wobblegong
wobblegong
Wibbles and Wobbles
7K posts
I'm pretty sure I don't know what I'm doing.
Don't wanna be here? Send us removal request.
wobblegong · 7 years ago
Text
Bethesda wanted to be the ones making it, borrowed the tech/ect talent from their sister studios (such as ZOS, the studio that did ESO) to help them do it and then ignored all feedback/advice they got. =)
Bethesda has not pulled a 2018-Blizzcon-Blizzard (yet?) but unless there’s some major changes I really worry about their hubris.
the saddest thing about the Fallout 76 fiasco for me, following it, is that ESO is a good game
it’s not my favorite Elder Scrolls, but it’s one of the better MMOs I’ve played, and they executed the Elder Scrolls components of it very well
they had the proven capacity to make/outsource a good MMO game and they failed
32 notes · View notes
wobblegong · 7 years ago
Text
It’s been a pleasure.
https://wobblegong.dreamwidth.org/
https://www.furaffinity.net/user/wobblegong/
I deleted my one sideblog and I don't expect to return, barring some massive 180 on corporate's part. (Massive-massive.) I’ll miss my friends and my shitposts but I’ll always carry you folks in my heart. (Or, y’know, poke me on Dreamwidth if you need to get in contact with me.)
7 notes · View notes
wobblegong · 7 years ago
Text
Oh sweet baby– thank you SO MUCH for finally explaining the rabbit hole that led to the D&D Alignment System, which I 100% admit up front is, imo, an absolutely terrible thing that I want to stake through its withered heart.
Where Law and Chaos Came From: a D&D History Lesson
I’ve seen a few interesting posts about Dungeons and Dragons alignments that all share two interesting commonalities:
1) They think the two-axis system of Law vs Chaos and Good vs Evil is too restrictive for people who like to roleplay. 2) They try to redeem the two-axis system by redefining Law and Chaos in ways that make sense to them personally.
Good and Evil aren’t usually a topic of debate on these posts - it’s easy enough to play a character as generally doing the right thing or as being a total bastard. Discussion on acts of more debatable morality (e.g. torturing a villain for vital information, killing an innocent person by accident, sacrificing one for the good of all) tends to veer towards whether the action itself qualifies as good or evil, and not whether good and evil themselves need to be redefined. Conversely, I’ve seen Law and Chaos rewritten as Community vs Individuality, Tradition vs Cultural Mutability, Authority vs Anarchy - all interesting ideas that tend to reflect more on the person writing them than the actual purpose of the Law vs Chaos axis.
I’m not saying these people are wrong, but that these players (as well as the fine folks who wrote the 5e Handbooks) are placing too much significance on the purpose or intention of Law vs Chaos. The historical secret is that Law vs Chaos alignment never had any deep meaning behind it - or, at least, it never had any meaning deeper than the Pittsburgh Penguins versus the Vancouver Canucks.
I’ll explain how, but it requires a bit of a history lesson. The idea of Lawful and Chaotic alignments - as well as a number of other cornerstones of Dungeons and Dragons - came from a different game: a miniature wargame called Chainmail. It’s time for a deep dive.
Keep reading
1K notes · View notes
wobblegong · 7 years ago
Photo
Tumblr media
i told twitter i said “im gonna draw dave in a dress and no one can stop me” and you know what? here we are
5K notes · View notes
wobblegong · 7 years ago
Photo
Tumblr media
the sweetest, happiest little tundra i’ve ever drawn for argante (#48858)! ♥
271 notes · View notes
wobblegong · 7 years ago
Text
I should really not be this picky but I’m Appraising everything I own before choosing what to toss (because for now I’d rather keep the better-stats stuff than the higher-cp stuff)
If we’re being charitable I have cleaned a fifth of my boxes.
Why did I put this off for a week.
aaaaaaaaaaa
Upside, I have my very first perfect-IV pokemon: my first Magmar! (Downside, I don’t care about Magmar and I don’t think it’s a meta golden child either, but still! My first!)
4 notes · View notes
wobblegong · 7 years ago
Photo
Tumblr media Tumblr media
ARDENT / (adjective•archaic•literary) / passionate; burning; glowing
44K notes · View notes
wobblegong · 7 years ago
Conversation
Me: I'm so glad I caught everything I wanted and I can head home now!
Pokestop that's about to make me speedwalk 1 km uphill: oh, you haven't heard?
11 notes · View notes
wobblegong · 7 years ago
Photo
The most distressing part of looking at this post– besides learning that Truck Nuts are mutating and moving into new ecological niches– was the sudden impulse to Buy Some because I’m looking for some kind of light/reflective thing to adorn myself with for my nightly walks.
I guess the advantage if I bought these would be any jokes referring to my nuts would no longer need to be metaphorical. There’s also the (admittedly myriad) advantages of testicles that are made of silicone, act as a light source, and can be hung from whatever I want. Gosh, I’m tempted to get some just to make all the AMAB folk jealous of my superior cyborg nuts.
Tumblr media Tumblr media
that is no moon
111 notes · View notes
wobblegong · 7 years ago
Text
That’s... very cool, actually! (And I salute the Ingress player(s) as well.)
One of the weird statues. “Please Don’t Feed the Artwork”. I was not prepared.
My dearest Toastiness,
sdlanqaaws 6 pokeballs thank you!!
ps. what the HELL landmarks are you visiting, I was not prepared for the postcard on your gift. I love it. xD
11 notes · View notes
wobblegong · 7 years ago
Text
My dearest Toastiness,
sdlanqaaws 6 pokeballs thank you!!
ps. what the HELL landmarks are you visiting, I was not prepared for the postcard on your gift. I love it. xD
11 notes · View notes
wobblegong · 7 years ago
Text
HOHMAHGOH I FINALLY CAUGHT A SHROOMISH!!!
And... did my good deed for the day? There was a car stranded in the church parking lot, I eventually got close enough for the driver to go “yo I’m out of gas, but I have a portable tank, but I can’t figure out how to work the nozzle” and I flailed at it until I lucked into how it worked.
Downside, my preferred jacket is now at the dry cleaner’s on account of EXTENSIVE GASOLINE STAINS and my gloves are ditto except at home where I can hand wash them.
“Going Outside Sometimes” is wild and I don’t know if I missed it but I also don’t think I’m displeased.
ps. swept a six-empty-hearts gym, fingers crossed Team Yellow lets my plush manta bb hold it for eight hours. Nevermind, the rest of Team Red heard there were opening and hustled the hell over. 886 Mantine is the weakest thing in the gym now and I expect we'll hold it awhile! <_<
5 notes · View notes
wobblegong · 7 years ago
Text
I’m lazy and I don’t have all my clothes because they’re in the wash (because clothes have to be washed eventually, me!) but the sun has more than five minutes left and that’d be a really nice chance to hit the corner gyms.
Conversely, I could Not™ and remain warmer, more comfortable, and get chores done faster-better-more efficiently.
I should really stay home and do chores, noooo.
2 notes · View notes
wobblegong · 7 years ago
Text
Tumblr media
I am my own ride but MOOD, BIG MOOD. “Oh look... I need to go grocery shopping... let me just casually add 90 minutes to the errand so I cAN SPIN STOPS!!” And then there’s an entire subreddit of people discussing the PROBLEM of auto-spin/catch peripherals working too well and clogging up their inventories with Pokemon/items and needed tending twice a day. @_@
ps. The pokeball drought is real.
Tumblr media
1. This is EXACTLY who I thought would make this comment.
2. I’m actually enjoying it so much! Turns out my janky meatsack figures out how to thermoregulate once I’m briskly walking so I’m more comfortable 45 min into the walk than I am sitting around at home!
Now I’m worried about playing during the warmer months of the year. ;_; Will I buy workout clothes just so I have garments to sweat all over by June? Eww.
6 notes · View notes
wobblegong · 7 years ago
Text
I keep dipping into the HARDCORE Pokemon Go arenas to get answers to “fiddly/complex but not actually intense” questions and, one hand to Arceus, it’s unnerving to see so many offhanded implications of massive whaling on display.
I’m sitting here in my Baby Corner feeling pleased that $10 buys me so many inventory upgrades (and feels like fair pay considering this game is the best health tool I’ve ever tried so far) while over yonder someone mentions that they and their wife* both tried X peripheral but it was too fiddly with their three PGO devices so they bought a pair of Y peripheral instead and haven’t looked back like!! Upthread someone mentions these peripherals are in the $50+ range per!!! Y’all casually buying a console’s worth of unenforced-but-probably-against-TOS curios so you can spin Pokestops/gyms while driving because that’s your life!!!! And you’re the normal/moderate population!!!!!!
I’m not judging the priorities, I’m just really! unaccustomed! to that level of wealth just FLOPPED OUT THERE casual-like in the sun! I come from the “no money, all time” gaming population where a box copy’s cost solely to buy one peripheral that works with only one game is probably not happening! This is weird to me!
* it’s @#$%ing always the @#$%ing wife who’s not posting aaaaaghhhhhh. I watched an explanation vid for one of the major resource-site’s tools and it physically pained me that the 4-5 people who spoke were White Tech Dudes with one (1) cameo by the wife of one of them, referred to as Mrs. [White Tech Dude’s handle] ‘cause they used an example involving Dratini and lady was hype to get a Dragonair. It wasn’t even particularly disrespectful, I’m just so tired of White Guys being the only ones talking and everyone else is DNE or a cameo with no lines. I want to believe some of those “wife” mentions are wlw folks but also it’s reddit so... weh.
6 notes · View notes
wobblegong · 7 years ago
Text
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
129K notes · View notes
wobblegong · 7 years ago
Note
GOSH I wish I could talk my family into Discord and do this. That would be pleasant (even if my particular group probably wouldn’t have an emergency genital discussion channel).
"family discord"
Y’all don’t have those?  Do recommend. 
It’s me and my 3 brothers and my mom.  A+ shitposting
23 notes · View notes