a-dash

[a-dash]

To those cherished few left waiting, it has returned–the lastest 2 pages (25 and 26 of Chapter 1, 33rd and 35th total). Resized, hopefully for mobile convenience. Read the rest of this grim but life affirming 18th century fantasy epic here: https://tapas.io/episode/1168383

[a-dash]

Pages 35 and 36 of The Concord Initiative, a grim but life affirming 17th century epic of heroes forced to work with the scum of the earth at the dawn of the Early Modern Period. Read the rest here: https://tapas.io/episode/1168383

[a-dash]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[a-dash]

I have 16+k liked posts

And too many of ‘em will be gone.

God damn it.

[a-dash]

Tumblr is dead

I have no reason to use this site anymore really lol.

[a-dash]

Monster fuckers and furries are the two ends on the same spectrum with werewolves in the exaxt middle.

You’re right and you should say it

[a-dash]

This is the payday meowth, reblog in the next 24 hours and money will come your way!!

[a-dash]

Someone screwed up your reincarnation papers, and you’re reborn as yourself. You start your whole life over, with all the knowledge and wisdom (or lack thereof) you had when you died.

[a-dash]

dude seeing these Mega high quality images of the surface of mars that we now have has me fucked up. Like. Mars is a place. mars is a real actual place where one could hypothetically stand. It is a physical place in the universe. ITS JUST OUT THERE LOOKING LIKE UH IDK A REGULAR OLD DESERT WITH LOTS OF ROCKS BUT ITS A WHOLE OTHER PLANET? 

[a-dash]

scene before movie climax:

protagonist: So who’s with me?

*5 seconds of silence*

the stoic one: *looks up* im in

4 people one after the other: me to

*after everyone else has joined we see The Edgy One standing in the back*

*2 more seconds of silence*

The Edgy One: *chortles* we’re all gonna die… what the hell, im in

[a-dash]

Gang-Plank Galleon - Super Smash Bros. Ultimate Soundtrack

[a-dash]

[a-dash]

this is what i downloaded audacity for

right ear is my terrible edit of megalovania, left ear is what happened when i midi’d it and then fucked with the tempo and volume. enjoy

[a-dash]

Super Smash Bros. Ultimate - Snake Codecs: Inkling

This isn’t meant to be me bashing on Splatoon. This is just how I picture Snake as a character would react to the inklings.

[a-dash]

i don’t remember making this

[a-dash]

source

[a-dash]