#<- fitting

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[meirimerens]

just remembered that horse i had on a trail ride who when we came to a trough in the village i was told needed his bridle taken off to drink because he had never figured out how to drink with the bridle on and would as such shove his lower face into the water and potentially drown himself. if you're ever scared of horses remember this.

[symerr]

...ok. serve.

[cordspaghetti]

really factual recounting with no embellishments whatsoever

[taahko]

i think some of you dont like narratives or stories or characters i think you just like fanfiction tropes

[kaereth]

Dragon harpy chimera birdy FALIN!! I love her

[cloud-ya]

outcast of the village

[prinnay]

Flower child

[sabertoothwalrus]

modern au laios

[churroach]

Full of Desires

[impillian]

white woman blast

[ceaselessbasher]

I swear to god one of these days were going to see a video of Amaury Guichon and he's going to be making some wings and they are going to look dope as hell, the detail of each feather will be breathtaking, he'll spray paint them to perfection, but as the video goes on, he's not building any sort of winged creature, just the wings. And then there's a human-sized harness (also made of chocolate, somehow, he can do it). And he's attaching the wings to the harness. And he's putting the harness on and he demonstrates how he can flap the wings. And then he'll be off. Out the window and up and up and up. And we'll be looking at the livestream (it's a livestream now) and we'll scream "No, Amaury, the sun! It's going to melt the wings!". But he knows this already. And he is free.

[l-a-l-o-u]

sending your friends terrible tumblr posts is a love language

[alexandriad]

jumping on the bandwagon with an ancient greek miku

[beebfreeb]

[sabertoothwalrus]

Chilchuck Northern Boys amv