciates the idea of a dirtbike. She has an intuitive grasp of the principles and theory of dirtbiking rivaled only by her natural skill at lovemaking.

TODD: She's fuckin' seventeen man! And you're, like--

MAX: Ageless.

TODD: Her dad is the mayor and Chip's dad is the sheriff! I could be in trouble just talking to you!

MAX: In a society where love is a crime, dirtbiking is meaningless. With all the dirt I have boke I have proven that dirtbiking is the only meaning. It follows that society and its "crimes" are mere fiction.

TODD: Dude, that's gnarly.

MAX: I will require your aid in purchasing a firearm.

[It's the last stages of the Viscounts of Dirtbiking tour and Todd and Chip are tied for first place, in spite of Chip's attempts to sabotage Todd with illegal trick dirtbike tires and a bouquet of white roses laced with curare. With the neuromuscular toxin slowly paralyzing the muscles in Todd's legs, it looks nearly impossible for him to perform the tiebreaking stunt where you do a loop on your dirtbike. Suddenly, Max appears, bloodied but unbowed, straddling his dirtbike at the crest of the dirthill created for the dirtbike events.]

MAX: Your local constabulary has been tested and found wanting. Toddothy, I wish to apologize for not having believed in you. I make no apologies at all concerning Holly and indeed plan to repeat our act of congress immediately after I perform the stunt where you do a loop on your dirtbike in your stead. 

[Max throws his empty Steyr-Hahn pistol to the ground and sets off down the hill. Almost immediately he falls from his dirtbike, tumbling bonelessly to the bottom of the slope.]

MAX: I must regretfully admit that my prior dirtbike experience was fraudulent.

[athodyd]

Behind The Creative Process: The Pocket Hose

"So Mr. Nicholson, I understand you had something to show me today?"

"Yeah girl... word around the R&D department is that you're wantin' to check out my Pocket Hose."

"Indeed. Do you have your design documents with you? Maybe some pictures?"

"Well, I thought it would be easier for you to just check it out in the flesh."

"You've got it into the prototype stage already? Interesting."

"Uh... prototype?"

"Yes. I was thinking that with the right marketing and a carefully determined price point, we might have a good prospect for the 'as seen on TV' market."

"I don't... I'm not following you. This is still about my Pocket Hose, right?"

"Yes. I assumed that this was a gardening product and not some sort of sexual double entendre, as interpreting this name in a sexual way would mean that your fully erect penis would still comfortably fit in a standard pocket."

"Uh..."

"I would assume such a penis to be three to four inches long while erect, and of proportionate girth. Maybe five inches at the longest, assuming the testicles to be extremely small or perhaps highly compressible."

"What if I told you it grew to fifty feet?"

"Assuming we continue interpreting this 'pocket hose' in a sexual manner, that length would be unnecessary and uncomfortable."

"Oh. Well..."

"As a metaphor for the genitals this 'pocket hose' would betray a childish misunderstanding of a woman's sexual needs, and perhaps even a lack of familiarity with sexual intercourse in general."

"...that's fine, because I was definitely talking about a portable garden hose that you can fit in your pocket, so if you... uh... if you walk past a lawn that needs watering and there's a faucet there, you can... you can do somebody a favor and water their lawn with that faucet. And the hose. And... and then just roll it up and put it in your pocket and... go away. Otherwise you just have to walk past all these dry lawns and... uh... unwashed cars."

"That's how I understood it."

"Because that's a real problem, that I have often had, and so I've been talking about a pocket hose to my friends at the office, because they have also been walking around and seeing all these lawns and cars and stuff."

"Reportedly you have often mentioned that I, personally, would be interested and even delighted by your Pocket Hose."

"...Yes, because you seem like someone who really cares about lawns. And lawn care. You seem like that sort of person, who would be interested in the sort of product I am describing and also designing for sale."

"That's just as well. If this was some sort of extremely clumsy sexual metaphor I would have to dismiss you and possibly seek legal action."

"I think we have definitely agreed that is not what is going on, and in fact I am fully capable of designing a fifty-foot hose that will fit in a standard pocket."

"I'm very glad to hear that. Did you have anything else for me today, Mr. Nicholson?"

"Not unless you wanted to see my penis."

"I saw all I needed to see at the office Christmas party. If you ever sneak a handle of Olde Kentucky Fluid into a company event again you're fired."

"Oh."

"You're also going to be fired if you don't have your pocket hose ready for full-scale production by close of business Friday."

"Um... that's what she said."

"Jesus, Nicholson, that doesn't even work. Close of business Thursday."

[athodyd]

History's First Photograph of a Chess Game, Henry Talbot Fox and Nicolaas Henneman, 1841

"How does it feel to make history, Mr. Henneman?" 

"Capital, Mr. Fox, capital."

"Indeed, this was a well-considered subject for what I might call a young or perhaps even an infant art-form; so dependent on stationary poses that allow our plates to absorb enough light and shadow to represent in some small way the images cast upon our optical nerves by the natural lenses of our own eyes."

"I thank you for your kind words--often have I thought that the silent moments of each chess game deserve recording, as to capture the quiet machinations of each player considering the state of play."

"And here we are, two combatants frozen in a perfect instant, locked in a sort of battle that might best be represented by the individual actions of each player during each round, rather than a portrait of the contestants from one particular phase of combat."

"Quite."

"A layman--a base, uncomplicated man unfamiliar with this game's context--might see this daguerrotype and assume an understanding of this game far removed from its reality."\

"Oh indeed?"

"Yes, I feel it is quite possible--regrettably possible--that those who view this picture might assume that I am confounded by your strategies and must require a quiet moment to mount a defense, if only because your relaxed and flippant posture could only be explained by a degree of levity unbecoming of a man seeking to challenge an accomplished chess mastermind."

"My word and honor! I had never thought to convey such an idea in this photo-graph project, regardless of how many times I may or may not have bested you in the game of chess."

"You have never bested me in the game of chess."

"An interesting statement, given that it lacks any photographic proof."

"..."

"..."

"...You know that I have never lost a game of chess to you."

"I know nothing beyond what respectable sources have--"

"You fucker! I knew you were working some sort of angle on this!"

"Oh what the fuck ever, Mr. Fox, through all the years we've worked together you see fit to accuse me of staging a chess game that might portray me in a favorable light--"

"I look like an asshole! You're all leaning on your hand like I'm fucked and I don't even know it, and I'm tilted over to get the maximum shine off my bald spot--"

"Point of order: you don't have a bald spot, you have a few hair spots surrounded by these shining plains of mirror-polished flesh that--"

"Oh, oh, oh, Professor Curly H. Dutchman with his fancy fuckin' hair, sidling up next to me to ensure that history's earliest and most significant daguerrotypes always somehow manage to show off how I went bald with dignity and never capture his big fat buttery ass!"

"You want a big fat ass? Maybe if you were really a pioneer of photo-graphic science you might understand why your good lady wife likes to take off her petticoat in front of a big bay window, and maybe if you were a pioneer of a good hard fuckin' you might understand why I have a closet full of petticoats rank with the fetid aura of congress!"

"That's it, Nicky, that's fucking it. Ye have sown the wind and ye shall reap the god-damned mother-fucking whirlwind, and in the name of English science I am going to tie your poxy Hollander dick to one of your precious windmills and every time the machine completes a revolution I will smash your balls with a hammer, so help me God."

"Fine by me, Hank Fox. Fine by me... although... we must still wait an hour for this daguerrotype to develop before we can take any action."

"Of course."

"Quite."

"No reason to disrupt the picture, nor to act in an ungentlemanly manner until then."

"I entirely agree."

"...Wine?"

"...That's what she did."

"As Christ is my witness I shall feed you your own johnson in fifty-nine minutes time."

[athodyd]

Savage Sword Of Social Justice

 “Hail, traveler, what brings you to my humble smithy?

  “Good morrow to thee, smith, I have come seeking a mystic weapon, that I might slay the darkness that menace the realm.”

  “Ah, you must be the one foretold in the prophecy. For your task, no common saber shall suffice. Only a blade blessed by the spirits above and forged in holy fires may rid our land of the forces of evil.”

  “And have you such a holy blade?”

  “Yes, good sir. I present to you… the Scourge of the Sodomite.”

  “Scourge of the what?”

  “Inlaid with mithril and hammered blue-hot in an orichalc fire, the Scourge wreaks such damage on those who lieth with one’s own that the mere sight of its glowing runes reduces paederasts to ashen—”

  “Wait a damn minute here! I thought I was buying something that kills vampires!”

  “Oh. Well… it’s certainly effective against those too.”

  “Then what’s all this crap about ‘sodomites?’ What kind of realm-menacing darkness did you think I was talking about?”

  “I… it’s… well, it’s just that this was the holiest blade I had, and… I mean, just look at the news lately.”

  “The fuck is that supposed to mean? My brother’s gay, you’re trying to get me to accidentally turn him into ash?”

  “Er, I’m actually not certain about that part. Much of the text referring to the Scourge of the Sodomite is somewhat metaphorical in nature, although I do know for a fact that the deadly kiss of its enchanted steel burns vampiric flesh hotter than a thousand suns.”

  “Doesn’t matter. I’m not buying anything named ‘Scourge of the Sodomite.’”

  “Well, the name isn’t that important. It’s simply a product of its time.”

  “What time was that? Uganda during an election year?”

  “Nay, for this mighty sword was crafted in a time before time, in the forges of Crea—”

  “Save it. I don’t want a homophobic sword. I don’t even know why I wanted a sword at all, I already carry a gun.”

  “And does this ‘gun’ of yours hum and tremble with the fantastic powers of the divine?”

  “Well, I’d have to check the SIG Sauer website, but offhand I’d say no.”

  “Then let me offer you a selection of holy bullets, tipped with wolfsbane, silver, garlic, and the prayers of the meek.”

  “You got that in .357 SIG?”

  “Of course, of course, and let me assure you that these munitions are guaranteed ten times more effective than conventional rounds against werewolves, night-gaunts, succubi, and…”

  “And?”

  “...Just those things. How many boxes did you need?”

  “No, tell me what the fourth thing is.”

  “If I tell you what the fourth thing is you won’t want to buy the bullets.”

  “We don't know that until you tell me what the fourth thing is.”

  “The fourth thing is lesbians.”

  “I don’t want to buy the bullets.”

  “Oh come on!”

  “No, fuck you! I’m going down to Cabela’s!”

  “Screw Cabela’s, I got the Vatican factory discount! I’m selling a hundred rounds for twenty bucks here! The only guy that sells it cheaper is Scott Lively and he makes you sign up for his stupid mailing list!”

  “I’m not giving any money to homophobic arms manufacturers!”

  “I’ll have you know that 70% of all Vatican weapons profits go to inner-city after-school warrior-nun training programs! It’s just like midnight basketball!”

  “Warrior nun training programs are nothing like midnight basketball! Warrior nuns don’t even play basketball!”

  “Are you kidding me? Warrior nuns live for basketball! It’s like the Mormons! What do you think the WNBA stands for?”

  “I don’t give a shit about the WNBA! Nobody does!”

 “Oh, and you’re calling me a bigot?”

 “That’s it, I’m done! Next stop is Cabela’s!”

 “If you’re going to the one by the Best Buy they’re gonna screw you over! They got rid of all their enchanted stuff because the new manager’s a werewolf!”

 “I KNOW! HE’S MY BROTHER!”

[athodyd]

RJD2's real name is Ramble John Krohn.

"You named him Ramble?"

"Yeah, after your dad, like we agreed."

"My father's name was John!"

"Well, okay, but you said yourself he was always a rambler."

"What? When did I say that?"

"He was a traveling salesman, wasn't he?"

"Yeah, for like two years. Then he bought a car dealership in Medford and lived there the rest of his life."

"Was it an AMC dealership?"

"What does that have to do with anything?"

"Well, I thought, maybe he sold a lot of Ramblers or something."

"..."

"I'm just trying to think of where I got 'Ramble' from. Did he gamble?"

"Just change the name."

"I, uh, already signed the form. Maybe his middle name could be John?"

"..."

"Well hell, if you want to go down to the county clerk's office and spend $60 to get it fixed, be my guest."

(Actually, given he was born in Eugene, OR, he's probably lucky his parents didn't name him Bongwater McHikingtrip. I knew a girl from Klamath Falls named Olympia--not after the mountain, after the beer.)

[athodyd]

Gene Thieves of the 21st Century

SUSPICIOUS RADIO TRAFFIC

INTERCEPTED 0322 GMT 04/22/12

USN SOUTH CHINA SEA LISTENING POST

ENCRYPTED VOICE COMMUNICATION

TRANSCRIPT FOLLOWS

TRANSMITTER (hereinafter MARIGOLD or M, believed to be a freelance corporate spy operating in the Taiwanese research industry): Byzantine, this is Marigold. Come in Byzantine.

M: Byzantine, repeat, this is Marigold. Requesting pickup.

RECEIVER (hereinafter BYZANTINE or B, evidently MARIGOLD’S client): Byzantine receiving.

M: Oh thank God, I’ve been on this raft for the last—

B: Marigold, please refrain from broadcasting any extraneous information that could reveal your position.

M: Oh yeah. Sorry Ste—uh, Byzantine.

B: Marigold, until further notice restrict all communications to mission-critical information.

M: Sure.

(PAUSE IN COMMUNICATIONS OF ROUGHLY TEN SECONDS DURATION)

B: Marigold?

M: Yeah?

B: Requesting you provide mission-critical information at this time.

M: Oh yeah. I got the, the thing.

B: Requesting clarification—did you obtain target data?

M: Yeah, the thing. Except… uh, the little USB doodle was, uh, destroyed.

B: But you still have the target data?

M: The genome thing? Yeah! I mean, I wouldn't be calling if you--

B: In what media is the target data saved in? What format? Are you able to transmit remotely or is it necessary to obtain the data in person?

M: Oh man, definitely transmit remotely. I don't know how long I can remember all this stuff.

B: What?

M: I memorized it.

ADDITIONAL VOICE IN BACKGROUND OF RECEIVING STATION (hereinafter X): [inaudible] the fuck did he just say [inaudible] memorized the [inaudible] genome?

B: Say again, Marigold?

M: When it was downloading into the thingie, I decided to memorize it just to be on the safe side. It was easier than I thought it would be but gee whiz, it's really tough to keep it on the tip of my tongue...

X: [inaudible] 800 megabytes of information and [inaudible] some kind of Rain Man shit? Where did you find [inaudible]?

M: So if you guys could just record me while I do this that would be really great.

B: Ah... stand by Marigold. (quieter, presumably a whispered aside to X) All right, first of all I didn't hire this guy--

X: Then who the fuck did? [inaudible] in the morning with my throat cut because [inaudible] fucking sourced our secret agent from Temps R Us!

B (still quiet): Check with HR, I don't goddamn know! Secondly and more importantly, is this going to be a secure channel for this informaton?

M: Guys, are you ready to record this? Because I'm really worried that I'm getting fuzzy on some of the details.

X: [inaudible] worked so far and it sounds like [inaudible] much of a choice.

B (louder): Marigold, you are clear to transmit data.

M: Great! (clears throat) Okay, tell me when you're recording.

B: Recording now.

M (musical, singing voice in tenor range): Gatctgaccaaaggtcacgacatcaggccacttatgat--

B: Wait, what?

M (continuing): --ctaggcactcagtagcatatgcactact--

X: FUCK! (unidentified noise, tentatively identified as a chair being kicked into a wall)

B: Marigold, please--

M: --don'tinterrupti'lllosemyplace--gatcagccatatgacag--

B: Hold it, just--cease transmission!

M (speaking voice): Seriously guys, I'm going to have to start over now!

B: Marigold, are you able to transmit data in any other format?

M: Um, no. Negative.

X (clearly audible, suggesting he has seized the microphone): I want this to be perfectly clear: the only way you can transmit the data and fulfill your objective is to recite nearly a gigabyte of DNA sequence information over a semi-secure encrypted radio link?

B (quieter): Semi-secure? You just said--

M: Well, not so much recite as sing.

X (quiet, to B): I said that before I knew--(louder, to M) Hang on, what?

M: I memorized it as a song. It's easier that way. Heck, I don't think it's even possible to remember all those letters in sequence any way else.

B: So... you're going to sing the gene sequence to us.

M: Yeah!

B: Over a period of...

M: When I practiced in the hotel it took about ten or eleven hours.

X (quiet): Oh God.

M: On three. One, two--

X: And you say the original data package has been destroyed?

M: Well, probably destroyed. I had it in my shower bag and after I changed planes in Manila--

X: For the last goddamn time, no proper names!

B: Hold on, let him finish. After you changed planes--

M: In Manila.

X (background): FUCK!

B: After that, what happened to the data?

M: Well, it was in my shower bag, and the airline lost it.

(PAUSE IN COMMUNICATIONS OF ROUGHLY FIVE SECONDS DURATION)

M: So you can see it's a good idea that--

B: You LOST it? You lost it in one of Asia's largest airports?

M: Well I lost my baggage tag for it and I wasn't sure--

X: Why the FUCK didn't you take it as a carryon?!

M: I had to use that for my backpack with all my socks and underwear. It's an old traveler's trick, you see--

[More indistinct crashing noises are heard from the receiver.]

X (background): [unintelligible] DEAD IN A FUCKING SEWER [unintelligible] TRIADS [unintelligible] INSIDE OF A FUCKING WEEK [unintelligible] OUR BALLS--

M: But like I said, it's okay since I memorized it. On three: one, two, three--

B: No, no wait--

M (singing again): Gatctgaccaaaggtcacgacatcaggccacttatgat--

B: Slow down dammit--

M (continuing): --tcaggcactcagtagcatatgcactact--can'tslowdownbeevenlonger--

X (background): Maybe we can salvage this. What the hell song is that?

B: I think--I dunno--

M (continuing): --forgotthenameitsagoodsongthough--tactgatcgcacagtatgac--

B: It needs to be SLOWER! Nobody can understand what the hell you're saying!

M (speaking voice): If I go slow it won't be the same song! Jeez! (continues) Gacacatagac--

B: It does sound sort of familiar.

[Subsequent analysis by US Navy cryptanalysts suggests (97.5% certainty) that the tune in question is "Institutionalized" from 90s hardcore punk group Suicidal Tendencies. An insignificant minority believed it was "something from Henry Rollins' solo career" but were overruled.]

M (singing): GAC ATG CTAGAC! Gatacagatacatca! TACG ACA AGAT! Tagacatgacatata!

B: We're fucked.

X: I'll set fire to the boat, you erase the drives. If we're both still alive in twenty-four hours we'll need to be on opposite ends of the planet.

M (singing): Ctagactagacactacgtatac gatacacatgacatacat tacagtacaggagcatacgat gcatacgactag MYSELF. Phew. Okay, I'm starting over. Did you get all that guys?

M: Guys?

M: Byzantine?

(PAUSE IN COMMUNICATIONS OF ROUGHLY FIVE SECONDS DURATION)

M: I don't mean to be a pill about this but I don't have any more food or water left.

[athodyd]

But my toes already look like beans!

[athodyd]

Disasters in Space: A Secret History

NOVEMBER 1957 - After hijacking an experimental Russian rocket, renegade crime-fighting animal hero Laika dies in an abortive attempt to defect to the society of superintelligent dogs living on the moon. Soviet propagandists work quickly to spin the incident as the beginning of their space program and immediately cancel Laika's forthcoming buddy cop movie with Vassili Zaitsev.

MAY 1960 - A single improperly-fitted gasket in an American Redstone-2 rocket leaves the experimental life support capsule completely unable to overheat, strangulate, electrocute, or catheterize Doug, a chimpanzee selected to test NASA's ability to torture monkeys in space. Heart rate telemetry indicated that Doug enjoyed a relatively relaxing 70 hours in orbit before coming gently to rest in the Sea of Japan, where scientists desperate to reclaim some value from the experiment beat him to death with a tire iron.

JANUARY 1961 - The nascent British space program is reluctantly shut down after scientists conclude that there was "essentially no chance" of finding aboriginal civilizations to rape, enslave, and teach cricket to within the Solar System. France immediately increases funding for the planned Kouro Space Center as part of the "Rub It In" diplomatic initiative.

FEBRUARY 1962 - John Glenn shrieks and gibbers in a high, girlish falsetto during his entire time in orbit aboard Friendship Seven. Following his recovery by the destroyer USS Noa, Glenn claims not to remember making any unusual noises during his flight, and when provided with audio recordings of the mission grows angry and insists that NASA personnel are "fucking with [him]."

JUNE 1963 - Valentina Tereshkova informs a crestfallen Yuri Gagarin that he's "such a great friend" and "like a brother to me." Over the course of the next several years, a desperate and smitten Gagarin independently explores the Friend Zone.

MARCH 1964 - Recently declassified Russian documents admit to losing "a whole goddamn bunch" of cosmonauts to space and ground accidents, including one incident where a busload of experienced Soviet pilots on their way to Star City was attacked and devoured by wild bears. Subsequent space missions are heavily bear-proofed with multiply redundant anti-bear systems. A later advance in pilot safety was the introduction of seatbelts.

SEPTEMBER 1965 - Eager to get rid of their monkey surplus before the end of the fiscal year, NASA hastily packs fifty chimpanzees into a Saturn IV and attempts to launch them into high orbit. Unfortunately, the collective intelligence of the chimps allow them gain control of the rocket and hover it over the Cape Canaveral parking lot, incinerating many employee cars, before "buzzing" the homes of several prominent scientists and then escaping to a small island in the Caribbean where they are rumored to live like gods.

MARCH 1966 - Following the recovery of Gemini VIII after its abortive docking attempt, civilian astronaut David R. Scott is rushed to the hospital with severe abdominal pain. Seven newly-adopted experimental "Space Pens" are removed from his rectum. Scott strenuously denies inserting the pens himself and claims to this day that Armstrong "did things to me" during his sleep. Armstrong publicly confessed to flicking Scott's nipples with his tongue several times during the flight but stated that it was purely a friendly and non-sexual gesture.

JANUARY 1967 - Panicked NASA engineers accidentally immolate the crew of Apollo 1 on the launchpad after monitoring a lengthy and apparently sincere discussion between astronauts Gus Grissom, Ed White, and Roger Chaffee about how much they enjoyed the smell of each others' balls. The Apollo 204 Accident Review Board eventually reaches two conclusions: one, that the fire was started when groundcrew hastily attempted to reduce oxygen content in the capsule to the point where the astronauts would lapse into unconsciousness; two, that everyone enjoys the smell of balls but that society was not ready for this topic to be openly discussed.

AUGUST 1969 - NASA embarks on a spiteful and misguided ten-year campaign to sneak diseased rats into Gil-Scott Heron's home.

OCTOBER 1970 - Cosmonaut Andrei Mikoyan suffers severe barotrauma and vacuum burns after attempting to "air hanky" on the United States from orbit.

JUNE 1973 - The first manned Skylab mission (Skylab-2) almost ends in tragedy when a small object believed to be a clump of fecal matter is found floating free in the Command/Service Module. Although the object causes no damage to the space stations' sensitive systems, the argument over which of the three astronauts should clean it up became extremely heated, as no one was willing to admit defecating outside of the vacuum toilet system. Subsequent testing of the object revealed it to be a Mars bar.

AUGUST 1973 - Skylab-3's mission is drastically cut short after commander Alan L. Bean encounters an object similar to the candy bar that plagued Skylab-2. Bean promptly took a bite out of the object, assuming it to be a Mars bar, then immediately went into convulsions as he realized it was not in fact a Mars bar. Subsequent testing of the remains of the object revealed it to be a Snickers bar, which triggered Bean's severe peanut allergy and sent him into anaphylactic shock. It remains unknown as to who brought the Snickers bar on board, as both Bean and pilot Jack Lousma had peanut allergies that they were well aware of and science pilot Owen Garriot claimed not to enjoy candy.

NOVEMBER 1973 - Upon docking with the space station, the crew of Skylab-4 open the hatch to reveal "dozens" of free-floating brown objects drifting around the cabin. The hatch is immediately shut and locked as Skylab-4's crew adamantly refuse to enter the station. After several days of arguing with the crew, NASA relents and allows the three astronauts to return to Earth. Although plans were made to fix Skylab's decaying orbit with the Space Shuttle, costs were prohibitive and enthusiasm for the project was limited, so Skylab was allowed to re-enter the atmosphere. Debris from Skylab struck the desert of Western Australia, where inspection teams reported an extremely strong smell of nougat.

JULY 1975 - The Apollo-Soyuz Test Project succeeds in docking the two workhorse modules of the American and Russian space programs but is considered an overall failure after the two sets of astronauts realize they have absolutely nothing to say to each other. While the mission is spun to the press as the end of the two countries' space-based rivalry, enmity persists between the two space programs as to who was supposed to bring the chips.

JANUARY 1986 - A congressional review of the Challenger disaster concludes that the event was to be the culmination of an otherwise harmless series of pranks intended to "haze" Christa McAuliffe. Technical advisor Richard Feynman formally advises NASA to "just jerk off on a cracker or hold a cherry in your ass or something, Jesus Christ."

MAY 1997 - Russian crewmen aboard the Mir are horrified to discover a bee that presumably accompanied British-American astronaut Colin Michael Foale on his shuttle mission to the space station. Over the next week, bee sightings prompt the hasty evacuation of the Kvant-1 astrophysics module, Kvant-2 augmentation module, and Mir core module, confining the terrified astronauts to the Spektr power module except for occasional attempts to retake the station from the bee using shoes and rolled-up newspapers. The situation goes from bad to worse when Foale suggests "just open[ing] the window and let[ting] it find its way out."

JUNE 2004 - The triumphant and unexpected return of famously "lost" cosmonaut Vladimir Ilyushin after surviving nearly 40 years in space is horrifically cut short as his re-entering space capsule encounters Scaled Composite's SpaceShipOne going the other way.

[athodyd]

Jonathon asked: Clearly racist….

Yo, I know that in their imaginations, White Supremacists think that if they’d only get their way, everyone would look like Dolph Lundgren or whatever, but they always forget that the actual face of racist assholes is kind of more like this half-toad half-Ned-Flanders fuckface who’s somehow both a dad and a virgin at the same time.

[athodyd]

Ancient Twitpic Treasures Part III: Lunyon, Jistis, é Konfyans

Louisiana! Officially the "Pelican State," popularly the "Bayou State," and most honestly the "Tragedy State," it is a rich and vital culture of desperately poor people of every race and creed and the oil company executives who occasionally deign to offer them employment. Instead of counties, Louisiana has parishes, and instead of a functional state government Louisiana has a messy hatefuck with openly/gleefully corrupt Democrats like Mary Landrieu and Ray Nagin battling literally insane and incompetent Republicans like Piyush "Bobby" Jindal and noted Klansman David Duke. Schools are run by the Pope and everything else is run by voudoun loas and British Petroleum and while everyone you meet is undeniably friendly and helpful there is maybe one chance in five that you will be able to understand what they're saying (today's title is the rough rendition of LA's motto of "Union, Justice, and Confidence" in Creole). If you drive through any part of Louisiana for more than two hours or a hundred miles, you are certain to drive past people living in conditions most Americans would associate with Third World countries, often while you're trying to overtake someone in a Lincoln Mark LT (an obscure luxury version of the Ford F150 that is vanishingly rare anywhere outside of Louisiana, where basically every fifth car is a Mark LT) or a Chrysler 300C with 30-inch alloys and metal-flake paint. An extended stay in Louisiana is basically a guided tour of the negative effects of late-stage capitalism and Christian syncretism; it is a visit to a universe of pain and struggling enlivened by incredibly delicious stews and sandwiches and the occasional classic Motown radio station.

I had only been in Louisiana for a week or so before the above magazine was slipped under the door of my super-charming mega-pleasant downtown NOLA Holiday Inn. "Happiness?!" I exclaimed as soon as the title and content of the offending magazine seeped through my hangover. "What is this horseshit?" I elaborated as I fell over an ottoman. Crawling to a window, I examined Loyola Boulevard for signs of journalistically noteworthy happiness. New Orleans' streetcars were trundling quaintly about in a way that inspired happiness in myself and whoever else shares my interest in historic mass transit, but it was difficult to reconcile that happiness with all the homeless people either sleeping or dead that were scattered about the sidewalk. While most of the Lousianans I had met had exhibited a casual friendliness and cheer that could be construed as happiness,  the few natives I had encountered who could be identified as outwardly happy seemed close to the sort of manic positivity exhibited by people who are either paid very well to be happy or who are close to a massive and crippling emotional breakdown. Over time, the only common personality trait I could identify among Louisiana natives was a sort of resigned fatalism combined with a drive to seek out and celebrate whatever tiny nuggets of joy they could unearth with a zest and gusto that could keep the wolves from the door as long as possible. I can see how this was not a suitable topic for a hotel-based tourism magazine, so I guess I can give Happiness a pass.

Unlike the publishers of Happiness, I was free to take any picture I wanted of still-devastated New Orleans and I can't help but think this gave me a different perspective on a city that was once purely associated with orgiastic hedonistic collegiate good-times and is now a symbol of how modern American federal government can't be bothered to assist the citizens/businesses/elected officials of one of the country's most important port cities unless they vote the right way and pay off the right lobbies. As I mentioned before, I was working in Louisiana in general and New Orleans in particular at least three years after Katrina and everything was still wrecked and fucked up and horrible. The below picture is an abandoned parochial school, currently fenced off (because that's all the city could afford), and if you bother to click on the enlarged picture you can hopefully see the graffiti on the side--I MISS YOU DAD.

How did that dad die? Was he drowned or smashed or shot during Katrina? (I include "shot" because there were a number of cases where New Orleans citizens were shot by cops or "concerned citizens" on suspicion of "looting") Or was his death completely unrelated to Katrina and just part of the background noise of murder and violence that the NOPD ignores unless it threatens the Bourbon Street tourist trade? (I should take this moment to state the Bourbon Street smells like piss at all times, from the entrance to the local Coyote Ugly franchise to the numerous shops where you can buy voodoo souvenirs and/or bongs.) Happiness offered no hints as to the death of this or any other dad, although they went into great detail about how delicious a genuine New Orleans po'boy was (as if I needed to be told that a roast beef sandwich literally dripping gravy was a good thing to eat).

Driving around New Orleans, I was so preoccupied with sadness and pain and poverty that I generally wasn't aware that my rented Pontiac was bouncing from pothole to pothole like a skipped pebble. Excess humidity/rain/water-water-everywhere fucks up roadways even in cities that haven't been hit by catastrophic hurricanes; in the poor or outlying neighborhoods of NOLA, four out of five local streets would have been considered wrecked beyond repair in a city with money and time enough to fix it, but were still in use because there was no other way the city could operate. I inspected four or five stores in New Orleans before I fled to the next assignment, bearing the horrible weight of depression that accompanies any visitor to New Orleans who dares venture outside the officially tourist-approved vacation zones.

Apparently I was also bearing a huge egg-shaped lump in my right front tire that I had picked up in one of the craters I had ricocheted from while navigating New Orleans' uniquely violent and schizophrenic traffic patterns. I was able to safely ignore this for nearly two-thirds of the trip along Louisiana's proto-Interstate freeway US-90 from New Orleans to Lafayette when my Pontiac's super-advanced hyper-intelligent Trav-Lomatic Compu-Tastic Auto-mo-Brilliant General Motors Carputer let me know that my right front tire pressure sensor was registering 1 PSI and that was unusually low compared to the 30 PSI reported from my other, more loyal tires.

Road surface quality was so bad all throughout Louisiana that it took me two miles of bumpy driving and a frantic dashboard error message before I pulled over and discovered that one of my tires had suffered an enormous and catastrophic blowout. I was lucky or stubborn enough to have nursed my car over a long and narrow causeway devoid of breakdown lanes, but I still found myself tending to a wounded car marooned on a 30-degree slope, rummaging through the trunk in search of the jack and donut that would allow me to reach civilization, busting knuckles and thumbnails as a constant stream of commuters blew past me at 90+ mph (at the time US-90 was 99% free of state trooper interference because they had almost no dry land to establish speed traps on; on a later visit I was able to clock 110 MPH in a rented 4-cylinder Chevy Malibu because that was the same speed everyone else was traveling) and eventually clamping a tiny bald spare tire directly onto the drivetrain onto what was supposed to be one of GM's most refined and sophisticated front-wheel-drive cars.

I spent the next two hours driving very carefully to Lafayette, where Enterprise Rentals told me the nearest affiliated Firestone dealership was, and after way more paperwork than anybody should ever reasonably expect I was provided with a brand new right front tire. This allowed me to bust ass in the opposite direction (south) down US-90 so I could reach the last USDA assignment of the day, one that I had to review that day or our company would be at risk of defaulting on our contract. I remember hurtling into Jeanerette and braking hard into the front yard of a crab boil outfit that had innocently applied to the food-stamp program--everyone who worked there was sitting comfortably outside with a beer or a glass of booze after a long day's work, and they were suddenly confronted with a late-model Pontiac skidding into the front yard and some wild-eyed Fed begging for a guided tour of their restaurant/seafood store/produce shack that they had closed an hour earlier. Because they really wanted their USDA/SNAP certification, and because they were genuinely pleasant people who received my frantic gibbering with gentle pleasantries, they let me inspect their store even though it was against basically every rule imposed by the USDA, and I was able to book a decent hotel that I was able to pass out in just two hours later.

I still have the Pontiac emblem from that exact tire--with some masking tape and a spare magnet I have converted it into an especially meaningful fridge decoration. I don't have that job anymore, because after four and a half years of punishingly loyal service I got fired for being a half-hour late. Don't trust your bosses, kids! But do trust me, because I am totally going to deliver a new story tomorrow unless I am too catastrophically drunk or depressed to even try to do so. And remember: Pontiac is Driving Excitement!!!

[athodyd]

Ancient Twitpic Treasures Part II: Escape from LA (The Abbreviation for Louisiana)

Crack open a Jigga Juice and fire up an album by renowned hip-hop stars Diamond and Sales Clerk (fea. DJ Illegible) and let us return to Louisiana, where the kittens are infected and the grandpas are all dead and I worked for an entire month back in 2008 inspecting local convenience stores, groceries, fruit stands, and butchers to ensure that they conformed to the guidelines of the USDA Supplemental Nutritional Assistance Program (food stamps) and were also not actively poisoning people. Did Jigga Juice count as poison? All I knew was that you couldn't buy it with EBT and so it was beyond my jurisdiction.

While my USDA activities took me to every corner of the Tragedy State, I spent nearly half my time in NOLA, which was still a mess of wrecked buildings, roads, and people three years after Katrina. Driving in from Slidell on I-10 I passed several new-for-2005 apartment complexes that had been totaled by the hurricane but remained un-repaired, un-demolished, and in a few cases were still sporting the same NOW RENTING banner that they hung up weeks before New Orleans got wrecked and fucked up forever. If you try and ignore that, you eventually find your eye drawn to the rollercoaster tracks of the abandoned Six Flags park just to the north, which operated for a few years before Katrina damaged it beyond repair. Six Flags claims that it's the city's responsibility to tear it down, but the city (and parish, and probably state) doesn't have nearly enough money to do so and is desperately trying to get Six Flags to take responsibility, and meanwhile the wrecked amusement park provides amusement only to hipster urban-exploration photography types and people who need really obnoxiously literal visual metaphors for the pain and suffering caused by Katrina. As of March 2012, there are plans to turn the site into an outlet mall, which is probably the only thing I can think of that is more depressing than an abandoned amusement park, but presumably will not be visible from the Interstate.

One thing in NOLA that is NOT horrifically depressing, though, is the Superdome Holiday Inn (above: the view from my hotel room), a beautiful thirties-era skyscraper a few blocks from the French Quarter where a room can be had for a mere $100/night and the only real problem is that sometimes the streetcars trundling along Loyola might wake you up with their charming ding-ing. Holly Inn has made a practice of buying up and renovating historic hotels in big cities and then managing them with the efficiency that people who don't mind finding dried blood and pubic hair all over their hotel rooms would call "soulless;" their Superdome location is obviously a product of this business strategy. The hotel lacks its own bar and restaurant but you're surrounded by awesome places to eat and they give you coupons for free drinks and half-price food nearby--the best place by far is a little dive bar right next door where the bartender will put some Louie Prima and Bad Brains on the stereo, cook you up a bowl of his mom's gumbo, and tell you fascinating stories in the obscure and awesome New Orleans accent, which sounds vaguely like a Brooklyn accent but with occasional excursions into Creole French and primordial Southern slang. Perhaps my favorite part about the hotel is the pool, which is outdoors but heated AND a full eight stories above the madding throng. For some reason floating in a pool is ten times more relaxing and enjoyable when you are doing it way high up in the air.

Tomorrow: having dealt with one of the very few things in New Orleans that is not depressing and awful, I will talk a little bit about everything else in the city that generally cannot be dealt with without having to lay down and cry.

[athodyd]

Ancient Treasures From My Defunct Twitter Account

Everybody knows that Twitter is fucking dumb, but everybody also knows Twitter is incredibly important--these are the two indisputable and irreconcilable truths that define modern English communication. Two years ago, I considered myself a revolutionary genius for independently discovering the first of these two truisms and thus abandoned my early-adopted Twitter account in what I can only now see as a fit of operatic hubris. Today, I am an unemployed alcoholic desperately seeking a job where I can wash dishes for twenty hours a week.

Coincidence? Unlikely. Unpossible. Unsinn. While coincidence may not entirely equal causation, I can't sensibly ignore the fact that in the two years I have neglected Twitter I have found myself in an inescapable professional/psychological/financial crash-dive into a metaphorical horrible death toilet, while Kourtney and Khloe Kardashian--notable only for being Armenian, having mildly irritating names, and being related to a woman with an incredible ass--have enjoyed improbable riches and fame merely for hammering out less-than-or-equal-to 140 characters about what clothing they might prefer or which c-level rappers might have peed on them. As such, it is impossible to continue my completely unrealistic and half-baked career arc towards a professional humorist without maintaining a Twitter account, and I think step one towards regaining my huge (maybe twenty people) Twitter following is recounting the best and most photogenic parts of my Twitter exploits.

Happily, the first picture I took that I used Twitpic to upload was the above--a cuddle-wonderful pair of mangy and obviously contagious kittens I found sunbathing outside a crumbling wreck of a supermarket I inspected far south of Houma, in the archipelagic part of southern Louisiana where the distinction between dry land and the Gulf of Mexico is never easy to make. I was there to verify that the grocery in question was able to stock sufficient staple foods to qualify for the EBT/Supplemental Nutritional Assistance Program/food stamp card during the few times it was above water, but I still find myself wondering whether those filthy kittens and their filthy mother (who I remember primarily for being very sweet and having an incredibly disgusting infected nipple) were able to cat-paddle through the periodic floodings of Louisiana's oil-rich half-dry southern lowlands. Would the filthy kitten survive to spread their horrible pathogens throughout the coastal South? Would I become Patient Zero of the 2008 Kitten Flu Pandemic? Such questions preyed on me for exactly two days until I found the following:

Will ferocious pubescents possessed of deadly rages and illicit passions kill all of my grandpas? There was no greater threat to my well-being until a day or so later when the tire of my rented Pontiac catastrophically exploded some fifty miles from any tire shop. STAY TUNED for more fleshed-out and sexed-up recountings of my florid Twitter tales, and sign your filthy ass up to follow my actual twitter account which I am fairly sure is where you would expect it to be. Rule of thumb: anything athodyd on the internet is likely to be me unless it concerns a canoe.

[athodyd]

Overheard on the set of XXXcessIv Productions "Dog Dick Afternoon"

“Aw come on dude, the entire afternoon?”

“Rod, that’s not what—”

“I mean the dog’s gonna get tired eventually. I owned a Great Dane when I was a kid and believe me Marmaduke is like 90% BS, especially if its hot out.”

“It’s a movie parody. Dog Day Afternoon? Al Pacino?”

“Uh…”

“It’s a fucking classic man. Remember how I told you were going to bring back the retro-classic days of narrative-based quasilegal bestiality porn?”

“I thought you meant I should grow a mustache.”

“No, its—actually the mustache was a good idea though—anyway it informs the plot. After having sex with your dog, you decide you need money for a species-change operation so you can marry your dog, so you hold up a bank and then everyone there gets banged by your dog, and they love it and they get the cops to drive you to the airport and bang your dog, but they double-cross you and shoot you and you have just enough energy for you to bang and be banged by your dog.”

“That sounds really complicated man, and plus that is definitely going to take up the afternoon.”

“Well, you’re not going to just be constantly screwing the dog, is the point. There’s going to be a bunch of breaks for dialogue and acting and shit.”

“I’m not really good at that stuff.”

“It’s fine dude, we’ll fix it in post. You ready to go?”

“Are you sure this is how Ed Norton got his SAG card?”

“What? No, this is how you can get a bunch of meth for the weekend.”

“Oh, oh yeah. Sweet.”

[athodyd]

Internship at National Geographic Channel's "Hunt for Hitler" already over

I was all ready to fly out to Argentina when we got the call that he owned a mobile home park just outside Biloxi. Everyone was really surprised because we hadn't turned up any rumors to that effect but it turned out he was the only guy in Mississippi who owned a Wehrmacht High Command staff car with a bunch of Haley Barbour bumper stickers.

(actually that's like every fifth car in Mississippi)

[athodyd]

BORN OF NIGHTMARE: My Two Morriseys

This post is going to be at least half about the fact that last night, for absolutely no discernible reason whatsoever, my normally dreamless but fidgety sleep was replaced by wall-to-wall paralytic nightmares of helplessness and dread and extremely unnecessary medical procedures and hillbillies. I know that everyone hates reading descriptions of dreams, but I think that at least a few people might be curious about how I am currently genuinely afraid to go to sleep or even lie down for too long, and how that mental state has galvanized my interest in creating the last viral parody sitcom hit the Internet will ever need, ever. If you are one of those people, I invite you to consider the following situations:

WHEREIN I am a bedridden child being wheeled down a spiral staircase deeper into my hospital and being reassured that I am about to meet Optimus Prime but slowly I realize that the walls and stairs are becoming the entrails and sinews of a giant organism disguised as a hospital and I don't even like Transformers

WHEREIN I am an infant being levitated down a vast hall covered in abstract paintings towards Max von Sydow and when I drop my rattle into his glass of juice he retaliates by using his psychic powers to force me to drink a glass of trimmed chicken fat and amniotic fluids

WHEREIN a scrawny, violent, bearded man similar to Jesco White without the redeeming characteristics (mountain dancing, guest appearances on Squidbillies) is sequestered in our family's house by the police without our consent and begins threatening the kittens and us with a number of rifles, but then his grandfather murders a famous bear in Beaufort SC and he escapes in the night but we are ordered/obligated to assist in the investigation and ensuing gunfight

WHEREIN my parents try to break into my house and kill me because I distracted them while they were playing Warcraft II

AND FINALLY THAT at the end of each dream I briefly awoke only to realize I was suffering one of my occasional and horrible episodes of sleep paralysis, at which point I helplessly fell back asleep and into another variation of the above four dreams, and basically if one of the cats hadn't started to chew off my leg I would still be trapped in the biomechanical hillbilly hospital with Max von Sydow and my homicidal parents. What a good kitten!

If you're not that kind of person you probably should've skipped directly to this line (sucker) and taken it as read that I not only didn't get any sleep last night, I got some sort of terrifying hyperadrenal anti-sleep where for the last four hours I have been staggering around trembling so violently my edges are sort of blurred out and fuzzy. That's how my day's going.

Due to my hopelessly naive belief that most things in the universe happen for some sort of reason, I have spent my time since escaping bed trying to figure out what the hell I did that would lead to a richly detailed eight-hour horror festival in my head. Alcohol? I'd had three Heinekens and a strong IPA some three hours before I went to bed. Medication? I never take anything stronger than an ibuprofen before sleep because otherwise I pass out for twelve straight hours or remain rigidly awake until late the following afternoon. Food? I had roasted chicken, pita chips, hummus, and an awesome Turkish-or-Greek yogurt dip my sister and I made, and if any of those things were responsible for destroying my ability to sleep I would basically have to give up sleep. I hadn't been reading or watching anything more frightening than Adventure Time reruns, and while the family stuff of last week was king hell dogshit while it was going on, the matter had been recently resolved and I'd never had any nightmares during that time.

At this point I started reaching (arguably I am still reaching) and started thinking of  things I had done the day before that might have cleverly lain dormant through the night in hopes of more effectively fucking me up and giving me the Fear. I had attempted to follow through on my earlier bluff and get a pleasant evening's walk on by visiting the gigantic blood-plasma wholesaler that I can only assume is the economic foundation of my neighborhood, only to discover there would be a full two-hour wait before the draining of my precious fluids, making the whole affair unpleasantly reminiscent of work. I had attempted to sell off the two completely useless but essentially brand-new Wii Zappers only to discover that the other guy on Craigslist had no idea where I was. I had confronted a near-suicidally-depressed  underemployed single mother who was attempting to deal with the loss of her (neglectful, thieving) mom by trying to have desperate teary sex with me and a bartender, possibly at the same time, possibly without even leaving the bar, even though she was too messed up to even play Connect Four with us (because somehow we thought that might help).

Looking back on it that was an almost farcically grim day, but somehow none of these terrible rock-bottom depressing events struck me as the sort of thing that would interrupt my usual snuggly bedtime fun with graphic body horror, if only because the bartender had managed to talk the crying drunk woman into putting on most of her warm clothing and shoes before she bolted off into the night (she even said she lived within walking distance!). The one thing I could think of that had happened that day and that was still preying on my mind to any degree was one of the many ideas that prey on me while I am trying to feel guilty about not writing more articles. Among the thousands of terrible flashes in a stupid pan that make me type a paragraph into tumblr before deleting it, this idea refused to go quietly and even now is clinging to some important and vital organ in my brain until I give into it and type out

MY TWO MORRISEYS

starring

YOUNG MORRISEY, depressed singer-songwriter possessed of a voracious and sucking need for companionship and a hatred of heroin addicts 

OLD MORRISEY, pudgy singer-songwriter possessed of a voracious and sucking need for vegetables and a hatred of Asians

STEVE, relatable everyday average Joe who, after encountering a bizarre rift in space-time triggered by eating vegan ice cream while listening to "How Soon Is Now?" finds himself forced to share his upscale apartment with the two Morriseys and their continual passive-aggressive battle for dominance; and what's he going to do when his crazy Marine dad comes to visit???

INT. APARTMENT - EARLY EVENING

Fade in with a smooth poppy rendition of the opening of "The More You Ignore Me, The Closer I Get." YOUNG MORRISSEY is curled morosely in the corner of the sofa, weeping silently onto a notebook covered with scribbled-out lyrics about rejection and self-loathing. OLD MORRISSEY sits at the opposite corner disinterestedly flicking a Wiimote from side to side with one hand and scooping handfuls of hummus directly into his mouth from a tub with the other. Enter STEVE from the apartment's front door, stage right.

STEVE

Hey Morrissey! Hey Morrissey! What've you guys been up to today?

OLD MORRISSEY

Mmmmeeehhhhhhh.

YOUNG MORRISSEY

(subdued whimper)

STEVE

I hope you guys had time to go down to that coffee shop that just opened up... they're always looking for creative types!

OLD MORRISSEY

I 'ad a visit but I don't really see them hiring me.

YOUNG MORRISSEY

(sob)

STEVE

Is that so, guys? Because it sure looks to me like you're in the exact same positions you were when I left for work this morning...

OLD MORRISSEY

Oi, well I was on me way down to the place when I saw some Chinese bint walkin' 'er dog and I couldn't well take thinkin' about it because I know she's only going to go and eat it later, so I had to go right straight home before I said something and had the bloody Guardian climbing up me arse again.

YOUNG MORRISSEY 

Couldn't honestly see the point of even leavin' the couch, myself. 

STEVE

Guys, I've told you before, our landlord is willing to let us slide a little on the rent, but if we want to keep the place both of you are going to have to start pulling a little weight around here--

YOUNG MORRISSEY

Ha ha.

OLD MORRISSEY

Here now, what are you on about you pasty wee git? Find something funny, do you?

YOUNG MORRISSEY 

(uncurling from his notebook to sneer at his future self)

You do know you're the only fat vegan in history? You should be in the basement of an 'ospital with a bunch of nutritionists 'round you administering chickpea IVs and shakin' their 'eads, trying to figure out what went wrong.

OLD MORRISSEY

(lumbering from his seat, chin still smeared with hummus, raising the Wiimote in a threatening manner)

Why you--I'll administer you a bloody chickpea!

YOUNG MORRISSEY swiftly darts underneath OLD MORRISEY'S lunge, headbutting his future self in the thigh and knocking over one of the many bottles of antidepressants stacked on the coffee table. The situation quickly devolves into a clumsy brawl, as STEVE, looking on with a sort of affectionate bemusement, shakes his head and shrugs his shoulders in the classic "what can you do" gesture.

OLD MORRISSEY

See how bloody celibate and asexual you are after I shove this Nip gewgaw up your arse, you willowy ponce!

YOUNG MORRISSEY 

You couldn't get a blowjob from a baby seal if you bought it a sweater made out of dead Eskimos, you thick moo!

STEVE

That's My Two Morriseys!

CURTAIN. Wait, that would make it a play.

I have at least six seasons of this taking up space in my head and generating dangerous toxins that will not allow me to go to sleep. My Two Morrisseys enter a bicycle race--but somebody on this bicycle built for two isn't pulling their weight! My Two Morrisseys work the assembly line at a microwave saag paneer factory--but the conveyor belt keeps moving faster and faster! My Two Morriseys meet My Two Bob Geldofs and the sparks really start to fly!

Oh god, none of this is good. This is in fact considerably worse than having those nightmares. I hope I just had a stroke or something instead of having this lodged in my brain.

If anyone reading this is a sitcom producer, amateur Internet spoof director, psychological professional, or Mancunian dialect coach, I urgently need your help. If anyone reading this is Jesco White or Max von Sydow, please stay the hell away from my cats and I enjoyed your performance in Squidbillies and Intacto respectively.

[athodyd]

ONE-SENTENCE SUMMARIES

Because these were getting pretty far from being just one line AND they will not necessarily be restricted to my favorite things anymore.

Squidbillies: A photorealistic documentary of North Georgia.

TOR:CON: The Weather Channel's proprietary methodology for increasing ad revenue during severe thunderstorms.

Tiki bars: Bar decor theme based around the ancient Hawaiian religious concept of emptying a bag of sugar into a glass of rum and selling the result for $14.

[athodyd]

ANCIENT CHINESE SECRETS: The Development of Acupuncture

"Okay, hold still."

"Ow."

"How's that? You feel any better?"

"Pretty much the same, Master Shung."

"All right, we'll cross that point off the list. What about... here?"

"Ow. No, that's not really helping either, sir."

"Really? Damn, had a good feeling about that one. Hmm. Okay then, better one--"

"Ow."

"--or better two?"

"Ow! Damn!"

"Sounds like better one."

"Respectfully, Master Shung, neither point was exactly a trip to the beach."

"Well you know what Liu, it's early days yet. As acupuncture becomes more refined and advanced we'll have better charts and a more developed understanding of chi flow, but as of right now it's going to have to be trial and error."

"I guess I'm just having trouble understanding the rationale behind it, with the needles and all. Ow."

"How's that?"

"Nothing."

"I was thinking that one would remove the chi blockage preventing you from understanding the needle thing."

"No, that definitely didn't happen. I think I'm actually bleeding a little bit."

"Are you at least feeling less depressed?"

"Wait, is that what you were trying to fix? I thought this was about my foot."

"It's a holistic process. What's wrong with your foot?"

"You ran it over with an oxcart just last week."

"Oh yeah."

"What's a holistic process?"

"It means turn around. I'm gonna try a few in your ass."

"Master Shung, couldn't I--ow! Dammit!"

"Stop wiggling around!"

"Couldn't I just eat some willow bark or something? I hear that works. Ow!"

"Stay away from my damn willow tree. I need that to meditate under."