#5lan

[ofindigoskies]

he looks so good here win for long hair 5lan as he forms his new identity nation

[djmastermix1]

You're invited to Father's Day social dancing this Sunday, June 15th at Le Spot Café, Elmont, NY. Don't miss out!! Music by DJ Master Mix. Hosted by Betty Bella. Doors open: 7Pm-1Am. Adm.$20. Zelle (516) 574-2413#kompa#salsa#zouk#nyc#FathersDay#4kampe#joedwetfile#rutshelleguillaume#longisland#Tvice

*We celebrate birthdays and any other occasion.

[netalkolemedia]

5Lan dévoile “Gouyad Daddy”, premier album exclusivement dédié au Gouyad

Le 13 août 2024, le groupe 5Lan a marqué un tournant majeur dans sa carrière musicale avec la sortie de Gouyad Daddy, son premier album entièrement consacré au gouyad. Composé de dix titres, cet opus plonge au cœur de ce genre musical, avec le morceau phare “Grind On Me”, qui illustre parfaitement les rythmes sensuels et dynamiques du gouyad. Pour célébrer cette réalisation, 5Lan a organisé une…

[tieria-erde]

i think i didnt appreciate el4n nearly enough for what he was on my first watch through because i saw "cold and stoic character" + "cyber-newtype" and thought oh this is like a tieria. and then he really wasn't that and it threw me off. but now i'm engaging with the character and the character is kind of killing me

[charaznablespeteevee]

You ever think about how oddly similar 5nore and Chamuro are? Like--I swear that you could take like half of the Chamuro memes on here, switch them out with 5nore and they'd still be accurate.

Hmm, maybe if you kind of exaggerate Char being a wife guy and Amuro being tsundere as like a joke, but otherwise I don't actually think they're that similar. 5nore is more of a cyber newtype thing except turned on its head (the cyber newtype doesn't die this time!) whereas Charmuro is in its own universe of "fellas is it gay to accidentally mindmeld and then be starcrossed with your rival".

There ARE similarities in Char/5lan asking Amuro/Norea to run away with them, but that's what I like to call a Gundam Love Confession because it happens so OFTEN in this series so it's hardly unique to these two pairings. Soooo many Gundam ships do this lmao.

So yeah you could probably swap a couple of memes between the two but ultimately I think they're pretty different.

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

[adracat]

GWitch 23 thoughts

Sorry for the wait on this, I had to rewatch a few times to really drink in everything that was going on. I didn't have the best knee-jerk reaction initially ( I enjoyed it ofc but was a bit ambivalent about some things) and wanted to give it a fair shake.

First up, seeing Suletta zip around like the ace pilot she is was quite rewarding and fun! Now all those auto-pilot rumors can be laid to rest. However, the circumstances weren't the best and it broke my heart she was gasping for air the entire time. I had no doubt she'd live but it's still miserable to witness that

Ah Lauda. Your tomfoolery knows no bounds. We knew this was coming after the last ep, but it's still a bit frustrating. On a technical narrative level, it works since we're seeing two sets of siblings confront their simmering tension with one another. On a personal level, I wasn't very amused. I first saw this at 4 in the morning and had no patience for Lauda lmao. But rewatching it a few times gave me a deeper appreciation for what's going on. He's really intent on scapegoating Mio for everything wrong in his life. Fitting for her role as the Rose Bride and Lauda's demonized witch

This little aside from Chuchu is so suspicious tbh. Considering Mio's failure at piloting, this seems to imply either she does not have a permet implant of any sort or a flat intolerance. I have a sneaking suspicion it'll become a factor in the next episode.

Mio staring wistfully at Cool-san/etc memento of Suletta will always grab me by the throat. Girl wants to wife up Suletta so bad. And really, who could blame her?

Schwarzette is so pretty and cool. Unfairly so. Like, why did you make that thing so unique and cool? For dipstick Lauda?? Who is that pink permet for and why does it look like Utena??? ANSWER ME OKOUCHI

That's nice of Delling to rise from his sickbed to try and negotiate with the SAL. Unfortunately, this would be for naught because they're here to purge and replace. Not make nice. It was the thought that counts, I suppose.

Speaking of, the debut of a solar ray blindsided me. I mean, yeah it's Gundam, but I kinda thought we were skipping the big death ray lmao. After sitting on it, I think I know where it's headed. Totally on brand for SAL too in hindsight. They like to act removed, but they're just as entrenched as Benerit in the skeevy corpo politics. Allying with Ochs and now Peil cements it

Check the link above to see my Utena related thoughts on this moment btw. It might be the highlight of the episode beyond the Prospera confrontation. Stunned they finally stopped playing coy and seemingly confirm Notrette is indeed a GUND entity residing in pseudo hell, and likely a GWitch newtype like Eri

This was very sweet and I enjoy it more on a rewatch but I also understand why I and so many people had a gut-deep aversion to this subplot. The issue is entirely investment based imo, and tbh I just don't care that much about the Jeturk family dynamics. At best, I don't mind them. Guel is a bro but Lauda is SO exhausting on multiple levels. His misogyny and gross negligence of Petra in favor of revenge doesn't help.

If something came of this other than Lauda/Guel sibling closure, I'd consider it fulfilling. But if you lack investment in the conflict, it's going to feel limp or frustrating in comparison to the siblings you want to see. So while I appreciate the parallel with Suletta/Eri and the continuing subtext of witch coded Mio, that's it for me. But hey, it serves a purpose. A tragic cycle was broken after all, thanks to love and MVP Felsi!

The one big gripe I have after consideration is this man's continued existence. Kenanji doesn't deserve to play buddy buddy with the cast. He's a dirty space cop who bullies children and murdered Nadim, now he's joking with 5lan? The hell. I get the theme of the show is forgiveness and not perpetuating the cycle of revenge but... really? KENANJI gets to be happy but Norea/Sophie don't? Sigh

It was so dirty of Eri to use Suletta's love for Mio against her. She knows Suletta would panic over their mother possibly 'gaining two'. It's crafty and unrepentant, but Suletta holds fast. Her faith in Mio is greater than her idle fears

Mio scolding Prospera over her favoritism was great. We love a fiancé willing to take a stand against her shit in-laws. Speaking of, looks like Mio has fully embraced becoming a Mercury one day. 'All of us will be family' YEAH YOU WILL so suck it up Prospera. The holidays are gonna be so awkward

Btw love Mio was shouting at her while having an emotional breakthrough deciphering her mother's QZ riddle. This moment was excellent and easily superceded my minor gripes. UGH when will you reveal Notrette's whole deal GWitch? We're waiting

Such a bittersweet moment. We know from the Blessing and Cradle Planet that Eri loves her sister but it may not have been until this moment that Suletta understands her feelings. Now, I don't think she's 'dead' tbh. Or deader anyway. I suspect it's a false flag to hook you until the finale. It would be quite anti-climactic if she passed without a proper goodbye. I'm still holding out on a Tempest end where Prospera voluntarily sets her free.

The next Sunday will be our last. Hard to believe tbh. Feels like just yesterday we set out on this spectacular journey. Que sera sera! I'll see y'all in the finale~

[novumoru]

5lan just needs to get better at geoguessr

[prezaki]

Words cannot describe how much I hate this shot sequence and how much it has killed my creative drive regarding post-canon 5lan.

It's just such a cheap wrap-up. Destroying Quiet Zero doesn't bring Norea peace, doesn't make her happy, doesn't have anything to do with her at all! Norea died miserably and angrily!!

To have 5lan be like "ha! a job well done, now she can rest in peace :)" here is just... it sands down everything about their relationship, everything about the feelings they related on, just so the character arcs can feel 'closed'.

They shouldn't have been closed. This wasn't for Norea, this did nothing for her. It would have been so much more meaningful for me if they had dared to leave this as an open wound for 5lan.

[scarlthesnarl]

I'm looking forward to getting my shit together enough to finally put proper effort into getting the D&D AU going. I wanted to have a project with some longevity to help keep Suletta Sundays alive. @red-the-royal has been so kind as to be a sounding board and let me babble about it for like a month and came up with the working title of the AU.

There's a lot more going on but we have:

- Suletta as an aasimar oath of devotion Paladin

- Miorine the abjuration Wizard with a spot of [redacted], likely a half-elf.

- Chuchu as a Drake Warden

- Nika the Artificer (no shit amiright?)

- Guel the human Battlemaster

- 4lan and 5lan as some separate flavor of rogue

- most of Earth House is still up in the air but I've got Aliya pegged as a Circle of Stars Druid.

Chapter 1 is in the works while I am working a project for the bumbleby big bang but I hope to have more ready soon!

[ticketgatewaycanada]

BASS-MINT organizing BLACK DIAMONDS & PEARLS : T-Vice, 5Lan, Oli Duret, Paska + MTL's Top DJs event by BASS-MINT2025–01–01 09 PM in Canada we are selling the tickets for BLACK DIAMONDS & PEARLS : T-Vice, 5Lan, Oli Duret, Paska + MTL's Top DJs https://www.ticketgateway.com/event/view/black-diamond---pearl---t-vice--5lan--oli-duret--paska---mtl--top-djs

[djmastermix1]

April 6, 2025 - Save the date

Noche Caliente on fire!

Le Spot Café, Elmont, NY

Pay with Zelle (516) 574-2413

We celebrate birthdays and any other occasions.

[haitianculture509]

5LAN FEAT PASKA - PRETE'M RIN'W - official VIDEO!

[tieria-erde]

5LAN'S ULTIMATE HEADSHOT!!!!!!!!!!