#snake gourd

[rumeko]

taciturnity

[morethansalad]

Avial / South Indian Mixed Veggie Curry (Vegan)

[crudlynaturephotos]

[yuka-p]

カラスウリ

[fertilitylens]

Snake gourd Benefits, Uses, Impact on pregnancy, Precautions + Downsides

Snake gourd is regarded as a high-nourishing vegetable with outstanding nutrient value and functional benefits for human health. For example, one recent animal study suggests that Snake gourd fruit pulp extract can be used to prevent or treat dyslipidemia, protein oxidation, lipid peroxidation, and DNA fragmentation in the liver, this is due to its rich antioxidant content [1]. It is a versatile…

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[adventuresofsnake]

"One thing to know about me? I love a fucked-up looking gourd. The weirder that thing looks, the more festive I feel. The more ALIVE."

[regnigt]

Gintama Flower Suite, Part 23: Japanese Snake Gourd for Nobume

The Japanese Snake Gourd is a fascinating plant with tall thin fruits. Its white flowers look very unique and bloom only at night. Very beautiful, very unusual and strange. I think this flower fits Nobume well.

(The scientific name is either Trichosanthes cucumerina or Trichosanthes pilosa - there seems to be disagreement between Wikipedia and other websites on this point.)

[n3ongold3n]

The tag system is no help anymore so i don't know if i posted this already or not so here is the behemoth pumpkin i harvested accidentally and prematurely because it hid under long grass. It was almost 10 kg! I've split it with my garden friend and now will see how it tastes like oven-roasted.

[the-cricket-chirps]

Katsushika Hokusai

Year of snake

Meiji (1868-1912) printing

[rumeko]

I love December.

[cinemaocd]

Me allowing myself to overcome my massive obsession with Mark Rylance for five minutes to imagine another actor playing Cromwell:

[iwilldestroytom]

Channa Dal And Snake Gourd Curry

[crzygthumbs]

Like Green Beans... But Better?

Hmmm. Super long, snake bean. Usually when I am deep diving into large seed catalogs and I see “like ____, but better” I roll my eyes and think OK, I’m game. Prove it. This is what happened when I saw and then purchased seed for the Indian Python Snake Bean at rareseeds.com (AKA Python Snake Melon or Python Snake Gourd. Chachinda, Serpent Gourd, chichinda or parwal. It is used extensively in…

[fthrdvs]

Like Green Beans... But Better?

Hmmm. Super long, snake bean. Usually when I am deep diving into large seed catalogs and I see “like ____, but better” I roll my eyes and think OK, I’m game. Prove it. This is what happened when I saw and then purchased seed for the Indian Python Snake Bean at rareseeds.com (AKA Python Snake Melon or Python Snake Gourd. Chachinda, Serpent Gourd, chichinda or parwal. It is used extensively in…

[lumino-wall]

Pudalangai Pachadi ~ Snake gourd raita