whvabbeys

[whvabbeys]

Kink isn’t shameful because of the weird sex stuff. That part’s rad. It’s shameful because it is technically improv. 

[whvabbeys]

(after misunderstanding what someone said and embarrassing myself) oh great now they hate me and want to kill me with rocks

[whvabbeys]

[whvabbeys]

the monster under the bed is scary to YOU. i’m having sex with it though.

[whvabbeys]

No I’m not suicidal I just wanted to delay your train for work

[whvabbeys]

i’m like if a court jester had a fat ass and a sickening sense of melancholy

[whvabbeys]

friend who says he's "busy having nightmares" whenever you ask why he can't hang out with you

[whvabbeys]

[whvabbeys]

we all know about replacing letters with w's but some other things you can do recreationally that will soon ruin the way you type:

recplace g with k

replace ed with t

for example: i am dyink. and this is fuckt up

[whvabbeys]

halloween is where i thrive. skeletons dont even scare me. theyre just like normal people to me. yes i have x-ray vision but i don’t see why that’s relevant rn

[whvabbeys]

whenever you think tumblrinas have run out of weird doe eyed guys from the 60s & 70s they find another one

[whvabbeys]

Fish and War are the two most common things to mong.

[whvabbeys]

they call me a jack-o-lantern the way i… the way i jack.…. no, i shan’t say it

[whvabbeys]

she genetic code on my genome till i GATATATAGGACTAGATAGTA

[whvabbeys]

[whvabbeys]

“no rapping tonight"

why?

"you rap about arthurian knights everytime, it's embarrassing"

ok

[after one beer]

uh oh y'all i go into a trance a lot

[whvabbeys]

posting is like bloodletting