Tumgik
#dna sequence
tenth-sentence · 1 year
Text
No single DNA sequence or binding protein is common to all phytochrome-regulated genes.
"Plant Physiology and Development" int'l 6e - Taiz, L., Zeiger, E., Møller, I.M., Murphy, A.
0 notes
justnoodlefishthings · 4 months
Text
Tumblr media
jumping in on this meme with extremely niche comedy
274 notes · View notes
Text
First, let’s address the fact that hackers recently accessed the personal data of about 14,000 23andMe customers. Because of how 23andMe works—it has a “DNA Relatives” feature that lets users find people they are probably related to—this breach created 6.9 million “other users” who had data stolen in the breach, according to reporting by TechCrunch. This data included people’s names, birth year, relationships, percentage of DNA shared with other 23andMe users, and ancestry reports.
[...]
Getting your DNA or your loved ones’ DNA sequenced means you are potentially putting people who are related to those people at risk in ways that are easily predictable, but also in ways we cannot yet predict because these databases are still relatively new. I am writing this article right now because of the hack, but my stance on this issue has been the same for years, for reasons outside of the hack. In 2016, I moderated a panel at SXSW called “Is Your Biological Data Safe?,” which was broadly about the privacy implications of companies and other entities creating gigantic databases of people’s genetic code. This panel’s experts included a 23andMe executive as well as an FBI field agent. Everyone on the panel and everyone in the industry agrees that genetic information is potentially very sensitive, and the use of DNA to solve crimes is obviously well established.  At the time, many of the possible dangers of providing your genome to a DNA sequencing company were hypothetical. Since then, many of the hypothetical issues we discussed have become a reality in one way or another. For example, on that panel, we discussed the work of an artist who was turning lost strands of hair, wads of chewing gum, and other found DNA into visual genetic “portraits” of people. Last year, the Edmonton Police Service, using a company called Parabon, used a similar process to create 3D images of crime suspects using DNA from the case. The police had no idea if the portrait they generated actually looked like the suspect they wanted, and the practice is incredibly concerning. To its credit, 23andMe itself has steadfastly resisted law enforcement requests for information, but other large databases of genetic information have been used to solve crimes. Both 23andMe and Ancestry are regularly the recipients of law enforcement requests for data, meaning police do see these companies as potentially valuable data mines. 
753 notes · View notes
dieinct · 26 days
Text
vampire milk is truly one of my best posts but the fact that a gimmick blog got it circulating again. head in my fucking hands. can we get some organic engagement here
38 notes · View notes
stabble · 3 months
Text
Ghosts having DNA is actually so fucked up and I KNOW they probably put about two seconds of thought into it when they made Danny Phantom but I'M THINKING ABOUT IT NOW AND WHAT THE HELL
44 notes · View notes
cheebuss · 8 months
Text
Tumblr media Tumblr media
TF2 oc except it's just my headcanon for what BLU Spy's mum looked like lol
107 notes · View notes
mikiusol · 7 months
Text
Tumblr media
Neither tired nor angry but something else entirely
65 notes · View notes
adozenforks · 10 months
Text
Does anyone else want to do full genomic sequencing on the Saxons and the people of Camelot and then compare them or is it just me?
I want to know how much the two populations diverged in the unspecified time between "Holder of the GRAIL" and Mordred failing his driving test
Also I'm guessing that the evolutionary rate is ridiculously high among Saxons because of the radiations, but also given the low survival rate, in normal conditions there should be a low genetic diversity because of the bottleneck effect
87 notes · View notes
iobartach · 10 days
Text
i want to 🤝 the hand of any muse that's able to detect / sense that there's something a liiiitle bit off about miguel 👀 that he isn't your standard, run-of-the-mill, stumbled-into-his-powers-by-chance kind of empowered guy. no-noooo, there was a certain amount of consideration put into this spider freak's creation, and in this house, we're not gonna shy away from the horrors inherent in that reality👍
23 notes · View notes
notwerewolf · 1 year
Note
CGACTAGCCATCCCTCTGGCTCTTAGATAGCCGGATACAGTGATTTTGAAAGGTTTGTGGGGTACAGCTATGACTTGCTTAGCTGCGTGTGAGGGAAGGAACTTTTGCGTGTTAGTATGTTGACCCGTGTACTACGCATGCGGGTAGATTATGTAGGTTGAGAGATGCAGGAGAAGTTCTCGACCTTCCCGTGGGAGGTGAACCTATTCACTATTGGAGCATTCCGTTCGAGCATGGCAGTAAGTACGCCTTCTCCATTCTGGTAACCTTCATCCCTATCAGAGCTTGGAGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTCCTACTCACAGTCGGTCACATTGGGCTACTCCATGGGTCTTCGGCTTGACCCGGTCTGTTGGGCCGCGATTGCGTGAGTTTCGGCCCCGCGCTGCGCTGTATAGTCGATTCTCATCCGGCCCTCACATCTGGAAACCCCAACTTATTTAGATAACATCATTAGCCGAAGTTGCTGGGCATGTCCACCGTGGAGTCCTCCCCGGGCGTCCCTCCTTCAAATGACGATAAGCACCGGCAAGCACCATTGATCAACGCAAGGATCGGTGATGTTAACAAAGATTCGGCACATTACTCTTGTTGGTGTGGAATCGCTTAACTACGCGGCGAAGCCTTATGGCAAAACCGATGGGGAATGATTCGGGTAGCGCTAAAAGTCCATAGCACGTACATCCCAACCTGGCGTGCGTACAGTTTGACGACCGCTTCACGCTAAGGTGCTGGCCACGTGCTAAATTAATGCGGCTGCACTGCTCTAAGGACAATTACGGAGTGGGCGGCCTGGCGGGAGCACTACCCCATCGACGCGTACTCGAATACTGTATATTGCTCTCACATGAACAAATTAGTAGAGTGCCGCTTTCAGCCCCCCTGTCGTCGGCGACGTCTGTAAAATGGCGTTGATGTGGATCGACTCTATAGAGGCATCTACTGATGCGTAGGGAGATCCGGAATGTA
Tumblr media
i wish that this was a new ARG cryptography strat for creating messages using only amino acid abbreviations. do better
95 notes · View notes
tenth-sentence · 2 years
Text
Cytosine methylation is catalyzed by one of several methyltransferases, whereas DNA demethylation is catalyzed by glycosylases that replace methylcytosine with unmethylated cytosine.
"Plant Physiology and Development" int'l 6e - Taiz, L., Zeiger, E., Møller, I.M., Murphy, A.
0 notes
oliveroctavius · 1 year
Text
Tumblr media Tumblr media
Spider-Month 2023: origin story
150 notes · View notes
meatexe · 5 months
Text
the cookie monster pajama pants girl literally can not be replicated in this day n age like she is a dying breed
24 notes · View notes
thecorpuscorpse · 5 months
Text
#6- An Anonymous Source
CW: Knife use and blood, some 'fighting', mild kidnapping
It had been two months since the sealed letters began showing up on Villains bedroom window at night when they weren't there. Each one with a different wax embellishment on the front, made of paper worn with time, and never signed. The swirling perfection of the calligraphy was unlike anything Villain had seen before, just like the words they formed. Five letters were stacked on the desk, and the sixth Villain held by the lamplight, eyes scanning over words they always wished to hear. In brief moments, they almost believed them.
The life they lived was not as tender as the words directed at them. There was no beauty in bloodshed- not anymore, at least. Yet, whoever seemed to be hiding in their blind spot thought otherwise. With how long they ran Headquarters, it was refreshing to have a little spice in the routine of wondering who thought so highly of someone as lowly as them.
After sending their squads out for recon, Villain remained tucked away in their office at headquarters to keep an eye on cameras when one detected movement in the server room. Villain knew each employee schedule inside and out- after all, they arranged each one. Within the orchestrated machine-like facility Villain spent so many years building up, the blaring alarm was akin to grinding gears.
Hero.
Every so often, Hero would figure out a new password Villain set, or intercept shipment plans that then would lead Villain to foil Heros plans, and the process would repeat in a few weeks. It was so hard to find good help nowadays, so Villain found handling Hero a nice break from handling paperwork. There was monotony in routine, but at least they could take their impatience with their anonymous admirer out on the other.
"Dammit... now of all times, Hero?" They snapped as they stood from their desk.
As much as the alarm irked them, Villain was more irritated their work was being interrupted. Scanners failed to pick up any DNA trace, leading them to another dead end. Somewhere, someone saw Villain and thought fondly of them. For a while, the simple knowledge of it was enough to qualm the loneliness, but now was more of a curse. They called the author a coward. They called the letters a trap. Yet, Villain headed down the hall to pursue a perpetrator after they stayed up until four in the morning... again... to read the letters in hope something would tell them who claimed to adore them so.
The door to the server room was ajar, main lights turned out. The dull glow of blinking red, blue and yellow lights cast shadows on the wall in varied patterns. The main lights were shorted, forcing them to identify misplaced figures in the dim light. It only dug further into Villains impatience with the matter. Against the low hum of the computers, a tinny clank echoed near the back wall.
Villain kept steady strides slow, mindful of the linoleum under their shoes and how quiet their breath was. Silence, as well as any leverage, was better than none, and it worked to Villains virtue when it guided the blade to the turned back of who they knew was tampering with their tech.
"I don't have time for you tonight, Hero," Villain said as they pressed the knife against their spine. "There is plenty of work for me as is without you getting involved."
Dressed in all-black, which happened to be quite flattering for the Hero, they tuned after setting their tools down and raising their hands. Villain took a step forward and pressed the edge to their throat.
"That's why I figure I'd lighten the load~" Hero said, offering an innocent shrug. "By-"
"Yes, yes, thwarting my recruitment of more people through disrupting our log system," Villain droned, pressing the blade harder. "Now really, I do have pressing matters to attend to."
There was a static in the air, and not from the whirring machines around them. The more Villain stood in it, the more irritated they got. It showed in the quick right cross-swing of butt-end of the knife towards Heros head before the move was blocked by Heros hand.
"Wow, whats the matter with you?" Hero mused with a shit-eating grin as he twisted Villains arm into a lock behind their back. The knife clattered onto the floor. "Not very like you to 'not have time for me', Villain. Plus, what a sloppy execution."
"You don't know me, Hero," Villain hummed with a smile in their voice, flexing their hand under Heros grip. "So I'll show you a real sloppy execution."
Villain dug their heel into Heros foot, and used the momentum to twist them to slam into the server paneling. With the grip loosened, Villain snaked away and went for the knife. It was only a second more before Villain was swept off their feet- literally- and hit the ground.
"Yeah, that was pretty sloppy too," Hero said as they went to further restrain the fallen Villain. "You're making me jealous, don't tell me there's another Hero you have to go cause havoc for~ Ugh, I'll be heartbroken!"
Villain struggled against Heros grasp, writhing and twisting their body so they could never get a solid pin. While Hero had their brawn at their side, Villain knew it was only a matter of leverage.
"I do, but they aren't a Hero~"
They took the moment Hero stalled in their attempts to pin them down to get their lets out to kick Hero back, knocking the wind out of them. Villain went for the knife again and came up behind Hero to hold the knife to their throat again.
"Bullshit," Hero gasped out, though an amused smile graced their stupid face. "I can barely tolerate you as it is."
Villain contemplated for a moment. What harm would a white lie do when they didn't even know who was writing the letters? There would be no one else to go after. It would be nice to pretend- Villain did it enough as it was.
"Oh, you should hear how they talk about their love for my vile and vulgar ways Hero. How they adore the plans of misery I make for the thousands," Villain gripped Heros hair and tilted their head back to look at them proper. "And the tongue they have..."
"Then why aren't you with them now?"
"Because I'm dealing with you," Villain said as their jaw set. "A thorn in my side since we crossed paths, and always coming back like a damn infection," They brought the edge up against Heros neck. "You are pestiferous- a plague in my life every time your head pops up." Villain narrowed their eyes, bringing small beads of blood against the blade. "And I think I'm going to purge the source tonight."
"Then do it."
Below them, there was a rumble followed by a blaring alarm from what Villain assumed was a few floors down. It only took one distracted second for Hero grab Villains wrist and flip them over and onto their back before they dove behind a rack of server blocks. There was a flash, and the room filled with smoke. The colors against the smoke were disorienting, yet once Villain got hold of their knife, they could barely make out a figure escaping through one of the vents.
"One thing after a-fucking-nother..." Villain hissed as they ran out from the server room and towards the blaring fire alarm down below.
Once done dealing with the aftermath of a blown-apart storage unit, Villain trudged back up to their office and collapsed in their chair. It was now six in the morning, and looking at the camera they had set up to face their bedroom window at home- no letter to be seen on the window. They pushed their hair back with a sigh, before deciding to freshen up there, and continuing their monotonous work for their empire, with breaks reading loving words Villain needed to hear after such a long night.
---
The seventh letter was different than the rest.
It had taken longer than the rest to arrive- almost a month later than the last one, when the others came once or twice a week. Nights were seemingly endless when Villain would simply stare at the window from the camera. They knew if they were home, they wouldn't arrive, and so they worked long into the night, going home every few days to make sure their plants were watered.
Unlike the other ornate and delicately put together envelopes, the newest came in a simple black one. The handwriting was reminiscent of the others yet the words scrawled unsteadily. The droning news anchor in the background discussed the impending weather as Villain attempted to make sense of everything they were reading.
What was said was not the romantic poetry they were used to, of regrets and promises they wished to keep to Villain of seeing them, of truly being with them and being sure there would be nothing keeping them apart anymore.
The signature at the bottom made Villains heart sink. Not because of who had written the confession they read. Not because it was from someone they wouldn't have wanted at all. But because it wasn't a signature at all.
Except a smear of blood.
Villains head felt light, the corners of their vision hazing a little as they tried to make sense of what it all meant. They sat down in their chair, still staring at the letter before them. It wasn't until the news anchor interrupted their broadcast with breaking news.
'The beloved and respected savior of our beautiful city, Hero, has officially been pronounced dead today by coroners after their body had been returned to city officials by an anonymous source. Further details the cause to be released.'
"No..."
They took a long look at the radio, eyes wide in disbelief as their mind began to piece everything together. In a moment, they were at their sequencer and after they got a sample of the paper, pulled out their knife. What little blood left from their fight with Hero remained, and they flaked off the dry remains in the other bottle. Time blurred as they waited, walking crop circles into their carpet while the machine processed the samples.
They didn't see anyone on the cameras the night before. No sound, no disturbance. First nothing was on the window, and when daylight broke, there it was. They hadn't dealt with Hero recently, which they only grew to notice the more they thought.
They couldn't settle down, and any time their office door was knocked on, they would simply throw a book at it and tell whoever it was to bother them tomorrow. Word must have gone around because soon the knocking stopped and Villain was left alone with the machine, which whirred just like the servers did their last night with Hero.
They were pulled out of their mind when the machine stopped, and the face glowed green with the information Villain already put together in their walk about their office.
DNA Sequencing Completed- Results: 100% Match
---
Villain drummed their thumb against the steering wheel of the car. Occasionally, it would follow the tempo of their racing heart, or the shake in their muscles from the adrenaline in their blood. The timer they set on their phone for five minutes was halfway through. Villain regretted even permitting that much time to wait. It had been too long already, and with any more time, they could be too late.
Three minutes and no sign. Villain shifted in their seat, instead now tapping their foot and squeezing their hands together. The last they slept was indistinct, waiting for the right moment to make their next move. A drastic one, which would leave more loose ends than they would like, but it was just as a drastic situation they had on their hands.
Four minutes and Villain was getting ready to get out and handle the ordeal themselves. They checked to make sure their gun was loaded, as they did a dozen or so times before even though they hadn't used it. Before they reached the door handle, the passenger side opened to Villains relief.
"Very good. Hurry up." Villain said, gesturing with the gun to get in.
Five minutes was all Villain needed. As they sped off, the silence was cushioned by the low hum of the car. Villain didn't know what to think. What to say. What if, in the time they were gone, Hero was too? The thoughts were heavy as Villain drove, until their passenger pulled them out of their head.
"I shouldn't be doing this..."
"Then why are you." Villain said, rather than asked.
"Well, you told me with a gun to my head that you hunt me down and kill my girlfriend in front of me, then send my body parts to various family members."
"Good memory, and I will if you make any attempts to run."
"Good to know..." The accomplice said with a tight-lipped smile before looking down at the bag.
"And... I'm helping someone, aren't I?" They asked after another moment of passing silence. "Someone you care about?"
There was a thick lump that sunk into Villains throat. It irked them to know they had to get outside sources with such a high risk, but they were pushed to no other choice. They offered a single, but humble nod before turning off onto a dirt road.
"What the fuck did you say you did again?"
"I'm a first assistant," they said as they shuffled the medical bag on their lap while twisting the handles nervously. "Not quite a surgeon, but I'm getting there."
"Of course, I pick up the intern in the operating room..." Villain uttered as they watched the road. The car, being small, only allowed the young surgeon to hear the remark clearly.
"The operating rooms of the ICU," they huffed a bit too confidently for Villains liking. "Much more intense and less room for error. I mostly make sure the room is clean but I do help with sutures, and other general care."
With a less than patient sigh, Villain parked the car in the driveway and looked the young surgeon square in the face, gun held towards them with a finger threatening pressure on the trigger.
"Keep your attitude in check, and keep them alive." They said flatly. "Both the person I'm bringing you to, and your girlfriend."
It had just been the two of them since Hero showed up battered, beaten and bloodied just two weeks before. They hadn't gotten better and while Villain was good at many things, medical diagnosis weren't one of them. They took leave from work to get Hero somewhere more secluded than Villains home closer to the city.
When Hero was awake, Villain limited themselves to one question because Hero would get winded from speaking too much. Day by day, they learned how Hero wanted things to be different, not only for themselves only, but between the two. How they grew to love Villain, admire them and respect them, to want them yet be restricted from doing so. Hero detailed how they convinced a select few to assist them in faking their death with a glow which made Villain hopeful, but then Hero fell asleep before telling them how it went, and hadn't woke up since. It'd been three days.
With a nervous nod in understanding, the two got out of the car, and Villain walked the man to the house with a gun drawn on them the entire way. Sleepless nights were still to come, yet there was a bit more relief in knowing Hero stood more of a chance now. Villain hoped they didn't make a mistake, for Hero wouldn't be able to survive it.
32 notes · View notes
silllyyyyy · 9 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
First day for school completed!!! This is all the stuff I made in my classes today >=D
27 notes · View notes
Text
Tumblr media
ONE OF MY FAVORITE MOMENTSSSS
8 notes · View notes