#frog names

[sillykittyco]

₊˚ ‿︵‿︵‿︵✿ · · ♡ · · ✿‿︵‿︵‿︵ ˚₊

KEROPPI NAMES !!

‧˚₊•┈┈┈┈★┈┈┈┈•‧₊˚⊹

Ribbit - Spring - Tadpole - Cattail - Algette - Leaperre - Lillypad - Croak - Logelle - Mangrove - Gillesse - Ampheon

₊˚ ‿︵‿︵‿︵✿ · · ♡ · · ✿‿︵‿︵‿︵ ˚₊

[pangur-and-grim]

working on a new print

[frognames]

you give your frogs bad names

[peridyke]

my roommate told me to clip this sgt frog bit that we were losing it over so here you go

[marlynnofmany]

This is genius. Off to search the kitchen for new character names.

[possession1981-moving]

THE FIRST OMEN dir. Arkasha Stevenson, 2024

[poscariastri]

any race can be your home race if youre oscar piastri

[highlandkall]

a dip in the lake ^^

[aquacomet]

Week 7 @daycarefriendpickup magma art! 🐸🌧

Decided this week to doodle up some art of @crabsnpersimmons raincoat Sun and Moon designs from their Rain or shine AU! The designs are super cute so I just had to doodle something up for them!

I wonder if they would make some little froggy friends while splashing in puddles, I can sure imagine they'd have fun hopping along with them!

Live Aqua reaction during breaks:

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[markscherz]

My mother and I have two masters degrees between us and yet somehow we could not figure out if frogs have lungs or not.

Can you help settle the debate?

All frogs have lungs except one! The bizarre Barbourula kalimantanensis is the only known frog to lack lungs. It makes up for this by being heckin' flat, basically imitating the bizarre pipids.

[amphibianaday]

day 1421

[lucabyte]

times ive drawn loop being used as a reading light: 2

[fatedtime]

sorry for all the toshiro posting but i'm thinking a lot about toshiro and laios and how, even though it didn't happen cleanly or neatly, laios was exactly what toshiro needed in his life. laios's socially-awkward ‘cannot mask to save his life’ autism was, in the end, was not a bad thing -- it was something that, deep down, toshiro was jealous of and through that jealousy it showed him the path to being more open and honest with others.

if laios had been different, i don't think toshiro would have realized what he needed to change to be happy. he might have gone his whole life never being able to be himself because he was so convinced that he doesn't matter. because laios didn't just frustrate toshiro to no end, finally making him snap so he articulated his true feelings for once in his life -- he also told toshiro he cared for him, wanted to be his friend, and that toshiro needed to eat and sleep. that he needed to care for himself, too. and because toshiro accepted that he had his regrets and wished he was more open like laios... he was able to be more authentically himself.

idk. that's really special to me. that laios being the way he was wasn't bad, in the end, even though so often not reading social cues is seen as a damning negative. if laios hadn't been flawed, idk if toshiro would have ever come to these conclusions.

[kringle-c]

happy baldurs gate anniversary

[werewolfaday]

day 8! for Void :) (prompt under cut)

(if you wanna request a werewolf for one of the days, you can tip me thru ko-fi!)