beatricethestrange

[beatricethestrange]

One day i will feminize all men

[beatricethestrange]

I can't believe "Misandry is real" is a real opinion that people hold. What a joke

[beatricethestrange]

Tumblr did not “Goncharov” Poob. Poob is Glupp Shittoing Tubi/Pluto/Roku Channel/Hulu/etc.

[beatricethestrange]

"i don't care if they make their whole way though uni with chatgpt" i think you guys are so internetpilled that you have forgotten there are actual jobs out there that require people to know what they are doing in any way possible or else people die

[beatricethestrange]

Bitches love reblogging this post every Tuesday the 18th

[beatricethestrange]

I do find it really funny when people say they listen to trans guys and then you find out it’s their one trans guy tumblr mutual who hasn’t touched a single book about transmasculine related theory. They just know one guy and act like he’s the CEO of trans men.

[beatricethestrange]

[beatricethestrange]

she genetic code on my genome till i GATATATAGGACTAGATAGTA

[beatricethestrange]

hey tumblr can you make it so that when i look on my following page I don't have to scroll through the 20 posts i just reblogged? no?

ok :(

[beatricethestrange]

hey chat did you guys know there's a whole website with informational videos on the rights you hold when interacting with ICE or witnessing interactions with ICE. all written by immigrants and for immigrants. idk man it'd be a shame if people watched these informational videos y'know.

[beatricethestrange]

I grit my teeth and read the entire executive order regarding trans people, and I just want to take the opportunity to remind folks not to forget intersex people. One of the rescinded documents is “Supporting Intersex Students: A Resource for Students, Families, and Educators," and there is a huge emphasis on legally enshrining "only two sexes."

Yes, this affects trans people, but with the way intersex voices often get ignored in trans spaces, I just want to remind folks not to shut us out. Don't forget us. Don't keep talking over us. Don't act like we aren't on the front lines. Don't act like this is just about you. Please.

[beatricethestrange]

i dont know what trans girl needs to hear this but i like you better as a girl <3 im so glad you're a girl. it makes you cuter and prettier and cooler for you to be a girl, actually.

[beatricethestrange]

Do you ever talk to your mutuals?

not really i just post things and hope they fall in love with me

[beatricethestrange]

Looking at the biography section of the wikipedia page for any german creative alive in the early to mid 20th century is always like playing russian roulette if the odds were 50/50 to begin with instead and also the empty chambers of the gun might spontaneously spawn a bullet in them at any moment with no warning

[beatricethestrange]

“a penis is Ontologically Evil because it’s technically capable of perpetrating sexual violence” damn, wait till you hear about hands!

[beatricethestrange]

IF GOD HATES TRANNIES WHY DO WE KEEP WINNINGGGGGG

[beatricethestrange]

since it’s a scary time to be trans: refuge restrooms is an app which maps gender-neutral/single-stall restrooms. it’s community-mapped, so it’s possible you might be the first person to log the restroom locations, but hopefully it’ll help some people.

please reblog this post if you’ve got trans followers. stay safe.