#man eater bug

[thewittyphantom]

I set up a win for my opponent with the rarely-seen Flying Elephant effect, by using Man-Eater Bug to fail to destroy it on my turn and letting them attack with it directly next turn. I bet they were happy to pull it off! :)

[yugiohtournaments]

Best Level Two Insect - Round 2 Match 14

[aduelbetweenkingdomsafreshstart]

ADBK: Man-Eater Bug

Epithet: The General of Gluttony

Voice Actor: Dee Bradley Baker

Tribe: The Arthropod Empire

Biography: As if the likes of Kamakiriman and the Great Moths weren't enough trouble, along comes this ferocious Insect general with long claws, sharp teeth, and the horns of a bull! Meet the Man-Eater Bug, easily the scariest of the Arthropod Empire's armed forces.

His bites are often an instant killer, and very few monsters can withstand his other attacks. However, the downside is that he's also hard to control, making him problematic if he goes on too much of a killing spree.

At one point, he even attacked his own army in a fit of rage! As such, he's usually under the supervision of a second general, often the likes of Kamakiriman or Javelin Beetle.

[thewittyphantom]

These are so adorable and cool! I love them all!

Archive day!

Some fanmade toon monster designs by me!

As follows:

Toon Change of Heart

Beta the Toon Warrior

Toon Kuriboh

Toon Blast Sphere

Manga Monster Reborn

Toon Hoshiningen

Toon Lemon Magician Girl

Black Skull Toon Dragon

Toon Injection Fairy Lily

Toon-Eater Bug

[themsoundwaves]

Did some doodling for Lethal Company O..O I'm making an animation meme with the poses but might scrap it because its pretty choppy

[yu-gi-poll]

REMADE - ROUND 3A! MATCH 2 OUT OF 4

Monster Stats & Propaganda Under the Cut:

Witch of the Black Forest is used by Rebecca Hopkins ("Rebecca Hawkins" in the dub), Step Johnny ("Johnny Steps" in the dub), and Yugi Mutou. Its stats are the following:

Attribute: DARK

Level: 4

Type: SPELLCASTER / EFFECT

Effect Type: TRIGGER

Effect (according to the anime): "When this card is sent from the field to the Graveyard: Add 1 monster with 1500 or less DEF from your Deck to your hand."

ATK: / DEF: 1100 / 1200

Propaganda:

[None Submitted]

Man-Eater Bug is used by Yami Bakura. Its stats are the following:

Attribute: EARTH

Level: 2

Type: INSECT / EFFECT

Effect Type: FLIP

Effect (according to the anime): "When Man-Eater Bug is flipped face-up, destroy 1 monster on the field."

ATK: / DEF: 450 / 600

Propaganda:

It instantly destroys a monster on Flip. Any monster. Man eater bug do not care what you got, it eats it. Very fun to flip on someone's big tough monster.

[keereejou]

i need to learn how to play Yugioh because these damn cards are the best things in the world to me now

[zeeturn]

Found this beautiful lady inside my freaking car on my way into work!!!

[misano17]

average party interaction

Featuring the party’s paladin, the very tired, very not deserving of Cy’s shit, stressed out man named Neil.

anyways, reference image under the cut

[thewittyphantom]

I had a really chaotic dream that made sense in the moment where I was at my local video game store, found a secret entrance in the back, and it led to the world of Yu-Gi-Oh Forbidden Memories and I was the Prince. Shada (not Shadi or Sadin) was my guide and he and the Prince were familiar enough to kiss, which is definitely one of the odder pairings I've seen in the fandom XD The other weird thing was Yugi also had an Ancient Egyptian counterpart and he was crying cause he didn't want the Prince to die... I guess someone had told him about the anime's future and he was worried, or worried he might die fighting Heishin or Priest Seto.

Speaking of Seto, he knew who I was and proceeded to taunt me about it, and challenged me to escape a labyrinth while the Man-Eater Bug card was chasing me--it'd be easy if I could read Ancient Egyptian, but alas XD Somehow I made my way through just in time to see him imprison Heishin into a card with the Millennium Items, and he returned a lost Gemini Elf card to me. And then we got distracted talking about the logistics of the song "Purple Snowflakes" (Seto believed it was real, I didn't) which I woke up with in my head.

[harteofthehart-ayyy]

//can we not send food related asks please and thank you

[melodrangea]

Nicknames Soul Eaters Boys call their S/O

———————

Soul “Eater” Evans

sweetheart

he says this extremely sarcastically, especially during training

“C’mon sweetheart, is that all you got? I saw you lift twice as much yesterday.”

doll

often uses it in a more formal setting or when he’s trying to tease

“What’s the matter doll? Cat got your tongue?”

He’s a little menace but he’s our menace <3

babe

most common out of the three

you name DOES NOT exist to this man

no name, no nickname, nothing

“Babe can I borrow your notes. Babe where do you wanna go later? BABE”

———————

Black Star

n/n or another variation of you name

doesn’t really use pet names much (sorry babes)

why words words on pet names? he’s way too blunt and if he’s feeling something he’ll just say it, not waste time on fancy words or pet names

(that’s what he tells himself being fr he’s not creative enough as much as I love him)

babe

mostly used around friends (this dumbass thinks he’s being smug)

“hey babe wasn’t going out yesterday awesome? I mean since we’re so inlove and everything.”

the little shit would make your relationship EVERYONE ELSE’S problem (no one is safe 😭)

———————

Death the Kid

Darling

this pretentious hipster

is fairly consistent with the pet names he uses but darling is his favorite

“Darling can you please pass me that book there?”

“Are you alright darling?”

my dear

uses this one without realizing it most of the time

will be chilling in the library studying and will half-consciously call for you

“are you almost done?”

“just a few minutes more my dear, then we can go”

you chuckled, “what did you call me”

“what do you mean, what did I call you?”

love

Kid is a romantic at heart, very classy as well

he would stare into your eyes and call you love

“my love you have no clue how much I love you.”

———————

Crona Gorgon

honey

you would call him honey bunny as a joke and he loved it so he started calling you honey

would always have the cutest blush in his face when he said it too

“o-oh thank you honey :)” (cutie patootie 💋)

dear

would definitely take him a while to start calling this, but when he does 🤌💋

“are you alright if we stay a little longer dear? It’s been a while since we’ve seen the others”

being fr this poor soul would be TERRIFIED to call you something other than your name or a variation for A WHILE

his brains running six times the speed 🏃🏼

———————

Professor Stein

this sadistic mf

i pray for anyone dating this man

but we can be delulu for a few

dove

would absolutely call you dove or some other kind of bird

reminds him of how he protects you like your a delicate bird (and he likes experimenting on birds if yk what i mean 😏)

angel

TELL ME HE WOULDN’T

ngl he only calls you angel when he’s horny asf in a good mood

“hey angel, can you come here for a bit?”

NONE OF YOUR HOLES ARE SAFE RIP

honey

only time your safe if when he calls you honey

mostly calls you this when you’re having a bad day

BUT HE STILL MANAGES TO SOUND SARCASTIC ASF

this is a warning, this man will accidentally hurt your feelings 24/7

“You doing alright there honey? You want to talk about it?”

———————

Kilik Rung

fuck not being allowed to have favorites I LOVE THIS BITCH

only fully green flag in the show i stg (except Marie ofc)

lovebug

he will call you every single pet name he can come up with, but love bug is his favorite

neither of you know how it started but you’re not complaining

“You’re too sweet for me lovebug” <33

sweets

ya see what i did there? ofc he combines his two favorite things: you and those damn candy bars

“This class is so boring, right sweets?”

will calls you sweets often to express thanks kinda like a “thanks toots”

getting more into that

toots

he thinks he’s funny (and he is)

will say this very ironically and usually infront of friends to make everyone laugh

the only slightly annoying quality abt Kilik is his inability to take anything other than combat seriously

“hey toots, how’s it goin’?”

hon

I SWEAR THIS IS THE LAST ONE!

but you cannot tell me this man is not from New Orleans or some other adjacent

and the hon with the southern-ish accent

being so fr he will call you hon all the time and it will fluster tf out of you (he’s smug abt it, just a little 🤏

“You look nice, who are you all dressed up for hun?”

———————————————————————————

woo hoo first post!

anyways hope y’all are doing great

any comments, questions, requests or concerns feel free to DM me!

-Melodrangea <3

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[traincat]

Is Peter sympathetic to his villains?

It depends on the villain and the circumstance. He can be very sympathetic to his villains. He can understand a villain's motivations but lack sympathy for his actions. Or he can just actively not care at all. It's circumstantial.

(Marvel Knights Spider-Man #12)

These don't have to be like, costume villains either. He's famously not cool about violent street crime or anything targeting women or kids.

Peter, please, a man just died. (ASM v2 #42)

There's villains I don't think Peter, if written in character, should ever have sympathy for. Characters like Morlun, for example, or the Jackal, or Carnage.

There are characters I think he understands but should never be sympathetic towards. I think any sympathy he had for Norman Osborn died with Gwen, and then again with Harry. (This is part of the reason the Good Norman plotline bugged me so much. It wasn't really about making Norman Not Evil, it's just that even if Norman could be un-evil and was genuinely remorseful, I don't think it's good characterization to have Peter treat him with anything but scorn.) It's similar with, say, Doc Ock or the Lizard. These are characters Peter has traditionally felt sympathy for, especially the Lizard who, as Doc Connors, WAS his very good friend. But these are also characters who have committed acts so unforgivable that I think any sympathy Peter has for them should have rightfully died. (It hasn't, in the case of Doc Connors, but we all know Spider-Man writing has been beyond lousy the past decade.) In Doc Ock's case, it was bodyjacking Peter. In the Lizard's case, it's that he ate his own son. (Shed, Amazing Spider-Man #630-633. Don't read it. It's bad and it's also genuinely the most depressing Spider-Man story I've ever read.) There are characters like Sin-Eater, where Peter is just not ever going to be sympathetic towards him, and he's right.

(Spectacular Spider-Man #134)

But there are other villains like Sandman or the Rhino where Peter is sympathetic to their circumstances. It doesn't mean he won't punch them in the face, but he gets it, and it keeps him up at night. There's characters who started off villains, like the Prowler, who became card carrying members of his extended polycule his friends. There's characters like Vermin, where, yes, he was eating people in the sewers, but that is NOT his fault, and Peter understands that. (This is a Vermin stan blog. You have to read Kraven's Last Hunt, The Child Within, and The Death of Vermin to understand. CW for childhood sexual abuse.) You have Kaine, his clone, although most of the sympathetic rumination on Kaine's tragic backstory comes from Ben Reilly, his other clone. There's Harry, who has frequently been a villain, who Peter loves beyond reason and is so greatly sympathetic towards.

(Spectacular Spider-Man #183)

(ASM #599)

There's characters like Ezekiel, who, yeah, tried to kill him, but Peter has a relationship with them. A lot of people have tried to kill him. He can't hold it against everyone. And if you want to count J Jonah Jameson as a Spider-Man villain, Peter is sympathetic towards him and does love him, even if he would rather stick his leg in a bear trap than admit it.

In general, Peter doesn't tolerate or show any sympathy towards people who hurt his friends and family. Lay a finger on them and that's the big red line for him. (See above with Sin-Eater, who murdered Jean DeWolff, a detective who was friends with Spider-Man.)

(ASM #665)

(ASM #598) The face of a man who is about to get parts of his face ripped off. Literally.

(ASM #637) And Kraven's wife getting her face ripped off for her part in the death of his clone, Kaine. (He got better. She did not, but that's Kraven's fault.)

(Spider-Man and Black Cat: The Evil That Men Do #6) Heavy content warnings on this one again for childhood abuse, sexual abuse, and incest. It also retcons Felicia's backstory in a way I don't love, but it has really good Peter and Felicia interaction and the Peter voice is consistently strong.

(ASM #540) With the man who shot Aunt May. As a note, the black suit here is NOT the Venom symbiote, it's the cloth version of the costume. A lot of the times when Peter is written harder and he's in the black suit, there's an assumption that it's the symbiote, influencing him, and that's simply not true in 616. 90% of the time you see the black suit, it's going to be the cloth variation.

Which leads into a big case of Peter Is Never Going to Be Sympathetic: the Kingpin.

(ASM #542) Please please please read Back in Black please please please. It's so good it's my favorite it's angry Peter at his absolute best yes it leads directly in One More Day and no I don't care. You can stop after the Nine Felonies if that's a dealbreaker.

So the Kingpin is the big one for me, because he hits all of Peter's buttons. He's rich, he's corrupt, he thinks he's the most powerful man in the room. Those are all going to tick Peter off immediately, and that was before the assassination attempt on Mary Jane where the bullet struck May instead. He's just never going to feel sympathy for the Kingpin, ever, Wilson Fisk's gay mob boss son is disappointing him is not an excuse that's valid to Peter.

Then there are the villains that Peter isn't sympathetic to not because their actions are beyond his threshold for sympathy, but because he thinks they're total fucking losers.

(Marvel Knights Spider-Man #11) This comic is so deeply bro-y but also really fun, if you can take that much Mark Millar. This is Mac Gargan as Venom, by the way, not Eddie Brock, and Peter has always thought Mac is a gigantic loser. He's not wrong.

(Spectacular Spider-Man #145) He hates a little rich boy. Unless it's one of the two little rich boys that are in love with him.

(Spectacular Spider-Man #185) Don't make fun of the gay walrus, Peter, come on.

Then there's this fucking guy.

This is the Black Fox, an old gentleman thief who thwarts Peter at every turn by looking like a kindly old man and going "heyheyhey c'man man I'm just a little guy I'm just a little birthday boy" at Peter until Peter just lets him go and the Black Fox gets away with everything and Peter tells himself it won't happen next time and then it happens next time.

Every single time and Peter is left standing there like an idiot.

[microcosmia]

New Headcanon RE: Suo's eating habits

Suo actually is a picky eater

Like, in the way that he has issues, sometimes randomly, with both texture and taste

So it's just a LOT easier to say he's "on a diet" and then figure out how to eat things at home

Furin has figured out so far that:

Suo will eat small bites of things if you keep handing them to him - and KEEP handing it to him, even when he sets it down

You CANNOT MENTION IT. If you bring it up, it dispels the magic! He won't eat it then! DON'T SAY ANYTHING!

His social politeness makes it hard for him to turn down food gifts from the Makochi community

Those things are often the easiest thing to get him to try

His expression changes on things that he really doesn't WANT to eat (but you gotta be paying attention)

Sakura can get him to try anything once so long as it is something Sakura also hasn't tried

Nirei is good at describing and breaking foods down to flavors and textures which makes Suo more comfortable trying things

They need to be subtle cause Suo is obviously not comfortable with his food issues

They're not super good at being subtle

Suo thinks it's super childish and kinda hates that he has this issue because he hates being "childish" more than like anything. He'd rather get punched in the face.

But he hates having to be accommodated more

And it's something he's already been dealing with and doesn't feel like he needs to change anything

His family growing up also thought it was "all in his head" or a hold up on being a kid so they also didn't try to accommodate him

Umemiya is horrified - the food man did not know one of his little bros COULDN'T EAT HIS FOOD. It tears him up a bit

Nirei has a second book that is "top top secret" with the foods and styles of food they've gotten Suo to eat

Tsugeura is actually really good at making like "hidden food" recipes, like the ones where the veggies are hidden and don't taste/texture like the veggies

Kiryuu will use all of his father's money to buy Suo all the tea and tea cakes he wants. It's not an issue. He would and has bought worse.

Sugishita cares but also won't push about it because that's not his personality; if Suo is sitting with Sugishita then everyone knows he's Not Eating today. Sugishita can and will snap fingers if someone tries to bug him

Sakura is clumsily concerned and awkwardly trying to help in his own ways. If for no other reason than Sakura is reaching out first, Suo will try his hardest to eat whatever Sakura puts in front of him

The gist is, they love each other your honor and Suo's disordered eating is Important To Me.

[yu-gi-poll]

ROUND 1A, MATCH 8 OUT OF 16

Monster Stats & Propaganda Under the Cut:

Man-Eater Bug is used by Yami Bakura. Its stats are the following:

Attribute: EARTH

Level: 2

Type: INSECT / EFFECT

Effect Type: FLIP

Effect (according to the anime): "When Man-Eater Bug is flipped face-up, destroy 1 monster on the field."

ATK: / DEF: 450 / 600

Propaganda:

It instantly destroys a monster on Flip. Any monster. Man eater bug do not care what you got, it eats it. Very fun to flip on someone's big tough monster.

Morphing Jar is used by Yami Bakura. Its stats are the following:

Attribute: EARTH

Level: 2

Type: ROCK / EFFECT

Effect Type: FLIP

Effect (according to the anime): "FLIP: Both players discard their entire hands, then draw 5 cards."

ATK: / DEF: 700 / 600

Propaganda:

A crazy effect from a creepy monster. Easily the second most iconic jar-based card in the game. (First is a certain spell that lets you draw 2 cards).