#Microplate Luminometer

[labotronicsscientific]

Microplate luminometer

Microplate luminometer is a semi-automatic luminescence measuring unit. It is characterized with a counter type photomultiplier tube for glowing luminescence.

[rainyducktiger]

Microplate Luminometer Market Size Share and Demand Analysis to 2033

The microplate luminometer market is experiencing significant growth, driven by advancements in research, diagnostics, and the increasing need for precise, high-throughput analysis. These instruments are essential in detecting and quantifying low-light signals from chemiluminescent and bioluminescent reactions, enabling researchers to explore various biological processes such as enzyme activity, cell proliferation, and gene expression. The market's expansion is attributed to technological innovations, rising applications in drug discovery, and the growing demand for personalized medicine.

Market Overview

As of 2023, the global microplate luminometer market is valued at approximately USD 0.6 billion and is projected to reach USD 0.83 billion by 2031, registering a compound annual growth rate (CAGR) of 4.02% during the forecast period.  This growth is propelled by the increasing adoption of microplate luminometers in various applications, including drug discovery, chemical kinetics, quality control, toxicology, and bioassay validation.

Download a Free Sample Report:- https://tinyurl.com/y3puuy94

Key Market Drivers

Technological Advancements: Continuous innovations have led to the development of more sensitive and accurate microplate luminometers. Modern devices offer enhanced detection capabilities, improved user interfaces, and integration with advanced software for data analysis, making them indispensable in research and clinical settings.

Expanding Applications in Drug Discovery: Microplate luminometers are crucial in high-throughput screening assays, facilitating the rapid identification of potential drug candidates. Their ability to provide precise and reproducible measurements accelerates the drug development process.

Rising Demand for Personalized Medicine: The shift towards personalized medicine necessitates detailed understanding of individual biological responses. Microplate luminometers aid in analyzing specific biomolecular interactions, thereby supporting the development of tailored therapeutic strategies.

Growth in Biotechnology and Pharmaceutical Industries: The expansion of these industries has increased the demand for advanced analytical instruments. Microplate luminometers are extensively used in quality control and research activities, ensuring product efficacy and safety.

Market Segmentation

The microplate luminometer market can be segmented based on type, assay type, application, end-user, and region.

By Type:

Single-mode Microplate Luminometers: Designed for specific luminescence measurements, offering high sensitivity for dedicated applications.

Multi-mode Microplate Luminometers: Versatile instruments capable of performing multiple detection modes, including fluorescence and absorbance, in addition to luminescence.

By Assay Type:

Glow-type Luminescence Assays: Characterized by a steady light emission, suitable for continuous monitoring.

Flash-type Luminescence Assays: Involve a rapid burst of light, requiring instruments with fast detection capabilities.

Glow and Flash-type Luminescence Assays: Combine features of both, offering flexibility for various experimental needs.

By Application:

Drug Discovery: Utilization in screening potential therapeutic compounds.

Chemical Kinetics: Studying reaction rates and mechanisms.

Quality Control and Toxicology: Ensuring product safety and compliance.

Bioassay Validation: Confirming the accuracy and reliability of biological assays.

By End User:

Research Laboratories: Academic and commercial labs conducting fundamental and applied research.

Academic and Research Institutions: Universities and institutes focusing on scientific studies.

Biotechnology and Biochemistry Companies: Firms engaged in biotech product development and biochemical analyses.

Food and Beverage Industries: Utilizing luminometers for contamination detection and quality assurance.

Regional Insights

North America: Holds a significant share of the microplate luminometer market, attributed to well-established biotechnology and pharmaceutical sectors, along with substantial investments in research and development.

Europe: Demonstrates steady growth due to the presence of prominent research institutions and a focus on technological advancements in life sciences.

Asia-Pacific: Expected to witness the fastest growth, driven by increasing healthcare expenditures, expanding pharmaceutical industries, and rising emphasis on research activities in countries like China and India.

Latin America and Middle East & Africa: These regions are gradually adopting advanced analytical instruments, with growth supported by improving healthcare infrastructure and increasing research initiatives.

Competitive Landscape

The microplate luminometer market is characterized by the presence of several key players focusing on product innovation, strategic collaborations, and geographic expansion to strengthen their market position. Notable companies include:

Promega Corporation: Offers a range of luminometers known for their sensitivity and versatility, catering to various research needs.

Tecan Trading AG: Provides advanced microplate readers with luminescence detection, emphasizing automation and high-throughput capabilities.

Berthold Technologies GmbH & Co. KG: Specializes in high-performance luminometers designed for both routine and specialized applications.

Thermo Fisher Scientific: Offers a diverse portfolio of microplate luminometers, integrating cutting-edge technology for enhanced performance.

Luminex Corporation: Focuses on developing innovative solutions for multiplexed assays, including luminescence-based detection systems.

Future Outlook

The microplate luminometer market is poised for continued growth, driven by ongoing technological advancements and expanding applications across various sectors. The increasing focus on personalized medicine and the need for high-throughput screening methods are expected to further propel market expansion. Manufacturers are likely to invest in research and development to introduce more sophisticated, user-friendly, and cost-effective instruments, catering to the evolving needs of end-users.

In conclusion, the microplate luminometer market presents a dynamic landscape with promising growth prospects. Stakeholders, including manufacturers, researchers, and investors, should closely monitor technological trends and application developments to capitalize on emerging opportunities in this field.Read Full Report:-https://www.uniprismmarketresearch.com/verticals/healthcare/microplate-luminometer

[bhattmohit43-blog]

Future Trends of Microplate Luminometer Market by Product, Technology, Growth Factors and Trends by Forecast 2025

Excell Reports include new market research report “Microplate Luminometer Market” to its huge collection of research reports at the global and regional level. This report presents the worldwide Microplate Luminometer market size (value, Capacity, production and consumption), splits the breakdown (data status 2014-2019 and forecast to 2024), by manufacturers, region, type and application. The global Microplate Luminometer market is expected to grow at a significant CAGR during the forecast period. A stringent emission regulation is anticipated to drive the growth prospects for the market for the coming years. Health-care industry is grabbing the attention of all since last few years. The number of growing diseases and increasing concern and awareness about health are the factors contributing to the growth of Microplate Luminometerindustry and its allied industries. Increasing use of innovations, and technologies, as well as increasing investments in R&D, is furthering the market scope and revenue growth of the global market.

The Global Microplate Luminometer Market to reach USD xx Million by 2014. Global Microplate Luminometer Market valued approximately USD xx million in 2018 is anticipated to grow with a healthy growth rate of more than xx % over the forecast period 2019-2024.This report provides in depth study of “Global Microplate LuminometerMarket” using SWOT analysis Strength, Weakness, Opportunities and Threat to the organization. The report also studies the global market status, competitive landscape, market share, market drivers, opportunities and challenges, growth rate, future trends, sales channels, distributors, PEST and Porter's Five Forces Analysis. The report also focuses on the consumption, production, sales price, and capacity analysis in different geographies. Any special requirements about this report, please let us know and we can provide custom report.

•Get Report Sample and Customization:  https://www.excellreports.com/request-for-sample/?id=151285

[super-excell-reports-things]

Analysis Report of Microplate Luminometer Systems Market 2018-2025 | Segment by Application, Types, Key Players and Regions

Excell Reports has released its latest research-based report entitled ‘Microplate Luminometer’ Market. This comprehensive report provides a holistic approach to the market growth with a detailed and precise analysis of the overall competitive scenario of the Microplate Luminometer Market worldwide along with the key trends and latest technologies, playing a prominent role in the Microplate Luminometer market growth over the predicted period 2025. It also takes into account the market trends, aspects like drivers, barriers, challenges, and opportunities that impact the market and presents statistical and analytical account on it. This research report features a comprehensive discussion about the current scenario to estimate trends and prospects of the Microplate Luminometer market soon. Moreover, it provides dynamic and statistical insights pertaining to the market at both regional as well as global scale.

For Free Sample Copy, click here: https://www.excellreports.com/request-for-sample/?id=151285

Healthcare industry is grabbing the attention of all since last few years. The number of growing diseases and increasing concern and awareness about health are the factors contributing to the growth of Microplate Luminometer industry and its allied industries. Increasing use of innovations, and technologies, as well as increasing investments in R&D, is furthering the market scope and revenue growth of the global market.

Recognizing the rising prevalence of Microplate Luminometer market, this research report proves to be a primary source of guidance and detailed data on the market at global scale. The report evaluates the present scenario and status as well as changing trends in the market to project its outlook and prospects. This report is a systematic research study based on the market and analyzes the competitive framework of the global Microplate Luminometer industry. A holistic report covers exhaustive information obtained from reliable industrial sources and through proven research methodologies. The data thus obtained is then combined with relevant tables and graphs to support the information revealed. Thus the report features graphs, figures, and data and provides a high-level blueprint of the global market.

To view the table of contents and know more details please visit: https://www.excellreports.com/product/life-sciences/medical-devices/global-microplate-luminometer-market-report-2019-history-present-and-future/

Various competent analytical tools have been used to offer a comprehensive assessment of the market. The report comprises of each aspect of the global market for Microplate Luminometer. It starts with the basic information and then advances to the market classification and segmentation based on different criteria. It analyses the key segments and the regional subdivision of the market and helps determine the future of the market in the global arena.

Major regions, countries, and sub-segments have been analyzed for providing the better understanding of the market scope worldwide. The report studies the market by evaluating the manufacturers, manufacturing chain, contribution in the industry, regulations, prevalent policies and cost structures. The regional markets for the Microplate Luminometer market are analyzed by evaluating the pricing of products, profit generated, logistics, demand, and supply, production capacity, as well as the historical performance of the market in the given region. The report also provides insights on the competitive landscape of the global Microplate Luminometer industry with the leading players profiled in the report. The Microplate Luminometer market is highly competitive and regulated. The company profiles, trends, tactics, merger & acquisitions, business strategies, financial metrics of the major participants operating in the global Microplate Luminometer market have been reviewed in this study.

Table Of Contents – Major Key Points

Chapter 1. Global Microplate Luminometer Market Definition & Scope 1.1. Research Objective 1.2. Market Definition 1.3. Scope of The Study 1.4. Years Considered for The Study 1.5. Currency Conversion Rates 1.6. Report Limitation Chapter 2. Research Methodology 2.1. Research Process 2.1.1. Data Mining 2.1.2. Analysis 2.1.3. Market Estimation 2.1.4. Validation 2.1.5. Publishing 2.2. Research Assumption Chapter 3. Executive Summary 3.1. Global & Segmental Market Estimates & Forecasts, 2015-2025 (USD Billion) 3.2. Key Trends Chapter 4. Global Microplate Luminometer Market Dynamics 4.1. Growth Prospects 4.1.1. Drivers 4.1.2. Restraints 4.1.3. Opportunities 4.2. Industry Analysis 4.2.1. Porter’s 5 Force Model 4.2.2. PEST Analysis 4.2.3. Value Chain Analysis 4.3. Analyst Recommendation & Conclusion & More

Check Discount: https://www.excellreports.com/inquire-for-discount/?id=151285

About Us:

Excell reports is one of the leading distributors of Market research reports produced by premium publishers. Being a one stop solution for research requirements, our Market research reports help our clients to keep abreast of thousands of industries all-round the globe. A better understanding of the predicted market conditions, a clear picture of supply and source industries allows our clients to closely monitor competitor activities. Our large database of more than 50,000 quality driven reports from over 40+ leading publisher ensures that your market research requirements are sufficed.

Contact Us:

Mr. George Collins

Excell Reports

9701 Wilshire Boulevard 10th Floor

Beverly Hills, 

California 90212

Tel - +18448939235 

Email- sales@excellreports.com

WebSite : www.excellreports.com

[customdesignnnn]

ATP Testing Market Worth $412 Million by 2027

ATP Testing Market Worth $412 Million by 2027

CHICAGO, April 7, 2022 /PRNewswire/ — According to new market research report “ATP Testing Market By Product (Consumables (Kits, Reagents, Microplates), Instrument (Luminometer, Spectrophotometers)), Application (Contamination, Disease Testing, Drug Discovery), End User (Hospitals, Pharmaceuticals, Food Testing) – Global Forecast to 2027″, published by MarketsandMarkets™, the global market is…

[healthcare-market]

Luminometers Market Segmentation and Forecast Analysis up to 2024

Luminometers Market: Overview

Luminometers find popular use in lab work in range of biomedical research, and form a key part of diagnostic research in medical sciences. They are capable of handling large numbers of samples and produce easy-to-interpret results. The luminometers market has benefitted on the back of technological advancements in assay techniques. An example is the popularity of ATP bioluminescence in range of assays. Around the world, highly sensitive luminometers are getting internalized in automated laboratory workflows. They can be microplate or single-tube type, where the former is preferred in labs that need high-throughput results.

Read Report Overview: https://www.transparencymarketresearch.com/luminometers-market.html

The key applications areas in the luminometers market are ATP Determination, phagocytosis test, active enzyme measurement, immunoassays, aequorin-based calcium monitoring, reporter gene assays, DNA probe assays, and SNP determination.

The study offers a granular assessment of key industry developments, major clinical avenues, investments trends, and drivers and restraints of the luminometers market. The study also look at close quarters the key implications of COVID-19 and the impacts on the demand dynamic in various key markets. Also, the study highlights the how research on viral diseases in recent months has spurred the demand for high-end devices that top players in luminometers market are striving to meet in the last few months. The study also identifies new investment pockets that can offer an incredible momentum to the future expansion of the luminometers market.

Request a PDF Brochure - https://www.transparencymarketresearch.com/sample/sample.php?flag=B&rep_id=78048

Luminometers Market: Competitive Analysis and Key Developments

The competitive landscape has in recent years has shaped by the advent of cutting-edge devices in cell research. In the past couple years, automated highly sensitive microplate luminometers are witnessing notable development avenues in the luminometers market. A recent study has looked at harnessing the potential of high-end luminometers in performing reagent dispensing and bioluminescence measurement. The device showed its usability in ATP bioluminescence. Such studies are expanding the potential of biological sciences research.

Request a Sample of Luminometers Market: https://www.transparencymarketresearch.com/sample/sample.php?flag=S&rep_id=78048

The luminometers market is characterized by a moderate barrier to entry. And, new players are creating significant price pressure for incumbent well-established players. This will also spur competitive spirit among serious players in the market. Local players are playing a center stage in some developing regions.

Some of the well-entrenched players in the luminometers market are Bio Therma, Charm Sciences, 3M, Microtek, LabLogic Systems Ltd., Titertek-Berthold, Thermo Fisher Scientific, Promega Corporation, BMG Labtech, and Berthold Technologies. Top players are engaging in deals and partnerships to advance their value chain and consolidate their positions in the market.

Request for Analysis of COVID19 Impact on Luminometers Market - https://www.transparencymarketresearch.com/sample/sample.php?flag=covid19&rep_id=78048

Luminometers Market: Key Trends

Rising prospective demand for luminometers in the pharmaceutical industry has boosted the luminometers market. Growing investments in biomedical research and cell studies are reinforcing revenue potential. Growing popularity of high-sensitivity luminometers among the worldwide research community in analyzing cell-based studies has imparted a robust momentum to the growth of the luminometers market.

Easy to use interfaces and integrated assay chemistries have opened new avenues in the luminometers market. The growing demand for dedicated microplate luminometers has opened new avenues in various regions. Expanding awareness of the proper use of luminometers has boosted the demand for clinical expertise. This is stirring the adoption of high-end devices for various areas of biomedical and medical research.

Pre-Book Luminometers Market Report - https://www.transparencymarketresearch.com/checkout.php?rep_id=78048&ltype=S

Luminometers Market: Regional Analysis

Both the developing and developed worlds have witnessed the generation of remarkable revenue streams. In particular, the rapid pace of adoption of luminometers in biomedical research has catapulted North America as one of the prominent markets. Moreover, the advent of cutting-edge high-sensitive luminometers in the developing economies of the world has paved way to new avenues, such as in Asia Pacific.

More Trending Reports by Transparency Market Research:

https://www.prnewswire.com/news-releases/solutions-offered-by-software-product-services-companies-to-drive-telemedicine-market-to-us-109-43-bn-by-2027--says-tmr-301362599.html

https://www.prnewswire.com/news-releases/adoption-of-rpa-technology-to-outsource-manual-repetitive-tasks-to-drive-life-sciences-bpo-market-tmr-insights-301345998.html

https://www.prnewswire.co.uk/news-releases/increase-in-demand-for-treatment-of-venous-thromboembolism-to-boost-global-unfractionated-heparin-market-says-tmr-897429570.html

About Us

Transparency Market Research is a global market intelligence company providing global business information reports and services. Our exclusive blend of quantitative forecasting and trends analysis provides forward-looking insight for thousands of decision makers. Our experienced team of analysts, researchers, and consultants use proprietary data sources and various tools and techniques to gather and analyze information.

Our data repository is continuously updated and revised by a team of research experts, so that it always reflects the latest trends and information. With a broad research and analysis capability, Transparency Market Research employs rigorous primary and secondary research techniques in developing distinctive data sets and research material for business reports.

Contact

Transparency Market Research, 90 Sate Street, Suite 700, Albany, NY 12207 Tel: +1-518-618-1030 USA - Canada Toll Free: 866-552-3453 Website: https://www.transparencymarketresearch.com/

[reportsandddata]

ATP Assays Market Size, Share, Key Players, Growth Trend, and Forecast, 2021–2028

Reports and Data has recently published a market research report on global ATP Assays market comprising 100+ pages that provides an in-depth analysis of the market size, market growth, market share, key segments and sub-segments, top companies, current and emerging trends, drivers and restraints, opportunities, and forecast values up to 2028. The ATP Assays market research report is an investigative study that offers key insights into industry overview, key manufacturers and buyers, sales network and distribution channels, and financial standing.

The research offered by the ATP Assays report has been formulated through key analytical tools and extensive primary and secondary research further validated and verified by industry experts, industry professionals and analysts. The report includes SWOT analysis, Porter’s Five Forces analysis, feasibility analysis, and investment return analysis to impart better understanding of the ATP Assays market dynamics.

Thermo Fisher Scientific, Inc., Merck KGaA, Promega Corporation, Danaher Corporation, Geno Technology, Inc., PerkinElmer, Inc., Agilent Technologies, Elabscience, Inc., Abcam plc, Hygiena, Abnova Corporation, LLC, AAT Bioquest, MBL International Corporation, BioThema AB, Lonza Group, PromoCell GmbH, BioVision, Inc., Canvax Biotech S.L., Biotium, and Creative Bioarray are the renowned companies operating in the global ATP assays

Click Here to Access the Sample Report @ https://www.reportsanddata.com/sample-enquiry-form/3902

Key Highlights of the Report:

Based on product type, the consumables & accessories segment accounted for the largest market share in 2020. It is expected to continue its dominance throughout the projected period, mainly owing to the rising adoption of advanced ATP assays in the pharmaceutical and food & beverage industries.

Among the various end-users, the pharmaceutical & biotechnology companies segment is poised to acquire the highest market revenue in the coming years. The growth of this segment is attributed to the surging focus on drug safety, increased government investments in the pharmaceutical and biotechnology sectors for research purposes, and new drug development projects.

Of the key market regions, North America emerged as the leading regional segment in the global ATP assays market in 2020, retaining the highest revenue. North America’s market is predicted to grow substantially over the estimated period due to the region’s state-of-the-art healthcare infrastructure, increasing prevalence of chronic diseases like cancer, rising occurrence of contagious diseases, and a significant spike in the number of healthcare R&D activities.

Buy now @ https://www.reportsanddata.com/checkout-form/3902 For the purpose of this report, the global ATP assays market has been segmented based on product type, application, end-user, and region:

By Product Type (Revenue, USD Million; 2018-2028)

Instruments

Luminometers

Spectrophotometers

Consumables & Accessories

Reagents & Kits

Microplates

Others

By Application (Revenue, USD Million; 2018-2028)

Disease Testing

Contamination Testing

Drug Discovery & Development

Others

By End-user (Revenue, USD Million; 2018-2028)

Pharmaceutical & Biotechnology Companies

Academic & Research Institutions

Hospitals & Diagnostic Laboratories

Food & Beverage Industry

Others

Table of Content:

Chapter 1. Methodology and Scope

1.1. Market Segmentation & Scope

1.2. Market Definition

1.3. Information Procurement

1.3.1. Purchased Database

1.3.2. Internal Database

1.3.3. Secondary Sources & Third-party Perspectives

1.3.4. Primary Research

1.4. Information Analysis

1.4.1. Data Analysis Models

1.5. Market Formulation & Data Visualization

1.6. Data Validation & Publishing

Chapter 2. Executive Summary

2.1. Market Outlook

2.2. Material Type Outlook

2.3. Application Outlook

2.4. Regional Insights

Chapter 3. ATP Assays Market Variables, Trends & Scope

3.1. Market Introduction

3.2. Penetration & Growth Prospect Mapping

3.3. Industry Value Chain Analysis

3.3.1. Sales/Retail Channel Analysis

3.3.2. Profit Margin Analysis

3.4. Market Dynamics

3.4.1. Market Driver Analysis

3.4.2. Market Restraint Analysis

3.4.3. Industry Challenges

3.4.4. Industry Opportunities

Continue…

Enquire for customization in Report @ https://www.reportsanddata.com/request-customization-form/3902

Thank you for reading this article. You can also get chapter-wise sections or region-wise report coverage for North America, Europe, Asia Pacific, Latin America, and Middle East & Africa.

[lupine-publishers-lojpcr]

Lupine Publishers |he Anti-Inflammatory Activity of Ferulic Acid on NF-κBDepends on Keap1

Lupine Publishers | LOJ Pharmacology & Clinical Research

Abstract

Nrf2 and NF-κB are the two master transcriptional factors activated by different cellular signals turned to counteract the deleterious effects of pathological cellular processes linked to inflammation and oxidative stress.Several recent studies have highlighted a molecular connection between NF-κB and Keap1/Nrf2 pathways. The Keap1 protein seems to be the central player in this interaction, as it is involved in both IKKβ-NF-κB and Nrf2 modulation. Ferulic acid (FA) is a well-known antioxidant and antiinflammatory agent, able to relieveinflammatory response viaNF-κB/IKK kinase, but until now the complete molecular network under its action is not all clear. Immunoblot data conducted on LPS-treated macrophage-like RAW264.7 cells transfected with si- Keap1 show that the FA anti-inflammatory and modulatory effects on NF-κB are abolished. Luciferase assay conducted in human A549 cell line, in which Keap1 protein is partially inactive, highlights that NF-κB activation induced by LPS is refractory to FA inhibition. This study proved that Keap1 and IKK together are important modulators of NF-κB and their activity is essential for FA anti-inflammatory effectiveness.

Introduction

The process of inflammation leads to the onset of a state of oxidative stress and a series of cascade reactions that are associated with chronic diseases such as cancer, autoimmune disorders, and metabolic diseases [1]. NF-κB is the master transcriptional factor mainly involved in the activation of inflammation and immunity, whose excessive upregulation is associated with many human diseases, including inflammatory disease and cancer [2,3]. External pro-inflammatory stimuli activate NF-κB that induces the expression and the release of a set of inflammatory mediators such as IL-6, a pleiotropic cytokine contributing to switch the acute to chronic phase of inflammation [4,5]. NF-κB is mainly regulated by IKK kinase, which in presence of pro-inflammatory stimuli phosphorylates the inhibitory protein IkB, that dissociates from NF-κB with subsequent nuclear translocation [6]. Recently, many studies have highlighted the interaction between NF-κB/ IKK kinase and Keap1protein [7,8]. Our previous studies showed that Keap1 is a modulator both of Nrf2 and NF-κB pathways [9]. In physiological conditions, Keap1 maintains Nrf2 levels low. In conditions of oxidative stress, Keap1 is oxidized on the reactive cysteine residues and inactivated, so that Nrf2 moves into the nucleus. Nrf2 (nuclear factor erythroid2-related factor2), belongs to the basic leucine zipper (bZIP) transcription factor and heterodimerizes with small Maf proteins [10], and it is the primary player in the inducible cell defense system.

It binds to the promoter region of genes involved in redox regulation, proteostasis, DNA repair, prevention of apoptosis, iron and heme metabolism, and phase I, II, and III drug/xenobiotic metabolism [11]. The activation of this factor is controlled at the transcriptional and post-transcriptional level through the regulation of its stability, the post-transcriptional changes, and the availability of its binding partners [12,13]. In response to different stimuli, Nrf2 moves to the nucleus where it activates the transcription of its target genes, such as HO-1. Nrf2 is a modular protein presenting seven domains of homology to Nrf2-ECH (Neh), each of which performs a different function. In particular, the Neh2 domain binds Keap1 in the Kelch repeats [14]. In addition, Keap1 has five major domains: an N-terminal broad complex, tram track, and bric-a-brac (BTB) domain; a central intervening region (IVR) and a series of six C-terminal Kelch repeats.

The IVR and BTB domains are required for the redox-sensitive regulation of Nrf2 through a series of reactive cysteines. The 624 amino acids of murine Keap1 include 25 cysteines [15,16]. All cysteine residues are conserved and cysteines C257, C273, C288, and C297, located in the intervening region (IVR) domain, give Keap1 the molecular sensor able to respond to such a diverse array of chemical stimuli [17]. Early studies have identified IKKβ and Keap1 as the key drivers of inflammatory response [18,19]. IKK kinase is the main target of several anti-inflammatory molecules and kinase inhibitors are very effective in the control of many diseases [20-23]. In fact, LPS-signalling that is activated in macrophages via TLR4 involves a number of kinases. After binding to its receptor, the signal is transmitted by different adapter proteins: TIRAP (Tollinterleukin 1 receptor domain-containing adapter protein) and MyD88 (Myeloid differentiation primary response gene 88) driving the MyD88-dependent pathway, while TRAM (TRIF-related adaptor molecule) and TRIF (TIR-domain-containing adapter-inducing interferon-β) drive the MyD88-independent pathway.

The MyD88-dependent pathway converges into IKK (IκB kinase) and MAPK (Mitogen-activated protein kinases) activation and subsequent activation of NF-κB and activator protein AP- 1. In LPS-activated THP-1 cells, a human monocytic cell line, has been reported thanks to bioactive compounds such as flavonoids, hydroxycinnamic acids, tannins and in particular ferulic acid (FA), a hydroxycinnamic acid derivative, an effective inhibition of NF-κB activation as well as a decrease in the expression of proinflammatory cytokines TNF-α and IL-1β [24,25]. Furthermore, FA has a wide range of therapeutic effects like anti-inflammatory, antidiabetic, neuroprotective and hepatoprotective properties in others cellular models and in animals [26]. The present study carried out in RAW264.7 cells shows that the ferulic acid exerts its anti-inflammatory activity when Keap1 and IKK kinase are functionally active.

Materials and Methods

The mouse macrophage-like virus-transformed leukemia cell line RAW 264.7 was purchased from American Type Culture Collection (ATCC). RAW 264.7 cells and A549 cell line (provided by Francesca Sardina e Cinzia Rinaldo (IBPM-CNR, Roma, Italy) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% v/v heat-inactivated fetal bovine serum (FBS) and antibiotics (100U/ml penicillin and 100μg/ml streptomycin) at 37 °C in a humidified atmosphere with 5% CO2. FBS, DMEM, penicillin and streptomycin (10,000 U/ml) were purchased from GIBCO (Grand Island, NY). LPS from E. coli serotype O55: B5 and ferulic acid (FA; CAS Number: 537-98-4) were purchased from Sigma-Aldrich, Inc. (St. Louis, MO). TRIzol was purchased from Invitrogen. The Quanti Nova RT PCR kit and Quanti Nova Sybr Green PCR kit were obtained from Qiagen (Hilden, Germany). Nitrocellulose Blotting Membrane was purchased from Amersham Protran (Buckinghamshire, UK).

RT-Qpcr

RAW 264.7 cells were cultured (1 ×106 cells/well) in a 6-well plate overnight. Cells were treated with 100 ng/ml LPS or without (negative control) in the presence or absence of 100μM ferulic acid in DMEM supplemented with 10% bovine serum for 4 hours. Cells stimulated with 100ng/ml LPS for 4 hours served as a positive control. After such stimulation, the cells were detached from the wells and washed once with PBS. Total RNA was isolated with TRIzol according to the manufacturer’s instructions and was quantified by UV absorbance spectrophotometry and reverse transcribed with Quanti Nova RT PCR kit. QPCR was performed in triplicate on each cDNA sample for each gene:

IKK-β NM 010546 F:5’-GCCAGGGAGACTTGATGG-3’ R:5’- GAGGTCTGTGCTTTAGCTGCTT-3’ IL6 NM 031168 F:5’-GAGGATACCACTCCCAACAGACC -3’ R:5’- AAGTGCATCATCGTTGTTCATACA - 3’ HO-1 NM 0125082 F:5’ -GCGAAACAAGCAGAACCCA-3’ R:5’ – GCTCAGGATGAGTACCTCCCA- 3’ HPRT NM 194F:5′-GCTATAAATTCTTTGCTGACCTGCTG-3′ R: 5′-AATTACTTTTATGTCCCCTGTTGACTGG-3′

by using primers set Quantitect from Qiagen. The threshold cycle (CT) values were calculated against the housekeeping gene HPRT. At least three distinct biological samples were examined for each gene and treatment (each one performed in triplicate). The cycling parameters were set as 95 °C for 5min, followed by 40 cycles at 95 °C 15sec and 60 °C for 2-min. The expression was calculated by the 2-ΔΔCt.

Transfection and luciferase reporter assays

A549 cells (3 × 104 cells/well) were seeded in 96-well plates and allowed to adhere for 24 hours. The cells were then cotransfected with pKEAP1Vector, pIL-6FL and Renilla-Luc plasmids (Promega) using the Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After that, the cell culture medium was removed and replaced with fresh medium containing 100μM of FA for 1-hour, followed by co-incubation with 100ng/ml of LPS for 4 hours. Then, the cells were harvested, the luciferase activity was quantified by using the Dual-Glo Luciferase Assay System (Promega) and was normalised according to Renilla luciferase activity. The level of induction was calculated as the ratio of the normalised luciferase activity of LPS stimulated cells compared to non-stimulated cells and of association between LPS and FA compared to treatment with agents alone. Relative light units were measured in a GloMax 96 microplate luminometer (Promega).

Sirna transfection

The RAW264.7 cells (5×105 cells/well) were seeded in 6-well plates for 24 hours. Briefly, the siRNA pool for Keap1 (Qiagen) and NC-siRNA (Qiagen) were incubated with Lipofectamine RNAiMAX (Promega) in basal media with no serum or antibiotics and allowed to complex for 10 min at room temperature. Then, the complex was added to the cell suspension of each well (final siRNA pool concentration of 10nM). Finally, cells were incubated for 24 hours in a humidified incubator and then used for the analysis.

Western blotting

RAW 264.7 cells (1x107 cells) were cultured in 10-cm dishes (Falcon) and allowed to adhere for 24 hours. After treatment with FA 100μM 1 followed by co-incubation with LPS 100ngr/ml for 4 hours, the cells were washed twice with cold PBS and lysed in lysis buffer (10mM Hepes pH 7.9, 10mM KCl, 1.5mM MgCl2, 0.1mM EGTA pH 7, 0.05 mM DDT, and 1% protease inhibitor cocktail (SIGMA). After vortexing for 10s, the lysates were centrifuged at 1250g for 15min; the supernatants (cytoplasmic extract) were immediately transferred to a clean pre-chilled tube and put on ice. The pelleted nuclei were re-suspended in a hypertonic buffer (5% glycerol, 1.5mM MgCl2, 0.1mM EGTA, 0.05mM DTT, 0.4 M NaCl, 20mM PMSF and 10mM HEPES pH 7.9) and shaken for 60min at 4 °C. The proteins in the supernatants (nuclear extract) were collected by centrifugation at 20817g for 15min, then immediately transferred to a clean pre-chilled tube and put on ice. Whole cell lysates were obtained using RIPA buffer (Cell Signalling Inc. Beverly, MA, USA). The protein concentration of cell lysates was determined by the Bradford method.

An equivalent amount of protein (30μg) from whole or nuclear and cytoplasm fractions, respectively, was separated on 8-16% Tris-Glycine Gel (BioRad) gels by electrophoresis and transferred to a nitrocellulose membrane. The membranes were subsequently incubated for 1 h at room temperature with 3% BSA in TBS buffer (0.1% v/v) to block non-specific binding and incubated with an appropriate primary antibody in 1% BSA in TBST (tween 0.01% v/v). Antibodies polyclonal anti-mouse recognizing p-IKKα/β, IKKα/β, p65 NF-κB, lamin B1, Keap1, Nrf2, Histone H3 and betaactin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Incubation with the secondary antibodies Alexa Fluor 680 goat anti-rabbit (1:2000) and Alexa Fluor 800 rabbit anti-mouse (1:5000) (Molecular Probes, Life Technologies, Carlsbad, CA, USA) was performed for 1h at room temperature. Densitometry analysis was conducted using the Odyssey Infrared Imaging System (Li-COR Bioscience, Nebraska, USA).

Statistics

Statistical analysis and graphical presentation were performed using the statistical package GraphPad Prism Version 8 (GraphPad Software, Inc,USA). Data were expressed as mean ± SD and were evaluated using unpaired t-test calculator or one-way analysis of variance (ANOVA) for multiple comparisons. The differences were considered statistically significant when p values were <0.05.

Results

Keap1 silenced abolishes ferulic acid modulation on NF- κB-IKK pathway in LPS-treated RAW 264.7 cells

Our previous study [9] has proved that in Keap1- silenced RAW264.7 cells, the LPS treatment induced a higher proinflammatory cytokines mRNA expression compared with ncsiRNA transfected cells and moreover FA treatment resulted not able to reduce cytokines mRNA expression induced by LPS. Other authors [27] showed that depletion of Nrf2 induced the activation of NF-κB and a higher expression of TNF-α, IL-1β, IL-6 cytokines. In addition, it was reported that Keap1 is identified as an IKKβ interacting protein, involved in IKKβ phosphorylation [28]. To verify a potential Keap1 role in the FA modulation on NF-κB pathway, we analyzed by Western blot analysis NF-κB-IKK pathway in depleted Keap1 and FA-LPS treated RAW 264.7 cells. Cells were transfected with siRNAs for Keap1 and, after 24h, exposed to 100ng/ml LPS for 4h. One hour before LPS, cells were treated or not with 100μM FA, a known inhibitor of the NF-κB-signalling pathway in LPS-activated RAW 264.7 [29]. Cytoplasmic and nuclear extracts were prepared and analyzed in immunoblotting for the NF-κB p65. Figure 1A (panel a) shows that in Keap1-silenced and LPS-treated cells there is a significant increase of p65 in the nuclear fraction, compared to non LPS treated cells, and in accordance with our previous evidences [9], pre-treatment with FA does not decrease NF-κB translocation. In Figure 1A (panel b) is showed Western blot analysis of NF-κB pathway in nc siRNA transfected and FA-LPS treated RAW 264.7 cells, where FA is able to modulate p65 translocation also when LPS treatment occurs.

IKK kinase activates NF-kB pathway, so we analyzed whether Keap1 silencing had any influence on the kinase expression and activation. Total extract protein was prepared and analyzed in immunoblotting for IKKα/β. As reported in Figure 1B, when LPS treatment occurs, in the nc-siRNA transfected RAW264.7 cells, there is an increase of IKK level protein which decreases when cells were pre-treated with FA (p<0.0005). Instead, in the Keap1- silenced RAW 264.7 cells, neither LPS treatment nor FA have effect. QPCR analysis of IKKβ mRNA expression was conducted on total RNA extracted from Keap1 silenced and LPS treated RAW 264.7 cells. The results showed that IKKβ mRNA expression is lower (1,9-fold LPS vs C, p<0.0001) than the nc-transfected cells, where there is an increase of 8,4 fold LPS vs c (Figure 1C). These data indicate that Keap1-silencing has effect on IKKβ transcription and protein expression. Moreover, we investigated the Keap1 silencing influence on IKKα/β phosphorylation. The results are showed in Figure 1D: in nc-silenced and LPS treated cells, FA inhibits IKK phosphorylation (0,3fold FA+LPS vs 1,08 fold LPS), not such as in Keap1 silenced cells (1,8-fold FA+LPS vs 2 fold LPS). The results show that the Keap1 knockdown results in a much-altered IKK pathway modulation by FA.

 Ferulic acid is effectiveness on NF-κB activation in RAW 264.7cells Keap1 overexpressed

The overexpression of a specific protein is a common method for investigating the specific biological function and the mechanism of action. In order to confirm the data observed previously, we decided to over-express Keap1and to analyze the FA modulation on NF-κB/IKKβ activation. In our previous paper we described the FA effectiveness on inhibition of NF-κB activity [29]. We transfected RAW 264.7 cells with the expression vector for Keap1, let the cells grow for 24 hours, conducted the treatments as already described and extracted total RNA. IL6 is the major inflammatory gene under the NF-κB control, so to examine the effect of Keap1 overexpression on NF-κB modulation by FA, we analyze IL6 mRNA expression in LPS- treated and Keap1- overexpressed cells. Interestingly, FA reduces IL6 mRNA expression such as in RAW 264.7 transfected with pGEM-vector as control and LPS treated cells (Figure 2A). These results show that Keap1 overexpression does not alter neither the NF-κB activation neither the anti-inflammatory effect of FA. To confirm this result, we verify the p65 translocation occurring in LPS treated and Keap1 overexpressed cells in Figure 2A. We conducted an immunoblot analysis on proteins extracted from nuclear and cytoplasmic fractions. Figure 2B shows that LPS induces p65 translocation and FA-modulation occurs (0,5fold FA+LPS vs 6,8-fold LPS p<0.0001), unlike in Keap1 silencing cells. We have also analyzed IKKα/β phosphorylation. As showed in Figure 2C, in Keap1 overexpressed and LPS treated cells, FA is able to modulate IKK phosphorylation. The results show that the Keap1 overexpression does not alter the ferulic acid anti-inflammatory effect on NF-κb pathway.

  A549 cells a useful model to analyze FA effect on NF-kB activities

To confirm the results obtained by molecular approach by silencing the messenger for Keap1, we used A549 cell line. A549 is a lung carcinoma cell line that has an inactivating mutation on Keap1 allele, which translates into a protein with a minor binding capacity towards Nrf2 [30]. This cell line is a useful model to study Keap1 loss of functionality. We transfected A549 cells with pIL6- Luc, containing the IL6 promoter region and examined the effects of FA pre-treatment on luciferase activity and ferulic acid capability to alleviate inflammatory response via NF-κB pathway. Figure 3A shows that the up-regulation of luciferase activity LPS induced is not modulated by pre-treatment with FA (171fold FA+LPS vs 111fold LPS p<0.0001). Immunoblot for IKKα/β in Figure 3B shows that the effectiveness of FA is lost, in fact there is not a significant decrease of IKK protein level when LPS and FA treatment occurs. Moreover, to verify the level of Keap1 protein in A549 cells we conducted an Immunoblot on total proteins extracted from A549 treated or no with FA and LPS. Figure 3C shows that there are not significantly differences in Keap1 level in cells treated or not. These results follow the Keap1 silencing data indicate that Keap1and IKK are involved in the ferulic acid anti-inflammatory

  Ferulic acid maintains its anti-oxidant effectiveness on the Nrf2/HO-1 pathway modulation in Keap1silenced RAW264.7 cells

Nuclear transcription factor erythroid 2-related factor (Nrf2) is the most important transcription factor regulating the coordinated expression of antioxidant enzyme response such as Heme Oxygenase-1 (HO-1). Nrf2 resides in the cytoplasm by forming a complex with Keap1 that regulates its degradation by the proteasome. Our previous study carried out on LPS- treated RAW264.7 cells has shown that pre-treatment with FA determined a down-regulation of HO-1 protein [9]. Thus, to evaluate if FA maintains the antioxidant properties, also in altered Keap1 expression conditions, we analyzed the HO-1 expression in Keap1silenced RAW264.7 cells. As shown in Figure 4, FA down regulated the expression of HO-1 mRNA. These results indicate that FA maintains its antioxidant effect and the capability to modulate Nrf2 activity.

 Discussion

FA, a phenolic phytochemical found in many traditional Chinese medicines such as Angelica Radix and Chuanxiong Rhizoma, appears to be a potential therapeutic agent for treating various inflammatory disorders, although the molecular mechanism underlying the effectiveness is not entirely known. The pharmacological activity of FA in vascular endothelial cells is demonstrated, in fact, capable of inhibiting the expression of adhesion molecules in HUVECs [31]. Therefore, it was demonstrated that free and SLNs-loaded FA recover cell viability in neuroblastoma cells LAN5 [32]. FA treatment, in particular if loaded into SLNs, decreased ROS generation (Figure 5), restored mitochondrial membrane potential [Deltapsi(m)] and reduced cytochrome c release and intrinsic pathway apoptosis activation. In addition, FA modulated the expression of Peroxiredoxin, an anti-oxidative protein, and attenuated phosphorylation of ERK1/2 activated by Abeta oligomers. In our study highlight the Keap1 partnership in the molecular mechanism underlying the well-known anti-inflammatory effect of ferulic acid. Macrophage-like RAW264.7 stimulated by LPS was used in this study in that macrophages play vital roles in regulating inflammatory responses and LPS, the main component of the outer membrane of gram-negative bacteria, binding to the TLR4 receptor promotes inflammation [33]. Many data indicate that the molecular mechanisms underlying inflammation and oxidative stress are interconnected. NF-κB and Nrf2 are the main transcription factors on which a lot of antioxidant and inflammatory genes depend, but also tumorigenesis and apoptosis. There seems to be many the ways in which the two pathways interact, and Keap1 is one of the main [34]. Our results showed that Keap1 protein is the key point of the regulation carried out by FA on NF-κB pathway through IKK kinase. Recently, an ETGE motif (NQE36TGE39) similar to that of Nrf2 (DEE79TGE82) has been identified in IKKβ and so it is reasonable to suppose that Keap1 is an IKK modulator, regulating the ubiquitination and subsequent degradation [12,13,14].

 Moreover, our data highlight that Keap1is able to influence the transcription and protein expression of IKKβ, but the mechanism is not clear. In fact, in Keap1 silenced RAW264.7 cells it is observed a decreased IKKβ transcription and protein expression in RAW264.7 when LPS treatment occurs. Remarkably, Keap1 silencing does not inactivate NF-κB pathway, but the FA modulation is lost. In our previous study, we demonstrated that IKK is an upstream target of ferulic acid in LPS-induced NF-κB activation [29]. It can be hypothesized that Keap1 plays an important role in the NF-κB/ IKK modulation FA mediated. Yet, to confirm the data observed previously, we overexpress Keap1 in RAW264.7 cells and we analyze FA modulation on NF-κB/IKK pathway after treatment with LPS. Immunoblot data confirm that LPS stimulus activates NF-κB/ IKK pathway and FA modulation occurs.

Therefore, Keap1 and IKK kinase proteins are very important for the FA effectiveness. To confirm the results obtained by molecular approach by silencing the messenger for Keap1, we used A549 cell line to examine the biological effect of Keap1 protein mutation on the NF-κB/IKK modulation by FA. A549, in fact, is a lung carcinoma cell line that has an inactivating mutation on Keap1 allele, and the level of the Keap1 protein is the same in non-treated and LPS treated cells. In this cell line the Nrf2 pathway is dysfunctional, because the NRF2-Keap1interaction is altered [30]. The Luciferase assay data show that LPS induces up-regulation of IL-6 promoter in LPS and in FA+LPS treated cells. It is probable so the Keap1 evolvement in NF-κB/IKK FA-modulation. Recent results have revealed that the cysteine residues Cys-151, Cys-273 and Cys-288 have been identified as direct sensors of electrophiles and oxidants [17]. Keap1 acts as a molecular sensor of ROS, NO and oxidant species and the interaction with oxidizing species results in an activation signal towards Nrf2. Nrf2 is an important mammalian member of the CncC family, which has been studied in numerous cellular systems and represents an important target for drug discovery in different diseases. Nrf2 is distributed in the cytoplasm together with Keap1 normally [12,13,14]. Under oxidative stress, Nrf2 was released and migrated to the nucleus, inducing HO-1 expression. HO-1, an antioxidant enzyme in the stress response, catalyzing the degradation of heme, biliverdin, and carbon monoxide (CO), also plays a key role in inflammation and oxidation responses.

Our previous study showed that the pre-treatment with FA carried out on LPS-treated RAW264.7 cells determined a decrease of HO-1 protein level [9]. Until now there are not any data demonstrating IKK involvement in Nrf2 modulation, so to verify the FA effectiveness and IKK/Keap1 involvement we analyze the HO-1 expression in Keap1silenced RAW264.7 cells. The results showed that pretreatment with FA decreased HO-1 mRNA expression in Keap1silenced RAW264.7 cells. Therefore, the results obtained agree with Kim et al [28] who identified Keap1 as IKK interacting protein and highlight that the Keap1 protein underlie the FA effectiveness on NF-κB modulation. The network Keap1-Nrf2-NF-κB/IKKβ is very interesting: it has many implications, being involved in inflammation, chemoresistance and cellular homeostasis [16,17,18]. Further studies are necessary to clarify the role of Keap1 in the NF-κB/ IKKβ dialogue. Our results also show that the Keap1 is an attractive target for therapeutic purposes, especially to improve the efficacy of anticancer and antiinflammatory molecules.

 https://lupinepublishers.com/pharmacology-clinical-research-journal/pdf/LOJPCR.MS.ID.000133.pdf

https://lupinepublishers.com/pharmacology-clinical-research-journal/fulltext/the-anti-inflammatory-activity-of-ferulic-acid-on-nf-%CE%BAbdepends-on-keap1.ID.000133.php

For more Lupine Publishers Open Access Journals Please visit our website: https://lupinepublishersgroup.com/ For more Pharmacology & Clinical Research Please Click Here: https://lupinepublishers.com/pharmacology-clinical-research-journal/ To Know more Open Access Publishers Click on Lupine Publishers

Follow on Linkedin : https://www.linkedin.com/company/lupinepublishers Follow on Twitter   :  https://twitter.com/lupine_online

[labotronicsscientific]

Microplate Luminometer

Labotronics microplate luminometer is a semi-automatic luminescence measuring unit.It effectively analyze multiple sample simultaneously placed in parallel grids on microplate. It can test the luminescence under wavelength range 300nm~650nm and measures in a range 0~2.0 × 10^7 RLURLU through counter type photomultiplier tube efficiently .It provides complete configuration flexibility to set parameters as per requirements and highly efficient optics for detecting low-intensity luminescent signals accurately

for more visit labotronics.com

[nickyhants]

The new luminometer selection guide is now available on our website (link in bio - see products and microplate readers section) to help you find the right plate reader for your lab. The GloMax® line includes high-performance plate readers with a range of detection options, from advanced multimode luminescence, fluorescence, absorbance, BRET and FRET capabilities to dedicated microplate or single tube luminometers. . . . #LabChat #LabWares #LabWork #platereader #luminometers #Laboratorywork #ilovescience #instascience #scicomms #LabLife #researchers #science #biology #scientists #biologists #Promega #PromegaUK #assays #protocols #photocounting #photomultipliertube #fluorescence #luminescence #scienceisawesome #bioluminescent #assay #cellhealth https://ift.tt/30JapEv

[rainyducktiger]

Microplate Luminometer Market Size Share and Demand Analysis to 2033

The microplate luminometer market is experiencing significant growth, driven by advancements in research, diagnostics, and the increasing need for precise, high-throughput analysis. These instruments are essential in detecting and quantifying low-light signals from chemiluminescent and bioluminescent reactions, enabling researchers to explore various biological processes such as enzyme activity, cell proliferation, and gene expression. The market's expansion is attributed to technological innovations, rising applications in drug discovery, and the growing demand for personalized medicine.

Market Overview

As of 2023, the global microplate luminometer market is valued at approximately USD 0.6 billion and is projected to reach USD 0.83 billion by 2031, registering a compound annual growth rate (CAGR) of 4.02% during the forecast period. citeturn0search4 This growth is propelled by the increasing adoption of microplate luminometers in various applications, including drug discovery, chemical kinetics, quality control, toxicology, and bioassay validation.

𝗗𝗼𝘄𝗻𝗹𝗼𝗮𝗱 𝗮 𝗙𝗿𝗲𝗲 𝗦𝗮𝗺𝗽𝗹𝗲 𝗥𝗲𝗽𝗼𝗿𝘁👉 https://tinyurl.com/y3puuy94

Key Market Drivers

Technological Advancements: Continuous innovations have led to the development of more sensitive and accurate microplate luminometers. Modern devices offer enhanced detection capabilities, improved user interfaces, and integration with advanced software for data analysis, making them indispensable in research and clinical settings.

Expanding Applications in Drug Discovery: Microplate luminometers are crucial in high-throughput screening assays, facilitating the rapid identification of potential drug candidates. Their ability to provide precise and reproducible measurements accelerates the drug development process.

Rising Demand for Personalized Medicine: The shift towards personalized medicine necessitates detailed understanding of individual biological responses. Microplate luminometers aid in analyzing specific biomolecular interactions, thereby supporting the development of tailored therapeutic strategies.

Growth in Biotechnology and Pharmaceutical Industries: The expansion of these industries has increased the demand for advanced analytical instruments. Microplate luminometers are extensively used in quality control and research activities, ensuring product efficacy and safety.

Market Segmentation

The microplate luminometer market can be segmented based on type, assay type, application, end-user, and region.

By Type:

Single-mode Microplate Luminometers: Designed for specific luminescence measurements, offering high sensitivity for dedicated applications.

Multi-mode Microplate Luminometers: Versatile instruments capable of performing multiple detection modes, including fluorescence and absorbance, in addition to luminescence.

By Assay Type:

Glow-type Luminescence Assays: Characterized by a steady light emission, suitable for continuous monitoring.

Flash-type Luminescence Assays: Involve a rapid burst of light, requiring instruments with fast detection capabilities.

Glow and Flash-type Luminescence Assays: Combine features of both, offering flexibility for various experimental needs.

By Application:

Drug Discovery: Utilization in screening potential therapeutic compounds.

Chemical Kinetics: Studying reaction rates and mechanisms.

Quality Control and Toxicology: Ensuring product safety and compliance.

Bioassay Validation: Confirming the accuracy and reliability of biological assays.

By End User:

Research Laboratories: Academic and commercial labs conducting fundamental and applied research.

Academic and Research Institutions: Universities and institutes focusing on scientific studies.

Biotechnology and Biochemistry Companies: Firms engaged in biotech product development and biochemical analyses.

Food and Beverage Industries: Utilizing luminometers for contamination detection and quality assurance.

Regional Insights

North America: Holds a significant share of the microplate luminometer market, attributed to well-established biotechnology and pharmaceutical sectors, along with substantial investments in research and development.

Europe: Demonstrates steady growth due to the presence of prominent research institutions and a focus on technological advancements in life sciences.

Asia-Pacific: Expected to witness the fastest growth, driven by increasing healthcare expenditures, expanding pharmaceutical industries, and rising emphasis on research activities in countries like China and India.

Latin America and Middle East & Africa: These regions are gradually adopting advanced analytical instruments, with growth supported by improving healthcare infrastructure and increasing research initiatives.

Competitive Landscape

The microplate luminometer market is characterized by the presence of several key players focusing on product innovation, strategic collaborations, and geographic expansion to strengthen their market position. Notable companies include:

Promega Corporation: Offers a range of luminometers known for their sensitivity and versatility, catering to various research needs.

Tecan Trading AG: Provides advanced microplate readers with luminescence detection, emphasizing automation and high-throughput capabilities.

Berthold Technologies GmbH & Co. KG: Specializes in high-performance luminometers designed for both routine and specialized applications.

Thermo Fisher Scientific: Offers a diverse portfolio of microplate luminometers, integrating cutting-edge technology for enhanced performance.

Luminex Corporation: Focuses on developing innovative solutions for multiplexed assays, including luminescence-based detection systems.

Future Outlook

The microplate luminometer market is poised for continued growth, driven by ongoing technological advancements and expanding applications across various sectors. The increasing focus on personalized medicine and the need for high-throughput screening methods are expected to further propel market expansion. Manufacturers are likely to invest in research and development to introduce more sophisticated, user-friendly, and cost-effective instruments, catering to the evolving needs of end-users.

In conclusion, the microplate luminometer market presents a dynamic landscape with promising growth prospects. Stakeholders, including manufacturers, researchers, and investors, should closely monitor technological trends and application developments to capitalize on emerging opportunities in this field.

Read Full Report:-https://www.uniprismmarketresearch.com/verticals/healthcare/microplate-luminometer.html

[fmihealthcare-blog]

Microplate Luminometer Market 2018 - 2028: Analysis by Application and Geography with Top Industry Leaders

Microplate luminometer are used to detect luminescence assay that are chemical and enzymatic reactions. These reactions uses a substrate and each time a substrate is acted upon, a luminescence is produced which can be detected and measured by microplate luminometer. Microplate luminometer are used for variety of quality check experiments, for example, microplate luminometers measure the amount of ATP in water sample which gives an estimate about the presence of microbes in the sample. Gene expression studies and protein-gene or protein-protein interactions are precisely studied with microplate luminometers. Differential gene expression in identified infectious disease or cancer hold a promising applications for microplate luminometers. Microplate luminometers are also used for quantitative verification and validation of biomolecules or chemical substances.

Microplate Luminometer Market: Drivers and Restraints

Microplate luminometers finds applications in various biochemical, pharmaceutical, environmental and biotechnological sectors which lure manufacturers in the microplate luminometer market. Increasing biotechnology and biochemical research along with increasing increased research and development expenditure by government and manufacturers is expected to propel the growth of microplate luminometer in the market. Advancing technology and developing biotechnological and pharmaceutical sector is estimated to further fuel the demand for modified and next-gen microplate luminometer in market. Microplate luminometer is anticipated to play a role in personalized medicine, genetics study and cancer research which will promote the drive of microplate luminometer market even more over the forecast period. Rising demand for other assay quantifier devices such as fluorescence microplate reader, microplate absorbance reader, etc. pose a threat for the growth of microplate luminometer market.

Microplate Luminometer Market: Segmentation

Tentatively, the global microplate luminometer market has been segmented on the basis of treatment type, distribution channel, and geography.

Based on component, the global microplate luminometer market is divided into following:

Multimode

Single mode

Request Sample Report @ https://www.futuremarketinsights.com/reports/sample/rep-gb-8418

Based on assay type, the global microplate luminometer market is divided into following:

Glow Type Luminescence

Flash Type Luminescence

Glow and Flash Type Luminescence

Based on application, the global microplate luminometer market is divided into following:

Drug Discovery

Chemical Kinetics

Quality Control and Toxicology

Bioassay Validation

Others

Based on end users, the global microplate luminometer market is segmented as below:

Research Laboratories

Academic Research Institutions

Biotechnology and Biochemistry Companies

Food and Beverage Industries

Microplate Luminometer Market: Overview

The global market for microplate luminometer is expected to experience fast growth due to increasing demand and adoption of the device by end users. The global microplate luminometer market is segmented into single mode and multimode with respect to product type. Multimode microplate luminometer is expected to register maximum market share in the terms of revenue owing to the additional features incorporated and being suitable to a wide range of samples. On the basis of assay, the global microplate luminometer is segmented into glow type luminescence, flash type luminescence and glow and flash type luminescence, out of which glow and flash type luminescence microplate luminometer is estimated to grow with highest CAGR over the forecast years. As per application, the market is divided into drug discovery, chemical kinetics, quality control and toxicology, bioassay validation and others. According to end users, the global microplate luminometer market is categorized into research laboratories, academic research institutions, biotechnology & biochemistry companies and food and beverage industries. Amongst end users, biotechnology & biochemistry companies are expected to contribute highest revenue during the forecast time.

Microplate Luminometer Market: Regional Wise Outlook

Geographically, global Microplate Luminometer market is classified into regions viz. North America, Latin America, Western Europe, Eastern Europe, Asia-Pacific excluding Japan (APEJ), Japan and the Middle East & Africa (MEA). North America is expected to be the leader in global microplate luminometer market owing to the presence of high demand from the end users. Western Europe microplate luminometer marker is expected to register second highest share owing to the increasing adoption of the device and greater expenditure for biological and pharmaceutical research and developmental. The microplate luminometer market in Asia Pacific excluding Japan is expected to expand at good CAGR due to increasing number of end users and presence of manufacturers. MEA microplate luminometer market is expected to register slow growth because of stagnant development in biochemical and therapeutic research.

Request to View TOC @ https://www.futuremarketinsights.com/toc/rep-gb-8418

Microplate Luminometer Market: Key Players

Some of the major players identified in the global microplate luminometer market are Promega Corporation, Tecan Trading AG, Danaher Corporation, Berthold Technologies GmbH & Co. KG, Thermo Fisher Scientific, Meril Life Sciences Pvt. Ltd., Luminex Corporation, STRATEC SE, SAFAS and MicroDigital Co., Ltd.

[amanjadejablog]

Microplate Luminometer Market Trends Analysis by 2023 – by Application, by End-Use Industry

Worldwide Microplate Luminometer 2019 Research Report presents a professional and complete analysis of Global Microplate Luminometer Market on the current situation.

Download FREE Sample Brochure @ https://www.marketgrowthinsight.com/sample/5786                                 

The market intelligence report focuses primarily on the market size, share and growth rate of the industry during the estimated period with the aim to help business owners make a wise investment decision and chalk out a blueprint of profitable business strategies. Apart from this, the valuable document weighs upon the performance of the industry on the basis of a product service, end-use, geography and end customer.

A high focus is maintained on factors such as demand and supply, production capacity, supply chain management, distribution channel, product application and performance across different countries. The report not only offers hard to find facts about the trends and innovation driving the current and future of Microplate Luminometer business, but also provides insights into competitive development such as acquisition and mergers, joint ventures, product launches and technology advancements.

Purchase Microplate Luminometer Market Research Report@ https://www.marketgrowthinsight.com/checkout/5786

Region wise performance of the Microplate Luminometer industry

This report studies the global Microplate Luminometer market status and forecast, categorizes the global Microplate Luminometer market size (value & volume) by key players, type, application, and region. This report focuses on the top players in North America, Europe, China, Japan, Southeast Asia India and Other regions (Middle East & Africa, Central & South America).

Microplate Luminometer Market Report Highlights:

1.Detailed overview of parent market. 2.Changing market dynamics in the industry. 3.In-depth market segmentation. 4.Historical, current and projected market size in terms of volume and value. 5.Recent industry trends and developments. 6.Competitive landscape. 7.Strategies of key players and products offered. 8.Potential and niche segments, geographical regions exhibiting promising growth. 9.A neutral perspective on market performance.

Report holds answers to important questions:

What will be the estimated market size and the growth rate of the Microplate Luminometer for the forecast period, 2019 – 2023?

What are the major driving forces shaping the progress of the Microplate Luminometer market worldwide?

Who are the key industry players dominating the Microplate Luminometer industry and what has been their performance status so far?

What are the major trends and challenges that have influenced the growth of the Microplate Luminometer market across different regions?

What type of opportunities can the major market players bank on for the forecast period, 2019 – 2023?

View Full Report @ https://www.marketgrowthinsight.com/5786/microplate-luminometer-market

About us : Market Growth Insight is a one stop solution for market research reports in various business categories. We are serving 100+ clients with 10000+ diverse industry reports and our reports are developed to simplify strategic decision making, on the basis of comprehensive and in-depth significant information, established through wide ranging analysis and latest industry trends. Contact us : 502, Sai Radhe, Kenedy Road, Behind Hotel Sheraton Grand, Near Pune Station, Pune-411001, Maharashtra, India. sales@marketgrowthinsight.com + 91 8956 049 020

Connect With Us : Twitter | Linkedin | Facebook | Google+

from WordPress https://ift.tt/2JnS0qI via IFTTT

[americajobsnet]

[Full-time] Blood Analyzer Repair Technician - Baltimore, MD at Jobisite

Location: Maryland URL: www.jobisite.com Description: Looking to hire candidates with experience servicing Abaxis, Abbott, Bayer, Beckman, Becton Dickinson, Biomerieux, Mindray, NovaBio, Drucker Co, T2Biosystems, OR Thermofisher blood analyzers, including installation and repairs as needed. Activities: Conduct equipment testing and validation in prior to installation in customer facilities. Author Standard Operating Procedures, training manuals, and service guides, and provide training to client operators regarding equipment operation and basic troubleshooting. Perform preventative maintenance, and respond to service calls to troubleshoot and make repairs as necessary. Document and communicate to Management recurring technical problems and equipment failures, and make recommendations for product improvements or enhancements. Should have experience with some of the following subcomponents: Fittings, Bearings; Pistons; Rotors; Gear Drives; Mounting Plates, Filters; Microplates & Pipettes; Reaction Wells; Valves; Sensors; Storage Tanks; Reaction Chambers; Micro-Fluid Pumps; Vacuum Pumps; Cameras; Stepper Motors; Motor Drives; Servo Drives; Linear and Rotating Actuators; Heaters; Thermisters; Chillers; Incubators; Fluid Reservoirs; Fluid Dispensers; Reagent Dispensers: Aspirators: Mixers; Injectors; Vibrators; Conveyors; Shakers; Spinners; Centrifuges; Probes; Bioreactors; DC Power Supplies; Control Boards; Image Processors; Photo Multipliers: Signal Processors & Transmitters; Digital Displays; Automatic Wash Systems; Automatic Suction Systems; Metering Systems; Reflectometers; Spectrophotometers; Chromatographs; Microscopes; Cytometers; Luminometers; Potentiometers; Magnetic Resonance Systems; Radiographs; Integrated Dry and Wet Chemistry Systems; PCR Systems; Sample Supply; Reagent Supply; etc. Generous base + overtime comp and bonus program for technicians who limit equipment failure and malfunctions in the field. Call on your years of experience and allow for earnings potential in excess of 6 figures as well as employee benefits including Medical, Dental, Health and others. For complete details contact James Franco at: (609) 584-9000 ext 283 Or, submit resume online at: dmc9.com/jef/app.asp Or email to: 1000038653_10007335 AT jobbank301.com Please reference #38470365 when responding. Education Requirements: Some College Minimum Experience Requirements: 2-5 years Job City Location: Baltimore Job State Location: MD Job Country Location: USA Salary Range: $70,000to $120,000 Diedre Moire Corporation, Inc. Diedremoire_dot_com WE ARE AN EQUAL OPPORTUNITY EMPLOYER and our employment decisions are made without regard to race, color, religion, age, sex, national origin, handicap, disability or marital status. We reasonably accommodate individuals with handicaps, disabilities and bona fide religious beliefs. Jobs Career Position Hiring. CONSIDERED EXPERIENCE INCLUDES: Field Service Technician Application Specialist FSE Installations Repair Field Service Engineer Blood Chemistry Analyzers Albumin Analyzers, Automated Biochemical Analyzers, Blood Gas Analyzers, Automated Blood Gas Systems, Blood Bank Systems, Blood Lactate Testers, Clinical Chemistry Analyzers, Hemoglobin Analyzers, Hematology Analyzers, Hemostasis Analyzers, Immunoassay Analyzers, Immunochemistry Analyzers, Blood Glucose Analyzers, Blood Component Separators, Coagulometers, Centrifuges, Blood Cell Counters #DiedreMoire #FieldServiceJobs #DiagnosticAnalyzers #JobSearch #JobHunt #JobOpening #Hiring #Job #Jobs #Careers #Employment #jobposting DISCLAIMER: We will make every effort to consider applications for all available positions and shall use one or more of the contact methods and addresses indicated in resume or online application. Indicated location may be proximate or may be desirable point of embarkation for paid or unpaid relocation to another venue. Job descriptions may fit single or multiple presently available or anticipated positions and are NOT an offer of employment or contract implied or otherwise. Described compensation is not definite nor precise and may be estimated and approximate and is negotiable depending on market conditions and candidate availability and other factors and is solely at the discretion of employers. Linguistics used herein may use First Person Singular and First Person Plural grammatical person construction for and with the meaning of Third Person Singular and Third Person Plural references. We reserves the right to amend and change responsibilities to meet business and organizational needs as necessary. Response to a specific posting or advertisement may result in consideration for other opportunities and not necessarily the incentive or basis of the response. Nothing herein is or may be considered a promise, guarantee, offer, pledge, agreement, contract, or oath. If you submit an application or resume which contains your email address, we will use that email address to communicate with you about this and other positions. We use an email quality control service to maintain security and a remove and dead address filter. To cancel receiving email communications, simply send an email from your address with the word "remove" in the subject line to pleaseremove_AT_candseek4.com Or, visit the website at jobbankremove_dot_com. If you have further concern regarding email received from us, call (609) 584-5499. Reference : Blood Analyzer Repair Technician - Baltimore, MD jobs Apply to this job from America Jobs http://www.america-jobs.net/job/29637/blood-analyzer-repair-technician-baltimore-md-at-jobisite/