#Gene Expression Regulation

[simonh]

Protein Modules In Signal Transduction: A Lecture by National Library of Medicine Via Flickr: Series Title(s): NIH director's Wednesday afternoon lecture series Contributor(s): Pawson, T. National Institutes of Health (U.S.). Medical Arts and Photography Branch. Publication: [Bethesda, Md. : Medical Arts and Photography Branch, National Institutes of Health, 1998] Language(s): English Format: Still image Subject(s): Signal Transduction, Gene Expression Regulation -- physiology, Eukaryotic Cells -- physiology Genre(s): Posters Abstract: Black, orange, and red poster with a visual representing signal transduction. Details of the event are also given. Extent: 1 photomechanical print (poster) : 71 x 41 cm. Technique: color NLM Unique ID: 101456172 NLM Image ID: C02937 Permanent Link: resource.nlm.nih.gov/101456172

[catboybiologist]

half baked morning rant

I do want to make it clear that the reason I talk about HRT and its biological effects so much is not because HRT or medicalization defines your gender.

Its because, for me personally, the interface of my biology education and my transition was mostly centered around figuring out what sex hormones do. I learned about basic biology principles like DNA organization, gene regulation, cell biology, and physiology in high school and undergrad. Taking that understanding and extending it to the mechanisms that hormones use to change gene regulation, and by extension, the rest of your body broadly, was something I did as my understanding became more complete in later undergrad and grad school. It was the key to me starting my own transition.

Why?

Because it was the first time I realized that the "basic biology" arguments of transphobes were complete and utter bullshit. From that point, it was a cascade. As in, wait, if dynamic changes in gene expression aren't considered "biological" to them, then why am I believing anything they say about anything else? When they talk about gametes, and try to include infertile cis people in their definitions of biological sex by talking about what gamete you're "intended" to make, what do they even mean? Why does my current gene expression not define that "intent"? And wait, back up, why is the brain suddenly not considered part of our biology? Why are neurological differences suddenly not "biological"? Why can we say someone's thinking patterns aren't "biological"?

Backing up even further, why does any of this matter more than psychological gender, or sociological gender? If the way we navigate society is gendered, that affects a lot of our lives, and we're just throwing that away?

Basically, being educated about how deep the biological changes of HRT really go was the first domino to fall when I worked through my internalized transphobia.

This is one of many reasons why I hate, hate HATE the concession that uninformed allies and even many trans people themselves give: "well NO ONE is saying that you can change your biological sex, sex and gender are completely unrelated, sex is binary and gender isn't!!!!!"

Well. I am saying that you can change your "biological" sex, I am saying that biological sex isn't binary, and I am saying that misunderstanding of those points has set back transgender advocacy. It makes medical decisions surrounding us less informed, it poisons conversations about how we interact with society, and it makes trans people feel like their gender and sex are less "real" than cis people's.

Not to mention the horrific way it discards intersex people from the conversation entirely.

Recently, I've seen this point enter the mainstream a little, by using intersex people and variation of sex in other species as a "counterargument" to "binary biological sex" thinking. It still doesn't sit right with me. One, because it uses intersex people as a prop for trans advocacy while not actually addressing the needs of either group. And two, because it completely disregards that your current biology and physiology is not 100% predestined from birth, and using people who were "born this way" as a prop does absolutely nothing to increase people's acceptance of trans people who change their biology later in life.

Ugh. This got away from me but yeah. That's my sipping coffee ramble for this morning. If anyone wants to add comment or correct me on discourse here, please do. Especially if you're intersex- this is all the observations of a perisex trans woman.

[evidence-based-activism]

Could you do a post on whether sex is binary or not please? Love your blog and appreciate how much effort you put into it!! Huge respect.

Thank you!!

Sex is Binary

Despite efforts to confuse matters, there's one simple fact that underlies the sex binary in animals: anisogamy.

Anisogamy refers to the difference in size of the two types of gametes [1, 2]. Gametes are the sex cells (eggs and sperm), which are combined during sexual reproduction [2]. By definition [3, 4], the females produce the larger gamete (the egg or ova) and males produce the smaller gamete (the sperm).

There are no intermediate gametes; therefore, there are no additional sexes. No human has ever produced both ova and sperm; therefore, every human is either female or male.

Importantly, the sex binary is not equivalent to sexual differentiation or sexual dimorphism. (Although they are strongly correlated.)

Sexual Differentiation

Sexual differentiation refers to the process in which "male and female sexual organs develop from neutral embryonic structures" [5].

Every embryo has both precursor structures: the Müllerian duct, which can develop into the female organs, and the Wolffian duct, which can develop into the male organs. Once sexual differentiation begins, one of these precursor structures will develop into maturity, and the other will atrophy. [5]

In humans, the process of sexual differentiation is controlled by various hormonal secretions by the embryo at specific times during development. These hormonal secretions are determined by the genetic makeup of the fetus. For example, the SRY gene, found on the Y chromosome, regulates the expression of multiple genes which together result in the differentiation of Sertoli cells. In the third month of development, the Sertoli cells secrete Müllerian inhibiting hormone, which initiates the atrophy of the Müllerian duct. [5, 6]

Importantly, therefore, the process of sexual differentiation depends on biological sex. Or, as this article [1] puts it, sexual differentiation is a consequence of biological sex. In a healthy organism, the embryo has the genetic instructions necessary to initiate the process of sexual differentiation that will ultimately result in the production of either ova or sperm (which defines biological sex). This expected capacity or "developmental trajectory" allows us to categorize an organism's sex even in the absence of successful gamete production. Put simply, the organism's biological sex is defined by the gamete they would have produced, had they been capable of producing a gamete.

Disorders/differences of Sex Development (DSD, Intersexism)

The complex process of sexual differentiation can be disturbed at various points, which can result in disorders/differences of sex development (i.e., intersexism). Importantly, however, every embryo starts out with the capacity to produce only one type of gamete. [5]

Further, the development of the ovary is not a "default pathway" [6, 7]. Instead, ovarian development is an active process that necessitates the activity of many factors. The mere absence of complete instructions for male development does not mean a fetus will undergo normative female development.

In other words, each embryo has the genetic instructions necessary to develop the capacity to produce either sperm or ova. However, genetic mutations in many different genes can disrupt this normative development, typically resulting in the absence of any gamete production. These individuals still have a biological sex of either male or female; it is simply determined by which gamete they would have produced had they not had their genetic mutation(s) and instead undergone normal sexual differentiation.

Astonishingly, despite the many possible points of disruption in sexual differentiation, the frequency of genuine intersex conditions is extremely low. Based on the definition of biological sex and our understanding of sexual differentiation, we can describe intersex conditions as conditions in which an individual undergoes some degree of sexual differentiation that is inconsistent with the differentiation for their expected gametic production.

In practical terms, this means that intersex conditions include cases where an individual's chromosomal sex is inconsistent with their phenotype (primary sex characteristics) or they have an ambiguous phenotype. Using this definition, we can estimate that approximately 0.018% of the population has an intersex condition. [8]

And allow me to emphasize again, that these individuals are still either male or female. Their sex can be identified by what type of gamete they would have been capable of producing, had they not had a genetic condition that disrupted their sexual development.

Another way to think of this is that, had these individuals actually been the opposite sex, their genetic mutation would not have impacted their sexual development. For example, people with Complete Androgen Insensitivity Syndrome (CAIS) have a genetic mutation that means their "cells do not respond to testosterone or other androgens", leading to female-typical external genitalia.

This genetic mutation only disrupts the sexual differentiation of biological males. If this person had been biologically female, their sexual differentiation would have proceeded normally. It is possible they may have some other health condition, but they would not have an intersex condition.

Further, the occasional disruption of a biological process does not negate the validity of that process for the species. For example, normative human development results in the development of two (complete) arms and legs. However, some humans are born missing part or all of one or more limbs, which is called limb reduction. In fact, the frequency of this is estimated at 0.05%, which is almost three times greater than intersex conditions. Despite this, we understand that the statement "humans have two arms and two legs" is accurate and does not imply the absence of non-normative phenotypes. [9]

And, in addition to all of this, people with access to modern medicine do not go their "whole life" without knowing they are intersex. Intersex conditions that are not associated with ambiguous genitalia will generally be identified at the onset of puberty or when investigating the cause of infertility. If you were not identified as having an intersex condition at birth, you underwent typical puberty, and you are not having fertility issues, you are not intersex. If you did not undergo typical puberty and/or you are infertile, you may have an intersex condition, but there are also many other more common conditions that cause these issues.

People (now or in the past) who did/do not have access to modern medicine may not have been identified as having an intersex condition if it was not physically obvious at birth/puberty. However, these individuals would present with later health issues, including, but by no means limited to, infertility.

Sexual Dimorphism

Most of the arguments suggesting sex is not binary are based on the assertion that either (1) humans are not sexually dimorphic or that (2) the partial overlap in dimorphic traits suggests a continuum in human sex. Neither of these is true.

First, I've recently made a post on sexual dimorphism, describing a sample of the many ways humans are sexually dimorphic. Hopefully, that is sufficient to refute the first assertion.

Second, I state in that same post that:

It's important to note that it is not necessary for there to be absolutely no overlap between the sexes for any particular characteristic to be considered sexually dimorphic. It is merely necessary for there to be an average difference on the population level. We should also note that, due to the many, many traits in which humans are sexually dimorphic, an individual with an opposite-sex-average trait will typically still be same-sex-typical for the many other traits.

In other words, sexual dimorphism is not equivalent to biological sex, but a consequence of it. Biological sex normally determines sexual differentiation which in turn determines sexually dimorphic traits. However, while there is some degree of overlap in sexual dimorphism (e.g., a man may be as tall as the female-average), there is no overlap in biological sex (i.e., a human cannot produce both eggs and sperm).

(Also, for the Anon who sent a video from an "advanced biologist". See the above for the difference between the sex binary and sexual dimorphism and the relevance of intersexism.)

I hope this helps, Anon!

References under the cut:

Goymann, W., Brumm, H., & Kappeler, P. M. (2023). Biological sex is binary, even though there is a rainbow of sex roles: Denying biological sex is anthropocentric and promotes species chauvinism. Bioessays, 45(2), 2200173.

Sexual Reproduction. Britannica, 15 Feb. 2025, https://www.britannica.com/science/sexual-reproduction.

“Female.” Merriam-Webster.com Dictionary, Merriam-Webster, https://www.merriam-webster.com/dictionary/female.

“Male.” Merriam-Webster.com Dictionary, Merriam-Webster, https://www.merriam-webster.com/dictionary/male.

Sexual Differentiation. Britannica, 3 Dec. 2018, https://www.britannica.com/science/sexual-differentiation.

P A, Aatsha, et al. “Embryology, Sexual Development.” StatPearls, StatPearls Publishing, 2025. PubMed, http://www.ncbi.nlm.nih.gov/books/NBK557601/.

Witchel, S. F. (2018). Disorders of sex development. Best Practice & Research Clinical Obstetrics & Gynaecology, 48, 90-102.

Sax, L. (2002). How common is lntersex? A response to Anne Fausto‐Sterling. Journal of sex research, 39(3), 174-178.

CDC. “Limb Reduction Defects.” Birth Defects, 30 Dec. 2024, https://www.cdc.gov/birth-defects/about/limb-reduction-defects.html.

[o-craven-canto]

From Cameron D. E. et al. (2014), A brief history of synthetic biology: a selection of simple machines that can be built inside living organisms by using gene expression and regulation as parts.

For the sake of illustration, the purpose of all these machines is to start the expression of Green Fluorescent Protein (GFP), which does exactly what the name suggests.

(Note: italics are used for the name of genes, and not for the proteins they encode. The gene GFP encodes the protein GFP.)

Toggle switch. Two genes, lacI and cI, repress each other's transcription (repression is represented by the T-shaped end of a line, an transcription by the bent arrow), so that exactly one of each can be expressed at any given time. This occurs because the expression of each gene is a repressor protein that binds to the control region of the other, making transcription impossible. Since GFP is consecutive to cI, the former is only expressed together with the latter. The enzyme called IPTG deactivates the repressor lacI, starting the transcription of cI and therefore GFP: the fluorescence switches on, and lacI remains inactive because cI is repressing it. If heat is applied, then cI is deactivated: lacI is expressed, lacI deactivates cI, and the fluorescence switches off.

Purpose: gene expression that can be cleanly switched on and off by simple inputs.

Repressilator. A circuit in which lacI represses cI, cI represses tetR, and tetR represses both lacI and GFP. In each cell, a signal of repression travels through the whole circuit: the repression of tetR allows the expression of lacI, which represses cI, which reactivates tetR, and vice versa. The expression of GFP, and therefore the cell fluorescence, fluctuates over time in a regular cycle.

Purpose: gene expression that cycles over time.

Autoregulatory circuit. The gene tetR, concatenated to GFP, represses its own expression. Whenever too much tetR and GFP are produced, the expression regulates itself down, so that in a large population there is much less variation in fluorescence: all cells converge to a moderate value. (remember?)

Purpose: gene expression that is kept moderated in a population of cells.

Modular riboregulator. Control acting later in gene expression: not on DNA -> RNA transcription, but on RNA -> protein translation. Transcribed GFP is connected to a sequence that inhibits translation by folding over and preventing the ribosome from attaching to the RNA. A separated activator RNA binds to this sequence and prevents it from preventing translation.

Purpose: a second tier of control over gene expression.

Two-input AND gate. Logic gates with genes! Expression of GFP requires a promoter encoded in T7, which in turn is only expressed in the presence of arabinose. However, the promoter only works if it's modified by by RNA produced by supO, which is only expressed in the presence of salicylate. Therefore, GFP is only produced if both arabinose and salicylate are present at the same time.

Purpose: protein synthesis that only occurs if multiple conditions are verified.

Multicellular pattern formation. This one is meant to be used in large cell populations. The gene luxI in the "sender cell" encodes an enzyme that produces AHL, a signal molecule. This molecule may bind to LuxR receptors in the "receiver cells". LuxR binding AHL activates the expression of cI, which stops the expression of lacI, which stops the expression of GFP. However, lacI can also be directly activated by binding AHL, so that only an intermediate concentration of AHL results in producing the fluorescent protein. By adjusting the sensitivity of LuxR, GFP and RFP can be produced selectively at different concentrations of AHL, and therefore at different distances from the sender cell.

Purpose: spatial control of gene expression.

Relaxation oscillator. Similar in concept and purpose to the repressilator, but the cycle it creates is more stable and regular. araC activates GFP, lacI, and itself; lacI represses GFP, araC, and itself.

Recombinase-based logic. GFP is flanked by sequences that can be inverted by the recombinase enzymes Rec1 and Rec2 (Rec1 inverts whatever is between the blue boxes, and Rec2 what's between the orange boxes, respectively). Arranging the markers around GFP in different ways allows the construction of different logic gates. In the case of the AND gate, the transcription in the blue region is going in the wrong direction, and GFP is also backward; both recombinases must be active for GFP to be expressed. In the case of the OR gate, transcription begins in both the blue and the orange region, but goes in the wrong direction in both; it's sufficient for either to be inverted by one recombinase to express GFP. In the case of the NOR gate, transcription already proceeds well, as long as both recombinases are absent.

Purpose: construction of arbitrarly logical circuits; very precise conditional control of gene expression.

Edge-detection circuit. A modification of the quorum-sensing system used for the multicellular pattern. The cell colony is exposed to light, half-covered by an opaque mask. Cells in the dark express the luxI gene, producing the AHL signal, as well as cI; the sensor that activates the expression of these two genes turns off in the light. The gene lacZ leads to the production of a black pigment; it is activated by LuxR (the receptor of AHL), and repressed by cI. Therefore, the black pigment is only produced in cells exposed to light (no expression of cI) which are adjacent cells in the dark (low-sensitivity LuxR receiving AHL from neighbors).

Purpose: mark edges between areas with different conditions.

[mindblowingscience]

In a study published in Nature Structural and Molecular Biology, scientists from the Department of Medical Biochemistry and Biophysics at Karolinska Institutet, have discovered that water molecules play a crucial role in helping proteins, specifically transcription factors, read and regulate the human genome. Only approximately 1% of our genome consists of genes, sections of DNA that specify the structure and function of proteins. Protein-coding genes are highly similar among mammals, with most differences between humans and other animals arising from how gene activity is regulated. Proteins called transcription factors regulate gene activity so that only a necessary set of genes is switched on at a particular place and time. Each transcription factor recognizes and binds to a unique short DNA sequence, most often located in the 99% of the genome that does not encode proteins. Binding of transcription factors either increases or decreases the expression of nearby genes.

Continue Reading.

[calina-alda]

give me your post-viral wesker physical/bodily hcs please. what's he look like in there... do you have any pg67 function headcanons. the masses must know! (if you want to share, of course... i saw biology and i ran in here)

Okay so first of all congratulations, because with this question you accidentally triggered two of my fixations, resident evil lore and biology. So naturally I spent way too much time thinking about this at a molecular level, and emerged with a little manifesto on 'what the virus does to Wesker'.

Okay, lets get into it!

The virus inserts viral DNA directly into the host’s genome, permanently altering Wesker's genetic code. It targets specific stem cell populations to overwrite genetic instructions. These new genes code for synthetic proteins that give his body enhanced abilities. The virus functions similarly to an engineered gene therapy vector, but instead of fixing a mutation, it adds entirely new capabilities:

Healing Factor

• Wesker’s body heals stupidly fast. Bullet wounds seal up in real time. It’s not just fast, it’s efficient. No scar, no bruise, just gone. That’s because of proteins, that promote extreme tissue regeneration by accelerating transcription of growth factors.

• The viral DNA triggers production of proteins that upregulate mitochondrial efficiency. So his cells are constantly in overdrive, replicating and regenerating at insane speeds. That kind of process would literally melt a normal person from the inside out, but the virus keeps him juuuuust stable enough to survive it.

• That means he burns through nutrients and energy at an insane rate. But he still eats very little because his body has learned to metabolize efficiently.

• Because of this, he doesn’t get sick. Like, ever. No flu, no fever, nothing. His immune system probably nukes bacteria before they finish replicating.

Strength

• A key viral protein might mimic myostatin inhibitors, increasing muscle mass without bulk, think insane strength in a lean frame.

• He could punch a hole in reinforced steel if he wanted to, but the scary part is that he doesn’t. He holds back all the time. He can crack a man’s ribs with one hand, or gently zip up your jacket without pulling the tab off.

• His control is off the charts. He’s not just strong, he’s precise. Every movement is calculated.

Eyesight & Senses

• He sees more than most people. Infrared, low light, motion trails, his vision is layered. The world probably looks like a high-contrast heatmap half the time.

• That’s why he wears sunglasses 24/7. Not just for the aesthetic (though let’s be real, it’s working), but to help with light sensitivity. Without them, he’d probably get visual overload in a well-lit room. (Okay, Gojo Satoru)

• His hearing is sharp too. Not supernatural, but he can pick up your heartbeat if you're close enough. It makes sneaking up on him borderline impossible.

The PG67A/W Serum

• The serum is a lifeline. The virus is unstable on its own, the host cells try to over-replicate or misfire signals, leading to cellular death or mutation.

• PG67A/W likely acts as a suppressor or regulator, binding to specific viral receptors or feedback loops, controlling gene expression and inhibitory enzyme systems to keep certain proteins from overexpressing.

• He doses every 6 to 8 hours. He keeps spares on him at all times. If he’s on a mission, he builds his entire schedule around those injections.

• He hides injection sites on his inner thigh, shoulder, or hip, places easy to reach but not visible.

Body Temperature

• His body runs hot. Like, unnaturally warm to the touch, like 39°C on a normal day. You could probably use him as a space heater.

• He doesn’t sweat much, but if he’s pushing his limits, the heat builds up fast. He’ll disappear for a cold shower or just stand in front of an AC vent for five minutes without saying anything.

• Resting heart rate? Low. Like athlete-low, sometimes around 40 bpm. But if he moves into combat mode, it spikes instantly. Controlled tachycardia, probably tied to the virus.

Time Perception & Reflexes

• The virus likely alters neurotransmitter uptake and synaptic plasticity, enhancing reaction time and cognition. It increases dopamine and norepinephrine sensitivity, creating hyper-alertness without overstimulation.

• Neural conduction speed may be boosted by: enhanced myelination of neurons. Modified ion channels that allow faster action potential firing.

• The result? Time feels slower to him. His brain processes information so fast that everything else seems like it’s moving in slow motion. That’s why he reacts before you even finish blinking.

• But it’s also exhausting in a subtle way. Conversations feel slow. Meetings drag. He lives in a world that’s slightly out of sync.

Mutation Risk

• He’s constantly on the edge. The virus wants to take over, it wants him to evolve into something monstrous. He keeps that in check with raw willpower and serum, but it’s always there.

• He has nightmares about it. Not dying, mutating. Losing himself.

Aging

• The virus triggers production of novel proteins that tabilize telomeres.

• His aging basically stopped. He should be pushing 50, but he still looks like he’s in his late 30s at most.

Touch & Intimacy

• His body doesn’t regulate hormones quite the same anymore. He can feel arousal, desire, etc., but it’s slower to build and hits harder when it does.

• And his stamina...He doesn’t get tired, doesn’t lose focus, and has total control over his body. He can go for hours without so much as breaking a sweat, and he’s frustratingly composed the whole time

Pain Response

• The virus likely alters his nervous system, especially the nociceptors.

• Instead of fully shutting off pain, it modulates the intensity, filtering it through a “useful or not” lens.

• So he still feels pain, but it’s dulled. A knife wound feels like pressure. A gunshot is just an annoyance.

• He can weaponize it too. Take a hit, stay standing, stare you down without even flinching, smile on his face, it’s terrifying. And he knows it.

Anyway. That’s the gist of what I think is going on inside Wesker’s terrifyingly efficient, (incredibly attractive) body. Please note:

• I did have microbiology, but I’m studying environmental science.

• I am not a virologist or Umbrella scientist (tragic, I know), just someone who thinks too hard about fictional men with god complexes.

• Also, I had to use a translator for like 40% of the fancy terms because my English science vocab just noped out halfway through. So if something sounds too text book, blame the language barrier

Thank you for enabling me, lol

[bestanimal]

Round 3 - Cephalopoda - Sepiolida

(Sources - 1, 2, 3, 4)

Order: Sepiolida

Common Name: “bobtail squid”, “dumpling squid”, or “stubby squid”

Families: 1 - Sepiolidae

Anatomy: no internal shell; 8 small, suckered arms and 2 tentacles; rounded mantle; bioluminescent due to symbiotic bacteria

Diet: small crustaceans, mollusks, fish, and annelids

Habitat/Range: shallow coastal waters of the Pacific Ocean, some parts of the Indian Ocean and Atlantic Ocean, and on the west coast of the Cape Peninsula off South Africa

Evolved in: unknown

Propaganda under the cut:

Bobtail squid have a symbiotic relationship with bioluminescent bacteria (Aliivibrio fischeri), which live inside a special light organ in the squid's mantle. The luminescent properties of the bacteria regulate gene expression in the light organ. The bacteria are fed a sugar and amino acid solution by the squid and, in return, camouflage the squid's silhouette when viewed from below by matching the amount of light hitting the top of the mantle. Symbiosis with A. fischeri from the surrounding seawater is initiated immediately upon the bobtail squid’s hatching, and the bacteria's colonisation of the juvenile’s light-organ induces morphological changes in the squid that lead to maturity.

Unlike most other cephalopods, Sepiolida are iteroparous and a female can lay several clutches, each consisting of 1–400 eggs (dependent on species), over her estimated one-year-long lifetime.

The Common Bobtail Squid (Sepietta oweniana) is known to have one of the shortest life spans among cephalopods. They can reach maturity in about 6–9 months.

Common Bobtails are estimated to begin declining due to climate change, as the waters during their reproductive seasons may be too warm for their eggs to develop.

[covid-safer-hotties]

Reference saved in our archive

An interesting pilot study showing a probable biomarker for long covid.

Abstract

Introduction: Long COVID is a debilitating condition that lasts for more than three months post-infection by SARS–CoV–2. On average, one in ten individuals infected with SARS CoV- 2 develops Long COVID worldwide. A knowledge gap exists in our understanding of the mechanisms, genetic risk factors, and biomarkers that could be associated with Long COVID.

Methods: In this pilot study we used RNA-Seq to quantify the transcriptomes of peripheral blood mononuclear cells isolated from COVID-recovered individuals, seven with and seven without Long COVID symptoms (age- and sex-matched individuals), on average 6 months after infection.

Results: Seventy genes were identified as significantly up- or down-regulated in Long COVID samples, and the vast majority were downregulated. The most significantly up- or downregulated genes fell into two main categories, either associated with cell survival or with inflammation. This included genes such as ICOS (FDR p = 0.024) and S1PR1 (FDR p = 0.019) that were both up-regulated, indicating that a pro-inflammatory state is sustained in Long COVID PBMCs compared with COVID recovered PBMCs. Functional enrichment analysis identified that immune-related functions were expectedly predominant among the up- or down-regulated genes. The most frequently downregulated genes in significantly altered functional categories were two leukocyte immunoglobulin like receptors LILRB1 (FDR p = 0.005) and LILRB2 (FDR p = 0.027). PCA analysis demonstrated that LILRB1 and LILRB2 expression discriminated all of the Long COVID samples from COVID recovered samples.

Discussion: Downregulation of these inhibitory receptors similarly indicates a sustained pro-inflammatory state in Long COVID PBMCs. LILRB1 and LILRB2 should be validated as prospective biomarkers of Long COVID in larger cohorts, over time and against clinically overlapping conditions.

[pooksgetspooked]

Teacher’s Pet

Summary: Leon was never good with people. Not since Raccoon City, not after the DSO, and certainly not after he’s involuntarily signed up to be a temporary professor at a University. He simply didn’t have the same charm that others envied, so thank the heavens he didn’t have to be when you were there to charm him instead.

Pairing(s): Professor!Leon s. Kennedy x Student!Fem!Reader

Word Count: 3.6k

Content Warnings: MDNI! Age gap, Both of them are a bit of a creep, But they’re cute so it’s okay, Obsessive & Stalker undertones

“So, does anyone have an answer for this first question? Yeast deletion library can be used to validate tumor suppressor genes identified in tumors from humans. From such studies, we can infer that these genes function mainly as…? Anyone?” A lengthy silence followed, cut short by a sigh. “Mainly as cell cycle regulators.” The air of confidence ebbed away, leaving a soft murmur meant for his ears only as he slumped into his chair in behind the front desk.“Come on Leon, this is stupid. Awful. Am I even doing this right?” 

A calloused hand carded through blonde locks, tousling them as the man took a deep breath while sifting through his slides once more. “Is there anyone who knows what cell cycle regulators do? No, that’s too textbook, they’ll understand better in a real life application question,” he grumbled once more to himself within the vacant classroom, “real life application… I better start bringing lab samples if I’m gonna start talking about real life application,” he snorted dryly. Odd, maybe that’s an inside joke between him and himself. You couldn’t help but giggle softly to yourself; actually to yourself, unlike Prof Kennedy. Poor sod. Sat outside the classroom with your ears pressed against the door, you were jotting down notes to yourself with some scribbles for entertainment purposes. 

Your attention was rapt however, when you heard him murmur your name. Breath hitched, you froze while scrambling to pack your things and get away before he could open the door. “Yes, you. Do you have an answer to this question? It’s alright if you get the answer wrong, but i’d like you to try.” You let out a sigh of relief, shoulders sagging as you realized he was just practicing, but that didn’t stop the warm flush of your cheeks while your hand came up to cover your lips. Was he practicing with the thought of you in mind?

Professor Leon Kennedy, or Prof Kennedy as some of your classmates preferred to address him by, was the new professor teaching the principles of genetics module. You had heard whispers about him being younger than most of the geriatric professors, something something government involvement and a temporary break.

You were more concerned about this guy’s ability to teach, because you were damn sure if you had someone with the teaching capacity of a TA as your prof, you might personally see to that he clocks in his early retirement. 

But turns out, he was a pretty alright professor. You’ve definitely had better, he wasn’t exemplary. No, Prof Redfield took the cake for that. Eye candy, and brutal at Chemistry. You didn’t hate O chem any less than when you first started, but he was convincing enough to keep you from skipping. 

While Prof Redfield was masterful at his subject and teaching, Prof Kennedy was diligent but at the same time, kind of a grouch. It was kind of sweet to see how hard he was actually trying to make lectures more bearable, but you had every reason to believe that he himself could hardly stand being there when he never had anything beyond an impassive expression. You were pretty sure you’ve seen cadavers with more life in their face than he did 95 percent of the time. The other 5 percent was when class ends and he’s got the same urgency to match the pace he’s packing, because somehow he’s always the last guy in and first guy out of the lecture theatre.

“Alright class! Can anyone tell me about- no that’s not right, what am I saying?” Leon was near his wits end. Couldn’t recall why on earth he agreed to teach at some university as a break. Actually no, he did recall. 

He recalled how Chris and Claire had both coaxed him into the idea during one of their nights out drinking, and he recalled not recalling signing anything, but apparently he was already signed up for it within the same week of his disgruntled verbal agreement. He wished the government would work just a fraction as fast as whatever organization body that was desperate enough to take him in as a professor. Oh, but I think you’d be a good match Leon, what with all your lab background, you’ve got the knowledge they’re looking to teach. Plus, it’s an easy paid holiday from work! Leon rolled his eyes as he recalled the muddled voice of Claire, or was it Chris? Doesn’t matter. They considered a whole lot of his technical abilities, and a lot less of his social skills neck to neck with a nut. Tipping his head back as he stared up at the fluorescent lights, he thought back to his first lecture. Fucking terrifying, mind you. Facing BOWs with the ability to detach his spine from his head wasn’t anywhere near the same kind of nerve-wrecking when he had to stand in front of a whole auditorium of students. The second lecture was better, but only but the smallest sliver.

Lesser students this time, but still too many eyes for comfort. The only saving grace was that this time, he practiced. Spent an embarrassing amount of time going through the lecture materials with himself before stepping up on stage. 

Asides from that however, he had a little more brain capacity to actually observe the students during his second attempt. Most of which, jotting down notes on their ipads, using their phones; he couldn’t blame them, genetics can be pretty dry, and he would’ve chosen to teach something else as well if he was given the choice. However a little something stood out from the crowd. You were nearer to the front, rather dolled up. You were cute. And not only that, lo and behold, you were a nodder. Lecturers must love you, because Leon sure as hell did when he finally caught notice of you, and how you seemed to reciprocate his lectures with an encouraging nod and a smile whenever your gaze met. He found it a little easier to go up on stage after that. His gaze deviated more towards you, and at some point he just pretended like he was just teaching you. Drowned out the rest of the auditorium, and acted like it was just the two of you. 

That’s how he first came to know of you. Not actually though; professors don’t actually interact with the students. He didn’t get paid enough for that, and he didn’t want to come off as a creep, so he left you alone for the most part. 

Just did his own private digging to find out your name, and oh, would you look at that? You should really learn to safeguard your particulars better because it took him less than 5 to find your address, birthday, education history and wow, your grades were nothing to scoff at. Pretty, and smart? A girl after his heart, except that was a violation of so many school conducts that the idea was quickly carted off. He noticed starting from the fourth week that you were starting to find a voice in the class, and his attention all but zeroed in on you. The immense relief Leon felt when for the first time ever, a student actually tried to answer his question and not leave him to bask in awkward silence. It was only near the end of the lesson that he realized that his question was meant to be a rhetoric. It was an opening to the next chapter. You weren’t supposed to know what he was talking about, so how’d you know the answer? Do dean-listers just study ahead of class? “I just do some extra studying outside of class,” you had smiled sweetly up at him the one time he mustered the courage to approach you after the lecture ended, “you did a good job with this week’s lecture, by the way. The math was a little dry and confusing, but you made it a lot more bearable than it would’ve been.” The man was a real slump, but you could appreciate his effort, even if the exact opposite was reflected on his face every lesson. 

“Thank you,” caught off guard by the compliment, Leon sheepishly scratched at his chin, cheeks tinged warm, “if you ever need help, i’m usually free outside of lectures.” Both you and Leon blinked at each other. Whoa. Did the grumpiest professor you’ve ever interacted with just offer their time outside of class? Willingly? You were going to buy a lottery ticket later for your course code.

“Oh, I appreciate the offer,” your lips parted and closed as you tried to think of how to carry the conversation. You almost turned him down out of reflex, and frankly you never thought you’d make it to this stage. Sure, you were creeping just a little bit with the one sided after school supplementary class, but were you really about to push it? “how’s this friday?” The answer was yes. Yes, you were. Who knows? It might even be fun. This friday? Leon was going back home this friday to sleep away the school air and hopefully into a coma. Maybe he could sneak some drinks in, in his couch alone at home. That’s what he was doing this Friday. “This friday? I can do friday. I’ll email you later, and we can work out a time?” Or maybe not. “Sure! Thanks Prof,” he remembered how you beamed so warmly up at him, almost blinding, before strutting off with your bag hauled over one shoulder. With only the linger scent of your perfume tickling his nose, he was left to stand there by his lonesome.

It took a grand total of one and a half occasions for him to cave. The first was Friday. 

Friday came quick. Too quick, really. Maybe all that alcohol from a couple years back was finally coming back to fragment his memory, but it was like time was lost on him. Whatever time between that week’s lecture and Friday was lost on him while he was too busy imagining what the tutoring session would look like. Maybe he should smile a little more, come off more amicable and nice. Or should he just stick with the grumpy vibe? He knows that’s been hitting it off with some of the girls in school, he’s heard some of the passing comments. No, but you seem like a nice girl who would like a sweet guy. “Hey Prof, you okay?” Oh, why would you look at that? It seems his sense of time was failing him again. 

“Hm? I’m okay, just a little tired is all,” he blinked back to life, rubbing his face as he gave you a nonchalant wave of his hand, “don’t worry about me.” You frowned softly, eyes scanning him with an intensity that made Leon feel the same tingly warmth from last lecture. Before he could convince you any further, you leaned in close, and that might’ve been the closest Leon has ever been to a woman who didn’t have the ability nor intention to kill him in 3 seconds flat in a very long time.

He swallowed nervously, adam’s apple bobbing, but he otherwise made no move to push you away. Blue eyes flitted from your eyes; soft and glittery, down to your lips; Plump, pillowy and shiny. He noticed you usually had a tube of lip gloss on your desk during lectures. He went to google it, said it was strawberry flavoured. Suddenly, he was having cravings for strawberries. 

His lids fluttered, half lidded as he stared down at you, mind empty yet reeling all the same. What were you doing, little minx? “Your eyebags are pretty bad, a little too pale, your cheeks are kind of sunken as well. You should take care of your health a little more,” you suddenly said, before pulling away and returning back to your seat, back straightened as though nothing had happened. As though you didn’t lean in close enough for him to smell the strawberries off your lips. Didn’t threaten Leon’s self restraint to close the gap between the both of you. “ I can take care of myself. Thanks for the concern, but don’t worry about me kid,” he coughed, voice a low rumble as he glanced away. Right. He remembered reading about you being a medical student. He was getting ahead of himself. A doll like you with damaged goods like him? The notion was laughable, but Leon would never admit to the tinge of warmth that bloomed at the thought of it.

“Everyone could use a little help regardless of what stage of life you’re in,” you shrugged all to nonchalantly, like you were stating a fact. Which you were, before glancing towards him as you fished out this week’s study materials from your bag. “And you think you can help me?” “I’m sure I could be of some help, one way or another,” You flipped open your notebook, ipad on the side with your questions all prepared. What Leon wouldn’t give to have coworkers as efficient and enthused as you. Maybe he could put in a good word for you in his lab, pull you in for your internships. A relationship between co-workers would be alot less inappropriate than a relationship between professor and student. He knew he was still going to get shit from it from his office though, but that was a problem for later. Maybe then you could help him out. Out of his ditch of misery, out of his wandering mind, help him out of his pants. Whoa. Where did that come from?

He cleared his throat, swallowing his spit before picking up your notes. “We can talk about that another time. For now, what’re you having trouble with?” Half an hour in, and Leon was struggling. Fighting for his life, actually, because he’d been sporting a boner beneath the table 10 minutes in after your legs accidentally brushed against each other. He couldn’t tell if he was suffering from acute testosterone poisoning, and the horniness was deluding him into thinking that you were dropping him hints, or if you were genuinely showing some sort of interest in him. Your lashes fluttered when you stared up at him, lips coated in a sheen of gloss puffed into a soft pout everytime he explained something through tripped words and stutters. Everytime he found it in himself to knock the thoughts out of his head, you always found some innocuous way to enthrall him and his dick back into your whimsy, imaginary grasp. He wondered if your hands grab onto dicks as hard as you grabbed his attention. Just as Leon felt like he was finally going to see which would pop first; his dick or his blood pressure, the lesson was cut short. He wasn’t sure if he found the hour long session too short or too agonizingly long. Your eyes finally flickered away from him to your ringing cell, your lips rounded in surprise. “Sorry, this’ll be quick,” you gave him a sheepish little chuckle, manicured nails plucking the cell as you stood upright. To match, Leon’s cock sprung upright too. As you waltzed off, humming a small hello through the phone, all he could really see or hear was your bare thighs and waist, easily small enough for him to grab. And your ass? By god. He could see it from your physique. You were soft. Far softer than any of the ladies he had worked with for the last miserable 10 something years, all of which could easily deck and curbstomp him for having the thoughts he had towards you. 

You had a habit of leaning on one leg, Leon had noticed by the third class. You’d rest on one leg, your hips jutting out in that direction while the plush of your thigh squeezed beneath the hem of your pants to give a small pudge. Denim shorts day was a particular treat for him. Shame that today wasn’t one of those days, but it was still shorts day, so it was half a win for him. 

“Fine,” Leon blinked hard, gaze snapping right back up at the sound of your reluctant little sigh, “I’ll go, sure, but I’m not going for next week’s, I have some papers coming up. I’ll see about the week after,” you huffed into the phone, swapping the cell to the other hand so you could lean on your other leg. “Yeah?” He could hear your giggle, sweet and lithe. What other way more fitting words were there to describe you? “Alright, I’ll see you tonight. See you! Mhm, bye bye!” “Sorry about that, I thought I had my phone on silent, but I must’ve forgotten,” you slipped yourself back into your seat, your gaze rising from the screen of your phone back up to find leon’s, who was watching you ever so intently. “Some friends invited me to a party,” you supplemented, mistaking his stare for one of curiosity. 

Well, he wasn’t that curious before, but he certainly was now. He had heard all sorts of things about university parties, but never got the chance to actually experience one for obvious reasons. He had just about accepted his life ended at the tender age of 21 back in Raccoon City, before it was handed over and detained by the DSO for the unforeseeable remainder of his hopefully clipped life. 

So the idea of something as normal as a party charmed him, and through the shine of his eyes, you could tell. Your head tilted, an amusing little quirk of yours whenever your attention was hooked on something and the cogs in your head was turning. 

“You go to parties a lot?” he cleared his throat awkwardly, his turn to be fidgety under your scrutiny. He knew you were thinking. He knew you were thinking something of him, specifically. But he didn’t know what you were thinking. 

“I wouldn’t say a lot, I get invited a bunch but I don’t always go,” you word trailed off into a soft drone, mind pacing with considerations before you cracked a smile, “but would you like to come to this one?” “Uh, join you to a party?” the nervous chuckle slipped past his lips before he could even think to hold it back. You didn’t seem the slightest bit dejected from his apprehension however, instead choosing to press on. “You don’t have to of course, but if you’d like, you’re welcome to come to this one, it’s an open party, so other people will be there too!” 

 Oh god, what was happening. “I’ll uh, I’ll think about it?” He did. Sort of? He slept on it, more than anything. The rest of the session was a blur, you were a fast learner who pretty much solved the remainder of your own questions once you picked up on the first couple of questions. That, and he was pretty sure all the blood meant for his head was relocated to his dick, so forgive him if he was tripping over himself in a rush to get home and jerk himself off until his dick went raw.

By the next afternoon when he had stumbled out of bed with his crotch still sticky and bedside tissues stiff, imagine his surprise when we saw that you went ahead and did him the liberty of actually emailing him the party address; he had thought you were just saying it to be nice, honestly. 

‘Hey Professor Kennedy! Here’s the address for the party, again no pressure if you don’t feel like coming, but there’ll be free drinks if you do!

Take care!’ 

He spent way more time than he cared to admit considering your offer. Somehow, you’ve reduced him from a grouch wagering bets as to whether tomorrow would be the day he bites the bullet, into still too old of a man feeling like a perverted youth with a libido to match.

He thought long and hard through the myriad of fantasies that played out while he went to shower. As his hands absentmindedly lathered his soapy, blonde locks, his gaze fixed on the water stained glass. He could picture the droplets sliding down your back and past the curves of your ass. The size of the shower would force you to press flush against his chest, his stiff mast resting on your lower back, balls against the perk of your butt. 

Would you pant as he lays his weight on you, your breast pressed up against the glass and the shaft of his dick shower in the slippery dip of your pussy? Maybe you’d mewl as he toys with your nipples, rough pads pinching and twisting at the nipples while grubby hands knead and paw at the plush of your chest. He bet he could make your breath hitch and your eyes well with tears as he feeds just the tip of his dick to your gummy walls, never pushing himself all the way in. Just the tip, until you’re begging like he was your lifeline and that you’d be his good girl. 

His jaw clenched, chest tight and knees buckled as milky fluids splattered against the glass, catching the drops of water that rolled down. Leon’s lips parted as he blinked himself back to the present, the fluorescent light making it difficult for his sight to return, his ears ringing while his chest heaved desperately for air. 

For that second that your imaginary presence coaxed his undoing, he forgot how to breathe.For as much as he wants to be your lifeline, you were quickly becoming his.

[felixcloud6288]

"Basic Biology" Transphobic rhetoric is so stupid and so frustrating to listen to for someone like me going into a genomics field.

To begin, the default human sex is female. So there's no point in even arguing about whether or not someone is a woman on any biological level. That's the default state.

Meanwhile, the binary nature of their mindset causes everything to essentially boils down to whether or not your genetic code contains a roughly 840-base pair length gene sequence called the SRY gene. This gene makes up roughly 0.00000028% of the human genome.

SRY is an ON switch. It activates various male-coding genes, WHICH ARE IN DIFFERENT CHROMOSOMES. Which means that everyone has the genetic material to become male, it's just a question of if the activation switch was properly installed.

But it's possible to have the gene and it fails to be expressed, causing you to become an XY female. It's possible as you get older for the Y-chromosome, and subsequently the SRY gene, to get deleted from your DNA. It's possible for the SRY gene to end up in an X chromosome and have an XX male. It's possible for the fetus to develop both male and female sex organs.

Meanwhile Transphobes are like "Ignore all that. Ignore how hormone regulation is done by different genes. Ignore that human bodies produce estrogen and testosterone naturally. Ignore that our bodies are actively receptive to estrogen and testosterone. Ignore that the SRY gene is a one-time gene that doesn't do anything after to the point you can remove it and it won't change anything. Ignore that the actual argument is completely cultural in nature and we're using FALSE arguments about biology to justify our bigotry and hatred."

Transphobes will look at this and say "Behold a man!":

AGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA

And they'll ignore the remaining 0.99999972% of us that truly decides who we are.

[humancelltournament]

Human Cell Tournament Round 1

Propaganda!

A killer T cell is a T lymphocyte (a type of white blood cell) that kills cancer cells, cells that are infected by intracellular pathogens (such as viruses or bacteria), or cells that are damaged in other ways. Most cytotoxic T cells express T-cell receptors (TCRs) that can recognize a specific antigen. An antigen is a molecule capable of stimulating an immune response and is often produced by cancer cells, viruses, bacteria or intracellular signals. Antigens inside a cell are bound to class I MHC molecules, and brought to the surface of the cell by the class I MHC molecule, where they can be recognized by the T cell. If the TCR is specific for that antigen, it binds to the complex of the class I MHC molecule and the antigen, and the T cell destroys the cell.

In biology, histones are highly basic proteins abundant in lysine and arginine residues that are found in eukaryotic cell nuclei and in most Archaeal phyla. They act as spools around which DNA winds to create structural units called nucleosomes. Nucleosomes in turn are wrapped into 30-nanometer fibers that form tightly packed chromatin. Histones prevent DNA from becoming tangled and protect it from DNA damage. In addition, histones play important roles in gene regulation and DNA replication. Without histones, unwound DNA in chromosomes would be very long. For example, each human cell has about 1.8 meters of DNA if completely stretched out; however, when wound about histones, this length is reduced to about 90 micrometers (0.09 mm) of 30 nm diameter chromatin fibers.

[thejournallo]

Life hack: belance in yourself

Hormones are powerful chemical messengers produced by glands in the endocrine system. They travel through the bloodstream, regulating various bodily functions such as growth, metabolism, reproduction, and mood. Hormones play a significant role in maintaining balance in the body, known as homeostasis, and any imbalance can affect your mental and physical well-being.

How Hormones Work

Production: Hormones are secreted by glands like the thyroid, adrenal glands, pancreas, and ovaries/testes.

Transport: Once produced, hormones travel through the bloodstream to target cells or organs.

Receptors: Hormones bind to specific receptors on cells, triggering a response. This can involve altering cell activity, gene expression, or initiating a cascade of processes.

Feedback Mechanism: The body monitors hormone levels using feedback loops. For example, if a hormone level is too high or low, the body adjusts production to maintain balance.

Key Hormones and Their Functions

Cortisol: Stress hormone; regulates metabolism, immune response, and energy.

Serotonin and Dopamine: Mood and happiness regulators; linked to emotional well-being.

Insulin: Manages blood sugar levels.

Estrogen and Testosterone: Sexual health, energy, and bone strength.

Thyroid Hormones: Control metabolism and energy levels.

Melatonin: Regulates sleep-wake cycles.

Adrenaline (Epinephrine): Prepares the body for fight or flight.

How to Support Hormonal Health

To feel better mentally and physically, it’s essential to maintain hormonal balance. Here are strategies to care for your hormones:

1. Nutrition

Balanced Diet: Eat whole, unprocessed foods rich in nutrients.

Healthy Fats: Avocados, nuts, seeds, and omega-3s (from fish) support hormone production.

Complex Carbs: Whole grains and vegetables regulate insulin levels.

Protein: Essential for hormone production; include lean meats, beans, and tofu.

Avoid Excess Sugar and Refined Carbs: These can cause insulin spikes and crashes.

Hydration: Proper hydration supports cellular communication and detoxification.

2. Sleep

7-9 Hours of Quality Sleep: Hormone regulation (like melatonin and growth hormone) occurs during deep sleep.

Consistency: Go to bed and wake up at the same time daily.

Limit Screen Time Before Bed: Blue light can suppress melatonin.

3. Stress Management

Mindfulness Practices: Meditation, yoga, and deep breathing reduce cortisol levels.

Physical Activity: Exercise releases endorphins, improving mood and balancing stress hormones.

Journaling or Therapy: Helps process emotions, reducing chronic stress.

4. Exercise

Moderation: Both too much and too little exercise can disrupt hormones. Aim for 30 minutes of moderate activity most days.

Strength Training: Boosts testosterone and growth hormone.

Cardio: Supports circulation and reduces stress.

5. Avoid Endocrine Disruptors

Limit Toxins: Avoid products with BPA, phthalates, and parabens (found in plastics and cosmetics).

Clean Water: Use filtered water to avoid contaminants.

Organic Foods: Reduce pesticide exposure, which can disrupt hormones.

6. Maintain a Healthy Weight

Excess body fat can increase estrogen levels, while too little fat can disrupt reproductive hormones.

7. Regular Medical Check-Ups

Hormone Testing: Regular blood tests can identify imbalances early.

Thyroid and Reproductive Health: Monitor specific hormones like TSH, estrogen, and testosterone as needed.

8. Natural Supplements (Consult a Professional First)

Vitamin D: Supports mood and immune function.

Magnesium: Regulates stress and supports sleep.

Adaptogens: Herbs like ashwagandha and maca root can balance stress hormones.

Omega-3 Fatty Acids: Reduce inflammation and support brain health.

Signs of Hormonal Imbalance

If you're experiencing persistent symptoms, consider consulting a healthcare provider:

Fatigue

Mood swings or anxiety

Unexplained weight changes

Irregular periods

Sleep disturbances

Low libido

Conclusion

Hormonal health is essential for overall well-being. By prioritizing proper nutrition, stress management, exercise, and regular medical care, you can support your endocrine system and feel better both mentally and physically.

[bnhaobservation]

Your focus is on the Todoroki family, so I'll focus on what was the main precursor to throwing the rose-colored glasses: Touya's quirk. Do you have any theories of your own as to why it is that his body simply began to adapt to an ice quirk?

Although I have my own theory based on, primarily, the ice quirk factor of Touya's heart and Shouto's strange division, which speaks of tetragametic chimerism (such as the case of the woman with her sister's uterus), the dominance of dominant traits (in this case, Himura blood) in elemental quirk homeostasis, the functioning of the long noncoding RNAs in charge of regulating the functions of the cells combined with the mutant gene "plus Alpha" (as would be the activation and deactivation of the physical adaptation mechanisms for the expression of an elementary quirk, such as temperature and acidity tolerance); as it would be possible that his physical change is due to the fact that at some point the ice quirk in his heart was passively activated and that triggered the readaptation of his body to the genetically dominant quirk.

But it always makes me very happy to learn about other theories from people who are dedicated to their writing and take the time to research even if they all come to different conclusions according to the knowledge and beliefs they hold. (It's a bit lonely being a writer in this sense).

I think what you want to discuss is why Tōya and Shōto have a composite-type (複合型 ‘fukugō-gata’) Quirk, right?

Sorry for the late reply but I needed to put some order in my notes before being able to reply to you in a vaguely cooherent way.

PREMISE: I don’t have a degree in biology, which means I might mess up things and my explanation can feel ridicule and basically amount to Quirk magic to who’s more knowledgeable than me so I’m not the best person to ask for such a thing. Horikoshi in creating his Quirks didn’t really bother with medical accuracy which doesn’t help with inferring how things works, especially when someone is, like me, more focused on respecting the canon than the real life biology. Also it’s an ‘in work’ theory. I might end up changing it in the future... or never think at it again since biology isn't really a fundamental point in my story... but I needed to have some ideas on how to set up things so this is what I came up with.

Now…

When babies are born canon gives them 3 possibilities regarding Quirks, they’re born Quirkless (〝無個性〟 ‘“Mukosei”‘), they inherit 1 of their parents’ Quirk, they inherit a composite of both their parents’ Quirk and therefore their Quirk is a new Quirk of the composite-type (複合型 ‘fukugō-gata’). [Chap. 1]

While Quirkless kids are slowly disappearing, the same isn’t true for the other two options, especially for the composite one. We know this by two things.

First, people of the second and third generation of Quirk owners deliberately organized Quirk marriages aiming to have their kids to inherit a composite of their parents’ Quirks. This means the birth of kids with a composite Quirk was recurring enough that people realized it happened and tried to exploit it.

Second, Garaki’s “paranormal singularity theory” (超常特異点 ‘chōjō tokui-ten’), later renamed “Quirk singularity doomsday theory” (個性特異点 ‘Kosei tokui-ten’), is based on this on how Quirks mix and become more complex with each passing generation [chap 166], meaning this isn’t something it happens so rarely it’s negligible, it happens with each passing generation in a way that’s consistent enough that people could fear it would bring doom to the human race.

This makes me think that composite Quirks are merely a result of codominant alleles which end up getting expressed at the same time (so nothing big that can risk affecting fertility, as otherwise people with Quirks wouldn’t manage to become the dominant majority).

I’m however assuming that the genetic code of a Quirk isn’t included just in a couple of alleles. Quirks are too complex for this, which means not all the alleles that create the parents’ Quirk are codominant, which allows two kids who have both their parents’ Quirks like Tōya and Shōto, to have Quirks that are similar yet different (plenty of characters in the series have composite Quirks, the one who’s more famous despite not being a Todoroki is Bakugō).

In short Shōto and Tōya’s Quirk might resemble mosaicism, but, I think, they’re actually not meant to be. They don’t have two different genetic codes inside their bodies, just one that says where their Quirks should manifest and in which amount and if they’ve or not the structures to withstand them.

What do I mean by this?

In chap 135 we've this bit.

Now I’m not a fan of Aizawa’s example, which split the tail Quirk into tail + infrastructure to move the tail because by logic the infrastructure to move the tail should be the muscles and if he can stop them he should be able to stop every muscle, plus he said his Quirk didn’t work on Quirk of the heteromorphic type, I get that now Horikoshi is trying to ‘retcon’ it by implying he can’t erase the tail, just stop it, but if he could stop the muscles of an heteromorph he would stop all his body from working, or, at least, he would stop the 4 arms of the guy that’s facing him and this doesn’t happen.

Anyway this works well to imply a Quirk is made by more structures, structures we don’t really know.

A Quirk likely isn’t decided just by a couple of alleles.

We see that people get to label the ‘result’, their own understanding of their Quirk, they label it with a name and present it to the Quirk registry, but they likely often don’t know how it works (which is why the Quirk registry allows people to make changes on how their Quirk work and why SURELY Tōya’s Quirk wasn’t named blueflame at the start as… it wasn’t blue. I like to bet it was registered as another Hellflame Quirk, which is why even though it was obviously a fire Quirk, Horikoshi refused to say its name).

In a fire Quirk user, he needs to have a part inside himself that create the fire, but also a part that can withstand the fire, similar to how an ice Quirk user needs to have a part that can create the ice and one that can withstand it. This however doesn’t mean 2 couples of alleles, one deciding if one has or not the part that creates fire and the other deciding if he has or not the part that withstand fire.

I generally assume that in truth ice and fire Quirk don’t really create ice and fire. In the ice case it’s possible they actually emit such a cold temperature that they freeze the water molecules in the air and therefore create ice.

In the fire case things are more complicate. It’s not enough for a fire Quirk owner to emit a hot temperature to have fire, fire to start doesn’t just need a heat source and oxygen, which it can find in air, but also some fuel to burn. Heat, oxygen and fuel form the fire triangle but, considering Enji and Shōto don’t burn themselves when they use their fire, it’s hard to say what they use as fuel.

Since Tōya’s tears took fire, it’s possible they’ve the fuel in form of body fluids so, kind of like how Bakugō excretes nitroglycerin-like sweat, they might possibly excrete oil-like fluids, which take fire if they heat up.

In order for a fire to burn hotter you either pump in additional air or pure oxygen or use a fuel that burn hotter, so it’s possible the substance in Tōya’s fluids is slightly different from Enji and Shōto’s.

What about fire and ice resistance?

Normal humans fight cold by shivering and by producing more inner heat and fight hotness by sweating but I take the idea is that ice and fire Quirk owners also have a skin that’s more tolerant to cold/hot temperatures than a normal one. This should be the case because in the sport festival Shōto hits his limit of cold tolerance and starts shivering after using his ice side a lot, when another person would have already gotten frostbites, as for sweat… well, if the sweat is actually the fuel the Todoroki use, it’s unlikely it cools them down, never mentioning Enji said his use of fire was starting to affect him, but we don’t see burns on his skin. Likely it was just that his inner organs were starting to get affected.

Now…

We know Quirks aren’t necessarily symmetrical, Lady Nagant’s Quirk manifest only on her right arm, so likely the placement of the Quirk on the body isn’t as simple as it might seem. Enji seems to have a whole body that can generate fire, eyes included, and that can withstand it according to certain limits, however is this always the case? Burnin’s fire Quirk only manifest on her hair. Midoriya’s father could only breath fire. It’s implied Onimā has fire resistance, in fact he worries for Kidō, who doesn’t have it, but it seems it’s all he has, as he is never show using a fire Quirk.

I said Tōya and Shōto’s double Quirk is the result of a codominance but this is an oversimplification because it’s not like they have a perfect codominance through the whole genetic structure of both Quirks and therefore through their whole bodies (like Bakugō might instead have).

At this we need to add the fact that Quirks are prone to mutate. I don’t mean this just in the sense that Eri and Terumoto Kōki have completely new Quirks, Quirks also apparently grow in power with each passing generation (Tōya’s fire is stronger than Enji), through in some rare cases they can get weaker (Shūichi’s Quirk is apparently weaker than the rest of his family or so his profile in chap 233 implies) and have abilities that can get unlocked with the whole Quirk awakening (個性覚醒 ‘Kosei kakusei’) thing, be it through training or through stress or near death experience.

From a scientific standpoint, there’s just too much we don’t know about Quirks and that probably not even in the BNHA world know to tell for sure.

Still, I wouldn’t say though Tōya’s ice is dominant and we’ve no info about it residing in his heart (though Shōto explains the heart is central to making both hot and cold manifest when using Phosphor… and the fact Tōya tried to use Phosphor as well to withstand Shōto’s ice might have subconsciously unlocked his ice Quirk). The Quirk doctor said it himself, the fire Quirk factor is more prominently inherited.

Ishi ‘Mezurashī reidesu ne… Honō no kosei inshi wa yori irokoku hiki tsugarete iru nodesuga. Nikutai wa Okā-san no hō o tsuyoku hiki tsuide shimatterundesu. Tsumari… Honō e no taisei yori mo hyōketsu… Samusa ni tekisei no aru karada nandesu. MaA… DESIGN jimita koto wa ne… Kono “kosei” jidai kinki nande… Yameto ita hō ga.’ 医師「珍しい例ですね…炎の個性因子はより色濃く引き継がれているのですが。肉体はお母さんの方を強く引き継いでしまってるんです。つまり…炎への体制よりも氷結…寒さに適性のある身体なんです。まア…デザインじみたことはね…この”個性”時代禁忌なんで…やめといた方が…」 Doctor “That’s a rare case… The fire quirk factor is more prominently inherited, but his physical body is more strongly influenced by his mother’s. In other words… his body is more suited to freezing… to the cold than to fire. Well… anything resembling design… has contraindications/is taboo in this age of “Quirk”… so it’s better to avoid it…” [Chap. 301]

In fact, in regard to emission, it’s likely the fire that’s dominant and the ice is minor, while in regard to structures to withstand temperature he’s better predisposed for the cold (Horikoshi has revealed in the side material Tōya also has fire resistance but it’s not enough to withstand his much hotter fire Quirk).

Tōya has both Quirks but they’re somehow unbalanced in how they express but can compensate if they work simultaneously, Shōto is more balanced in how both express each other but, at the same time he can’t reach the level his brother reaches.

So, back to Tōya, what caused the change in his body?

Quirk activation seems often to be involuntary in kids. As a newborn Tōya should have ended up activating his fire Quirk very early on, we know because Enji and Rei decide to have Fuyumi because Enji wants a kid with a dual Quirk (and believes Tōya doesn’t have it) and Rei thinks siblings could support each other. Fuyumi is conceived around 2 months after Tōya’s birth, which means they knew very early on about Tōya’s Quirk, which makes sense. The luminescent baby shined at his birth and baby Shōto iced his snot bubble as he slept. However he never unlocked his ice Quirk and the family came to believe he didn’t have one. It also make sense, Quirks might not manifest until preschool.

Add to this he was likely encouraged to use his fire side way more than any normal kid would, Enji even started to give him the first fire Quirk lessons.

It’s during one of them that Enji realizes his son’s hair started to turn white, when Tōya is 3, so I also think Tōya subconsciously turned on his ice Quirk, maybe in sleep and didn’t realize about it as the usage might not have been that relevant… or maybe at that time he was still used to sleep with Fuyumi and they assumed the ice in the room was made by Fuyumi, not by Tōya.

However hair color is due to melanin and cold damages melanin, which might be why all the ice Quirk owner have white hair. Their own Quirk damages their melanin causing them to be born with white hair or for their hair to become white as soon as they start to use their ice Quirk.

Why Tōya also starts to burn?

I do prefer to think he hit his limit, Enji has taught him to raise his fire temperature and his fire had become too strong for his fire resistance, but it’s also possible that by subconsciously activating his ice Quirk, Tōya, who’s still in the middle or a very intense growing phase, had caused his body’s resources to redirect on building up an ice tolerance instead than a fire one that can compensate the increase of heat in his fire. However, since Shōto could have both, this doesn’t seem to make much sense to me because this means the two don’t negate each other. Maybe it’s just me.

However I tend to place the blame on the speeding up of the whitening process not to Tōya using his ice Quirk subconsciously (otherwise at a certain point he should have realized he has ice) but to the stress the situation generated. Melanin can be damaged also by stress and, as soon as Tōya start to burn himself, things get very stressing for him, likely first due to medical exams and visits as his parents think there’s something wrong in him, and then due to how he’s told he can’t become a Hero, that he can’t use his Quirk and Enji dropping to train him and spending time with him.

While it starts as a sign he has a ice Quirk, it becomes a sign measuring his distress. So while his hair were always meant to turn white as he would start to use his ice Quirk, the psychological distress caused it much faster than the latent ice Quirk could have.

That’s what I put together that seems to fit with the canon we’re given. It’s obviously a compromise, I doubt Horikoshi cared about the biology in Quirks and very likely Shōto’s hair split as well as his heterochromia are there for a purely visual value (and so that Rei would be lead to attack him), and not because he lost sleep thinking at the biological implications.

As I said I’ve not a degree in biology and my interest is mainly in the psychology of the characters more than in the mechanic of Quirks (which is why I’ve a ‘medical inaccuracies’ tag for my fic) so sorry if this feels terribly unsatisfactory and unreal.

Still, thank you for your ask! As I've said I really have fun talking about what's behind my story.

[mindblowingscience]

A cell protein previously believed only to provide a scaffolding for DNA has also been shown to directly influence DNA transcription into RNA—the first step of the process by which an organism's genetic code expresses itself. The fundamental breakthrough was discovered in apple cells but is relevant to all living organisms made of nucleus-containing cells, including humans. The finding, published Dec. 20 in Plant Cell, was co-authored by Cornell researchers and colleagues from the University of California, Davis, and Shandong Agricultural University in Shandong, China.

Continue Reading.