#Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system

[naivelocus]

Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system

Generation of genetic constructs

Standard molecular cloning techniques were performed to assemble all constructs used in this paper and they are included in Supplementary Table 1.

Human codon-optimized S. pyogenes dCas9 was fused at the C-terminus with the tripartite VPR activator.23 VPR is a fusion of VP64, p65 activation domain, and Rta via two GS linkers. An SV40 nuclear localization signal (NLS, PKKKRKV) was inserted C-terminal to VP64. For visualization, mCherry was fused at the C-terminus of the construct. The fusion construct was cloned into a pcDNA3 vector with a CMV promoter driving the expression of dCas9-VPR-mCherry. For the mathematical model, a lentiviral pHR vector with a Doxycycline (Dox)-inducible TRE3G promoter was used instead.

ARRB2-TCS-dCas9-VPR was assembled by fusing ARRB2 (Human cDNA, NM_004313.3; Origene) with dCas9-VPR-mCherry and cloned into a pcDNA3 vector. The TCS sequence ENLYFQ/X was inserted in between and was flanked with GS linkers of varying lengths (Supplementary Fig. 3). Two nuclear export signals (NES, LALKLAGLDI) flanked ARRB2 to ensure cytoplasmic localization of the chimera. For the mathematical model, a lentiviral pHR vector with a Dox-inducible TRE3G promoter was used instead.

Synthetic GPCRs, natural GPCRs and TEV protease (Addgene #8835) were all PCR amplified and cloned into a pHR lentiviral vector by InFusion (Takara Clontech) cloning. The V2 sequence (derived from AVPR2)7 was inserted in between GPCR and TEVp as primer overhangs via InFusion cloning. For visualization, p2A-BFP was fused C-terminal to TEVp. Expression of GPCR-V2-TEVp-p2A-BFP was driven by an EF1a, PGK or SFFV promoter. See Supplementary Table 3 for plasmid sources for receptors.

All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

For multiplexing experiments, we also cloned a dual sgRNA vector to otherwise reduce false positives in bulk measurements (e.g., ELISA). This consists of two sgRNA cassettes in tandem driven by mouse U6 (mU6) and human U6 (hU6) promoters, respectively, and a co-expressed puromycin-p2A-BFP cloned into a pHR lentiviral vector. Here, the mU6 vectors are cloned using InFusion (Clontech) to insert PCR products into a modified vector digested with BstXI and SpeI. The hU6 sgRNA vector was cloned inserting PCR productions with InFusion cloning into a parent vector digested with XbaI and SpeI. After sequence verification, vectors were combined by digesting the XU6 sgRNA with XbaI and SalI, taking the insert and ligating into a SpeI and SalI digested XU6 vector.

Below is the standard S. pyogenes sgRNA scaffold used (N’s denote the spacer sequence):

5′-NNNNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAA TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′.

Spacer sequences for all sgRNAs used can be found in Supplementary Table 2.

Cell culture and generation of stable cell lines

HEK293T cells (Lenti-XTM, Clontech) were maintained in DMEM High Glucose with GlutaMAXTM media (Thermo Fisher) supplemented with 10% Tet System Approved FBS (Clontech) and 100 U/mL of penicillin and streptomycin (Gibco) at 37 oC with 5% CO2. We did not independently authenticate these cell lines and they were not tested for mycoplasma contamination.

For transfection, HEK293T cells (Lenti-XTM, Clontech) with 3 μL of Mirus TransIT-LT1 reagent per μg of plasmid added, and then incubated at room temperature for 15–30 min. Unless otherwise noted, GPCR ligands were added at the following concentrations at day 3 as specified in Supplementary Table 4. This table also specifies the media conditions used for each receptor to generate the data in Fig. 4.

We used lentiviral transduction to generate stable cell lines. At day 1, cells were seeded at 2.0–3.0 × 105 cells/mL in a 6-well plate format (Corning). At day 2, cells were 50–70% confluent at the time of transfection. For each well, 1.51 μg of pHR vector containing the construct of interest, 1.32 μg of dR8.91 and 165 ng of pMD2.G were mixed in 250 μL of Opti-MEM reduced serum media (Gibco) with 7.5 μL of Mirus TransIT-LT1 reagent and incubated at room temperature for 15–30 min. The transfection complex solution was distributed evenly to HEK293T cultures dropwise. Media was replaced at day 3 with fresh media. At day 4, lentiviruses are harvested from the supernatant with a sterile syringe and filtered through a 0.45-μm polyvinylidene fluoride filter (Millipore) for immediate transduction of target cell cultures.

Filtered lentiviral supernatants were mixed 1:1 with appropriate fresh media to replace media of target cells for transduction. Adherent cell cultures were transduced at 50% confluence. Approximately 10 days after transduction, the HEK293T pTRE3G-GFP line and the pUAS-GFP::pEF1α-rtTA-p2A-puro reporter line (pre-selected for 2 days with 1 μg/μL puromycin) were transiently transfected with dCas9-VPR and a targeting sgRNA (sgTET and sgUAS, respectively) for 1 day prior to sorting via GFP FACS in Carmen (BD InFlux) and Aida (BD Aria II) sorters, respectively. For the rate model, the HEK293T pUAS-GFP::pEF1a-rtTA-p2A-puro line was transduced with pEF1α-hM3D-V2-TEVp-p2A-BFP and pTRE3G-(ARRB2-TCS)-dCas9-VPR-mCherry and sorted ~7 days after transduction for both BFP and 1-day doxycycline induction of mCherry expression.

Flow cytometry analysis

Cell were dissociated using 0.05% Trypsin-EDTA (Life Technologies) and analyzed for reporter fluorescence in the Stanford Shared FACS facility with a Scanford FACScan analyzer (Becton Dickinson), or with a CytoFLEX S flow cytometer (Beckman Coulter). We collected 10,000 cells containing constructs of interest for analysis (BFP and mCherry double positive). The data presented are normalized to either a free dCas9-VPR with no sgRNA, or non-targeting sgRNA control as specified.

Time-lapse microscopy

At day 0, HEK293T TRE3G-GFP reporter cells were plated at 1 × 105 cells per 24-well well (μ-Plate 24 well; ibidi). At day 1, 250 ng of each plasmid was transfected (see Fig. 2a and Supplementary Fig. 4). At day 2, 20 μM of CNO was added to appropriate wells and immediately imaged. Time-lapse microscopy was performed on a Leica DMi8 inverted microscope equipped with, Lumencor SOLA SMII 405, Leica DFC9000 GT camera and Oko-Lab cage incubation system at 37 oC with 5% CO2. Leica Application Software was used to set up time-lapse imaging. Images from phase contrast, mCherry (filter cube TXR, No. 11525310), and GFP (filter cube GFP, Cat. No. 11525314) channels were taken every 0.5 h for 48 h with a 20x/0.40NA corr PH1 objective using Leica Adaptive Focus control. Image processing was performed in Fiji (ImageJ).

Reversibility experiment

A stable HEK293T line containing pUAS-GFP, pEF1a-rtTA-p2A-puro, pEF1α-hM3D-V2-TEVp-p2A-BFP, and pTRE3G-(ARRB2-TCS)-dCas9-VPR-mCherry (Supplementary Fig. 2b) was pre-induced with 1 μg/mL Dox for seven days to stabilize ARRB2-TCS-dCas9-VPR levels. Cells were then treated with 10 μM CNO either for one to seven days, or for 1 day and removed for 1–6 days. All cells were measured by flow cytometry on the same day, collecting 10,000 mCherry and BFP double positive cells for analysis.

Endogenous cytokine activation and secretion assays

A day before transfection, HEK293T cells were seeded in 24-well plates at a density of 5 × 104 cells per well. On day 1, cells were transfected with 250 ng of each plasmid (i.e., the CRISPR ChaCha components: GPCR-V2-TEVp of interest, the ARRB2-TCS-dCas9-VPR, and an sgRNA). On day 2, controls were transfected, consisting of the GPCR of interest, dCas9-VPR, and an sgRNA. Media on the ChaCha-containing cells was then changed to those with or without ligand treatment (10 μM for CNO; 0.5 μM for NMB).

Supernatants from cell cultures were harvested on day 4, and stored at −80 oC. Secreted proteins were quantified using the ELISA MAX Deluxe kits for human IL2 and IFN-γ (BioLegend). Absorbance at 450 nm and 570 nm was measured for samples in technical triplicates with a Synergy H1 plate reader (BioTek). Samples were standardized by subtracting measurements at 570 nm from those at 450 nm. Protein concentrations were then determined by standard curves fitted to a power law using Excel (Microsoft).

qPCR analysis of gene expression

Cells were transfected as described in the proceeding section. On day 4, cells were harvested and RNA was extracted using a RNeasy Midi Plus Kit (Qiagen). cDNA was then prepared using 500 ng of RNA per 20 μL reaction via iSCRIPT cDNA synthesis (BioRad). Following synthesis, cDNA was stored at −30 °C until qPCR.

qPCR was conducted in 10 μL reactions using 384 well plates, using 15 ng of cDNA, a 400 nM final concentration of primers, and iTaq Universal SYBR Green Supermix (BioRad). See Supplementary Table 5 for primers used. From transfection, there were three technical triplicates that were then ran in technical duplicate for qPCR reactions. Thermocycling was done as follows: 95° for 1 min, 95° for 10 s, and 60° for 30 s. The latter two steps cycled for 50 repeats with plate reads taken after the 60° step40 on a CFX384 Touch Real-Time PCR thermocycler (BioRad). To reduce technical variation in loading 384 well plates, each independent experiment was ran on the same day with the same aliquots of a qPCR reaction master mix. We applied a Ct threshold of 35 cycles after running water controls for each primer. Thus, any Ct values that were over 35 or not reported after 50 cycles were then set to a Ct of 35 cycles.

The data were analyzed using the ΔΔCt method. ΔCt was calculated about the housekeeping gene GAPDH. Then ΔΔCt was calculated using the ΔCt t from the gene of interest (GOI), subtracted from the ΔCt of the free dCas9-VPR and sgGal4 condition (M 0 ). We then report relative expression as the following:

Fold changes are reported as the ratio of relative expression between the CNO treated and untreated conditions.

Class A GPCR phylogenetic tree construction

The phylogenetic tree in Fig. 4a was constructed using GPCRdb41, 42. Human GPCRs from the Swiss-Prot database were used as reference, without any selection for G protein preference. One GPCR from each family of Class A/Rhodopsin Family GPCRs was used to construct the tree, including those utilized in this study. Full-length sequences of receptors were considered for tree construction. No bootstrapping was performed, and distance calculation utilized the neighbor-joining method, with the regular branch lengths option. The tree was then rendered using T-REX43.

Modeling GFP activation by doxycycline-inducible dCas9-VPR

We construct rate equations to model the induction of dCas9-VPR-mCherry (referred hereafter simply as dCas9) by Dox (D) and the dCas9-induced activation of the target reporter gene, GFP.

(1)

(2)

where α1 and α2 are first-order rate constants for dox-induced dCas9 (C) production and subsequent dCas9-induced production of GFP (G), respectively; the Hill coefficient n and K D are the cooperativity and affinity constants of dox induction, respectively; the exponent m is a lumped parameter that captures the following processes in series: dCas9 binding to the gene target (GFP), transcription, and translation of GFP; β1 and β2 are first-order degradation rate constants for dCas9 and GFP, respectively.

At steady state,

which yields steady state (ss) formulae for C and G

(4)

(6)

where κ1 = α1/β1, κ2 = α2/β2, and Gmax = κ1κ2; Gmax represents the theoretical maximum GFP level.

A simple mathematical rate model of the CRISPR ChaCha system

We construct rate equations to model four connected processes, which are: (i) conversion of inactive hM3D-TEV (R) receptor to an activated state (R*) upon CNO ligand (L) binding, which leads to (ii) the cleavage of dCas9-VPR-mCherry (C) from ARRB2-dCas9-VPR-mCherry (A, referred hereafter simply as ARRB2-dCas9) that can be (iii) induced with doxycycline (D), and (iv) the subsequent activation of the target reporter gene, GFP (G), by cleaved dCas9-VPR.

(7)

(8)

(9)

(10)

(11)

Where α R , α R* and α A are production rate constants for inactive receptor, ligand-activated receptor, and ARRB2-dCas9; β R , β R*, β A , β C , and β G are first-order degradation rate constants for inactive receptor, active receptor, ARRB2-dCas9, cleaved dCas9, and GFP, respectively; γ C and γ G are reaction rate constants for active receptor-mediated cleavage of ARRB2-dCas9 to release dCas9, and subsequent dCas9-induced production of GFP, respectively; n is the number of ARRB2-dCas9-VPR molecules recruited per one active receptor.

At steady state, all time derivatives go to zero, which yield the following steady state (ss) formulae for relevant molecules

(12)

(13)

(14)

(15)

Substituting equations (12), (13), (14) into Equation (15) yields a steady-state formula for GFP as a function of CNO ligand and ARRB2-dCas9,

(16)

or simply,

(17)

where represents the theoretical maximum GFP level at high saturating levels of L and A, and it is a function of the rate constants for receptor production, dCas9 degradation, and GFP degradation; represents the set-point concentration for the CNO ligand to produce half-maximal GFP levels; represents the ratio of active receptor-mediated ARRB2-dCas9 cleavage and active receptor degradation rate constants.

Data presentation and analyses

Data are displayed as individual points with sample size indicated in figure legends. No sample size estimates were performed, and the sample sizes used in this study are consistent with those used by similar genome editing and gene regulation studies. Experiments were performed independently at least two times. Values reported are relative to indicated control conditions. No randomization or blinding was performed.

Statistical analysis was performed using SPSS Statistics 21 (version 22, IBM Corporation), or Prism 7 (Graphpad). Equal variance between populations was not assumed. To account for unequal variance among conditions, Welch’s two-sided t test was performed when comparing two conditions, and Welch’s ANOVA was performed followed by Games–Howell post hoc tests when comparing more than two conditions with each other. All statistical data analyses are compiled in Supplementary Table 6.

Data availability

All relevant data can be provided by the authors. In the manuscript we provide the raw data (Supplementary Data 1–4) and R scripts (Supplementary Data 5) used to generate in Fig. 1 and Supplementary Fig. 2.

— Nature Communications