#identifying computers in posts
Explore tagged Tumblr posts
Text
strap in, this is a long one
Sony Beans Walkman WM-EQ Stereo Cassette Player (1995); Nike Presto Watch Duo (2004); (n/a); iMac G3 in Bondi Blue (1998); (n/a); Yahoo! Digital Camera (2000); KDDI A1403K Mobile Phone (2004); (n/a); Sony S2 Sport Walkman Portable CD Player (2005)
literally obsessed with the design of blobjects










#Jesus Christ lol#apple#powermac era#iMac g3#Yahoo!#Sony#Sony Walkman#identifying computers in posts#tech roundup#queueputer!
95K notes
·
View notes
Text
ENa dream bbq. To me.
#Honestly how it feels sometimes .#Ogre can only identify surface level themes like The loss of identity and autonomy forced upon ones self by a capitalistic system#and cant comprehend deeper ideas like.#...Uhh. Uhhhhhhhhhhhh . [Computer crashing sounf effect]#ena#calli.txt#ANyway.#My goal in life is to one day sound so esoteric about hashtag My Special Thing that every poor soul who looks at my posts thinks This#And im sorry in advance.
21 notes
·
View notes
Text
19 years old and burning songs onto cds this generation isn't cooked yet
#alina post#ive always known how to do this because i used to make 'films' with my friends#but it IS the first time in years ive tried anything like this#so it's good that like. basic tech skills still exist in my brain#esp in a world trying to expel any form of actual technological autonomy#dont get me wrong im still fairly bad with tech. but thats more 'not being that way inclined autistically'#not necessarily 'cant use a computer or identify basic tech settings and functions'
2 notes
·
View notes
Text
Thinking about one of the loser men I dated directly post-college who, after I showed them Dirty Computer [the emotion picture] by Janelle Monae, said they "prefer rap that has something to say"
#this person identified as a man but used they/them pronouns just in case that was confusing#but yeah like. what does that mean. did you watch the video#also one time said colorado edibles were 'too strong' and therefore 'dangerous'#they said that COLORADO should have more 'regulations' imposed on weed products lmfao#also when i was watching mad men and expressed that i liked it#they were like 'i dont see the appeal bc the commentary feels obvious to anyone whos lived on the east coast' skskdkdkelsdnakas#they had the WEIRDEST complex about being from the east coast. like. most tightly wound person ive ever met in my life#who was constantly insisting they were sooo type b and so chill and go-with-the-flow#and like yeah im aware im from one of the most laid back slacker states#but this person was one of the most uptight people ive ever met let alone dated#and just had like 0 self awareness about it#like they would exclusively wear button downs sweater vests and cardigans. wouldnt be caught dead in a hoodie unless it was northface#would only drink coffee if it was made from a french press#also see above story about edibles (which was the biggest 'fight' we ever got in bc i was like what the fuck r u talking about)#like. the label says clearly how much thc cbd etc is in each edible and how many doses there are per container#what else could you want#if you dont know how itll affect you just take half or even a quarter of one first???#this still gets me heated to think about#but yeah like what kind of person sees DIRTY COMPUTER and is like 'hmm not political enough' lmfao#OH ALSO guess why we broke up#the blm protests happened and they said they were just 'too affected by police violence to be dating right now'#(they were very much white. blonde white)#and then i found out 11 months after we broke up that they had started dating a poc a month before we broke up#because i saw an anniversary post they did and i was like '...wait a minute'#and a friend of mine used to work with them after we broke up and according to him this person would constantly bring up what a great 'ally'#they were for dating a poc#fucking. wild
5 notes
·
View notes
Text
Sony Vaio PCG z505r, next to another Sony Vaio PCG z505r, next to a Sony CLIÉ PEG-S300, with not one, but TWO WonderBorgs on top of the main Sony Vaio

#Sony Vaio#Sony CLIÉ#WonderBorg#Sony#rip to the Sony Computers division you guys made some wacky ass shit#Sony Computers#identifying computers in posts#im actually obsessed with WonderBorgs. I want one now#it’s entirely obsolete. I want one for my shelf
11K notes
·
View notes
Text
i was told to use firefox profiler to assess my browser performance to see what things r fucking up the slow start but i dont knowhow to read this. 'theres jank in the web extensions' yes i know that. which one. tell me please? please? please?
#ill figure it out but also ue. having to know things scary...#whatdver ill be a cool computer girl who can do computer things#if any of u cunts think u could figure out lmk but im not gonna just post it bcos it probs has identifying info in it lolz
14 notes
·
View notes
Text

The Undertaker™ wants your PC.
The 1997 Undertaker Screen Saver & Trivia/Puzzle Game
From the dark world of gravestones and tombs straight to your PC. The Undertaker, at 6'10" and 328 pounds, looms over the World Wrestling Federation and your monitor.
(One small image of the Undertaker making his entrance with a caption reading "Where is he?" A second small image of the Undertaker performing a Tombstone Piledriver on Mankind with a caption reading "Here we go!" In the centre of the page is a 1993 Dell Dimension 433SV 486 desktop computer, with keyboard and monitor. The monitor displays a third image of the Undertaker, serving as the desktop background.)
NOT
AVAILABLE
IN STORES!
[ Transcript below ]
Each includes:
1997 Shawn Michaels™ Screen Saver & Trivia/Puzzle Game (small image of Shawn Michaels stripping in his red and white zebra print gear)
1997 Marlena™ Screen Saver & Trivia/Puzzle Game (small image of Marlena in white, sparkly lingerie)
1997 Sunny™ Swimsuit Screen Saver & Trivia/Puzzle Game (small image of Sunny in a bikini top)
1997 Sunny™ Lingerie Screen Saver & Trivia/Puzzle Game (small image of Sunny in a blue lingerie)
1-4 Player Trivia Game
Puzzle Game
Sound Effects
On Screen Date/Time
And More
ONLY $9.95 ea.
Shipped on 3.5" Diskettes for Windows™
DOWNLOAD INSTANTLY!!!
www.blackhawkcafe.com
System requirements: IBM PC or Compatible, 486/33 MHZ or Higher, Windows™ 3.1 or Windows™ 95, 4 MB RAM, 4 MB Free Hard Disk Space, 256 Color Display or Higher, Sound Card (optional). Shipped on two 3.5" diskettes for Windows™
#SOUND EFFECTS!!#and yes i had to identify the exact computer. i used to work refurbishing old hardware and loved it#undertaker#marlena#[ colour commentary ]#[ slater ]#[ supercard ]#mango#if anyone has these floppies. i desperately want to preserve these in their full states.#wwf#eye strain#long post#retro tech
20 notes
·
View notes
Text
0 notes
Text
Seeing the Invisible Universe

This computer-simulated image shows a supermassive black hole at the core of a galaxy. The black region in the center represents the black hole’s event horizon, beyond which no light can escape the massive object’s gravitational grip. The black hole’s powerful gravity distorts space around it like a funhouse mirror. Light from background stars is stretched and smeared as it skims by the black hole. You might wonder — if this Tumblr post is about invisible things, what’s with all the pictures? Even though we can’t see these things with our eyes or even our telescopes, we can still learn about them by studying how they affect their surroundings. Then, we can use what we know to make visualizations that represent our understanding.
When you think of the invisible, you might first picture something fantastical like a magic Ring or Wonder Woman’s airplane, but invisible things surround us every day. Read on to learn about seven of our favorite invisible things in the universe!
1. Black Holes
This animation illustrates what happens when an unlucky star strays too close to a monster black hole. Gravitational forces create intense tides that break the star apart into a stream of gas. The trailing part of the stream escapes the system, while the leading part swings back around, surrounding the black hole with a disk of debris. A powerful jet can also form. This cataclysmic phenomenon is called a tidal disruption event.
You know ‘em, and we love ‘em. Black holes are balls of matter packed so tight that their gravity allows nothing — not even light — to escape. Most black holes form when heavy stars collapse under their own weight, crushing their mass to a theoretical singular point of infinite density.
Although they don’t reflect or emit light, we know black holes exist because they influence the environment around them — like tugging on star orbits. Black holes distort space-time, warping the path light travels through, so scientists can also identify black holes by noticing tiny changes in star brightness or position.
2. Dark Matter
A simulation of dark matter forming large-scale structure due to gravity.
What do you call something that doesn’t interact with light, has a gravitational pull, and outnumbers all the visible stuff in the universe by five times? Scientists went with “dark matter,” and they think it's the backbone of our universe’s large-scale structure. We don’t know what dark matter is — we just know it's nothing we already understand.
We know about dark matter because of its gravitational effects on galaxies and galaxy clusters — observations of how they move tell us there must be something there that we can’t see. Like black holes, we can also see light bend as dark matter’s mass warps space-time.
3. Dark Energy
Animation showing a graph of the universe’s expansion over time. While cosmic expansion slowed following the end of inflation, it began picking up the pace around 5 billion years ago. Scientists still aren’t sure why.
No one knows what dark energy is either — just that it’s pushing our universe to expand faster and faster. Some potential theories include an ever-present energy, a defect in the universe’s fabric, or a flaw in our understanding of gravity.
Scientists previously thought that all the universe’s mass would gravitationally attract, slowing its expansion over time. But when they noticed distant galaxies moving away from us faster than expected, researchers knew something was beating gravity on cosmic scales. After further investigation, scientists found traces of dark energy’s influence everywhere — from large-scale structure to the background radiation that permeates the universe.
4. Gravitational Waves
Two black holes orbit each other and generate space-time ripples called gravitational waves in this animation.
Like the ripples in a pond, the most extreme events in the universe — such as black hole mergers — send waves through the fabric of space-time. All moving masses can create gravitational waves, but they are usually so small and weak that we can only detect those caused by massive collisions. Even then they only cause infinitesimal changes in space-time by the time they reach us. Scientists use lasers, like the ground-based LIGO (Laser Interferometer Gravitational-Wave Observatory) to detect this precise change. They also watch pulsar timing, like cosmic clocks, to catch tiny timing differences caused by gravitational waves.
This animation shows gamma rays (magenta), the most energetic form of light, and elusive particles called neutrinos (gray) formed in the jet of an active galaxy far, far away. The emission traveled for about 4 billion years before reaching Earth. On Sept. 22, 2017, the IceCube Neutrino Observatory at the South Pole detected the arrival of a single high-energy neutrino. NASA’s Fermi Gamma-ray Space Telescope showed that the source was a black-hole-powered galaxy named TXS 0506+056, which at the time of the detection was producing the strongest gamma-ray activity Fermi had seen from it in a decade of observations.
5. Neutrinos
This animation shows gamma rays (magenta), the most energetic form of light, and elusive particles called neutrinos (gray) formed in the jet of an active galaxy far, far away. The emission traveled for about 4 billion years before reaching Earth. On Sept. 22, 2017, the IceCube Neutrino Observatory at the South Pole detected the arrival of a single high-energy neutrino. NASA’s Fermi Gamma-ray Space Telescope showed that the source was a black-hole-powered galaxy named TXS 0506+056, which at the time of the detection was producing the strongest gamma-ray activity Fermi had seen from it in a decade of observations.
Because only gravity and the weak force affect neutrinos, they don’t easily interact with other matter — hundreds of trillions of these tiny, uncharged particles pass through you every second! Neutrinos come from unstable atom decay all around us, from nuclear reactions in the Sun to exploding stars, black holes, and even bananas.
Scientists theoretically predicted neutrinos, but we know they actually exist because, like black holes, they sometimes influence their surroundings. The National Science Foundation’s IceCube Neutrino Observatory detects when neutrinos interact with other subatomic particles in ice via the weak force.
6. Cosmic Rays

This animation illustrates cosmic ray particles striking Earth's atmosphere and creating showers of particles.
Every day, trillions of cosmic rays pelt Earth’s atmosphere, careening in at nearly light-speed — mostly from outside our solar system. Magnetic fields knock these tiny charged particles around space until we can hardly tell where they came from, but we think high energy events like supernovae can accelerate them. Earth’s atmosphere and magnetic field protect us from cosmic rays, meaning few actually make it to the ground.
Though we don’t see the cosmic rays that make it to the ground, they tamper with equipment, showing up as radiation or as “bright” dots that come and go between pictures on some digital cameras. Cosmic rays can harm astronauts in space, so there are plenty of precautions to protect and monitor them.
7. (Most) Electromagnetic Radiation
The electromagnetic spectrum is the name we use when we talk about different types of light as a group. The parts of the electromagnetic spectrum, arranged from highest to lowest energy are: gamma rays, X-rays, ultraviolet light, visible light, infrared light, microwaves, and radio waves. All the parts of the electromagnetic spectrum are the same thing — radiation. Radiation is made up of a stream of photons — particles without mass that move in a wave pattern all at the same speed, the speed of light. Each photon contains a certain amount of energy.
The light that we see is a small slice of the electromagnetic spectrum, which spans many wavelengths. We frequently use different wavelengths of light — from radios to airport security scanners and telescopes.
Visible light makes it possible for many of us to perceive the universe every day, but this range of light is just 0.0035 percent of the entire spectrum. With this in mind, it seems that we live in a universe that’s more invisible than not! NASA missions like NASA's Fermi, James Webb, and Nancy Grace Roman space telescopes will continue to uncloak the cosmos and answer some of science’s most mysterious questions.
Make sure to follow us on Tumblr for your regular dose of space!
4K notes
·
View notes
Note
Got my things stolen and can’t remember what model to replace my ipad from, it was Apple Pencil 1st gen compatible. Thank you wizard


(2016) iPad Pro 9.7” OR (2017) iPad Pro 10.5”
Below the cut are my opinions on a replacement iPad, the information i used to figure out what model you had, and also Apple’s weird rose gold phase. rip the rose gold colorway, 2015-2020
iPad shopping advice—
I do not recommend buying a refurbished 2016 iPad Pro, while not technically obsolete, iPadOS 16 is no longer receiving active support— security updates are still being pushed out but Apple tends to only provide those for another one or two years unless a zero-day vulnerability is found. (iPadOS 16’s active support expired a year ago, for further context)
I can’t in good faith recommend buying a refurbished 2017 iPad Pro, it currently operates on the latest OS (iPadOS 17), however that’s likely to be its last core update in its lifetime— it turns 7 years old this year (a typical lifespan for an iPad is 5-6 years), iPadOS 17 has less than a year of active support left with iOS & iPadOS 18 slated for September 2024… however, the prices look good if you can find one from a reliable seller.
I have two recommendations for replacement*
Refurbished** iPad Air (2020) 256gb
Runs iPadOS 17 and will be receiving core updates for another 2-3 years minimum
Support for up to 5 Gbps over USB-C support (which means support for external storage devices)
Support for the Apple Pencil (2nd Gen) and Apple Pencil (USB-C)***
Smaller bezels; the home button is removed and TouchID is on the power button
Support for a external mirrored display
Support for Wi-Fi 6 & Bluetooth 5.0
5G LTE support if you’re into that sort of thing (cellular models do cost extra)
iPad 10th Gen (2022) 256gb
Runs iPadOS 17 and will be receiving core updates for the next 4-5 years minimum
Support for USB-C with speeds of USB 2.0
Front-facing camera is horizontal (which is the reason for the next point)
Support for Apple Pencil (1st Gen w/ Adapter) or Apple Pencil (USB-C)***
Smaller bezels; bigger screen, TouchID on power button
Support for an external mirrored display
Wi-Fi 6 & Bluetooth 5.2 support
Cellular models equipped with 5G support
*Only if you need an iPad before March or April of this year. For the first time since 2010, Apple skipped a year in iPad refreshes. Mark Gurman predicts that new iPads will be released by the end of March. The 6th Gen iPad Air is rumored to be receiving a pretty large facelift— likely slashing the price of the 5th Gen Air. The iPad Air is widely considered to be the best price-to-performance option from the iPad family.
**I recommend checking out open box pricing for the latest generation iPads before making a decision. If possible, hit up a BestBuy or Microcenter so you can look at open box devices in person. Only buy refurbished devices from trusted sources; I recommend Amazon Refurbished or Geeksquad Refurbished.
***the Apple Pencil (USB-C) does not support pen pressure on any iPad model. The Apple Pencil (2nd Gen) is the most feature-rich model to date, read more here.
as both these iPads run the same processor, here are the benchmarks from CPU Monkey for the A10X Fusion (IPP2017) vs. A14 Bionic (IPA2020)
And the insane amount of information I know about Apple’s rose gold phase that led me to what iPad you have:
Apple introduced the rose gold colorway in 2015 with the launch of the iPhone 6s, and the phasing out started with the release of the iPhone 8 in 2017, replacing rose gold with just plain gold. That’s the timeframe for our rose gold iPad— and there were only six iPads launched between 2015-2017. This assumption is further supported by the launch of the Apple Pencil in late 2015 and the eventual launch of the the smaller 9.7” iPad Pro in 2016, which came in the standard space gray, silver, and gold, but was also released in one extra color: rose gold. The rose gold colorway in the iPad lineup was exclusive to the smaller IPP 1 & 2 until 2020 (see “Other Apple products…”). Additionally, the visible sides of the iPad suggest it’s from the “tapered unibody” MacBook era— specifically the “rounded edges” or “squircle” era, when all iPads fit awkwardly into folio cases if they weren’t made by Apple. The iPad that received a rose gold colorway in 2020 is of the “squared edges” era, thus ruling it out entirely.
Other Apple products that saw a brief rose gold colorway:
Retired from the Apple Watch lineup in 2017
Retired from the MacBook lineup in 2018
Retired from the iPhone lineup in 2017
Retired from the iPad Pro lineup in 2018
Added to the iPad Air lineup in 2020 and then immediately replaced by pink following the next release
Apple recently has introduced the pink colorway into its products as it delves more into the colorful side of tech again. Things you can buy in pink from Apple if you want to stay on theme:
iPhone 13, 15
iPhone 15 Plus
iPad 10th Gen (2022)
iPad Air (2022)
Apple Watch Series 9
#fungusdotc0m#identifying computers in asks#read the annotations + my last few tags if ur considering a new iPad btw I had some other thoughts right before posting#iPad#iPad Pro#iPad Air#Apple History#rose gold#if you’re actually like. in need of a laptop too for whatever reason i would save for an iPad Pro 2022 (either size) bc those are laptops#like basically#the iPad Pro is a MacBook Air but with a touch screen and also weighs less and costs less depending on the model. it’s just better#i have a ton of other information I can say on this matter but this post is SO long. iPad comprehensive guide coming in 2024 probably
0 notes
Text
iPad Pro 10.5” (2nd Generation) in Gold w/ Apple Pencil (1st Generation)


more of this
#ipads are technically laptop replacements now. so.#identifying computers in posts#iPad#iPad Pro#Apple Pencil#Apple#2017
10K notes
·
View notes
Text
So. Okay. I use my personal computer for work. This is not an ideal situation, and it's a holdover from Gary refusing to buy work computers for anyone when we went remote. I do not recommend this. You should not do this. If you are a business, you should not allow your employees to do this. It's a security issue for you and for your employer and is, all around, a bad idea.
My company installs an RMM agent (a program that lets us remotely manage the device and to view the screen in certain circumstances) on all of our client computers; you need the agent to do some server access stuff, so sometimes I have to have the RMM agent on my computer and get joined to our environment. When I'm done doing whatever it is, I uninstall the agent because I don't want my boss to have remote control software on my personal device. If you are using your personal computer at work, you should not allow your employer to maintain remote control software on your personal device.
My computer has a dorky name. I usually name my computers dorky things. This one is called Atredies and the last one was Gandalf and the one before that was Hende Nicholas and the one before that was Robocop. This, notably, does not match our office's pattern of "BN-1508," or even Gary's standard of "Work-Related-Concept" ("Shipping") or "First Name" ("Maddy") for naming our office computers. So sometimes I'll be sitting in the virtual office and someone will look up from doing device approvals and will say "What company has a desktop named Atredies" and I'll be like "us, the sleeper has awakened, let me on" and everyone is like hey Alli you're a huge dork and I'm like yeah.
So here's the thing. You should not be using your personal computer as a work computer. If you are using your personal computer as a work computer, you should not allow your employer to leave control programs installed on the device. If you do have control programs on the device, it's good to make sure that your computer is VERY VERY VERY identifiably *not* a computer owned by your employer. If your employer gave you an old computer that was being decommissioned, you should make sure to do a fresh OS install and you should make sure to rename the machine something that will make it easy to see it's your machine.
This post is brought to you by the lady whose gifted-from-her-job 12 year old laptop named "WP-1644" we just bricked because the client didn't maintain an inventory list and when they couldn't identify the user they decided it was stolen.
1K notes
·
View notes
Text
Inspired by this post by @0nemorestranger Hopefully close enough to what you had in mind
Edit: now on AO3
Lost Media
Steve didn’t realize he’d been humming along to anything until the music cut off suddenly and looped around to start over. The opening riff played for about three seconds before it cut off again.
“Wait, who’s humming?” The question came from one of Steve’s younger co-workers. A part-timer working his way through college. Steve couldn’t remember his name.
“Uh, that was me. Sorry,” he tacked on the apology as an afterthought.
“You know that song?” the kid asked. He sounded like Dustin.
“It’s called Plane of Shadows. I think it’s a DnD reference,” Steve answered. “Band’s Corroded Coffin. Haven’t heard them in years.”
That wasn’t strictly true. Every once in a while, Steve would play the tape he still had. Think about that one summer he’d spent as an unpaid, unofficial roadie. Daydream about what could have happened if he’d known himself a little better back then.
Not too often. Steve wasn’t that much of a loser.
The kid came over and plopped down in Robin’s empty chair. She was out sick today, getting over the flu Steve had picked up last week.
“It is. A DnD reference, I mean,” the kid said. Steve probably needed a better thing to call him; he was probably Erica’s age. “Shit, one of my friends posted that clip to this metal bulletin board. We've been trying to identify it forever. How do you know it?”
“They’re from the same small town I am. We all went to highschool together.” Not that Steve had known their music in highschool. “I don’t think they ended up with a record deal, but they did have an EP they used to sell at concerts. I can bring it tomorrow if you want.”
*********
Steve brought the tape, along with the souvenirs he’d saved from that summer. A couple of photocopied flyers. An ad clipped from a local Bloomington paper for a concert. A wristband from a bar that had marked him as too young to drink. Also his Walkman. Steve wasn’t sure if kids still had cassette players now that CDs were everywhere.
“This is so cool,” the kid - Brian, apparently - gushed when Steve handed him the shoebox he’d brought it all in at lunch. “Is it alright if I scan these? And can I borrow this tape? I want to digitize it and share the full song with the board.”
“You can do that?” Steve really needed to learn more about computers. Just not from Dustin who couldn’t teach anything without turning into a condescending asshole.
“Yeah, just record from the Walkman like it’s a mic. I’ll burn you a copy of the whole EP. That way you won’t have to worry about wearing out your tape,” Brian offered. “I would never have guessed you were such a metal fan.”
“I’m not, really,” Steve admitted. Brian blinked at him, surprised. And, well, it wasn’t the eighties anymore, and they weren’t still living in Hawkins. “Massive crush on the lead guitarist.”
“Oh, uh, thanks for telling me.” Brian leaned over and patted Steve’s shoulder. “So you and Robin aren’t-”
“Strictly platonic.” Maybe Robin was right and they should get signs for their desks.
*********
It was nearly a month later when Brian grabbed Steve at the water cooler and dragged him over to his desk, saying “You’ve got to see this.”
This was a post on the Brian’s metal bulletin board:
Crazy to hear from a buddy that our old band is a minor Internet sensation. Thanks, all. If you guys had been around back in the day we might have managed a full album. Or maybe not. Gareth’s parents would have killed him if he dropped out and Jeff actually wanted to go to college, so maybe we still would have broken up in ‘87. Regardless, we’re all thrilled our music is bringing joy to today’s metal heads. As the primary songwriter, and with the agreement of the rest of the band, I grant permission to upload and download the entire EP. We think any money we might potentially have made on it is worth less to us than the value of preserving what could have been lost media. Just make sure to credit us if your garage band turns one of our songs into a hit. Anyway, if you guys have any questions about Corroded Coffin, or the songs, reply to this post and I’ll do my best to answer in a timely fashion. Aside to OP: Is your preppy co-worker who had all our stuff a handsome former jock with spectacular hair? Because I’d love to get back in touch with our old roadie. -EM
“Oh my god,” Robin squealed, leaning over Steve’s shoulder as he read. “Please, you have to give Eddie Steve’s email. Or get Eddie’s email to give to Steve. Or both. Both would be best. That way at least one of them will have the balls to reach out first.”
“Eddie’s already reaching out,” Steve said. “And I thought you said it was anti-femminist to use testicles as a proxy for courage.”
“Stop quoting me when I’m being right, Steven.”
“So I should get his contact info for you?” Brian asked.
Steve hesitated. Real life was not some romantic comedy where attraction was always mutual and true love overcame all obstacles in the end. But it wasn’t like he’d spend the last decade pining. Even if it was nothing more than getting a friend back, it would be good to get in touch with Eddie again.
“Sure,” Steve answered. “Why not?”
#short ficlet#stranger things#steddie#well pre steddie#(in theory they could just end up friends)#(but we all know they're going to start dating)#my fic#i'll try to get this up on ao3 tomorrow but for now
789 notes
·
View notes
Text
Macintosh SE "SuperDrive" (1989)

3K notes
·
View notes
Note
Following you is so amazing because I could just be reading an already random or normal post and directly below it is a computer voice saying letters and then a picture of a snail
String identified: gaagcactagaaaaatacttactcagttatactaa
Closest match: Cabera pusaria genome assembly, chromosome: 9 Common name: Common White Wave

(image source)
#tumblr genetics#genetics#biology#science#asks#sent to me#yourcrazyboyokris#bugs#insects#moths#common white wave
790 notes
·
View notes
Text
Gentry Tokyo Co.: AMD’s EasyNow! VOGUE with matching CRT (1999)
Image source: PC Watch, “Gentry Tokyo starts Pre-orders for VOGUE”




#identifying computers in posts#Gentry Tokyo#VOGUE#AMD#AMD EasyNow!#1999#image source linked because it’s actually the only information I can find on this computer existing
3K notes
·
View notes