#4. silly string

[mo-ok]

ok. fine.

BUT THEN WE GET UNIQUE HENSHIN FOOTAGE TO MAKE SURE HE WAS STILL COVERED IN SILLY STRING

i admire the commitment ngl

[nova-rpv]

could you draw hyper knuckles with a ponytail? I love fanart of him with his hair tied back

ill do you one better: string worm hyper knuckles with a ponytail

hope you enjoy this silly echinda, echidna enjoyer

[ncttcday]

have plans to go to a friend’s house to make olivia themed friendship bracelets but don’t feel like going </3

[s0dium]

𝐌𝐀𝐑𝐀𝐓𝐇𝐎𝐍 𝐒𝐄𝐗

A/n: Almost kinktober guys ;) Synopsis: How many rounds can JJK men go for? Characters: Gojo Satoru, Toji Fushiguro, Geto Suguru, Choso, Sukuna Ryomen Warnings: Doggy, mating press, multiple orgasms, sub space, overstimulation, dub-con, photo taking, cock warming, nipple sucking, finger sucking, breeding, unprotected sex, virgin!Choso, mentions of masturbation, pussy drunk men

☆ Gojo Satoru: 3-4

The longest three rounds of your life

You think he can stop just cumming in you once? Hell no. The best part about sex is when he can see his cum oozing out of you with each push.

Also loves overstimulating himself until he is a groaning mess.

Unfortunately for you, Gojo Satoru is NOT a one-minute man.

"Awe come on don't go zoning out on me now~"

Gojo's voice is teasing, a low, melodic coo that slides into your ears as you struggle to focus. His grin is wide, almost predatory, his blue eyes twinkling with amusement as he leans in closer. You’re hazy, breathless, your mind clouded with pleasure, barely able to register the words.

"S'cant... feel too...” You mumbled and thrashed against Gojo's hold, forcing him to pin your wrists together above your head while he pistoned into you with brute force. Sure it's only the second round for him but for you, he's brought you over the edge more than your poor poor body can handle.

Your body feels completely spent, trembling with overstimulation as your legs, sore from the constant tightening and untightening, hang limp in Gojo's grip. He’s folded you in half, his hands pressing your legs against your chest, locking you in place with ease. The room feels heavy, a warm haze clouding your thoughts as you realize you’ve been drooling, too lost in the overwhelming pleasure to even care.

“Feel fucking amazing Jesus Christ.” Gojo manages to groan out between pants followed by a string of curses. Every time he leaves the clutch of your cunny, his cock is coated in a thick shiny sheen of creaminess, and when he snaps his hips back in, it settles right at the base of him, painting your puffy pussy lips as well. Gojo effortlessly lifts one of your legs over his shoulder, sinking even deeper into you with each forceful thrust. The new angle, paired with the relentless pace of his hips snapping against yours, sends you spiraling dangerously close to the edge. Your grip on the sheets falters, hands slipping as tears streak down your flushed cheeks. Your mouth hangs open, drool pooling beneath you, completely mind-fucked and overwhelmed by the pleasure that consumes every inch of your body.

Your limbs have no strength left to resist—no, you don’t want to. Every nerve in your body is thrumming, begging for more as you let him take control. His every movement draws out a fresh wave of sensation, each thrust sending you spiraling closer to that next high. You can’t stop it—there’s no chance to. Your body is his to use, to pull pleasure from again and again, and all you can do is surrender to the bliss as it builds, crashing over you uncontrollably.

"Come for me baby," Gojo coos. "I'll cum in you and if it spills we can start all over again."

~

☆ Toji Fushiguro: 6

First three you are riding him and doing all the work.

Then when your legs give out thats even he fucks you silly

He is so big :( Sometimes he has to let you cock warm him for a bit so you can catch your breath

This is it you where going to die.

You were going to be fucked to death.

"Shhh, stop crying would you? Yer' taking it like a champ I promise."

Two big hands come up to your face to wipe the hot tears streaming down your face. Your body is trembling uncontrollably, every muscle quivering as waves of pleasure leave you numb and overwhelmed. It’s like your senses have short-circuited, leaving you shaking, barely able to register anything beyond the intense, lingering sensation pulsing through you.

Even though Toji is unmoving inside you, your pussy cannot stop spasming from the pleasure of his fat tip pressed up against your g-spot. Even if he wanted to pull out right now, Toji doubts that your cunt would give up the vice grip on his cock. Coincidentally that meant that he was keeping you plugged with 3 loads of warm sticky cum in your tight walls.

"Fuck still so tight baby, you want me to fuck you more don't you?" Toji's voice is a low, teasing coo as his focus shifts to your breasts, his tongue flicking over each hardened nipple, tracing slow, lazy circles that send shivers down your spine. One hand squeezes your breast, kneading the soft flesh, while the other glides over your sides and stomach, his touch warm and deliberate, drawing out every sensation. With all the strength you can muster, you wrap your legs around his waist pulling him closer to you so that you can feel his cock push impossibly farther into you, and he moans into your breast, biting your nipple softly. 

Then, without releasing your nipple from his mouth, he begins the slow roll of his hips into your sloppy cunt. Toji's hips move in a slow, deliberate rhythm, each roll pressing him deeper into you with a tantalizing, unhurried pace. His movements are controlled, almost teasing, as he grinds against you, making you feel every inch, every pulse of his dick as he draws out your pleasure with each smooth thrust.

"Just take it m'kay? You can handle it."

~

☆ Geto Suguru: 4

Geto is a real fiend

The breaks between sex consist of him drinking water and kissing the water into your mouth. After that it's right back to fucking.

Loves taking photos of his cum oozing out of you. Looks at it when he is bored.

“So pretty….”

Drool dripped from your chin onto the pillow below, mixing with the tears streaming from your eyes, which were rolled back in bliss. Your breath hitched the moment Geto's hand tightened in your hair, pulling your head back just enough to catch his gaze out of the corner of your eye. As your eyes lock, a dark, knowing smirk curves on his lips, sending a shiver down your spine. You were finally getting used to the dizzying, mind-numbing pressure of his tip crashing into your cervix—but the bad news? Your legs were completely numb, trembling and useless beneath you.

 “Did you hear what I said doll?”

 Whatever was left of your mind tried to reign back its focus on the man pistoning into you from behind, but as it turned out, there wasn’t much. The friction of his cock dragging against you was unbearable, even with the syrupy cum soaking the walls of your quivering pussy. All you could do was dizzily nod, earning a chuckle from Geto while he eyes the way your hips instinctively raise so his cock can sink even deeper into you from behind. If you could only know the heaven your cunt you're putting his mind in, he is sure you'd be the one smirking. Geto even has to bite harshly on his lip to stop himself from whimpering every time your sticky pussy spasms from pleasure.

The euphoria came in waves of electric current that pulsed through your sloppy pussy and the only thing keeping you grounded his loads of warm sticky cum dripping down your thigh.  

 “Come on speak to me baby, I've only come two times, we've barely even started.”

 The wet sounds of Geto's dick slipping in and out of you filled the room and your senses. His cock filled you so much better than your hands ever could, hitting that gummy spot inside your walls over and over again perfectly, and you wondered how you were ever satisfied with the way you masturbated before you met him.

 “I’m a lucky man arent I? To have such an obedient baby with such a pretty pussy.” His hand comes to your face to caress your cheek, and you nestle into his touch while his thumb wipes away your tears. Your too busy immersing in the warmth of his palm to notice the flash of light and the sound of a shutter above you. Even when you turn your head back in curiosity, all you see is Geto staring at the screen of his phone with a lazy grin spread on his face.

~

☆ Choso: 2

Give this man a break! He's a half century old curse who has never fucked before!

You should be glad that he didn't cum by just slipping his tip in, because oh god lord he is seeing colors.

Choso swore he wasn't a whimpering man. Nothing that good could ever make him stumble over his words like a schoolboy. But Jesus Christ, he was not expecting you.

“F-fuck, you’re tight,” Choso groans hoarsely. You felt good? Try god-like, Choso's mind was in euphoria right now. His hand or a fleshlight could never compare to the way your gummy walls sucked him in and hugged his cock.

"M'feel good Cho~" You whine, head thrown back against the plush pillow. The stretch was delicious. It had you squirming and writhing and you couldn't help but tighten as your body tried to push out the large foreign intrusion. You gasped when you felt his tip smush against your cervix, little bolts of electricity being sent through your stomach as he pressed against you.

Choso was slow at first, wanting to still admire the way your cunt swallows him up, the fat of his head has a hard time popping out with how greedy your cunny is being. He whines at how hot you are on the inside, but he’s quick to change to a faster pace.

Choso’s voice comes out in a deep, breathless groan, his grip tightening as he leans closer, his words heavy with need. "W-wanna do this all the time. Every day, baby," he rasps, his eyes half-lidded in pleasure, completely lost in the sensation. Each thrust seems to pull the words from his lips as if he can’t hold back, his body trembling with how good it feels. The thought of having you like this, over and over, only spurs him on, his pace quickening as he grinds against you, desperate to make this moment last forever.

Unable to handle the sensation, your hands grab his shoulder and grip them for dear life. Choso doesn’t let up his pace, in fact he increases it, pounding your poor little cunt with no remorse. His mind is foggy, everything just feels and looks so so good, he’s not even thinking when he shoves his fingers in your mouth, digits pressing down on your tongue and swirling around in the spit.

“Your gonna let me use you when ever I want right? Gotta lot of time to make up for, you gonna be a good girl and always make me feel good right?”

~

☆ Sukuna Ryomen: Lord have mercy

It depends.

Its either the longest no-break sex marathon of your life or 6 even seven rounds with small breaks in between.

Unfortunately, Sukuna is a sadist, it's a headcanon that he might prioritize his pleasure over yours. Combine that with his godly stamina and you have an insane combo.

Kneeling helplessly, both your wrists pinned behind you by just one of Sukuna’s powerful arms, you can only brace yourself as he thrusts into you from behind, each powerful movement sending shockwaves through your body as he effortlessly controls your every breath, your every tremble.

"C-cant do this!" you cry, your voice breaking as Sukuna's grip tightens around your wrists, holding you firmly in place. Your legs are sore from this kneeling position and the angle that his cock hits you is so euphoric it's almost painful from the sheer collision. Sukuna chuckles darkly, his pace relentless as he leans in closer, his hot breath ghosting over your neck.

"Oh, but you will," he growls, each word dripping with wicked amusement, his hips driving into you harder. "You don’t have a choice."

You can only wail in response, the sound escaping your lips uncontrollably as the overwhelming pleasure consumes you. Every thrust sends a wave of heat surging through your body, your mind going blank as Sukuna fills you completely, each movement pushing you closer to the edge. The pressure builds with each deep, forceful stroke, your body trembling beneath him, and all you can do is surrender to the intense, all-encompassing bliss that threatens to pull you under.

"Such a good girl, you're a natural submissive, aren't you? Or maybe you just loved being fucked like the slut you are."

How much time has passed? You can’t even tell anymore—everything blurs together in a haze of pleasure and heat. The rhythm of Sukuna’s relentless pistoning becomes the only thing grounding you, your mind foggy and lost as your body responds to him instinctively. Each second feels stretched out, an eternity of raw sensation as you teeter on the brink, utterly consumed by the moment.

"Gonna fuck you like this till I’ve had my fill, got that?" Sukuna’s voice is a low, dangerous growl in your ear, the words sending a shiver down your spine as he presses deeper.

[phosphoenolpyruvat]

"Closest match: Saxifraga rosaceawait how did you do that. what the fuck"

string detected: ctatcaagaacaattatattc

get aligned, nerd!

took less gaps than i anticipated

Material and Methods

Fresh material used:

DNA-Number: 1 Taxon: Gimmick post Tumb. Origin: Internet, Tumblr, hellsitegenetics

GenBank accession numbers for ITS sequences published in previous works used in this post.

Saxifraga rosacea Moench, AF261190.1

Methods:

Geneious Pro 4.8.3 (https://www.geneious.com)

you know what? no! *sanger sequences you and aligns you with a sequence of saxifraga rosacea no matter how many gaps i have to add between singular bases*

String identified: t g c g a a g. a t t a . t t t c g c g ' t . t. t c g c . a at c tt a a . t t . c a . t' at t t at t a a a . a ' t g t . at a c .

Closest match: Saxifraga rosaceawait how did you do that. what the fuck

[amaranthinespirit]

riding loser!könig

by the time you managed to straddle him, he's probably already came twice in his pants. the way your fingers fumbled with his belt and the zipper of his unbearably tight jeans, his bulge rubbing against the rough denim and cotton boxers.

he already made a mess of the material, and feeling as your hands caress across his chest, your body sinking down on his angry, red cock, he couldn't help but shoot thick, pearly cum from his tip. it oozed down the side of his dick, drooling across his hips and down onto the sheets below.

you merely chuckled, a hand barely wrapped around the girth of his cock as you spread his release, feeling the veins under your palm and the way he twitched in your hand, curses in his mother tongue flying from his lips in a desperate gasp.

all you do is guide his cockhead to your drooling cunt, slick with arousal as you part your folds with his tip. sticky cum mixed with your sweet slick as you coated his flesh as if it were lube. you hoped it would make taking his heavy cock easier—it wouldn't.

even before you had guided his cock to your slit, his chest heaved, features flushed from his previous climaxes that came way too easily. it's not his fault he's never been touched by a woman! not all his previous attempts had been successful—the poor social recluse and his debauched thoughts left to his own right hand.

but you were different than his past endeavors—he didn't give up. he didn't quite understand rejection when it came to you. come on, schatz! he likes you, so shouldn't you feel the same way? silly, silly maus, he'll convince you!

and he did! which is how you ended up on top of him, his meaty, thick cock wrapped in your hands as you hover above him, fingers barely touching, waiting to impale yourself on his sensitive dick. his two burly hands pawing at your breasts, kneading the fat under his palms and turning the skin red.

a burn had split down your body as you slipped his tip past your puffy folds, feeling his cock head twitch against your spongy walls as you slowly sank down onto his cock.

you felt a thick, white substance ooze from between your thighs, the way your sopping cunt was suddenly full despite only pushing his tip past your folds. if it wasn't for the loud groan that fell from his lips, you'd have been clueless.

all you did was smirk, slowly sinking further down on his cock while you tried to adjust to his brutish size. small gasps falling from your lips with every added inch, and it didn't help when his massive hands creeped from your breasts down to your waist, slipping to your backside and gripping the flesh between his fingers with bruising force.

you yelped as he forced you all the way down onto his heavy cock—he's selfish! can you really blame him, schatz? you feel like heaven, how could be not!

you're so warm, and tight, and wet, schatz! he just wants to stay buried in your sopping cunt forever! your spongy walls clamping so tightly around him, he was worried you'd push him out! his girthy cock was stretching you so much, you could feel the prominent veins along his length, as though they could be imprinted into your pussy. like his cock was the only thing made to fit inside your tight cunt.

your hands fell against his chest, strings of incoherent words babbled from your lips as he used your tight cunt, his hips pounding you fervently as vocal groans and grunts escaped his throat, drowning out your soft cries at the feeling of his bulbous tip slamming against your cervix.

he didn't last long—reference the 4 other times he had came that night. a mere 30 seconds before he filled you again, thick ropes of pearly cum leaking from his cock that was buried deep in your spongy cunt.

his hands on your ass, grasping firmly as he held you down—despite your shuddering and squirming on top of him. his tip grazing your cervix as he hoped for his seed to take. he just wants to stay with you, and this is a sure way for that to happen.

by the end of the night, he had come at least 5 times—he's sensitive, schatz! if you want him to last longer, you should give yourself to him more often! then, he'd be able to be buried in your pussy for longer than 30 seconds!

[dailydoseoffanfics]

⭐️ SELF AWARE FORSAKEN AU (GENERAL HEADCANONS PT. 2)

⭐️ a/n: DARLINGGGGG GUESS WHO'S BACK FROM JAILLLLLLLLL /silly ASDFGHJKL ANYWAYS THIS IS PART 2 TO MY PREVIOUS HEADCANONS ! FEATURING ELLIOT, SHEDLESTSKY, GUEST 1337, 007N7 AND BUILDERMAN !!! I'LL LATER DO THE KILLERS PART !!! (FEATURNING ALL 4 :3)

⭐️ warnings: possible ooc

reader is gender-neutral so they/them pronouns are used !

(1) (2) <- you're here!

You're a really normal fan about a Roblox game called "Forsaken".......yeah.....totally a really normal and sane fan about that game. But lately, you've noticed something weird about the characters you're playing.

The characters have varying reactions into finding out they're being controlled by something....or someone (you).

⭐️

ELLIOT (MY SHAYLAAA)

Elliot was going on his way to confront Noob about their sudden increased weariness when he noticed Two Time walking down the hallway as Elliot was approaching Noob's room.

Elliot noticed Two Time looked....deep in thought. They aren't smiling, and their eyes are narrowed, looking down in the ground. It feels like they didn't even noticed Elliot bumping into them.

....Elliot just decides it's best to not disrupt them, and shakes his head. C'mon, focus Elliot!

Back to his original mission, Elliot goes to Noob's room, and asks them what's going on, and cracks some jokes here and there to calm Noob down a little.

Something's controlling Noob, and they know by feeling a type of warmth?

That's......concerning.

Elliot's concern grew when he noticed Two Time being....more unusual. Elliot would catch a glimpse of Two Time looking at nothing in particular, their face looking like they're deep in thought. Two Time isn't the only one deep in thought though, Chance seems to look like he's in the clouds as well.

Elliot frowns about his observations of his acquaintances. What is going on? Why are Noob, Two Time and Chance suddenly acting...off? Did it had something to do with this warm, controlling thing going on????

........Speaking of this controlling thing.

When a new round started after observing his acquaintances' weird behavior, which is just, y'know, the usual trying to restrain himself when any of his teammates ignored the pizza he threw at them, he immediately felt something.

The warmth. His arms losing control and a muffled voice.....are those white strings around his arms???

Elliot felt his soul left his body for a second before immediately snapping back. My man is trying SO hard to stay focused and calm, but right now, his mind is having a mantra of "WHAT THE FUCK".

Annnnd when the round ends, Elliot is still having his mantra of questioning what the hell just happened and who was that person as he lays on his bed. Holy shit, he just wants to reunite with his family and make customers happy again. WHAT MORE CAN HE ASK FOR?????

The more Elliot thinks about who was controlling him, the more sleep he loses.....well not like Elliot has a sleeping schedule, he usually just stays up at night, so I think you just made his insomnia worse 💀(Random head canon I have for Elliot is that he's insomniac. He just wants to see his father and his sister again. He's fr trying his best 💔💔💔)

Elliot is SPOOKED about that incident. And then he quickly realizes that "oh shit am i going to be controlled by some kind of person EVERY. SINGLE. FREAKING. ROUND?????"

Yeahhhh, Elliot's kinda scared of you, but that's only because he doesn't know if you're good or not. And if your behavior seems alright so far, Elliot still got some doubt inside of his mind, but his heart is telling him to trust you.

He could even throw a smile at you for your helpfulness! He noticed that he's getting less hits and stabs from the killers so far, and he shows his appreciation by looking at the screen, and giving you a warm smile. He even thanks you for your help.

.......The response was Elliot immediately losing the warmth. Elliot is caught off guard by this, but is immediately sad about it. Awh man, did he scare you? He hopes you'll come back soon.

Overall, the most STRESSED about this situation (for a while). When he first felt some type of force controlling him, Elliot is sweating BULLETS. But later, he appreciates your hard work and also wants to know you more. Even if he's still a little scared of you....

⭐️

SHEDLETSKY

Being a former admin, he noticed that something is off about his teammates.

Noob was usually scared, so Shedletsky didn't mind. But now? Noob is acting like the boogeyman actually got them or something!

Two Time? Creepier than usual. One time, when Shedletsky went into Two Time's room to ask them if they want to eat dinner tonight, he saw piles, and I mean, PILES of papers being everywhere. It looked like a tornado struck Two Time's room, and one of them has .....a person in it? With the other half of papers being filled with.... undecipherable handwriting. (But that's only because Shedletsky immediately shut the door the moment Two Time's eyes locked with his. So uh, he didn't had enough time to read about what Two Time's writing about.)

Elliot? Normally, Elliot was happy-go-lucky and always smiling. And now? Elliot seems to always have his mind somewhere, with a blank face on his face. For Robloxia's sake, he even forgot to make dinner one time!! (..Ehhhh, it's not like he was actually starving, he totally didn't eat some fried chickens earlier.)

Chance also seems to have their mind occupied with something. Yea, he's still smiling and having a big ego, but Shedletsky also noticed Chance looking at a window, thinking about....something.

Shedletsky's confused, and frustrated about the sudden weirdness of his teammates' behaviors. Seriously, what's going on with these people?

Shedletsky talks to Builderman about what's going on lately. Turns out, Builderman also noticed as well, but he also doesn't seem to know WHY his four teammates are acting like this.

Shedletsky's stumped about this. But depsite this, whatever's going on, Shedletsky WILL find out about it sooner or later, and Shedletsky WILL find a solution to whatever this problem is.

.....That's what he thinks at first. Because during a new round, while Shedletsky is brainstorming a plan about stunning the killer, he feels....warm. And his arms go limp before being picked up by....white strings?? And Shedletsky thought that somebody laced his fried chickens with some kind of drug, because he heard a voice, despite the voice being....far away.

At first, Shedletsky tried to ignore it by saying some few jokes. Something like, "oh hahaha can't be that bad...." until his legs jerk forward, a movement that was NOT something he was in control of. Shedletsky got GOOSEBUMPS after that. Bro went "OH HELL NAH I'M NOT DEALING WITH THIS 😭😭"

Would try to cut off the strings with his sword LMAO. Meanwhile in your POV, you're just wondering why Shedletsky is trying to cut air.

When the round ends, Shedletsky wastes no time into checking his admin logs, yes he still has the commands. He's searching the logs PRECISELY, wondering who was controlling him, thinking you're some kind of hacker or exploiter.

Despite his bestest efforts, Shedletsky found nothing. Shedletsky lets out a groan of frustration, and immediately reports this encounter to Builderman.

Yeah, no. Whoever you are, Shedletsky is gonna FIGHT BACK. He thinks you're up to no good, and doesn't trust you AT ALL....at first.

For some reason, Shedletsky decided to do some kind of test of just letting you do whatever you want with him, and yea, he knows this idea has high risks, and pretty dumb, but he's going to only do this ONCE.

And YOU'RE actually......somewhat nice? Your voice is still muffled, but he could've sworn he heard a "sorry" when he got hit. You found a medkit, and even healed him.

.....Yeah he still doesn't trust you. What if you're just doing to make him trust you? So that you can betray him and torture him forever?

But eventually, if you still continue to be nice to him, his doubts will slowly melt, and he'll trust you eventually. He'll say some dialogue about thanking you for your hard work if you stun a killer (which you question if that dialogue was official or there is something wrong with your device) and when he's feeling goofy, he'll look at the screen with his epic face, while having finger guns pointing at you (or so what it looks like since he technically doesn't have fingers).

BRUH, WHY ARE YOU STILL PLAYING THIS GAME DESPITE THESE CHARACTERS SAYING THOSE THINGS THAT YOU SURE AREN'T IMPLEMENTED??? You thought to yourself as you saw what Shedletsky did, instantly leaving the game.

....Well damn. But Shedletsky knows you'll come back eventually, so he waits for you. And when you come back and play as him, he's going to ask some questions here and there.

........You meekly replied to some of his questions. Honestly, you're already mentally unstable in a way, so I guess there's no harm into answering these questions???

Even if your voice is muffled, Shedletsky turns his head away from your view, as he quietly cheers. "Score!" He says in his mind.

Overall, I think Shedletsky's mind will be between "Hahahha what will this person do i ain't scared (he is..kinda) 🤣🤣🤣🤣" and "oh shit what if this person is actually bad....", so erm, yea, he will be ON EDGE with you at first. But over time, he wants to know more about you, so he starts making jokes and casually talking to you like you've been his best friend for 10 years. He's definitely gonna yap about you to Builderman, and tells Builderman to trust you since he's CERTAIN you're a good person!!! (Builderman ain't buying it 💀)

⭐️

BUILDERMAN

Shedletsky's been talking about you for a while. Builderman wouldn't really mind if he knew you actually had, y'know, GOOD INTENTIONS.

Builderman reminds Shedletsky to not trust too easily, you never know. Shedletsky would agree....and then the next day talk about you again. Builderman would sigh at that.

Yeah, Builderman had been noticing something was going on with his teammates. It seems that Shedletsky seems to be under your influence as well.

Even if Shedletsky reassures him that you're a good person, Builderman is the boss of ROBLOX after all, so he'll be stubborn and won't trust you. He ain't budging.

....That's what Builderman thought at first. He knows the drill by now. He knows that the player is controlling someone by the strings (I'll make a separate post about the white strings cuz y not) and feeling a strong warmth, so he prepares for you to control him.

No matter how mentally and physically prepared he is, he still feels his skin crawling when his limps are wrapped around the white strings and hearing your voice that sounds mumbled. All of it just feels.....alien to him. So foreign. So.....unusual. So he doesn't try to resist you.

He wants to trust you, and I guess he is, kinda? I mean, he still would be on edge around you, but over time, he'll be more.... neutral about your presence. He guesses that Shedletsky was right after all. You don't seem too bad.

As long as you're nice and you showed that you have no harmful intentions, Builderman will be chill about you, and throws you a quick smile at your screen if he survives a round.

....You don't close your game this time. You've just....kinda accepted it at this point. (Builderman is secretly giddy about that, but he won't let you show his joyful face.)

Overall? Builderman WILL be more skeptical of you than Shedletsky, but don't worry, he'll be comfortable in your presence eventually. (Man, I think Builderman has like the least amount of headcanons... 😭)

⭐️

GUEST 1337 (i'll just call him by Guest in this post) (also fun fact: i actually had to watch the movie for the first time to try to make him more in character.....yeah i know, i missed out 😭)

Guest will eventually found out about this "controlling force" going on. He gets along with all of the survivors, so he's bound to know about it.

Initially? Guest is immediately on guard. What do you mean there's someone out there that is controlling them? How are we even certain that they're even good?

NGL, I feel like he would disapprove of Shedletsky and Builderman seemingly being positive towards you. C'mon, both of them are like, the higher beings of ROBLOX. But he keeps it to himself and doesn't say anything.

But what do you expect from a man who witnessed his parents get killed by one of the members of the Bacon Terrorist Organization, was in military, and had to sacrifice himself to defeat the Bacons? He doesn't even know if he'll ever see his family and his friend again. He's canonically stated to be the "no-nonsense type of person". He WILL not trust you in the beginning.

That's just because that's how he is. Adding on from what I said earlier, he learned that naivety will get him nowhere, so he'll always be on guard whenever he meets someone new.

He also already knows the drill by now. He overheard Shedletsky talking about feeling a strong type of warmth when you're being controlled, so he's READY.

And when he DOES feel the strong warmth and his limbs being wrapped around by the white strings, he.....surprisingly doesn't try any attempts to resist. He's just staring at the ground, and later looks at your screen.

...Well, Shedletsky did mention you didn't seem to be a bad person, so he'll let his guard down...for now.

So Guest just lets out a sigh and tells you to do whatever you want with him. And you obliged.

And...oh wow. Not even one teammate died. Even if one of them got injured, he could sense that you're genuinely trying your best, with the evidence being your voice letting out quiet squeaks of "sorry" and bodyblocking Elliot.

Guest feels......relieved in a way, and also feels a bit of happiness....but those emotions immediately dissolve when his paranoia logical side reminds him that you could be tricking the survivors, including him.

....And he's immediately on guard again. When the round ends, he's standing near a wall, with his arms crossed and his eyes gazing at the floor. You were truly an enigma. How would he exactly sure that you're a good person? And what even exactly are you?

Ehhhh, he's just generally protective. He'll learn to not hold grudges against you and will warm up to you. That's what you expected after all. But you were kinda expecting Guest to continue not trusting you, so this was a pleasant surprise for you.

Overall? Yeah he would definitely be the LEAST trustful about you in the beginning, so also give him some time to trust you. But like the other survivors, he'll warm up to you eventually. Might even defend you if anybody's talking shit about you.

⭐️

007N7

He already knew everything. He watched everything from the sidelines. He saw how his teammates were talking about this "person". About how they're controlling them.

However, 007n7 seems to be a special case. His first thought of you wasn't fear or distrust, it was....interest.

As in like, he was at first curious about you. I feel like he would be the person to ask the most questions. He's definitely going to yap to you A LOT.

However, he noticed that you didn't even try him once. So naturally, 007n7 just feels.....insecure. He thinks that his skills are "useless", which is why you don't play him. Or you might even hate him. Yeah, it's probably.

He's trying to think positively, reassuring himself that you don't seem to be the type of person to say like that. He's heard of the survivors talking positively about you!

But considering that he's an outcast of the group.....yeah, I don't he'll hold up these positive thoughts for long. The negativity will get to him 💔

BUT ONE FAITHFUL DAY, where a new round started, and during that round, he expected you to not play as him, so he just walks around, searching for a generator.

But his walking suddenly halts. And he feels....warm. And---oH SHIT, HE'S GOT STRINGS ON HIM.

007n7 was alarmed at first, but it quickly turns into disbelief.

But not in a way "OMG PLZ DON'T HURT ME 😰😰😰😰" it's more in a "....you actually wanna play as me??? fr"

(GIVE THIS MAN MORE LOVE HE'S BEEN THROUGH A LOT 💔💔💔💔💔)

His mind is running around circles about you actually playing as him, while you wanted to try something new, so you decided to play as 007n7 for a bit.

When the round ends, he runs off to the ocean where the fisherman resides, as his brain keeps replaying that interaction he had with you.

He knows that he's being too hopeful, too..... delusional. But despite these thoughts, you actually made him happy in a way, so yey :D

Overall? 007n7 the second chillest about this situation. He also wants to interact with you more, but sometimes, his insecurity will get the best of him 💔

[battlevann]

wormy time:-))

@silkekruse @rjavenuru

fuck it. worm on a string picrew chain. let's fucking go

happy worm creation my friends

tagging @areyoudoingthis @cursed-coat-of-homosexuality @peanutbutterex @tfemteach @piratecaptainscaptainpirates (no pressure 💛)

[sturniolohouse]

Junie Laughs - M.S

summary: four month old June laughs for the first time. dad!matt x reader - blurb

"Is daddy just so silly, Junie?" I beam at her belly laughs, each one more contagious than the last.

She has never laughed this hard before, it was a real one.

My heart swells as I record the moment, capturing the joy lighting up her face. Matt looks over at me with wide eyes and I cackle in disbelief of how genuine her laugh is.

At just 4 months old, she's giving us her first real laugh, not the little ones we'd try and poke out of her.

"Do you hear her?" He asks in pure shock, his whole face lit up in awe.

I nod quickly and look back to June, who's sticking her fingers in her mouth and looking up at Matt expectantly.

He leans in close again, using his animated, high-pitched voice, "Who's the cutest, most perfect, most amazing little girl…Junie is! You just love smiling big for daddy, my happy girl."

His excitement mirrors hers, and her squeals grow louder as she kicks her tiny feet, her laughter bubbling over once again.

He tickles her belly and smushes multiple kisses into her cheek, completely unbothered by the slobber coating her face. Her eyes squeeze shut in pure delight and when he pulls back, they pop open immediately, searching for him, eager for more.

She coos at him, dribbling a bit but Matt wipes it away with a his sleeve mindlessly. I get a quick glance at her droopy eyes and I know she's fighting sleep. It's getting close to her bedtime, which we had been doing pretty well with establishing a routine.

Right after her bath, before settling her in the crib, we always lay together in our bed. It’s become our little ritual, just the three of us cuddled close until she gets sleepy enough to drift off.

"Matt, you're getting her all worked up and she has to go to bed," I try to reason with him, but I can't help the smile on my face when she looks in my direction with her sparkling blue eyes. I shift to lie on my stomach next to her, propping my head up on my hand while Matt stays in front of her.

He continues to tickle her, pretending to bite her cheek and smothering her with kisses. Her squeals are so intense, I can hear the little gasps she takes in between, and it makes me a little nervous.

“Matt,” I warn softly, but he’s already backing off, laughing as he does.

He gives her a moment to catch her breath, his hands resting lightly on her belly as she hiccups through the last of her giggles, still smiling up at him. But I can tell her energy is fading fast, her little fists clench and unclench while her eyelids flutter, fighting to stay open.

"But she's so happy," Matt says through a smile, tracing his finger lightly over the curve of her cheek. "Tell mommy you want to stay up and hang with us," he teases, talking to her as she rubs her eyes, her full lips forming a slight pout.

She yawns this time, her tiny hands reaching up for Matt’s face, but her movements are slower now, her head lolling to the side for a moment.

I sigh, knowing it's only a matter of minutes before she's fussy and no longer our happy girl.

"Okay, okay, it’s bedtime, kid," Matt relents, pressing a kiss to the top of her head.

He lifts her gently off the bed, cradling her close before laying her on his chest and leaning back against the pillows. I join them, resting against the headboard, feeling the calm settle over the room.

June was such a good baby. All the research I did on colic and sleep regressions felt unnecessary in the end. She was the textbook definition of an easy baby.

We got extremely lucky, especially as first-time parents.

The first couple of months of her life, she really just slept most of the time. But now her little personality is starting to set in and every day she's seems to learn something new.

She's been starting to babble more and making tons of sounds now. Her favorite at the moment is "bah-bah," which usually turns into a string of "babababababa" when she's particularly happy. Matt thinks it means she's closer to saying "dada," but I'm pretty sure it's "mama."

Time will tell.

She loves her stuffed black cat that Nick got her when we brought her home. It's sometimes the only thing that will calm her down during a rare meltdown. And Chris? He's her absolute favorite playmate and snuggle buddy. They've formed a sweet routine over these past few weeks. Every morning after her first feeding, they lay together the couch while he slowly wakes up.

It's a little tight with all of us in the house, especially with all of the baby furniture and toys everywhere. But we make it work. It's so much easier than if Matt and I were on our own.

Chris and Nick help us out so much, especially in the mornings so we can catch a break. They usually take over so Matt and I can get showered or run errands.

It truly takes a village to raise a child and we're all learning together.

Junie being so little definitely makes living in such close quarters easier. But we already notice how fast she's growing, and it’s made Matt and I seriously consider getting our own house so everyone can have the space they need. It’s a topic that’s been looming over our heads ever since we brought her home.

As much as we love Nick and Chris around, living under one roof is not realistic long term.

I shake those thoughts away and instead focus back on Junie who's still fighting sleep against Matt's chest, her tiny fingers clenching his shirt.

"Every day I wake up and I can't believe she's real," I say, my voice soft, filled with awe. "I don't even remember life before her,"

Matt smiles warmly, his eyes never leaving June as she starts to drift off. "I know. It's like she's always been part of us."

Her cheek is smushed into his shirt, and her tiny ear rests right over his heart, the steady rhythm lulling her further into sleep.

June always falls asleep easily with any of us, but listening to mine or Matt's heartbeat was a guaranteed way to knock her out.

She melts into him, going limp in his hold as she stares at me through her heavy eyelids. I turn on my side and reach my hand over to trace her soft face. She stops fighting sleep then, succumbing to her tiredness.

Matt gently strokes June's back, his fingers tracing delicate patterns against her tiny frame. Once her grip on Matt's shirt loosens completely, I know she's asleep.

"Aaand, she's out cold," I whisper in victory and Matt peeks down at her, a proud smile spreading across his face.

He leans down, placing a long kiss on the top of her head and pausing to inhale deeply.

“I don’t think I’ll ever understand how she smells like actual heaven,” he says softly against her hair.

"I know, right? I don't understand it either. I could sniff her head all day," I agree, inching a little closer.

I keep staring at him, and he catches on, glancing at me out of the corner of his eye.

His expression shifts, a knowing smile creeping onto his face as he realizes I’m watching him closely.

He raises an eyebrow, playful suspicion in his voice. "What?"

"Nothing," I draw out a bit, my eyes fluttering slowly.

"You were staring pretty hard there," he quips back, his gaze flickering to my lips briefly before meeting my eyes again, a mischievous glint in his own.

"You just look really hot with a baby on you," I tease, a smirk tugging on my lips as I watch his face for a reaction.

Matt raises an eyebrow, trying to suppress a grin. "Easy there."

"M'just saying." I shrug innocently, enjoying seeing him squirm a bit.

His gaze drops to June, then back to me, his grin finally winning. "So, what, are you trying to say I should just walk around with a baby on me all the time now?"

"Wouldn't be the worst thing..." I reply with a smirk, leaning a little closer. Matt shakes his head, the smile never leaving his face as he rubs his eyes.

His chest rises and falls with a quiet chuckle, but June remains blissfully asleep against his chest. "You’re ridiculous, kid."

"Dare I say... DILF?" I tease further, raising an eyebrow.

Matt smirks. "Well, if I'm a DILF, then you're definitely a MILF."

"I would sure fucking hope so. I only carried your child for nine months, went through 20 hours of labor and then birthed her. Seems like the least I could get out of it," I say mainly lightheartedly.

Matt chuckles softly, "Don't worry, sweetheart, you've always been a MILF in my eyes," he says with warmth and affection, his hand finding mine and gently bringing it to his lips for a soft kiss.

I snort with a slight chuckle, "Good save."

He winks at me, then looks back down at June, her tiny fingers curled into his shirt. "Seriously though, we made a perfect little human, didn’t we?"

I nod, "Yeah, we really did."

We hear a few gentle knocks at Matt's door, and I softly tell them to come in. The door creaks open slowly, and Chris pops his head in, his usual mischievous grin already on his face. I put a finger over my lips, motioning to June sleeping.

"Aw, is she already out?" he whispers in a sing-song voice, walking over quietly to take a peek at her.

"Yep, just went down." I answer quietly.

He places his hands on his hips and pouts at her, "Sleepy Junie," Chris coos, his expression softening as he watches her sleep.

"Chris, you missed it," I whisper excitedly. "She was losing it before, laughing at Matt. I thought she was going to pass out... I got it all on video."

Chris's eyes widen. "No way! I can't believe I missed it, you gotta send me that shit," he says.

"It was so fucking cute, dude. She'd never laughed like that before," Matt chimes in, shaking his head.

Chris turns his attention back to Matt, rocking back and forth on his feet. I can already tell he’s gearing up to ask for something.

"Dude, you down to play fort for a few? I can't play with Nick again, he's fucking trash." He huffs, taking his hat off to adjust his hair before placing it back on.

Matt glances at me, stifling a laugh before carefully shifting June so she’s cradled more securely against him.

He shakes his head at Chris. "Really, dude? She just fell asleep."

Chris is relentless though, "Bro, come on, just a few rounds," he pleads, eyes darting between Matt and me.

I sigh, turning to Matt and giving him a small smile.

"You can put her in the crib now, she should be okay. Go play for a bit if you want." I nod toward the door, and from the corner of my eye, I catch Chris fist-pumping in silent victory.

Matt is grown and doesn't need my permission for anything, especially playing video games with his brother. But I know he would never go without me giving the green light.

"You sure?" Matt asks, glancing between me and June.

"Yeah, go ahead. I’m going to read for a bit" I reassure him with a smile.

He hesitates for a moment, clearly torn, before he finally relents, nodding. "Alright, I’ll be back in a bit."

As he carefully stands up, cradling June in his arms, I watch Chris bouncing on his heels, clearly excited.

I hear Junie's soft grunts as Matt places her in the crib in the corner of the room. We ended up having to move his desk up to the loft where the old podcast room was.

Matt shushes her gently, pausing for a second and watching her, making sure she's fully settled. He stands up and lets out a breath of relief when she doesn't wake up, his shoulders visibly relaxing.

He turns to me with a small, tired smile, like we've just dodged a tiny grenade.

"That was close," he whispers, shaking his head as he steps back from the crib. "Let me know if you need anything, okay? I'll be back in a couple hours," Matt tells me as Chris waits for him by the door.

I nod. "Oh, Chris?"

"Yeah?" He answers, rubbing his hands together.

"If you wake up June with your screaming, you're the one putting her back to bed." I say with a sweet smile, and I see Matt cover his mouth as he laughs softly.

Chris freezes. his eyes wide before sheepishly nodding. "Noted."

[gimmick-blog-bracket]

@hellsitegenetics

I love them

I didn't know I needed to know that the weed-smoking girlfriends post was genetically a wolf, but I did, and I do. Also puts great stuff on my dash.

it’s so fun to be scrolling unhinged posts and then boom. an organism!

so many moths‼ also, unexpected comedy with some of the matches

perfect blend of silly and informative, and makes for an excellent punchline at the end of a long post. puts creatures on my dash. literally what more could you ask for

It's a really unique blog concept and a lot of times the results are pretty funny. It's great when the sequence matches the post content too!

Creatures 👍

Finds beautiful creatures out of the mess of the hellsite

Offers finality AND gives us a creechur.

I love them. English speakers talk like moths

If this blog wins, they could run the text of the winning announcement, and determine the post's genus and species!

They're also very good about tagging the type of creature depicted in the results, so as long as you mute tags of creatures you don't want to see, it's a very fun time seeing iconic legacy posts (and new submissions) being reduced down to a string of letters and assigned a random species of fish or moth or something!

uhh it’s cool

BLAST

There are so many weird bugs in the world

Yippee!!

If, as Haldane said, God has an inordinate fondness for beetles, then surely this blog proves that Tumblr has an inordinate fondness for moths.

Top tier blog as a geneticist, I love seeing obscure organisms and MOTH

Admin got rate limited after trying to blast the bee movie

the knowledge of biology to pull this off (i have taken one biology class in my life) and also the work to find all the strings honestly deserves quite a bit of praise

This gimmick blog has it all: science, pictures of animals, interaction with the text of other peoples' posts, interesting information, and a unique and fun premise. As a biologist, I'm rooting for hellsitegenetics to reach the end and take the tournament, because it is truly a standout among gimmick blogs.

If they win, perhaps this blog too shall become a cool organism :3

@official-boob-posts

This blog was featured in the video ‘Depths Of The Tumblr Gimmick Blog Iceberg’ on the YouTube channel ‘STRANGE ÆONS.’

Boobs ( . )( . )

[waywardangel-wilds]

Things / silly moments Peeta Mellark would have during or after the growing back together era. I’m doing a sequel, Peeta edition lol!

1. Receive a breadmaker for Christmas. Who gave it to him? Haymitch? Johanna? His own traitorous wife? The possibilities are endless. Regardless, he is not amused (hahaha).

2.Repeatedly say he’s “okay with that,” regarding: kitchen organization (no he’s not,) loud noises (no he’s not,) people over staying their welcome (no he’s not, he cannot keep his friendly face on as long as he used to).

3. Somehow still have it in him to be surprised / honoured / brought to tears by Katniss wanting to be with him. Katniss thinks he’s silly.

4. Incapable of making stew at the level Katniss Everdeen can. He doesn’t know what the hell she’s doing, but he always falls asleep on the couch right after. How is she doing this?? How much butter is in this stuff??

5. Continue to be an insanely nosey person. He knows everyone’s business and yet no one suspects him. He’s like a sleeper agent.

6. Wake up one day confused by Katniss’s slow migration into his house. He opens a cabinet expecting to find his stuff only to find what Katniss thinks is a subtle stash of miscellaneous junk crammed in there. Is this something he can bring up in conversation? She can just move in, it’s fine. Would she run away if he says anything?? He’ll keep it to himself and see where she’s going with this.

7. After a period of shell shocked silence on Peeta’s part, he returns to what eventually becomes a tradition: shit talking Haymitch over a game of chess. Haymitch thought himself a grade A smart ass, but he’s got nothing on the kid. It’s not so much verbally abusive as it is insanely hilarious. The old mentor would have never thought of stringing that specific bouquet of words together.

9. One day, randomly, he watches as some rich person on the news announces that they’re auctioning a painting of his from his victory tour. He doesn’t take this well.

10. Finds the whole concept of hiring people to help him run the bakery deeply odd. It’s also a practice in realizing his parents did not worry about their kids safety enough when they were working.

11. Is just the type of person who, infuriatingly, cannot stay still. He needs a task, constantly. Oh, Katniss talked him into not going to work for once? He’s trying to clean the gutters. He’s down with the most nasty cold of all time? Perfect opportunity to regrout the bathroom tiles.

[novvabee]

And They Were Roommates pt.7

Summary: this one is pretty short and sweet, but Y/N makes the boys friendship bracelets.

“What colors do you want?” you ask Sirius who is sitting on the other side of the couch, picking out beads and charms that he likes. You were making little bracelets for you and the girls when Sirius walked in the living room and asked what you were up to. He cozied up next to you and watched as you intricately wove and knotted a pink, white, and green bracelet for Lily. Once you were finished he sweetly asked for one, and you of course agreed.

“Do you have red and black?” he asked, still sifting through the little charms.

“Of course,” you replied, “I also have this silvery color I think you’d like.” You lifted the string of the shimmery silver so he could see. His face lit up and he nodded. You cut three equal length strings in the colors he wanted and began tying knots.

He handed you three charms that he wanted: a star, a red guitar, and cherries. You couldn’t explain it, but those charms just made sense on a Sirius bracelet. 

He hovered over you, watching intently, sitting close enough to rest his chin on your shoulder. You enjoyed this small, quiet moment with Sirius. You felt like you didn’t get them often, but when they happen, it leaves you with a warm feeling all over.

“Could you teach me how to make one?” he asked.

“Yeah,” you replied, “just grab some colors and copy me.” you turned to face him, legs criss-crossed, knees touching his. 

“Ok, just go slow.” he said.

You smiled and showed him the basic knots and loops he had to copy, at a much slower pace, making sure your work was on clear display for him to follow. “See you make a ‘4’ with the strings, and make sure it is tight so that you can see the pattern,” you explained, “and then you move to the next string.”

“W-wait, slow down.” he laughed.

“Keep up, slow poke.” you laughed back. In all fairness, he did try, but somewhere along the way it all went wrong. 

The bracelet, if you could call it that, turned into some sort of knotted ball, strings hanging loose. You bit your lip and turned away to stop from laughing.

“Don’t you dare laugh.” he said, this just made you hide your face in your hands to muffle the giggles coming out. “Stop it! I tried so hard!” he said, fake pouting. 

“Oh it’s lovely Siri,” you laughed, holding out your wrist for him to tie it to. It looked like something a cat would play with, but you were genuinely proud of him for trying. He grabbed ahold of your wrist and secured it, a goofy smile cut across his face. You loved to see it, loved that he was comfortable to be silly around you, himself around you.

“Ok, ok my turn.” you say to him. He closed his eyes and held out his wrist, the same way you did. You tied the bracelet around his wrist, knotting it to make sure he could take it off when he wanted. “Ok look!”

He opened his eyes. His smile grew and he looked quite pleased. “I love it.” he said, eyes not moving from the strings. There it was again, that warm little feeling. "You gotta tie it tighter so it wont come off." you nodded and tightened it. You thought surely he would take it off soon after you put it on, but maybe you thought wrong.

You heard footsteps make their way downstairs. You looked up seeing Remus, still in pajamas and hair a bit messy. 

“Morning sunshine.” Sirius shot at him. Remus yawned and made his way over to the pair of you. It wasn’t irregular for him to sleep in so late, usually allowing himself a day of rest once a month, you figured it was because he always stayed up so late and he was trying to fix his sleep schedule.

“Hi Remmy,” you greeted him.

“What are you two up to?” he asked, voice groggy and deep.

“We are making bracelets, Y/N is teaching me.” Sirius said, holding his wrist up for Remus to see.

Remus took Sirius’s hand and held it close, examining your work. He smiled at you. “Fine craftsmanship, I see,” he said jokingly.

“Would you like one? I can make one for you as well.” you asked. It would not take long at all, you had made hundreds before.

He nodded. “Course I would like one, love.”

You beamed up at him, clapping your hands eagerly. “Pick out the colors and charms you’d like.” you ordered him.

He chose green, brown, and a yellowy tan color. The colors much like the sweaters he often wears. He picked out a singular charm, a crescent moon, and the letters spelling out ‘moony’.

“Moony?” you asked. He was now sitting on the armchair, sitting sideways, long legs dangling over the arm’s edge. 

He chuckled, supplying you with a short, “It’s a nickname.”

“But why-” you were interrupted with the front door opening and James swooping in, always the tornado. He was out of breath and sweaty, just coming back from a jog.

“Hello! I need to shower- Ah Remus nice to see you’re finally awake, anyways after that I want to make dinner-Chicken and pasta alright?” he asked, so fast paced and chaotic, the way he always was. He stopped in his tracks when he saw what you were doing, coming to the back of the couch and looking over. “What is that?” he asked.

“A bracelet, I made one for Sirius and now one for Remus. Sirius made me one too, which I love and am very proud of.” you held up your arm for James to see the yarn ball dangling halfway on your wrist. James and Remus both burst into laughter, Sirius chuckling along with them. 

“Well that's not fair,” James said, “if you are making friendship bracelets, I want one too.”

You giggled at the slight childishness of that statement, but  replied, “Fine, you pick out some colors and charms too.”

James picked red, yellow, and white for his colors and two tiny gold charms; a sun and a lightning bolt. The sun made sense for him, he was always the light and warmth within the house, bright and happy. The lightning bolt however…

“Why the lightning bolt?” you asked, straining your neck all the way back to look at him above the couch.

He smiled down at you and shrugged. “No clue, I just think it’s cool.”

Taglist 💌: @too-efn-old-to-be-here @cometsghost @eeviee4 @giuli-in-earth @spicybearnaise @the-lavender-girl @adharalikethestar @champomiel @itsleroyposts

[literaryvein-reblogs]

do you have any tips for a character who's initially seen as a comedic relief/not taken seriously character, and then at the end, BAM they were the villain all along and were pulling the strings from the shadows? thankss

Writing Ideas: Hidden Villains

some related tropes

Examples: Comedic Relief Character Tropes

Bad Liar: Someone who is terrible at telling lies.

Beware the Silly Ones: Character who acts silly but is also quite dangerous.

Born Unlucky: Bad things happen to this character on a daily basis.

Cannot Convey Sarcasm: A character who tries and fails to be snarky.

Cannot Tell a Joke: Someone who tells really lame and unfunny jokes.

Casanova Wannabe: A would-be womanizer who thinks they're great with the ladies, but are anything but.

Lovable Coward: A cowardly character whom one still wants to root for.

The Prankster: Someone who plays practical jokes on others for their own amusement.

"Hidden Villain" Trope

A situation where a Story Arc contains a villain whose identity is not known until much later.

This could be a result of the heroes going against The Faceless, requiring only a look under the mask to understand everything.

In most cases, this is an inversion of the Hidden Agenda Villain, where we know that something bad is happening and the Driving Question is the one behind it all.

The Reveal may involve a dramatic Emerging from the Shadows.

"Hijacked by Ganon" Trope: If the Hidden Villain turns out to be a previously known antagonist.

"The Dog Was the Mastermind" Trope: If it was someone who was never suspected at all. The Hidden Villain turns out to be about the least conspicuous person possible.

"Evil All Along" Trope: A seemingly good character turns out to be evil.

"The Man in Front of the Man" Trope: If the villain was Hidden in Plain Sight.

"Laughably Evil" Trope

The villain that makes you laugh.

It might be because they’re an idiot, it might be that you empathize with them, it might be because they’re quick with a quip, or it might be simply that their actions are so unexpected.

Funny does not always equal weak.

Some villains can cause a chuckle from the audience, right before viciously thwarting the hero's best efforts.

If done correctly, the very things that make a villain qualify can make them downright disturbing once they begin crossing the Moral Event Horizon.

Villain laughing at faking someone out with a gun with a "BANG!" flag coming out? Funny. Same villain doing the exact same laugh when shooting them for real a few seconds later? Creepy.

A truly well written one can manage to pull off both at once.

Just because a character qualifies, it does not prevent them from being completely evil and there are many villains that manage to be both. In these cases, what makes them funny also makes them very unsettling because of how much fun they have committing the most horrific acts possible.

Sources: 1 2 3 4 5 6 ⚜ More: References ⚜ Writing Resources PDFs

You can use tropes as a guide to initially develop your character. For example, choose one of (or combine/modify) the above Comedic Relief Character tropes (a longer list is in the source to provide you with more ideas) to portray your villain prior to The Reveal, and slowly incorporate characteristics of the Hidden Villain and/or Laughably Evil tropes until they are revealed as the villain. You can find examples of media portrayals of these tropes for inspiration in the links. All the best with your writing!

More: On Writing Villains

Villain Archetypes ⚜ Notes: Villains ⚜ Villain Motivations

An Unforgettable Villain ⚜ Anti-Villain ⚜ Villain Monologue

Sympathetic Villain ⚜ Your Villain's Evil Plan

[some-bunniii]

Lucifer confessing to an artist reader

・❥ Lucifer gets jealous, and has to prove his love for you

| Part 1 | Part 2 | Part 3 | Part 4 |

x: WOW this was a rollercoaster to write. Alastor being petty, a musical number, and.. 😏 you’ll have to read and see!

warnings: Mild swearing

“Mreow?” 

You stirred slightly under the covers in your bed, waking from the noise. You were so warm and cozy, in your little nest of pillows that you hugged to your chest. Stilling yourself, you strained your ears, listening for whatever had awoken you.

“Mreooow,” came that needy, animalistic cry again.

“KeeKee?” You whispered hoarsely.

A high-pitched chirp answered your question.

Grumbling in protest, you grasped the sheets and pulled them from your face. Squinting at the morning light emanating from the large windows on the other end of the room. 

You rubbed a hand down your face, in an attempt to squeeze out the exhaustion still fogging your mind. With a sigh, you pivoted, placing your feet on the cold, wood floor beneath.

Now where was that furball? 

You scanned the room, before your eyes landed on the small black and white cyclopean cat. She sat on your nightstand, her tail swishing with happiness as you answered her call. 

“You silly kitty, what do you want so early in the morning?” You questioned her, and received another chirp as a response.

You always found it fascinating that the small feline was actually the key to the hotel, created by Lucifer’s magic as a gift to Charlie when she took over the place. 

You could feel it, even now, that warm crackle of energy as it flowed off KeeKee’s fur. It was faint, but so familiar. If you buried her face in her fur far enough, you could even smell traces of his scent. 

As you and Lucifer grew closer, so did KeeKee. She had started following around the hotel, always a few steps behind as you traveled the halls. This morning routine of hers wasn’t new either. Before, you’d open your door and find her sprawled out on the ground on her back, her belly exposed as she greeted you. 

You started leaving your door cracked after that, allowing her to enter whenever she pleased. She’d make her bed on the same cushion Lucifer was so fond of while you painted, and drift into sleep. 

Sometimes, you’d use her for practice sketches. Although you could only do so while she dreamed, as she was not as good at sitting still as Lucifer was.

It was almost as if she sensed the connection between the two of you, mirroring your bond with her own loyalty. With a soft smile, you reached out to pet KeeKee, feeling the comforting vibrations of her purrs resonating through your fingertips. 

Rising from the bed, you made your way into the small bathroom. Twisting the sink handle, you let the fountain of water flow into the drain as it is heated. 

Your eyes landed on the object next to the faucet, and you smiled unconsciously as you picked up the yellow rubber ducky. 

“Your new soap dispenser,” Lucifer had stated one evening, “Easily compactible to take it on the go and.. with the scent of apple pie.” 

He demonstrated by softly squeezing the sides of the toy, and a small glob of soap left its mouth and landed into the palm of his hand. 

You had taken it from him and lifted it to your nose, inhaling a deep breath. 

“Delectable.” You teased, before placing it on the table beside you.

After his little performance at the art studio, Lucifer’s affection towards you grew bolder by the day. He often arrived at your room with a gift or two, even more than his silly little ducks. 

Once, he brought you a small violin, the color pure angelic white with golden strings. You had stared at it in awe when he set it on the table.

“It’s white for you to paint,” Lucifer had explained, “Whatever little fantastical ideas you have to cover this instrument with, I just know it’ll be amazing.”

You had blushed, before letting your fingers glide across its smooth surface. Tracing its frame, memorizing its shape. 

“I was going to get you a fiddle, like my own. But, I believe this best suits the musical pieces you are so familiar with.”

You sat across from each other at the dining table in your room, arms resting lazily on its surface as you sipped from your glass of Spiced Apple Wine. 

That was another gift he had brought you. Claiming he only enjoyed the taste of fine-aged wine from his personal cellar. You had gotten used to its slightly sour taste by now, but you were glad for that slight pinch on your tongue. It kept you from ogling Lucifer for too long.

The only light emanating from your room was the candles placed around you, their flames dancing, casting shadows across the walls. The soft ting of piano keys thrummed in the air, flowing from a small brown radio on your dresser.

Not too long ago, Alastor had given it to you for your personal use. A very rare gift from a demon like him. You had just assumed it was his way of getting you on his side, your unease of him must’ve been apparent enough. 

Your years of attempted swindling by potential buyers for your pieces created a sixth sense, the ability to smell when someone’s words didn’t echo their intentions.

Even though you had no animosity towards him, and spoke to him frequently enough that you did not feel any kind of negative intentions from him, his mysterious past and psychopathic tendencies struck you as odd. His presence was dark and cold. 

Nothing like Lucifer’s, who’s aura was so warm and energetic you could get drunk off of it. 

Alastor’s? That would sober you up in an instant.

Why didn’t you feel the same about Lucifer? After all, he had the same charm that swooped those around him off their feet. 

‘His ability to love,’ you concluded in your head, ‘that was why.’

He showed deep care for the people close to him, while Alastor always held people at arms-length. Literally and figuratively.

Your personal feelings didn’t mean you weren’t going to use the radio, so whenever you’d hear Lucifer nearing your room, you’d switch it to polka. Learning by now that was one of his favorite genres. It played in the background as you discussed the violin.

“I think it’s best if you taught me how to play, I might have some knowledge on musical history, but that doesn’t mean I know anything about the instruments themselves.” You had conceded.

He shook his head at that, “Nonsense. If there is anyone I know that could pick up skills like this quickly, it would be you.”

“What makes you think that?” You had laughed.

“Because, you’re amazing. Talented, with passion that could take on the world. You and my daughter have more in common than you think. A drive that I wish I had.”

That had stopped your train of thought, your cheeks heating once more. Most times you would try to brush off his comments, and continue on to the next subject, even if those words made it hard for you to fall asleep that same night.

But this time, you let his words linger in the air between you. The faint glow from the candles illuminating his face, his angelic features intensifying. 

It was your turn to make a move, you couldn’t let him have all the fun.

Slowly, your hand traveled across the table, until your fingers grazed his own. Lucifer never pulled back, instead, he accepted your advance. Lacing his fingers with your own.

The two of you didn’t speak, you didn’t need to. The day could be filled with laughter and quick-wits. But, the night? That belonged to your silent bouts of affection.

Just two pairs of eyes staring out through the large open bay windows, the flickering lights from the city your own little TV. 

What was he thinking about? You had wondered. You were aware of the divorce of his wife years ago, and the fracture of his family still weighed on him. Even if his relationship with Charlie was improving the day. Did he blame himself for his family splitting? 

You had never pried him on such things, there was no reason to bring him more pain. He’d open up about it when he was ready, he always did.

Was that why he was slow to actually ask for your kindness? Your care? 

Your love? 

He was a showman, with a drive to impress strangers around him, to win them over with his charm and flare. But you weren’t a stranger, not anymore. 

There was this tiny parasite that gnawed at the back of your mind, whispering such horrid things of him leaving you if you made the first move. 

‘His pride is too great to let him be swooned completely by a lower demon,’ it hissed, ‘He just wants something casual, nothing truly real,’

Was that true? Would he reject you and move on? Surely, there were much stronger, much smarter demons than you in Hell that he could choose. 

Maybe, you’d just have to grow a backbone and ask him. 

‘Soon’, you promised.

The calming scent that wafted from the candles around the room pulled you away from such thoughts. Instead, you used your free hand to lift the wine glass to your lips, downing the remaining liquor. Your body blooming with warmth as it traveled down your throat, and your head turning fuzzy with bliss. 

A gentle thump as KeeKee landed on the counter pulled you back to reality. You finished washing your face, and placed it into the cool embrace of the small towel in your hands.

Turning away from the sink, you walked back into the main room. KeeKee trailed you as you rummaged through your dresser, plucking out items of clothing as you began to change for the day. 

“Come, KeeKee,” You called, clicking your tongue at her as you strided to the doorway of your room. 

She responded with a chirp and raced past you, out into the hallway. You watched her scurry down the stairs as you headed for the lobby. You were supposed to finish the season of RuGaul’s Drag Race this morning with Angel Dust, and honestly, it was a pretty good show.

Unfortunately, the raised bump in the carpet right in front of your foot had other plans.

“Fuck!” You hissed as you fell forward, your arms instinctually raising to catch your fall.

You hit the ground with an oomph. Luckily, you caught yourself in time to not face any serious injury. Except the sting of your pride. You lay there defeated for a moment, the ache in your arms subsiding slowly.

“Well, hello down there, my friend!” Came a familiar call, static trickling from their voice.

 “Hello, Alastor.” You greeted the Radio Demon with a painful sigh. 

“It appears you’ve gotten yourself into a bit of a pickle, hm? Let me help you with that.” 

Black tendrils gathered around you, they were unnaturally cold and you squirmed against their touch. 

They tightened around you and lifted you up, up, and up until the soles of your feet were steady on the ground. They flowed off of you, disappearing like a shadow into Alastor’s form.

“Thank you, Alastor. That was very kind of you,” you spoke as you brushed dust off your clothes. You’d need to talk to Nifty about coming to your side of the building more often to clean. 

“It was no problem, my friend. I could not just sit by and allow you to take such an attitude from that silly carpet.” 

Alastor snapped his fingers, and the tiny lump in the carpet that had delivered the tripping blow vanished. Leaving behind a nice, smooth surface.

His head snapped back up to you, that large smile still plastered on his face. You were about to open your mouth again when his gaze landed on something behind you, past the railing.

“Ah, I see you have finished another one of your paintings! What a wonderful piece this is, yes, truly remarkable!” 

He walked forward, and placed one hand on the railing. On the opposite side of the room, at eye level to the second floor, was a painting depicting a very large, glittering lake. A tall forest surrounded it, with massive snowy mountains as the backdrop. 

Small winged-angels sat near the waters, feasting on grapes and wine as they enjoyed the summer sun. Some stood near white-freckled fawns as they fed them fruits and nuts, their faces lit in joyful smiles. 

“Yes, it took me forever. Water is a pain to get perfect. Do you.. think it fits?” 

“Of course it does, my dear!” His enthusiastic voice not missing a beat, “I think Charlie choosing you for this job was a marvelous choice! You must have taken much inspiration from some of the classic artists.. Perhaps Edgar Payne?”

A look of surprise crossed your face. He knew about the famous western landscape artist? Alastor didn’t seem like a fine arts kind of man to you.

“I used some of his techniques, yes. I didn’t know you had such knowledge, Alastor.” You responded, a hint of questioning in your tone. Prompting him to speak more about the subject. 

Alastor waved his hand in the air in a brushing motion, as if it was no big deal.

“Oh, here and there. When I was alive hosting my radio show I once toured an art gallery for an advertisement. His pieces were on display, and I suppose his work has been imprinted in my mind ever since.”

“That’s very interesting, actually. I shouldn’t be surprised though, you seem to be in favor of many classic mediums.” 

“Mm, yes. I just can’t stand the way modern society has seemed to falter from its most creative forms. I’m sure soon they’ll just start paying robots up there to make art for them.”

You doubted that, people using robots to make art? What was the point of it if not created by the human hand?

It was then you caught his eyes darting to something behind you, towards the staircase. Did his eye just twitch?

Alastor’s toothy grin widened further, which you thought couldn’t be possible. Before you could turn around and get a look at whatever had captured his attention, his gaze landed back on you.

He quickly sidled much closer to you, and placed his free hand on your shoulder. Your eyes widened at the touch, he’d never been brazen like this before. Let alone being this close to you. 

Suddenly, he let out a loud, boisterous laugh at nothing particular. His head slightly shook from side to side like he just heard the funniest story in his life, which made you lean back slightly at his very odd actions.

“Oh, my dear, you are such a charm. Truly. I always enjoy our little talks about your ideas. You are so very passionate about your work.” 

Your eyebrows raised in suspicion at his behavior. What was this man up to? 

“We should definitely continue our talks sometime, perhaps, in the comfort of your study?” He questioned, placing his other hand on your shoulder, “Maybe, you could even teach me some of that history you have trapped in your noggin, mmm what was that era called.. the Renaissance?”

Your mouth parted slightly as you contemplated his words. He wanted to learn from you? You had never graced anyone with your teachings other than Lucifer, and you kind of liked it that way.

“Well.. I don’t know if-”

“Ahem.” Came a familiar, male voice from behind the two of you. 

Your words caught in your throat. Uh oh.

You watched Alastor’s grin deepen into a knowing smirk. His eyes snapping to the figure behind you, eyebrows raised. 

You pivoted, seeing the familiar pale face staring intensely at you, practically into your soul. You tried to smile at him, your teeth clenched painfully as you stood besides Alastor. His hand still on your shoulder. 

You tried to speak through your eyes, desperately trying to tell him this was not something you had asked for. You weren’t sure whether he could read it.

Lucifer’s gaze diverted to the hand on your shoulder, and you could feel a crackle of scorching hot energy in the air around you.

“Why, hello there, your majesty.” Alastor greeted him with mock enthusiasm. 

“What a surprise to see you here,” Lucifer responded, a slight growl in his voice. He straightened his back, leaning slightly forward on his staff, as though the scene before him was not a bother. He was terrible at hiding it though. 

“Indeed. My dear friend and I were just discussing their paintings, aren’t they a wonder?”

“Of course they are.” Lucifer responded. 

“We have such good conversations, you know, about their vast knowledge on the subject. It makes me envious really.” 

He released your shoulder from his grasp, and you scooted an inch away from him. 

“Perhaps, one day, you would care to join us? But I'm sure their line of work isn’t something you are interested in, hm?” Alastor’s words left his lips, and Lucifer’s teeth bared at that.

Alastor’s smile intensified as his own energy filled the room, an invisible dual of power was beginning to emerge between the two demons. It reminded you of what happened when Lucifer had arrived at the hotel for the first time, when they had fought for the position as Charlie’s father figure. 

Alastor wasn’t an idiot though, Lucifer could eradicate him at any moment. Was just simply irritating the fallen angel his only motivation?

Was Alastor’s initial conversation with you just to pull the strings of what was happening now? Did he know Lucifer was coming to see you? That sly asshole.

Alastor turned away from Lucifer’s glare, and met your gaze.

“How is that radio doing that I gave you? I hope you’ve been putting it to good use, I was trying my hardest to

think of the perfect gift for you, and I just knew that you would be interested in it.” 

“It was.. nice, thank you.. Alastor.” You responded, afraid what would happen if you ignored his question. 

“My pleasure, dear friend. We’ve been through thick and thin, you and I. It’s only right I share with you a piece of my.. admiration towards you.”

Admiration? 

Lucifer stalked up to the two of you, staring daggers in Alastor’s back. Clearing his throat, he let out a dark chuckle.

“I’m sure your little relationship is over-exaggerated,” He said, his tone passive aggressive, “I’ve hardly seen you in the same room together, let alone have such meaningful conversations.”

“But, of course we do! I was there the first day they walked through those doors. I was the one that welcomed them to their new home, and it was I who furnished their room in the first place. Seeing as barely anything has been changed or moved around, it is safe to say our connection is much deeper than you may think.”

You heard Lucifer growl again. His eyes flickering to a shade of red.

“Well, it’s too bad your gift is useless now.” Lucifer hissed, “They have an instrument of their own, which I have provided them.”

Alastor’s ear twitched at that, and he turned to you in mock fascination. 

“Oh, an instrument? Did you know I used to play in a band?” He turned to you, his questions armed with ill intentions, “I would love nothing more than to give you a lesson or two!”

“I am going to teach them, actually.” Lucifer snapped, “I couldn’t imagine the terrible noises that would come from you plucking strings like a tone-deaf banshee.”

Alastor laughed at that before reaching out and grabbing your hand. You had the growing itch to rip it away, but his stare whispered dark things, and you relented. Allowing him to grip your wrist loosely.

“Well, this has been fun, and I would like to continue our talks,” He addressed you, “But I have important business to attend to within the hotel, as your faithful hotelier. Perhaps, later tonight?” 

Your smile faltered for a second, giving him a slight glare. You weren't going to let him think you were falling for his games.

“Such a shame you have so much attention on you from so many others, those demons on the streets really look at you with such enamoration. My word, just practically begging for your attention! If only you would share all your ideas and knowledge with just me, you’d know how fantastic of a listener I am.”

“Others?” Lucifer asked incredulously.

Alastor ignored him, instead, he did something that you never expected.

He gingerly pulled your hand closer to his face, before leaning down slightly and placing a quick peck to your knuckles. You gasped, placing a hand over your mouth to cease it quickly. 

It was meaningless, you could tell. An act to simply further spur on Lucifer’s rage. 

“Why you pompous little fucking-!” Lucifer roared, but was cut off by Alastor’s maniacal fit of giggles.

Suddenly, the red demon evaporated into a large green cloud of smoke. A gust of freezing wind rushed you as he vanished. Behind you, Lucifer’s large hat was carried with the gust of wind, and he was left practically frothing at the mouth, his hair disheveled from the wind. His eyes still a dark sickly-red. 

You strode up to him, placing a hand on his arm. Trying to get him to look at you. 

“I promise you, we were not talking genuinely just then, Lucifer.” 

“Do you have conversations with that creep when i’m not around? Have you been telling him the same things you’ve shared with me?” 

You rolled your eyes, letting out a breath of hot air. 

“Don’t be ridiculous, he’s just getting under your skin. I’ve barely spoken with him.”

“What did he mean by ‘others’? You have suitors that i’m not aware of?”

You leaned back, confusion spreading across your face. Was Lucifer.. jealous? Was the thought of other demons trying to get intimate with you.. bothering him?

“What? Well, I don’t know, maybe. It’s not like I-”

“It’s me who knows almost everything about you. I’m the King of Hell, what can anyone offer you that I can’t?”

What was this? He’s never spoken a word about courting you, which is why your feelings towards his affection were mixed. But now, he wants to? 

“And here I thought I could make it to the overlord meeting in time,” He growled. Before his gaze was renewed with fresh determination.

He grabbed your hand, pulling you closer, and snapped his fingers. 

Before you could blink, the area around you melted and transformed into a beautiful restaurant. You were sitting at an oak table, candles lit around you. A wine glass in front of you.

Lucifer materialized at the seat across from you in a very tight, clean black tuxedo with a red bow tie around his neck.

He gave you a playful smirk, before another figure strode to your table. You looked up, and saw.. Lucifer? Again? This time in a classic waiter outfit, an apron tied around his waist. He held a plate of food in one hand, before setting it down before you. 

“You’re favorite dish, catered by yours truly.” Waiter Lucifer spoke confidently.

You looked down at the foodstuff on the plate, your mouth watering. It really was your favorite dish. You reached out to grab it, before you were thrusted into darkness again.

Where were you now?! 

You were sitting on a very comfortable cushioned chair, and as you whipped your head around, noticed that there were rows and rows of the same kind of chairs. 

“What the hell is going on?!” You yelled to the scene, but received no answer. 

Placed in them were more.. Lucifers? They all whooped and cheered, clapping at whatever was in front of you. You turned your head, taking in the sight before you.

It was a lit stage. The curtain was closed, so you were unable to see what was on it. Suddenly, the curtain lifted, and there was Lucifer again, he held a Violin, similar to the one he gave you, but this time in pure gold.

He looked at you before gliding the bow across its strings, the echoes of its chords filling the room. You perked, recognizing its tune.

It was ‘Innsbruck, I must leave thee’! The same one he had asked you about when you caught him humming that one time.

Did he learn it… just for you? Your heart fluttered. Was this grandiose display just him trying to prove that he cared about you and your interests?

It continued for a moment longer, the strings on his instrument singing with raw power. It was a beautiful sound, and for a moment you were lost in it. Emotions from your past bubbling inside of you.

And then, he let go of the violin and it began playing on its own. It floated in the air gracefully as its tune continued. He leapt off the stage and landed right in front of your seat. He extended his hand, waiting for you to take it. 

You hesitated for a moment, unsure of where you would be taken next.

“Luci..” You said, giving him a questioning look.

He only smirked at you, his eyebrows raised playfully. You shook your head, a smile blooming on your face at his theatrics, and laced your fingers with his. 

Instead of being thrown into darkness like before, gold flashed around you as he teleported you somewhere distant.

This time, you were on the roof of a very tall building, you shook your head to rid yourself of the dizziness before taking in the sights around you.

You were in Pentagram city, Heaven high above you, it’s white glow helping to light the rooftop like a stage.

Your hand was still gripping his, and he did not pull away. Neither did you. 

Suddenly, a tune began once more. Unfamiliar this

time, and you twisted your head to find where it was coming from, but to no avail. It seemed to be emanating from the entire space around you.

Was there a faint musical number playing in the background, or was that just your imagination?

Lucifer pulled you closer, his classic red and white hats by vest clung to his frame. His hat and overcoat nowhere in sight.

“Lucifer, what are you…” You trailed off, right as he opened his mouth and started to.. sing.

With treasures untold and riches divine,

I offer you the world, to make you mine.

His voice was like velvet, that boisterous playful demeanor apparent as he circled you around, you turned with him, never releasing his hand. He continued, his eyes never straying from you as he sang.

I can offer you kingdoms, castles of gold,

Mountains of riches, for you to behold,

Diamonds that shimmer, like stars in the night,

With every breath, with every sigh,

I’ll lavish you with riches, until the end of time.

His singing ceased, and you were rushed back into reality. You looked at him in awe, enamored by that pretty voice of his. It was ethereal, just like God has designed him to be.

You stood there for a second, eyes fixed on Lucifer’s hand as it entwined with yours. Your gaze traveling to those big, beautiful golden eyes that practically begged for your response. 

In that moment, as the sun above illuminated his pretty face and his shining hair flowing in the gentle breeze, you realized how much you adored- no, loved this man. 

Summoning all of your willpower, you answered. Your lips parted as your tongue began to form words of your own design. You didn’t call up any lyrics from pieces of past design. These words needed to be yours. Needed to say everything you desired and more. 

I don’t want your magic,

I don’t want your gold,

I want your eyes on me,

Until we grow old, 

The words left your lips, soft and buttery, as your confession rang through the air. You desperately hoped your voice didn’t sound like nails against a chalkboard, that it held some resemblance to his own angelic vocals. 

His eyes widened for a moment, before they softened. A sparkle shining in them that wasn’t there before. 

A genuine, heart-melting smile crossed his face as he listened to your words flowing from your tongue so gracefully, like water cascading from the Fountain of Youth.

You took his other hand, pulling him backwards, as you danced across the narrow rooftop, like ballerinas, your footsteps synced and graceful. 

Suddenly, he turned you towards the edge, your heels mere inches from the ledge of the roof. For a moment, you felt like you’d slip and plunge into the depths, but those eyes of his held you steady in your mind.

Until his wings appeared behind him, beating softly, giving you air as he spun you slightly off the rooftop. A pulse of warm energy hit you, and your legs lifted out from under you. Like you were Jane with your Peter Pan, and his magic fairy dust was going to send you gliding off to Neverland.

For a moment, you felt like you had wings of your own. That feeling of absolute freedom, unchained from the ground as you floated for a moment before Lucifer pulled you back to reality.

Your feet hit the rooftop once more and you were breathlessly aware of your heart beating in your throat. Your gaze snapped back to Lucifer once more, and you felt one of his hands lowering to your hip, the other still entwined with yours.

Lucifer leaned forward, and you with him.  Your back curved into an arch as he leaned above you, your lips inches from brushing against each other. You felt like exploding, those butterflies fluttering wildly in your stomach threatening to burst.

Both your mouths opened at once, and your words entwined with his as your lips moved once more.

Your caring touch abundantly clear,

It’s all i’ve ever known,

With you my dear, 

I surely fear,

My heart will never be my own.

As your song ended, you felt your heart and mind clear instantly as your truth had finally been told. The look of pure adoration in his eyes was enough to have you trembling under his touch. 

Lucifer pulled you back onto your feet, his breathing heavy and the feathers on his wings ruffled. 

With both hands on your hips, you reached forward and cupped his face. Heat spread across your body as your fingers grazed across the small wisps of hair that curled around his ears.

“Darling, I-”

Before you could let him finish his sentence, you squeezed your eyes shut, and planted your lips against his. He froze for a moment, his breath hitching, before his hands around your waist tightened and he deepened the kiss.

You moved your hands from his face and instead wrapped your arms around his neck, grasping at his shirt collar with hungry desire.

His scent washed over you, and you drank it in with desperation. A sweet, crisp dose of apple cinnamon mixed with faint traces of roses. You thanked Heaven in that moment, for releasing them from their grasp, and right into your arms down here in Hell. 

Your knees hit the ground the same time as Lucifer’s, and you felt the soft touch of his wings as they wrapped around you. Blanketing the two of you from the prying eyes of all the realms. 

He pressed his face harder into yours as he cupped the small of your back. His teeth grazed the bottom of your lip, and you parted your mouth slightly, locking the two of you together even more intensely. 

His lips left yours, and he planted feverish pecks across your cheek all the way to your earlobe. He bit tenderly on it, and you had to squeeze your lips together to stop from whimpering. He continued, trailing down your neck with hungry kisses, before burrowing his face into your shoulder blade.

You felt his teeth graze the artery in your neck, and you gasped, grasping at his hair desperately as pleasure coursed through your veins. His breath hot against your skin, tickling it.

“Fuck,” You moaned, and his response was to push you farther into bliss as he suckled on your neck. Waves of pleasure hit you once more, and you began to sloppily kiss the top of his shoulder, slightly exposed from your roughhousing.

Lucifer tightened his grip around you, pulling you as flush to his body as he could manage. You both sat there on your knees in a mix of breathless gasps and hums of pleasure.

You did not want this moment to end. Finally, the both of you had opened yourselves up to your true feelings. You smiled at the thought, and planted a kiss on his earlobe as he lifted his head slightly from your neck.

Suddenly, the watch on Lucifer’s wrist buzzed violently, and you heard him curse under his breath.

“Is that for your meeting?” Your voice came out in a hoarse whisper.

“Unfortunately,” He grumbled, before switching off the noise. He didn’t move from his position though, and you realized he was going to try and skip out on it.

“You should go.” You spoke, almost a command.

“Why? They’ve been fine without me for this long.”

“You’re the king,” You retorted, meeting his gaze sternly, “Go do your job, i’m not going anywhere.” 

His look of distraught at having to depart sent another wave of butterflies into your body. You couldn’t help but smile before giving him another quick peck on the lips.

“Go.”

“Fine.” 

You both stood up, and his wings uncurled around your body, disappearing into his back. His fingers still with yours, as he reached down for his hat that lay on the ground beside you. You released his grip and fixed his bow tie. Pulling his overcoat back neatly onto his frame, and adjusting it slightly. 

You wiped the sweat off his forehead and smoothed down his hair. Attempting to tidy him up as quickly as you could so he wouldn’t be late. He smiled warmly as you fussed over him.

“Now, if you don’t mind,” You spoke softly, batting your eyelashes at him, “I need a way off this roof.”

He smirked, before grasping his staff and tapping it against the ground. 

A flurry of gold wafted around you, and that same energy tickled at the back of your neck just like it did at the art studio. His face blurring from the cascading waves of warm light that wrapped around you.

“See you soon, My Love,” His voice echoed as your eyes shut and you felt that pull of energy. That feeling of floating on thin air hit you again, as you were warped away. 

“There you are!” Angel dust threw his arms in the air in exasperation a few feet away from you, as the particles of gold that floated above you disintegrated. You blinked a few times, letting your eyes adjust to the lights in the lobby. 

“Where were you this morning? I had to watch the final episode all by myself!”

Shit. That’s right. You placed a hand on your forehead, berating yourself silently for forgetting. Although you weren’t too regretful about missing out on it for Lucifer.

“I’m so sorry, Angel. I just got.. busy, I guess.”

He shrugged, brushing off his slight irritation. 

“It’s alright, ain’t nobody hurt from it.”

He was going to turn away, towards the bar where Husk was readying drinks for the two of them, before his gaze narrowed in somewhere on your figure.

“Wait, what the fuck is on your neck?” He asked suddenly, his eyes giving you a questioning stare, as he motioned towards it.

You looked at him confused, before reaching up and running a few fingers down the side of your throat. Your eyes flew wide open in surprise, and your hand cupped your mouth as you felt it. Your cheeks set on fire instantly.

Apparently, as a final gift, Lucifer had left a rather large hickey in the crook of your neck. Both Husk and Angel leaned in to get a better look at it, their eyes widening in surprise. 

“That dickhead finally did it, huh?” Husk spoke up, a knowing smirk on his lips as he cleaned glasses behind the bar.

Angel’s eyes lit up in delight, and he squeezed his own cheeks as realization dawned on him.

“Fucking finally! Does that mean you two are a thing now?”

You contemplated for a moment, before meeting Angel’s gaze once more. A smirk growing on your lips. 

KeeKee appeared at your feet, rubbing at your ankles in greeting. You gingerly reached down and picked her up. She was so soft to the touch, and you caught the faint scent of Lucifer once more as she nestled into your chest.

“I guess so,” You finally replied once you situated the cat into your arms, “Now if you excuse me, gentleman, I need a breather.” 

Angel whistled flirtatiously behind you as you walked away, and you couldn’t help the growing heat that hit your cheeks once more.

——

a/n: let me know your thoughts!! i almost didn’t added the little singing bit but i cracked my knuckles and summoned the lyricist in me to have some fun. I mean, it can’t be Hazbin Hotel without a song right?

tag list: @ohnoivefallen @doodlebob2726 @coleisyn @loslox

[starcurtain]

More Phaidei Fics I Want to Read (Part 2)

1. The outsider POV one where the other members of the Kremnoan Detachment notice Phainon's... attention toward their prince much more than Mydei himself does. The absolute audacity of this so-called "Deliverer"! That's not just the Detachment's ruler, that's their pride and joy! If some upstart foreigner thinks he's going to be allowed to make eyes at their prince as if Mydeimos were a war prize to be won, Phainon's got another thing coming, prophecy be damned. If it means protecting Mydei's honor, the Kremnoan Detachment can be, and certainly will be, Amphoreus' most immovable wall. Unfortunately for them... Phainon is an unstoppable force. (Or: The one where Phainon gets cockblocked by an entire army, and no one thinks to ask Mydei his opinion on the matter until he finally has to settle the issue himself.)

2. The very silly comedy one where Mydei suffers a string of embarrassing accidental deaths in Okhema that wound his pride much more than they wound his body. In fact, the person most upset by the whole thing is (predictably) Phainon. Determined to put a stop to Mydei's streak of terrible luck, Phainon insists on forming the official "Mydeimos Protection Squad." Member Count: 1.33. (Trianne is helping.) In Nikador's damn name... It's going to be hard enough to recover his reputation after it gets out that Mydei actually managed to drown in one of the baths--does Phainon really need to act like this about it? And since when does being on a "Protection Squad" require Phainon to move in with him???

3. Beauty and Beast meets Mydei's Howl's Moving Castle AU: Okhema is a prospering magical city ruled by its beautiful and charming demigoddesses Aglaea and Tribios; however, their otherwise peaceful paradise has been haunted in recent years by a ghostly specter: a mysterious floating fortress that periodically darkens the skies, an unknown threat looming overhead. Rumors begin to spread of a terrifying "god of war" in the castle, one that devours beautiful maidens and lads without a hint of remorse. Curious and determined to solve the mystery of this castle in the air, Tribbie goes to investigate--and gets herself in terrible trouble when she discovers the rumors are seemingly true: the castle is ruled by a monstrous-looking beast calling himself the "soul of strife." Sealed away for trespassing, the only thing Tribbie can do is send out a desperate call for help through her other selves. Rallied to his leader's aid, Phainon, swordmaster of Okhema, steps up to help. There's no way he'll leave poor Tribbie to her fate--even if it means he has to exchange her freedom for his own. But there's more to this "beast" than meets the eye, and with both a powerful prophecy and the threat of a mad ancient god's legacy impending, it's up to Phainon to break a seemingly unbreakable curse--and secure his own happy ending.

4. The "in another life" one, but Phainon has all the memories--not just of the warm, golden days with Mydei in Okhema, but of everything that happened after, of the ultimate betrayal of trust, of the cold steel he plunged into Mydei's back... Their reunion in this new era was unintentional, unavoidable, and aching. The happy ending Phainon desperately desired all along is here, within his reach--and in danger of being ruined all over again. What horror will he bring to Mydei's life this time? Convinced that he doesn't deserve a second chance at happiness in their new life, Phainon does everything in his power to avoid Mydei. But even without all the memories of Amphoreus, Mydei has always been unstoppable when he sets his mind to something--and there's no way Mydei is going to let Phainon screw this up. (Not again.)

5. The canon divergent AU: Mydei's father King Eurypon avoids the trap of a self-fulfilling prophecy by refusing to throw his child into the sea, so Mydei is instead raised a beloved son of Kremnos by both his father and mother--but the kingdom's ultimate fate of destruction cannot be changed. Nikador still goes mad, and Eurypon and Gorgo's deadly duel still plays out when Gorgo rejects Eurypon's plan to use the mad god's power. But before a furious Mydei can avenge his mother, Nikador fully succumbs to the corruption of the dark tide and launches a brutal massacre against their own worshippers, claiming the lives of the king and half the castrum's populace. Forced to flee with the tattered survivors, grieving everything he knew and loved, Mydei is hurled into a role of leadership he is hardly prepared for and never truly wanted.

Only Kremnos's history has left them with no allies, and Okhema's Council turns away Mydei's every attempt at diplomacy. Desperate, with the weight of his entire people's safety on his shoulders, Mydei and the Kremnoan army lay siege to the holy city. If words alone cannot win them sanctuary, then it will be blood and blades that throw open the gates. But Okhema has a new champion, a swordmaster from afar who will stop at nothing to prove his worth to his new people, and it turns out this "Phainon of Aedes Elysiae" might be Mydei's only match--on the battefield and elsewhere.

(tl;dr: Enemies to lovers, meet-on-the-battlefield romance.)

[piscesbae7]

coriolanus and his pretty little best friend <3

trigger warning: coriolanus snow is a manipulative, whiny bastard!! discrimination against the districts, misogyny, self righteousness, sexual implications, sassy man apocalypse, etcetera!!

District bound for the foreseeable future and cheated out of the Plinth prize by his own hand, an 18 year old Coriolanus Snow’s thoughts often turn vile, driven by his maddening desire for revenge — against the war about nothing that had cost him everything, against the Districts, against dean Highbottom, against mother nature herself for taking his young self’s only source of light in childbirth.

If any positives are to be sought, he was rendered starving no more in the Districts — in exchange for slumming it in 12, mingling with morale lacking filth under the guise of serving his country, his basic needs were met. Late at night, when the barracks prove too noisy to sleep in due to the hushed ramblings of his fellow peacekeeping grunts, Coriolanus’ mind would drift to her. The Crane’s youngest daughter, who had begun to attend the Academy amidst his junior year — those who broke the strict dress code never ceased to irk him, serving as a cruel reminder of his calculatedly hidden class insecurities; but he found himself unable to be truly vexed by the darling bows she adorned in your hair, the sparkly pink lip gloss she thought unnoticeable to those unsuspecting. He knew by the end of the first semester, he simply had to have her.

And as it would seem, fate had other plans for him — a Snow, diminished to serving in arguably the lowliest of Districts? The mere concept is laughable. With each and every boyish string cut — the luckiest of which being Sejanus, clearly, as Strabo Plinth took it upon himself to give his dear boys inheritance to his self proclaimed brother — he was back in the Capitol just in time to begin University.

Not long after returning, he purchased an opulent penthouse separate from Grandma’am and Tigris with a small chunk of his fat, newly granted inheritance, assuring the two of them are taken care of entirely before he takes his leave. It’s still on the Corso, of course, but with the gained luxury of beginning his adulthood on his terms. Not long after settling into his shiny new bachelor pad, he offered his darling girl her own room in his home — after requesting her parents permission, of course. While he thinks Mrs. Crane a sentimental fool and Idmon Crane a slimy bastard, he’d paid his dues in kissing their asses whilst in the Academy — therefore, he feels owed the companionship of their now only daughter. He’d weaseled his way into her life through becoming Arachne’s science partner, though her death is what truly solidified their lifelong friendship — he’d wiped the tears from her pretty face, coddled her endlessly and swore never to rest until payback was had on the Districts for their barbaric, senseless violence. Arachne deserved what she got, of course, but he didn’t dare say that aloud.

With his somewhat self detrimental work ethic and blossoming desire for power, Coriolanus graduated University in 2 years rather than 4, the Valedictorian of his class. Now that she lives in his home and is partially provided for by him, a proposal is an unspoken expectation amongst their friend group and families — with Coriolanus’ ability to swiftly clime the ranks, as he was given the role of co- Head Game-Maker almost immediately upon his graduation, any young lady would be lucky to become his bride!

Bitterness and cynicism had long ago dominated his mind, plagued his relationships. Oh, but he adores his girl. Perhaps it isn’t love — he isn’t quite sure he’s capable, after being foolishly conned by Lucy Gray — but he feels as if he owns her. She is his to provide for and to protect, to have and to hold. Over his dead body would he allow some silly boy to steal her from his grasp — she’s to be Mrs. Coriolanus Snow, in due time. Unbeknownst to her, a ring with a price tag fat enough to feed an entire District for a year is awaiting being picked up at the jewelers this very week — a beautiful, richly colored ruby, surrounded by glittering diamonds; nothing lab grown, as the price increase for mined ones are well worth the bragging rights.

The lighting in his study is dim, on the middle setting, as he burns the midnight oil — so to speak — attempting desperately to finish the tonight draft of his latest Game proposal before he retires to bed for the night. His gelled back, platinum blond hair is messed up past what he’d ever show his face with in public by now, his tie strewn across one of the overstuffed armchairs in the corner of his office and his cufflinks neatly pushed beside his fathers watch, rested on the antique mahogany of his desk. The crack of the door and a pair of hands daintily rested upon his shoulders alert him to his sweet girls presence rather than the usual tell-tale announcement of her heels click clacking against the hardwood flooring, the silk material of her nightdress smooth against the side of his head as she leers over him in an attempt to catch a sneak-peak of his proposal.

“Just a few more pages, I promise.” Coriolanus claims, sighing heartily as he leans back in his chair. He glances at his watch — the time reading 5 past 1 AM — before running a hand through his hair. Unsettlingly blue eyes now fixed upon her smooth, glittery eyeshadow free face, he takes her wrist and presses a kiss to the palm of her hand. He prefers her this way, he thinks, free from the intricately made confines of the Capitol’s latest fashions, in merely her pajamas — so utterly his. God forbid anyone catch him acting such a way; Festus had, once, having stumbled upon them giggling like lovesick fools in a secluded hall of the Heavensbee’s manor, having snuck away from last years reaping party. He’d snickered before walking away, insisting Coriolanus was ‘pussy whipped’ — the thought was so crude he thought it almost laughable; if only she’d let him get so far.

“I’m afraid there won’t be any essays if you drop dead of exhaustion.” She comments, sarcasm more prominent than worry in her tone, sweet like summer rain no matter what she’s speaking of.

“There won’t be a thing if I don’t get these wretched plans approved.” The blond sulks, his never dormant desire to poke and prod at her boundaries bubbling up alongside his instinct to wallow in loathing for Volumnia Gaul. He grabs her wrist, yanking her to stand in between his legs.

Draped in silk and heavy velvet, a chiding sort of smile appears on her features. “Coriolanus.” She scolds — Coryo is saved for his redeeming, chivalrous moments, which are slim to none nowadays. It isn’t necessarily that she’s a pure hearted saint — she had starred in a rather raunchy musical during her time in the Universities theater program as a freshman, thank you very much — she simply knows she’s worth a fat diamond ring and a prestigious last name before gracing any man with a thing. Certainly Coriolanus would have bored of her by now, had she granted him what he seeks. He is very much aware of that — but, a Presidential hopeful undoubtedly needs a wife, and Miss Crane will do just fine.

“My father would have a heart attack.” She reasons, a little gasp falling past her lips as borderline manhandles her, tugging her down onto his lap.

“He would.” Coriolanus agrees with a soft chuckle, cocking his head to the side slightly to gaze at her properly. He adored her propriety, not partaking in the same sexual promiscuity as many of your shared peers — as the call girls he’s visited on more than one occasion. A rare gem indeed. Greedily, he sinks his fingertips into the flesh of her plush hips, shifting to sit up beneath her.

“He should be thankful I remain a gentleman, even in private.” He reasons, shamelessly burying his face against the soft skin of her breasts, sighing as he inhales the heavenly scent — rose and vanilla — of her now signature perfume, the one he’d gifted her over the holidays. His perfect girl, through and through.

“If I were a lesser man, I would do far more to you than simply pull you into my lap.” The Game-Maker promises, voice somewhat muffled by the steady, open mouthed kisses he’s littering where her velvet robe is fallen open.

She simply sighs in discontent, feigning propriety in a surface level attempt to keep the upper hand. The gossip rags remain correct in her newfound title — the gem of Panem — sickeningly desirable with her conditional affections and good family name.

“Enough.” She finally finds it upon herself to insists, smothering a girlish grin before it can fully blossom as she steadied herself against his broad shoulders, feigning being scandalized at his vulgar implications, his desperate touches. Standing up, she wraps her robe tighter around herself, leaning against the edge of his desk — careful not to slide around any important documents regarding his work. All the riches he spoils her in and necessities he provides for her aside — they aren’t yet married! Simply the best of friends.

Coriolanus groans lowly in disapproval, reluctantly letting her hips slip free from his eager grasp. He leans his head back, resting it against the back of his heavily padded leather chair. Although he remains immensely disappointed that he cannot have his darling girl in his arms anymore, watching her strut around tauntingly in her silk nightgown and velvet robe was — and will eternally be — pleasing on the eyes.

He sighs once again, reaching forward to tug at her hand. "Cruel woman." He accuses, a hint of frustration in his tone.

“It’s already far past midnight. Come sleep with me.” Coriolanus prompts, dangling the enviable thread count of his comforter and sheets so silky they’re borderline sinful as one would a prettily bundled ball of yarn to an awaiting feline.

“Shameless.” Is all she has to say in response, turning her nose up at him as if he’s insulted her entire bloodline and requested she drop out of University to pursue a career as a high dollar whore, secluded to his spacious office downtown.

She leans down, pressing a dainty kiss to his clean shaven cheek — a token of her affection, rendered precious due to the scarcity.

“Goodnight.” She offers with a squeeze to his tense shoulder, before sauntering off to her professionally decorated bedroom down the hall and leaving her political-to-be best friend to brood in the solitude of his own company.

Coriolanus sighs heavily, glancing to the grandfather clock on the wall of his study. How a silly young woman with more fashion sense than brains has managed to wrap him around her perfectly manicured finger is beyond him — perhaps he should beckon a call-girl over to the penthouse, he ponders, endlessly fed up with her playing hard to get.

But, alas, there is an essay to be completed — a Presidency he strives for, respect he demands — so, tomorrow, maybe.

Realistically? Not even then.

If all else fails the young Snow, his delusion prevails — his sense of spite, branded to him permanently as a result of all he’s lost. It’s saved him many-a-heartbreaks, really — Crassus would most definitely be proud of the dictator-to-be, strikingly resembling him in more ways than one.

not proof read oopsie