#i am not immune to the sexy spider

[leopardmuffinxo]

Kar'niss 🕷

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[eyelessfaces]

I will admit I haven't done too much research on Spider-Man 2099/Miguel O'Hara but he got fangs and paralyzing venom so my brain immediately goes to how that could be used for sexy times 🤔😈

Like the first thought of course is paralyzing his partner with sexy biting and having his wicked way with them (consentiually of course).

But also. What if 👀 Because hear me out. Idk if Miguel himself is immune to his own venom. And after reading your sub!Miguel fanfic I am in that type of mindset. So what if Miguel used his own venom on himself so his partner could use him like a human sized sex toy 👀

(please do ignore this if it's not your vibe. I wanted to share but I know that this may not be everyone's cup of tea)

OH MY👀 OH MY GOD

(this is very much my cup of tea babe.)

look his dna is half spider half human so we have 50% of chances that he can paralyze himself if it's his human part reacting there but for the sake of the horniness I feel towards this man let's assume he's indeed not immune to his own venom

it takes a little convincing because you're scared he'll hurt himself but he asks you if you've ever gotten hurt when he bit you and you're like yeah you're right never! lemme use you

the sight of him biting himself gets you even wetter because oh god (where would he bite? I'd say bicep or forearm because I think that's what's more practical and I think bicep looks even hotter)

and okay listen you use him like he's your personal little fucktoy but you better believe that he's still praising you so much telling you how pretty you look using him like this and how good it feels🙏🏻

he also makes sure you make good use of his mouth being one of the only parts of his body not paralyzed😋

[literalite]

character/story influences tag

rules: write up a blurb or make a visual collage of the people or characters (from books, TV shows, movies, etc.) that inspired your story and/or OC, either visually, personality wise, or just a general vibe

thanks for the tag @tricoufamily :DD i am tagging @gunthermunch @lucidicer @itsmariejanel @orphyd @goldenwaves this is FUN u should do it. thank u

medias/characters meet me in the woods: man in the dark (paul auster), orlando (virginia woolf), lord huron's entire discography, specifically meet me in the woods and the ghost on the shore, the godfather 1972 (barely), age of adaline 2015, the old guard 2020, this specific cc cross, and reading homer's the iliad in my final year of high school. somehow don't go where i can't follow: the raven cycle (maggie stiefvater), his dark materials (philip pullman), adventure time 2010-2018, mitski’s bury me at makeout creek album, next of kin by alvvays, bite the hand by boygenius, matilda (roald dahl) (jokingly), horrible no good homoerotic teenage friendships, the chosen one trope, and this post by tumblr user @/louisegluckpdf. also my life which explains why the aesthetic is completely disjointed RIP violent affairs (with @lucidicer): nbc hannibal, bones and all 2022, arachnids, ethel cain’s preacher's daughter, sir chloe’s i am the dog album, mine and olli's deranged combined mental energies mutually focusing on t4t cannibalism  vinny reign: matt murdock (netflix daredevil), joel miller (tlou), the fallen angel painting by alexandre cabanel, caravaggio paintings, catholic guilt, arsonist’s lullabye by hozier caleb vatore: those italian twinks that renaissance artists kept referencing to paint religious figures, dorian gray, orlando, timothee chalamet (LMAO), the reveal that the noo don’t kill yourself you’re so sexy guy is a twink [redacted] morrow: gojo satoru, howl pendragon (studio ghibli), jay gatsby, kageyama shigeo and also a bit of reigen arataka (mp100), ronan lynch and gansey (the raven cycle), eden's entire discography, birdcage by novo amor, mercy by sir chloe, myself ophelia griffin: ophelia painting by john everett millais, blue sargent (the raven cycle), clairo, phoebe bridger's discography, strawberry blonde and your best american girl by mitski, clairo’s immunity album, the first crush i ever had manny pluto: yotasuke takahashi (blue period), tbh a lot of blue period in general, alhaitham (genshin impact), adam parrish (the raven cycle), a hint of geto suguru, working for the knife by mitski nayef al karim: spiders, abel AND cain, julian slowik (the menu 2022), hannibal lecter (yes obvious i know but moreso the focus on fine dining as opposed to the psychology), stewy hosseini (succession), inbred by ethel cain

[neurotoxic-yuri]

ok hot character ask.... Widowmakier from overwatch?

Not My Type | Alright | Cute | Adorable | Pretty | Gorgeous | LORD HAVE MERCY

I am not immune to sexy spider-themed purple women but also she's better in my head because I fundamentally dislike Blizzard art design...and also quality headcanons >:3c

[bobasheebaby]

200 Brooklyn 99 Prompts

Rosa

1 “Talk to him, that's what friends do.” “Nope. I'm gonna wait 'til I'm on my deathbed, get in the last word and then die immediately.” “That's your plan for dealing with this?” “That's my plan for dealing with everything. I have seventy-seven arguments I'm going to win that way.”

2 “I'm already seeing somebody, NAME.” “Oh, and just like that, things got interesting.” “And just like that, I left.”

3 “NAME is even wearing his/her formal leather jacket.” “It's the one without any blood on it.”

4 “Right, that's the guy/girl you said the lame stuff about. Like he’s/she's a good listener.” “Sorry, what do you look for in a guy/girl?” “Real stuff, like the shape of his/her ass.”

5 “Sorry I'm late. I had to go back to the deli and return my Everything Bagel. In what world does everything not include beef jerky?” “All of them.”

6 “He/She also likes to look up recipes online and go, "Who's got the time?"

7 “Thank you, NAME. Your entire life is garbage.”

8 “NAME , tell us about your family.” “I have one.”

9 “Anyone over the age of six celebrating a birthday should go to hell.”

10 “I am dating his/her nephew/niece. Now we are hanging out on weekends. What is next? Oh! Small talk.”

11 “Wait, is that a smile I see?” “Possibly. My immune system is too weak to fight off my smile muscles.”

12 “Whoa, what happened? You know what, forget it. I'll just read NAME’s notes.”

13 “NAME? Are you stuck in there?” “No, I'm in here by choice.” “Oh, 'cause I hear some banging noises as if someone was struggling to open the door.” “No. That was the pipes.” “Or, is it the sound of you learning how to ask for help? You know, you can't spell ‘independent’ without ‘dependent.’” “And you can't spell ‘Go [bleep] yourself’ without ‘[bleep] you.’”

14 “I've said "excuse me" more times this morning than I have in my entire life. Twice!”

15 “Oh, nothing better after a long shift than coming to BAR NAME. It's like Cheers, where everybody knows your name.” “A place where everybody knows your name is hell. You're describing hell.”

16 “So, what is this? Casual, serious? I need to know how to make fun of you.”

17 “NAME and I broke up. He/She ate soup too much.” “What, like every day?” “It happened twice.”

18 “So, what are you drinking?” “I'll have a margarita. But, like, a skinny margarita. So, like, tequila, lime, and a tiny splash of agave.” “Mm. I refuse to order that.”

19 “What are you looking all wistful about?” “Just thinking, about relationships and love, and how I'm way better at them than I thought I'd be. Should I do a TED Talk on it?” “Doesn't seem any dumber than all the other TED Talks.”

20 “Why didn't you tell me? I had no idea things were getting that serious.” “Yeah, it's very embarrassing having feelings.”

21 “So are you bringing someone to the wedding?” “No, I'm taking a break from dating for a while.” “What?” “I'm sick of asking people how many siblings they have. Oh, is it somewhere between zero and two? How fascinating.”

22 “I grew a goatee and it looks amazing, and I know you can see it.” “Of course we can see it, NAME. It's horrible.”

23 “It feels like you're being a little harsh.” “Thanks, good note. I was going for extremely harsh. I'll turn it up.”

24 “Are your senses heightened?” “I think I might be pregnant, not bitten by a radioactive spider.”

25 “You're what sneezes are!”

26 “Seriously, you guys should stand up once in a while. You know, for your hearts.”

27 “NAME, this is dumb. I'm just gonna go.” “No, no, no. You promised me more time. I still have seven minutes.” “I really don't want to miss my flight, and I cannot physically stand the way that room smells anymore.” “Just breathe through your mouth.”

28 “You know, some people say, ‘Mo money, mo problems,’ but those people are idiots. Money's amazing.”

29 “Dude, just admit you ruined everything and turned our lives into a living hell. No biggie.”

30 “We don't want anyone getting alcohol poisoning, so if you throw up, you're disqualified.” “I never throw up. I just tell my stomach to deal with it. My body is terrified of me.”

Jake

31 “I also have a hairline fracture in my thumb. Mankind's least important finger, am I right?”

32 “I wasn't hurt that badly. The doctor said all my bleeding was internal. That's where the blood's supposed to be.”

33 “How much could I possibly owe you? Fifty, sixty bucks?” “Two thousand, four hundred and thirty seven dollars.” “Dollars?! Wait, of course dollars. Why was that the part I was surprised by?”

34 “So, I'm going to grab a healthy breakfast.” “Are those gummy bears wrapped in a fruit roll-up?” “Breakfast burrito, but yeah.” “I pity your dentist.” “Joke's on you. I don't have a dentist.”

35 “I'm talking to my credit card company. I tried to get an online subscription to the New Yorker and they declined me. Apparently, based on my previous purchases, they assumed it was fraud. That's crazy. I'm fancy. One time I had coffee-flavored ice cream.”

36 “Rules are made to be broken.” “They were made to be followed. Nothing is made to be broken.” “Uh, piñatas.” “Glow sticks.” “Karate boards.” “Spaghetti when you have a small pot.” “Rules.”

37 “Hey, can I ask you something?” “Mm-hmm.” “If the toilets drain into the ocean, does that mean a tiny shark could swim up and bite me in the butt?” “No, not at all.” “Psh, lame.”

38 “NAME, super important question. Which one of these shirts should I wear to dinner with your dad/mom tonight?” “Those are exactly the same.” “I have a signature look, NAME.”

39 “Hello, good sir, I'd like your finest bottle of wine, please.” “That will be $1,600.” “Great, I'd like your $8-est bottle of wine, please.”

40 “I am straight-up depressed. NAME’s been doing her best to cheer me up. He/She gave me this sticker this morning just for waking up.” “Ew, it's like you're dating your teacher.” “I know, it's so hot.”

41 “Wait. Before you say anything, I want to guess what happened based on your face. Someone died. No! You won a prize. I'm not getting better at this.”

42 “What is the bandwidth on the wifi here? We have much content to stream.”

43 “Oh, you sweaty, chair-spinning morons. You're gonna get us out of here.”

44 “Sir, I think I speak for all of us when —“ “He/She doesn't.” “He/She doesn't.”

45 “So, your brother/sister's a bit of a nightmare.” “I wouldn't say that. I mean, at most, he’s/she's a daymare.” “Those are so much scarier.” “Yeah.”

46 “Look, NAME, I burnt two hundred calories.” “That's your heart rate.” “Yeah, that checks out.”

47 “I don't slump, people. I opposite of slump. I pmuls. That's slump backwards and it's what I do. I pmuls all over this bitch.”

48 “Excuse me. We were just looking for a place to —“ “Boink.” “Yes, boink. That's my preferred term for it, too.”

49 “Thank you for doing this. I love you.” “Noice. Smort. I love you too.”

50 “Adult parties? I believe they're called orgies.”

51 “I have a sexy voice!

Champagne.

Mountain range.

Hugs.”

52 “Has anyone ever told you you look just like a statue?” “Yes.”

53 “NAME, you're smiling. It's very weird. Like seeing a turtle out of its shell.”

54 “You look happy. Let me guess. Your egg sandwich fell on the floor, and they gave it to you for free.” “No. Can you do that? Why doesn't everyone just drop their sandwiches on the floor?” “I was trying to insult you.” “And instead you gave me an amazing life hack!”

55 “So, we gonna talk about what happened back there? I haven't seen someone cry that much since NAME heard they were remaking ‘First Wives Club.’”

56 “Hey, there, NAME. Everything okay?” “No, I'm having a meltdown.” “Props. That was amazing.” “Thanks. It was a lot of work.”

57 “Almost makes me wanna take things seriously all the time. But then I'm like ‘boobs, farts, boobs, whatever’.”

58 “Ahh, babe, this is so nice. There are hot stones on our butts for no reason.” “Not on mine. My butt stones keep falling off, because I'm so tense about NAME being here and ruining everything.”

59 “Okay, don't shoot! That's how people get shot.”

60 “Rule number 3: Let's not have sex right away.” “Cool. Cool cool cool cool cool. No doubt, no doubt, no doubt. Good rule. No sex. Good rule.”

Charles

61 “Okay, but I thought since you were in charge, maybe I could be your right hand man? Your Tinker Bell?” “Tinker Bell?” “Let me tell you something about Tinker Bell. Tinker Bell is a loyal lieutenant and a real thorn in the side of Captain Hook.”

62 “NAME, why don't you show Danger what a fax machine is.” “Okay. Imagine a letter had unprotected sex with a phone.”

63 “Hey, NAME, are you ready to go streaking?” “What?” “That's what my dad/mom and I called getting blonde streaks in your hair. We used to do it to our ponytails on road trips. You just take a little lemon up top, and let the sun do the rest. We called it giving each other road head.” “You just said you called it going streaking.” “It had a couple names.”

64 “So we have good news, and we have bad news.” “My Nana always said, ‘Bad news first because the good news is probably a lie.’ Fun fact: she made me cry a lot.”

65 “What about me? What if something happens to NAME, and he never gets to meet my baby? I don't want to hang out with some stupid baby who's never met NAME.”

66 “Oh, you're right. I'm gonna tell him/her. It might not be today. It might not be tomorrow. It definitely won't be later than tomorrow. So pretty much today or tomorrow then.”

67 “No! I was eavesdropping. I'm always eavesdropping.” “I don't like it.” “Look, I didn't spend the last seven years watching your love ripen, only to have it sullied by a city hall wedding. You're getting married right here, right now.”

68 “I know you think my judgement's clouded because I like him/her a little bit.” “You doodled your wedding invitation.” “No, that's our joint tombstone.” “My mistake.”

69 “How many times have I smacked you in your face?” “Lost count.” “And you still have no fear of me.” “I'm trying to read your womb vibe.” “Exactly. Knock it off.”

70 “Okay, first of all, NAME, you look amazing. Secondly, I made an appointment at the salon with Nikki, for you, under the name Gabriella Fuentes de San Miguel Estrada. I had fun with the name.” “Clearly.”

71 “He’s/She's got a type, which is really any one but you.” “Yeah, that was my ex-husband/ex-wife's type, too.”

72 “Sexy train is leaving the station. Check out this caboose. Later, sluts.”

73 “I can't wait to see you, my luscious little breakfast quiche. I just want to draw you a bubble bath and spoon-feed you caviar. I think we should open up a joint checking account. I love you. [pause] What am I doing?” “It's okay. I hung up right after ‘Chucklebunny’.” “Help me. I've gone Full NAME.”

74 “Do you desire a crispen potato?” “Oh, don't mind if I do-ble. Wait a minute. Crispen potato. Why are you fancy talking.” “How dare you, sir/madam. I speak the common tongue.” “There it is again. You only do that when you're lying or hiding something.” “Hiding? Ha. Pish-posh.”

75 “Hey, donut holes. Don't mind if I do. Eurgh! Fish? Fish donuts, NAME? What is wrong with you?” “It's takoyaki. I'm drowning my sorrows in octopus balls.”

76 “Put on a T-shirt for all I care. It doesn't matter what you wear.” “Of course it matters. He has to wear the smaller checks. Big checks wash him out. Where are you, NAME?”

77 “Ooh, if they have your phone, we can track where they're going. I have ‘Find My Phone’ set up to track you. What? I do that for all my friends, not just you.” “Show me.” “There's no time!”

78 “You okay?” “Yeah, no burns. The doctor said I was lucky my body was so damp.”

79 “You guys have been down here for two hours. What, did you have sex forty times?”

80 “What? You don't need closet space. You have, like, one outfit.”

81 “You just graduated pie school, bitches. [pause] Sorry I said bitches, I'm just really worked up.”

82 “So, I know you're NAME’s best friend, and —“ “Did he/she say that? Did you get that on tape?” “No.” “No, he/she didn't say that or no, you didn't get it on tape? Doesn't matter. Either way, you screwed up big time.”

83 “What you did is the culinary equivalent of unprotected sex.”

84 “That's right. Boom. Just kicked Santa in the testicles.”

85 “No, there's no one in my life. [wink] Sort of a sad thing to wink about, I realize now.”

86 “NAME! Were you dreaming about NAME again?” “Why did you wake me up?! I told you never to wake me up!”

87 “You used all the touching time, NAME. I get 100% of the goodbye touching time. 100%.”

88 “Do you wanna know why he/she went out with him/her and not you?” “Yeah.” “Because he/she actually asked him/her out.”

89 “NAME, will you taste this batter?” “Mm-hmm. Hmm. I think it's a little off.” “You know what's off? Your mouth! Why NAME lets your stupid tongue anywhere near him/her I'll never know. Nope, I forgot the sugar. That's on me.”

90 “There's no need for NAME to see me unleash the beast.”

Captain Holt

91 “Look at you. Always working. What happened to my fun big/little brother/sister?” “Fun? I was never fun. You take that back.”

92 “It's the most fun day of the year. Something you wouldn't understand because you're not programmed to feel joy.” “Yes, but my software is due for an exuberance upgrade.”

93 “Sticks and stones, NAME.” “Describing your breakfast?”

94 “NAME, how are you feeling?” “Better today. I even managed to eat some plain toast this morning.” “Smart. Something bland.” “That's my favorite breakfast.”

95 “Joining us for lunch, Sir?” “Oh, no, I've already consumed the required calories for this day period.” “Yummy.”

96 “You all right, NAME? Tough weekend?” “I went to Barbados with my husband/wife. We wove hats out of palm fronds and swam with the stingrays. I've never been happier.”

97 “Maybe I should wing it. Love, it sustains you. It's like oatmeal.” “Okay. Okay. Not bad for winging it.” “I lied. Took me two hours to write that.”

98 “I do not have a problem. If I want to play Kwazy Cupcakes, I will play Kwazy Cupcakes. Kwazy is a difficult word to say in anger, but I think I've made my feelings clear.”

99 “This place is so romantic.” “Yeah, and so intimate.” “Don't worry. I'm not listening to you. I'm just thinking about how this sea bass is cold but not as cold and cruel as the hands of fate that have thrust my entire life into darkness.” “Ah, damn it. I just ordered the sea bass.”

100 “Yeah, and your new shirt is very aggressive and confusing. Is the pineapple the slut, or is it calling someone else a slut?” “Clearly the pineapple is the slut.” “Huh.”

101 “Oh, I've caused a problem. I think I am getting a text message. Bloop. Ah, there it is.”

102 “So nice of you to greet us, NAME. I thought surely you'd still be crushed under that house in Munchkinland.”

103 “So, do you NAME --“ “Yes.” “And do you --“ “Yes. Yes. We do. We're married.”

104 “I mean, don't people call you NAME?” “How dare you.”

105 “So you lied to me? Out of pity. You pity me.” “I wouldn't put it that way.” “I would. I am offended. I am angry. I am very tired. So I'm gonna take a nap, but when I wake up, oh, you are in for it.”

106 “Look at that. You've helped me find my smile.”

107 “Huh. Meat from the street. Sounds like a fun treat. Hah. I'm a poet and ... I didn't even know I was rhyming those words. But it happened anyway.”

108 “Oh, look at that. An alert. I'm probably trending already. What? My account has been deactivated?” “Twitter thinks you're a bot.” “Why? I am a human. I am a human male/female.”

109 “Care to sit? I'm sure you'd like to take some weight off your cloven hooves.” “Call me the devil, NAME? How original.” “Actually, I was calling you a goat. You goat.”

110 “NAME! I'm coming with you.” “Thank you, NAME.” “I'm also coming.” “Not necessary.”

111 “Spot checks are done. Needless to say I'm thoroughly underwhelmed.” “Huh. From your expression, I would have guessed constipated. Or chilly.”

112 “NAME, you have a pretty low bar for what you consider drama. Once, I used an exclamation point in a email. You called me Diana Ross.” “I assure you, in this case, I do not exaggerate.”

113 “I know they say it's not good to have a TV in the bedroom. Which is why I don't.”

114 “NAME, did you just laugh?” “Uproariously.”

115 “You know when you play along with the robot jokes, it kinda ruins my enjoyment of them?” “Yes, I know.”

116 “And what do you hope to get out of this, NAME? Let me guess revenge on Dorothy for killing your sister?”

117 “It was a good game though for a dumbass.” Okay, you're kinda overusing that one. Maybe switch it up a little bit.” “Oh, good note. You dick.” “That landed good.”

118 “Dancing over. Situation defused.” “No!”

119 “All right, NAME, I'm sick of you wasting time. So, yes, I spilled some minestrone on my pants and I'm sitting in my underwear. Happy?”

120 “You found me. Drinking seltzer in the shadows.”

Gina

121 “It's a sloppy Jessica. Mac n cheese, chili, pizza on a bun. Its everything I've wanted to eat for the last 48 hours.” “What happened? I thought you were gonna 'last forever bitches.'” “Turns out I gave up easy. You hear that bitches? I gave up so easy.”

122 “If NAME had a twin, he/she would have eaten him/her in the womb.”

123 “Wait a minute, I think I just figured something out. I got to go.” “Aren't you forgetting something?” [person a gives Person b a kiss on the forehead] “Uh no, pay your bill! Damn, who raised you?”

124 “The English language can not fully capture the depth and complexity of my thoughts. So I'm incorporating Emoji into my speech to better express myself. Winky face.”

125 “All right, gang. Diet day 4. How's everyone holding up?” “Honestly, I'm going to last forever. You hear that bitches? I'm gonna last forever.”

126 “If I die, turn my tweets into a book!”

127 “The only reason I didn't tell you is I don't value you as people, so why be honest?”

128 “Breakups are a cartoony thumbs down. They make people feel face-with-Xs-for-the-eyes.”

129 “I'm sorry. I just don't think this is something you're good at.” “What? The only thing I'm not good at is modesty, because I'm great at it.”

130 “Click. I just captured the exact moment you realized you had failed. I guess we all got something out of this.”

131 “It's so addictive, right? I play so much that when I close my eyes at night, I just see cupcakes instead of my normal dizzying array of flashing lights.”

132 “Forget your ex with meaningless sex. It rhymes because it's true.”

133 “NAME. NAME. NAME, I screwed up, big time.” “NAME, given your daily life experiences, you're gonna have to be more specific.”

134 “So, talk to me, goose. How are we looking?” “Sexy, but not like we're trying too hard. Like, sure, we're trying, but it's almost effortless.”

135 “Give me the ring.” “You sound like Gollum.” “That means nothing to me. I don't see those movies, I'm too pretty.”

136 “Oh no, six drink NAME isn't fun. He’s/She's just sad. Damn it!”

137 “I never have second thoughts. That's the luxury of having great first thoughts.”

138 “Ugh, constantly getting NAME’s approval is the worst.” “Yes. I can only imagine.”

139 “You think you can just bully people, but you can't. It's not okay. I'm the bully around here. Ask anyone.”

140 “This just might work out after all.” “You're damn right it will, 'cause we're a ragtag, scrappity, fart-dumb, moron parade, smart-ass team!”

141 “Okay, NAME, stop freaking out. I have the day off. I can step in and help.” “Yeah, me too. I'm not off, but I come and go as I please. It's part of my charm. I'm like an outdoor cat.”

142 “Gina, please keep an eye on NAME today. He's/She’s gonna say something to the wrong person and get himself/herself punched.” “Sure, I'd love to see NAME get punched.” “Try again.” “I will stop NAME from getting punched.” “Correct.”

143 “Oh, I want him/her out. But I'm too scared to tell him/her. “ “All right, listen. I know that your spirit animal is a caterpillar that's been stepped on —“ “Mm-hmm.”

144 “What are you creeps doing? You made me look away from my phone. You better pray I didn't miss a text.” “In the two seconds you looked away?” “Seventeen texts. All of them important.”

145 “What is my favorite soup?” “Chicken noodle.” “Potato leek.” “Corn frickin' noodle. I mean, chowder, damn it.” “You're all wrong. I've never had soup.” “Don't bother. They all suck.”

146 “Okay, so that plumber was useless. But we are two smart and capable people who can definitely figure out how to fix a toilet.” “Of course we can. The internet will tell us what to do. She always does.”

147 “It's crazy how much he/she flirts with me.”

148 “Good morning.” “For whom?” “For you-m.”

149 “So he/she didn't say what happened, which can only mean one thing.” “He's/She’s in a fight club.”

150 “What's up? How can I help?” “Well, when I was a kid, I invented a magnetic flashlight clip so I could read under the covers. This clip and I went all around the world together the Shire, Sweet Valley High, Terabithia.” “But never to a friend's house, huh?” “Uncalled for.”

Amy

151 “That stuff with us is in the past. We talked about that.” “I know, but that was before you saw me in this dope ass tux. I mean you must be freaking out.” “Oh, I really am. I'm really into rented clothes. I love how many butts have been in them.”

152 “You know, we're birds of a feather, you and I.” “I hate cliches.” “Cliches are the worst.”

153 “And now I don't know what to do.” “I think you do know what to do.” “Thanks, NAME.” [leaves the room] “I have no idea what he’s/she's gonna do but that's the safest way to give NAME advice.” “Yep.”

154 “Insult me all you want, for I have only this to say —“ “Victory shall be mine!” “I heard you practicing in the shower. You can't surprise me. Letting me into your life was the worst mistake you ever made.” “Cool, fun take on our relationship.”

155 “NAME, where you at?” “Four drinks.” “What's four-drink NAME again?” “Why don't you come over here and find out?” “Right, Horny NAME”

156 “I'm sorry. We only excluded you because you're kind of an over-texter.” “Over-texter? That's not even a thing.” “Oh really? So you don't remember the time you sent 97 unanswered texts in a five-minute span?” “My phone vibrated itself off the desk. I think it was committing suicide.”

157 “What the hell? I used NAME's exact recipe. I know I'm not a great cook, but I love following instructions.”

158 “What's going on? Is this a dream? No, I'm not holding a label maker.”

159 “My power went out last night and my alarm didn't go off.” “Your alarm is power dependent? You brought this on yourself, son.”

160 “I'd also like to apologize for my friend. His /Her parents didn't give him/her enough attention.”

161 “I'm in! A bet which improves someone's manners? Double score.”

162 “He’s/She's scared.” “He’s/She's not scared. With all due respect, NAME, NAME has no feelings.”

163 “I'm so cold even my fiery dance moves aren't keeping me warm.”

164 “I'm sorry. I tried to be myself and they hated it.”

165 “All right, someone's gotta go out there and kill that feathery bastard. NAME, you're always looking for an excuse to behead something.”

Sergeant Jeffords

166 “It was like taking candy from a baby.” “Why are you giving candy to a baby in the first place? Don't give candy to a baby! They can't brush their teeth!”

167 “I was raised on disco. Little NAME loved to hustle.”

168 “Or is your favorite artist really Taylor Swift?” [Scoffs] “No.” “Lie.” “All right, fine, she is. She makes me feel things.” “She makes all of us feel things!”

169 “Urgh, what's in these?” “Potatoes, butter, a little milk. Oh, and I ran out of salt, so I used baking soda.” “Why wouldn't you? They're both white powders. Of course they're interchangeable.” “Yeah.”

170 “I warned you against using donuts. They're my trigger food.”

171 “Hey, NAME, you know how you're really good at doodling?” “I know you think you're complimenting me, but calling them doodles is an insult. You a big fan of Picasso's doodles?”

172 “Your tone's braggy but your words are real sad.”

173 “See, NAME? Tough love works.” “Damn it! NAME proved the wrong point.”

174 “Now, be respectful and grieve your asses off.” “I don't know why this is happening.” “NAME, I love it. Everyone follow his/her lead!”

175 “Everything's spoiled. My lunch is ruined. My chicken, my potatoes, pasta, my meatballs, ham, my yogurt.” “Wow, that's a lot of yogurt.” “I love yogurt.”

176 “Kind of seemed like you were gonna get up and leave after saying all that.” “I was, but I think I hear NAME.”

177 “You better look cute in this picture, or no one's gonna want you. Do something with your damn paws!”

178 “My tolerance has really changed since I had kids!”

179 “I'm hungry!” “Oh, you're in luck; the fanny pack is filled with granola.” “Mmm! Loose granola.” “I don't want fanny granola! I want steaks and whiskey!”

180 “You probably can't tell, but I'm flexing my brain like crazy right now.”

181 “What's that smell? That's lavender. NAME loves lavender.”

182 “Okay. Excuse me. Can we please eat? My body is starting to digest itself. NAME needs nutrients!”

183 “Don't look at me. NAME wastes all that time building muscles, make him do it.” “Oh, come on, you all know these are just for show.”

184 “Sorry? You bumbling son of a bitch. You just ruined my life. I hope you get hit by a truck and a dog takes a dump on your face.” “Nothing to see here. Just a little hypoglycaemic rage. Move along.”

185 “I feel like a proud mama hen whose baby chicks have learned to fly!”

Hitchcock

186 “NAME, why do you have your shirt off?” “Can't spill food on your shirt if you're not wearing one.”

187 “What bet? What are you guys talking about?” “Seriously? The bet? They've been keeping score all year. It comes up all the time. What are you doing all day?!” “Nothing. Why, you want to hang out?”

188 “So you just want us to lie on the ground and do nothing like a bunch of losers?” “Yes, precisely.” “No!” “Jackpot!”

189 “I don't like it. Something stinks.” “Well, I'm sorry, but I refuse to mask my natural musk with a bunch of chemicals.”

190 “My God. NAME, are you the only person still making sense?” “Yeah. It's bad.”

191 “All right, food is ready, decorations are set, guests should start arriving any moment, and the chairs are still perfection.” “He/She said they're perfection. I'm so proud of you, buddy.” “It was you. You made this happen.”

192 “Who do you think it's gonna be?” “I've no idea.” “I bet it's me. I just hope I'm ready.”

193 “Okay, look, this was maybe a weird way to start the night, but the good news is, we can still make our dinner reservation and no one got hurt.” “Actually, I cut myself real bad.” “Of course you did.”

Scully

194 “Oh, so your plan is to not take this seriously at all?” “Oh, I am as serious as a heart attack. No offense, NAME.” “Nah. Mine are never that serious. I call 'em ‘oopsies’.”

195 “I miss my home chair.” “You miss a chair?”

196 “Are those thumbtacks? What the hell, NAME?” “I thought they'd make good confetti.” “Why?”

197 “All right, anyone else have questions? NAME, NAME, you've been weirdly silent.” “We didn't want to say anything that would get us uninvited.”

198 “Okay, first of all, I want to say that this was one of the hardest decisions I've ever had to make. There is so much talent in this room.” “Just tell us, bitch. Act as if you already have the role.”

199 “I'll be back. Don't move.” “Not a problem. I hate moving.”

200 “Where should we begin? Do you have any experience with puzzles?” “Yes. I've never solved one.”

[furiousqueenmarmaroth]

Angel’s Vice

No one asked for it, but here it is: some Azrael smut. I’ll probably reedit it when I wake up. Maybe a part 2 depending on my mood and the reception.

Azrael settled your legs over his, spreading them as wide as they could go while allowing you to rest against his chest. Cool air tickled your exposed sex.

You hadn't expected to have sex with him in Heaven, let alone on his bedroom floor. You had always assumed your first time would be done in secret on Earth, a late night filled with desperate touches never to be repeated. Maybe a prayer afterwards. At the very least, you expected a well thought out plan with every thrust scheduled.

Nope. He just met you naked in his room, commanded you to strip and told you to sit between his legs.

“Comfortable?” His warm, dry hands hands snaked under your arms to massage your breasts, fingers grazing over the nipples before tweaking them. A deep chuckle vibrated through your back when you squeaked at the slight twist.

“Always.” You could barely get the word out as the angel's mouth worked against your neck and shoulders, the soft hairs on his chin tickling you ever so often.

“Good. This isn't fun if you're not.” His fingers continued to explore your skin, occasionally returning to caress a breast or turn your head for a kiss. He avoided your displayed womanhood, though he seemed to enjoy getting teasingly close before pulling back. “You truly are a beautiful sight. All of you. The Creator's master work.”

Somehow this positive dirty talk and coy touching didn't surprise you. It was Azrael, after all. Yet, while there was a lack of rough handling and degrading language there was no question as to who controlled the situation.

“More?” He whispered into your hair, his long fingers walking down your stomach like a spider at your affirmation. One particular digit sent a shiver up your spine as it repeatedly lazily slid in between your slick lips and stopped cruelly just short of your clit.

So focused were you on trying to will his touch ever so slightly higher that you didn’t notice the disappearance of the hand that previously harmlessly rested on your ribs. However, when it returned with a prize it was a little harder to ignore.

“Would you like to discover what this is for?” The glass cylinder before you was beautiful, like an ice swan, except it was shaped vaguely like a penis. The translucent cock before you was undoubtedly of angelic craftsmanship, making up the less than elegant shape with the celestial feel of crystal. Definitely too exquisite to be subject to the murky depths of your sex starved imagination.

“You know how much I enjoy discovering things.” It was shaky. Hungry.

“I always ask before conquering.”

“Conquer me?”

“Politely.” And he was, indeed, very polite as he spread your womanhood with one hand and inserted the cool tip of the phallic work of art into your weeping slit with the other. “Always polite. At first.”

The cold dildo sliding in felt like taking a drink of water after chewing on mint gum, but in a sexy way. Just to balance it was two of the angel’s unreasonably warm fingers rubbing circles around your swollen and throbbing clit. Even while you trembled under his attention, you felt a sense of inner peace at the gentleness of his touch.

A feathery curtain encircled you, trapping you in a warm, secret plane for just the two of you. Time didn’t exist when he muttered prayers into your ear, the harmless and chaste words dripping with erotic honey at the tension in his voice. The outside world wasn’t welcome as your nails dug into the flesh of thighs as you braced yourself against the gradually intensifying waves.

The teapot beginning to whistle, the bubble about to burst, the cup about to overflow. Oh yes, the sweetness of staring down into the foggy abyss.

Ready to jump.

Ready to fall.

Ready to fly.

Only to be snatched away from the mountaintop altogether.

“There, wasn’t that fun?” It stopped. The scream that had built in your throat receded as his hands stopped moving entirely.

“Well… yeah!” You whined as the pleasure waned in the same waves it had come in, still sending tremors down your legs.

“Good. Because we’re going to do it again.” It was a wicked smile as he nudged your spine with his hard and weeping cock.

“Wait, what?”

“Even I am not immune to vice, my sweet. And you will be experiencing a few of mine during our session.” His tongue ran across the used toy. “Delightful.”

“Al-Alright.” You leaned back against his chest as he rewet his fingers in your well before starting the process over again. True to his word, he was less polite this time.

You didn’t know how many times he tortured you, growing rougher with every return from the edge. But at some point he gave you what your sweaty and trembling body begged for, setting aside the favored toy and exchanging it with two skilled and determined fingers.

No orgasm felt as intense as that one. Stars danced in your eyes as you lost all control of your convulsing body. An unholy, gasping shout echoed through your ears that you vaguely recognized as belonging to you.

The angel embraced you as your continued to shake, anchoring your soul to your body before it vibrated out of your skin. The wings that made up your safe space parted and you found yourself on his floor again, gasping the smell of tea and dusty books. The silvery wings sent specks of dust twirling through the air, sparkling in the light that streamed through the thin curtain the angel used for privacy in his personal space.

Azrael gently lay your body, still limp with pleasure, on the rug next to him, rising to stand on his long legs. He gave a brief stretch before heading to his notorious tea table. The swagger in his stride showed off his slender body body in all its glory. Gorgeous and elegant from his now slightly messed hair all the way to the fine off-white hairs that trailed from his chest to frame his still very erect member.

“Sorry for being loud.” You stood on very shaky legs, blushing furiously at the wet spot on the floor. “And the mess.”

A good natured chuckle, “I take both as compliments. Don’t get dressed quite yet. I have more planned after tea.”

[roominthecastle]

A ‘bullet point text reaction’ post thing to the season premiere would be forking good. If you can spare the time in between all the rewatching and RL, which again might be messin with the rewatching. Ps. sexy librarian ftw.

Apologies for the late reply, anon, and thank you for the interest. I gave it a try but apparently I had a lot more rambling in me than expected, so I’m not sure how much the bullet point format will help. Still, I rolled w/ it behind the cut:

obv spoilers ahead for those who haven’t seen + it’s mostly Michael focused but who is surprised at this point? ok, here we go:

Yes. All hail the Sexy Librarian Guy! 👍

and his ~~flawless~~ Australian accent lmao. I am no native speaker but even I could hear it was just… delightfully off. I love this disaster zone demon so much.

and how pleased he was that Eleanor was pleased w/ that particular “intervention”. It’s a small but nice reminder of how making her happy makes him happy now. #oppositeTorturesRule

it’s a v small thing but I also loved the “fast food link”: Michael being ecstatic about the Pizza Hut/Taco Bell combo & Eleanor fantasizing about Chipotle during Chidi’s lecture on Aristotle. It reminded me of that s1 moment when she tells Michael about those Arizona churro dogs and they both just go ahhhhhhhh at the image + Judge Gen ofc (they love fast food in the afterlife)

also also the sweet ache of Michael being entangled in her ticker tape while insisting on nudgy-nudge-nudge her & Chidi together bc that’s how it should be is still pressing hard on my heart thank you v much

but

I think that being deprived of close contact w/ his humans is causing Michael to slide back into puppet master mode again. His motivation is different or “reformed” now (secretly helping instead of secretly torturing) but his methods, his itch to control everything (and failing), and the rigid focus on his goals are… not so much, imo, and I love it bc this is Michael: he is a nerd but also an idiot w/ Wile E. Coyote vibes. Janet tries to reel him in but she can’t. Eleanor was the only one who could control him and she was the only one whose advice he actively sought and listened to, but she cannot be there for him now, so yes, I am getting a lot of S1 vibes from this double ep complete w/ her unintentionally messing w/ his formula by not falling for Chidi & the arrival of Trevor. *rubs hands*

COCOONS

so many

so… squishy

and TODD! I never thought I would see him so soon but I was right: he is the best lava monster and fork you, Shawn, for being a jerk to him when he was nothing but supportive and even brought you guys Dunkin’ Spiders to snack on.

I love Shawn, he is the perfect baddie, and I love that we got another glimpse into how TBP operates w/ all their excruciatingly low-tech gadgets. It’s in sharp contrast to (even Michael’s fake) TGP where everything is so neat, efficient, and high-tech. It’s another nice reminder of how the torturers are also being made miserable in TBP in various ways. I can’t blame Michael for wanting to keep his failing experiment running as long as possible.

Judge Gen (who continues to be a delight and way too relatable w/ her binge-watching of media content) is so up to something, people. I cannot shake this feeling that this whole “Operation Resurrection” is not what it looks like on the surface at all. Maybe it’s an experiment within an experiment sort of deal. I mean, why does she trust Michael of all creatures w/ the monitoring duty at all?? She might be quirky but she is def not stupid. She must know he’s a natural rule breaker who’s incapable of sitting still for longer than 2 seconds and he’s not at all impartial here. The way she set this all up reminds me of the test she gave Jason, and Michael is already failing just like Jason did bc he couldn’t opt out of “playing” due to lack of impulse control and a massive personal bias regarding his favorite team, the Cockroaches. idk what this will mean long-term but I think he’s gonna be in a lot of trouble soon.

speaking of Jason and Michael: theirs is my favorite (sort of bonding) scene, hands down. Again, it reminded me of an early S2 moment when Jason stumbles on a brooding, lost Michael and tells him a dope story about his 60-person dance crew that unexpectedly inspires Michael to seek out Eleanor & Co. The situations are reversed here but it’s an excellent parallel, esp when you compare the two scenes and see the development in both characters and their relationship. Jason is a bit   more grounded and Michael is less dismissive and much kinder to him now. I also love Jason’s continued immunity to Michael’s b.s. It’s different from Eleanor’s (his is stupid-based and hers is about being smartbrained) but it works and pushes Michael to just level w/ him and the second he does, Jason becomes instantly receptive. It’s just a really really great character moment that also moves the plot, so it’s basically perfect. Also I think this is the moment when Michael is temporarily pulled from his puppet master mode due to being near one of his human friends again, and his other side peeks out as he lets himself rest a bit - it’s in his body language, too, as he leans back against the bridge railing and has a semi-honest chat w/ Jason.

Michael’s disguises are an eternal source of happiness to me. All of them (and based on promo pics, more is coming). I also love the way he approaches each human bc it is reminiscent of how he steered them during the reboots: to Eleanor he gave a small clue and just let her chew on it and work w/ it. W/ Chidi, he was more direct, posing as a wise helper/guide. W/ Tahani, he targeted her sense of self-worth. W/ Jason, he gave up after 5 seconds and just told him what he wanted him to do.

I doubt his aliases raised many eyebrows, tho, not in a universe where Simone has colleagues called Mrelk and Catapulp :D but Eleanor seemed to have a bit of a “hmm” reaction to the name of Dr. Charles Brainman, so… we’ll see.

Dr. Simone Garnett had probably the smoothest entry into an established character group, imo. I’m usually sensitive to changes like this but it’s like she’s always been here - another excellent casting choice right there. I am not gonna touch shipping issues, thank you, but I love how Simone’s presence, which is a lot of fun in itself, instantly enriched the landscape of relationship dynamics regarding the present, the future and also the past. I feel that every character combination exists somewhere in canon whether it’s explicitly on screen or not, and that’s just an incredibly freeing, resourceful attitude to have on a show w/ this sort of “multiverse” setup, imo. They have the premise, so why not milk its full potential? The writers use relationships as tools to aid character development, they have admitted as much already, and I am looking forward to seeing what other combos they have in mind and how they play out.

despite his limited screen time and despite him spending most of it being flat and emotionless, frog guy aka The Doorman managed to deliver the biggest punch in my heart w/ that reaction to Michael’s gift. I.crumbled. the way his flatness did when he saw the frog on the mug. Thank you, Mike O'Malley.

It’s probably a good thing that they are becoming buddies now bc w/ evil Trevor in the mix, Michael’s gonna turn that Earth entrance into a revolving door. Unless Judge Gen is onto him and steps in at some point. And I still don’t know how he will interact w/ the team now since they’ve all met him already and he was posing as a different person each time. And given his track record, whatever solution he comes up with, Eleanor will see right through him eventually anyway.

ok this is way too long already, so I’m just gonna say that I am very excited for this season, I love the new setup, I miss the fake Good Place but the university environment is growing on me fast, too, and just bring it, show, ok?

my body is ready

[aquaquadrant]

Hey, have you seen tangled s2 ep1? If so, any thoughts?

i have. and i’ll go ahead and talk about it under a cut for both length and spoiler reasons.

so, first off, i loved the premier. the songs. the plot. everything about it. that flashback in the beginning??? WE GOT THE MOONDROP. WAS NOT EXPECTING THAT. AND IT’S AN OPAL. A LITERAL MOONSTONE LOOKING THING. AAAAAAAA.

the dark kingdom was a total surprise and i’m really excited about it??? i also think that since they revealed the destination at the end of the black rocks in the very first episode of the season, there’s gonna be a huge twist at some point. looking forward to it.

adira!! was so good!!!! she completely subverted the mysterious warrior trope while still establishing herself as a total badass, wise-cracking cryptic. i loved every second she was on screen and i’m so excited to see what she’s up to!!!

i could gush forever about rapunzel and eugene’s relationship so i’ll just say this; they are the one truly blessed couple and i’d die for them.

eugene?? telling lance he loves him???? just eat my heart why don’t you i loved it.

and honestly, when we first heard eugene’s ex was going to make an appearance, i was hoping they wouldn’t go with the jealous, clinging ex route. but in the context of the episode, it made perfect sense and established stalyan as one of the most realistic and despicable villains yet. i love to hate her, and she’s a great foil to rapunzel tbh, even if the ‘sexy woman Bad’ trope is a bit tired.

the only thing i’d say i was disappointed about was the baron as a villain. at first, i was digging it. he gave off ‘slightly western mob boss- vibes which i was loving, and the twist that it was all for his daughter was great. i have a particular fondness for evil dad characters, tbh. 

but in the second half of the episode?? the baron was defeated by his own weapon in a… really lame, bumbling way. like, dude. really? you use a deadly spider against people and never thought it might bite you instead? build up an immunity to the venom or something, i stg.

i’m positive this isn’t the last we’ll see of him and there’s always a chance he’ll redeem himself as a Serious Villain to be Feared, but at the moment, all the build up from season one seems to have been let down.

but all in all, i was thoroughly pleased with the premier and am so excited for the rest of the season!!

[cafeleningrad]

hey, if it cheers you up, can you do loki/yana as rare pair for the ship meme? :)

Hey, shippy anon, this is totally appreciated! Thanks a bunch! (after the latest stuff in my inbox it lights up my mood.)Seems I am not the only one crackshipping :’D

Who asks the other on dates: Loki, he’s oldschool when it comes to dating (and since “robbing of maiden’s from conquered territory” became a bit demodé)

Who is the bigger cuddler: Illyana, most for silent comfort

Who initiates holding hands more often: Loki, he likes staying close to Illyana

Who remembers anniversaries: Loki, even though he tries hard not to confuse the dates of former encounters in his head.

Who is more possessive: Illyana, partly because she’s still sometimes unsure about Loki’s sincerity

Who gets more jealous:Loki as Illyana actually has a circle of friends not consisting of super villains, and a functional relationship to her brother. Oh, the legitimate reign over her own kingdom as well.Once Loki tried to make Illyana jealous of his former affairs by sneaking a tale book to her rooms - his plan failed as Illyana burst out in laughter: “You really gave birth to an eight-legged horse ?!” They actually couldn’t have sex for a whole month after her reading tales about him, since Illyana would giggle terribly. 

Who is more protective: Illyana but Loki is surprisingly good soothing her when she feels distressed.


Who is more likely to cheat: In theory Loki. Maybe’s clamed fown since his days of godhood yet he enjoys flirting for it’s own sake, and isn’t immune to flattery.

Who initiates sexy times the most: Loki, he does not have that many children for nothing

Who dislikes PDA the most: Their PDA’s nothing fancy nor explicit, so both don’t mind. 

Who kills the spider: They’re good for dark magic so the spiders get to live in their household.

 Who asks the the other to marry them: Loki quiet early with the intention receiving the title “King of Limbo” over their marriage, later he does it for earnestly romantic reasons but between these events they have a long way to go.

Who buys the other flowers or gifts: Loki, he holds on to classical courtesy 

Who would bring up possibly having kids: Loki, but Illyana would look straight into his eyes: “You can bet your stupid helmet I am not gonna press a serpent, large enough to circle the earth, out of my vagina.” (Actually the thought of having children secretly scares her.)

Who is more nervous to meet the parents: Equal - who wouldn’t be nervous speaking to the most wisest, powerful gods from the Vikings? But what is this fear compared to ask Collosus out for permission if one was allowed to ask out his little snowflake?

Who sleeps on the couch when the other is angry: Loki, just because Illyana won’t let him have the luxury of a bed after arguing.

Who tries to make up first after arguments: Illyana

Who tells the other they love them more often: Loki, as Illyana is first hestiant with such meaningful words