#identifying computers in posts
Explore tagged Tumblr posts
Text
strap in, this is a long one
Sony Beans Walkman WM-EQ Stereo Cassette Player (1995); Nike Presto Watch Duo (2004); (n/a); iMac G3 in Bondi Blue (1998); (n/a); Yahoo! Digital Camera (2000); KDDI A1403K Mobile Phone (2004); (n/a); Sony S2 Sport Walkman Portable CD Player (2005)
literally obsessed with the design of blobjects
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
94K notes · View notes
callizinc · 8 days ago
Text
Tumblr media
ENa dream bbq. To me.
16 notes · View notes
biblicalhorror · 8 months ago
Text
Thinking about one of the loser men I dated directly post-college who, after I showed them Dirty Computer [the emotion picture] by Janelle Monae, said they "prefer rap that has something to say"
#this person identified as a man but used they/them pronouns just in case that was confusing#but yeah like. what does that mean. did you watch the video#also one time said colorado edibles were 'too strong' and therefore 'dangerous'#they said that COLORADO should have more 'regulations' imposed on weed products lmfao#also when i was watching mad men and expressed that i liked it#they were like 'i dont see the appeal bc the commentary feels obvious to anyone whos lived on the east coast' skskdkdkelsdnakas#they had the WEIRDEST complex about being from the east coast. like. most tightly wound person ive ever met in my life#who was constantly insisting they were sooo type b and so chill and go-with-the-flow#and like yeah im aware im from one of the most laid back slacker states#but this person was one of the most uptight people ive ever met let alone dated#and just had like 0 self awareness about it#like they would exclusively wear button downs sweater vests and cardigans. wouldnt be caught dead in a hoodie unless it was northface#would only drink coffee if it was made from a french press#also see above story about edibles (which was the biggest 'fight' we ever got in bc i was like what the fuck r u talking about)#like. the label says clearly how much thc cbd etc is in each edible and how many doses there are per container#what else could you want#if you dont know how itll affect you just take half or even a quarter of one first???#this still gets me heated to think about#but yeah like what kind of person sees DIRTY COMPUTER and is like 'hmm not political enough' lmfao#OH ALSO guess why we broke up#the blm protests happened and they said they were just 'too affected by police violence to be dating right now'#(they were very much white. blonde white)#and then i found out 11 months after we broke up that they had started dating a poc a month before we broke up#because i saw an anniversary post they did and i was like '...wait a minute'#and a friend of mine used to work with them after we broke up and according to him this person would constantly bring up what a great 'ally'#they were for dating a poc#fucking. wild
5 notes · View notes
dullahandyke · 2 years ago
Text
i was told to use firefox profiler to assess my browser performance to see what things r fucking up the slow start but i dont knowhow to read this. 'theres jank in the web extensions' yes i know that. which one. tell me please? please? please?
14 notes · View notes
Text
Sony Vaio PCG z505r, next to another Sony Vaio PCG z505r, next to a Sony CLIÉ PEG-S300, with not one, but TWO WonderBorgs on top of the main Sony Vaio
Tumblr media
11K notes · View notes
hostilecityshowdown · 2 years ago
Text
Tumblr media
The Undertaker™ wants your PC.
The 1997 Undertaker Screen Saver & Trivia/Puzzle Game
From the dark world of gravestones and tombs straight to your PC. The Undertaker, at 6'10" and 328 pounds, looms over the World Wrestling Federation and your monitor.
(One small image of the Undertaker making his entrance with a caption reading "Where is he?" A second small image of the Undertaker performing a Tombstone Piledriver on Mankind with a caption reading "Here we go!" In the centre of the page is a 1993 Dell Dimension 433SV 486 desktop computer, with keyboard and monitor. The monitor displays a third image of the Undertaker, serving as the desktop background.)
NOT
AVAILABLE
IN STORES!
[ Transcript below ]
Each includes:
1997 Shawn Michaels™ Screen Saver & Trivia/Puzzle Game (small image of Shawn Michaels stripping in his red and white zebra print gear)
1997 Marlena™ Screen Saver & Trivia/Puzzle Game (small image of Marlena in white, sparkly lingerie)
1997 Sunny™ Swimsuit Screen Saver & Trivia/Puzzle Game (small image of Sunny in a bikini top)
1997 Sunny™ Lingerie Screen Saver & Trivia/Puzzle Game (small image of Sunny in a blue lingerie)
1-4 Player Trivia Game
Puzzle Game
Sound Effects
On Screen Date/Time
And More
ONLY $9.95 ea.
Shipped on 3.5" Diskettes for Windows™
DOWNLOAD INSTANTLY!!!
www.blackhawkcafe.com
System requirements: IBM PC or Compatible, 486/33 MHZ or Higher, Windows™ 3.1 or Windows™ 95, 4 MB RAM, 4 MB Free Hard Disk Space, 256 Color Display or Higher, Sound Card (optional). Shipped on two 3.5" diskettes for Windows™
20 notes · View notes
90s-eddy · 1 month ago
Text
Tumblr media
0 notes
Note
Got my things stolen and can’t remember what model to replace my ipad from, it was Apple Pencil 1st gen compatible. Thank you wizard
Tumblr media Tumblr media
(2016) iPad Pro 9.7” OR (2017) iPad Pro 10.5”
Below the cut are my opinions on a replacement iPad, the information i used to figure out what model you had, and also Apple’s weird rose gold phase. rip the rose gold colorway, 2015-2020
iPad shopping advice—
I do not recommend buying a refurbished 2016 iPad Pro, while not technically obsolete, iPadOS 16 is no longer receiving active support— security updates are still being pushed out but Apple tends to only provide those for another one or two years unless a zero-day vulnerability is found. (iPadOS 16’s active support expired a year ago, for further context)
I can’t in good faith recommend buying a refurbished 2017 iPad Pro, it currently operates on the latest OS (iPadOS 17), however that’s likely to be its last core update in its lifetime— it turns 7 years old this year (a typical lifespan for an iPad is 5-6 years), iPadOS 17 has less than a year of active support left with iOS & iPadOS 18 slated for September 2024… however, the prices look good if you can find one from a reliable seller.
I have two recommendations for replacement*
Refurbished** iPad Air (2020) 256gb
Runs iPadOS 17 and will be receiving core updates for another 2-3 years minimum
Support for up to 5 Gbps over USB-C support (which means support for external storage devices)
Support for the Apple Pencil (2nd Gen) and Apple Pencil (USB-C)***
Smaller bezels; the home button is removed and TouchID is on the power button
Support for a external mirrored display
Support for Wi-Fi 6 & Bluetooth 5.0
5G LTE support if you’re into that sort of thing (cellular models do cost extra)
iPad 10th Gen (2022) 256gb
Runs iPadOS 17 and will be receiving core updates for the next 4-5 years minimum
Support for USB-C with speeds of USB 2.0
Front-facing camera is horizontal (which is the reason for the next point)
Support for Apple Pencil (1st Gen w/ Adapter) or Apple Pencil (USB-C)***
Smaller bezels; bigger screen, TouchID on power button
Support for an external mirrored display
Wi-Fi 6 & Bluetooth 5.2 support
Cellular models equipped with 5G support
*Only if you need an iPad before March or April of this year. For the first time since 2010, Apple skipped a year in iPad refreshes. Mark Gurman predicts that new iPads will be released by the end of March. The 6th Gen iPad Air is rumored to be receiving a pretty large facelift— likely slashing the price of the 5th Gen Air. The iPad Air is widely considered to be the best price-to-performance option from the iPad family.
**I recommend checking out open box pricing for the latest generation iPads before making a decision. If possible, hit up a BestBuy or Microcenter so you can look at open box devices in person. Only buy refurbished devices from trusted sources; I recommend Amazon Refurbished or Geeksquad Refurbished.
***the Apple Pencil (USB-C) does not support pen pressure on any iPad model. The Apple Pencil (2nd Gen) is the most feature-rich model to date, read more here.
as both these iPads run the same processor, here are the benchmarks from CPU Monkey for the A10X Fusion (IPP2017) vs. A14 Bionic (IPA2020)
And the insane amount of information I know about Apple’s rose gold phase that led me to what iPad you have:
Apple introduced the rose gold colorway in 2015 with the launch of the iPhone 6s, and the phasing out started with the release of the iPhone 8 in 2017, replacing rose gold with just plain gold. That’s the timeframe for our rose gold iPad— and there were only six iPads launched between 2015-2017. This assumption is further supported by the launch of the Apple Pencil in late 2015 and the eventual launch of the the smaller 9.7” iPad Pro in 2016, which came in the standard space gray, silver, and gold, but was also released in one extra color: rose gold. The rose gold colorway in the iPad lineup was exclusive to the smaller IPP 1 & 2 until 2020 (see “Other Apple products…”). Additionally, the visible sides of the iPad suggest it’s from the “tapered unibody” MacBook era— specifically the “rounded edges” or “squircle” era, when all iPads fit awkwardly into folio cases if they weren’t made by Apple. The iPad that received a rose gold colorway in 2020 is of the “squared edges” era, thus ruling it out entirely.
Other Apple products that saw a brief rose gold colorway:
Retired from the Apple Watch lineup in 2017
Retired from the MacBook lineup in 2018
Retired from the iPhone lineup in 2017
Retired from the iPad Pro lineup in 2018
Added to the iPad Air lineup in 2020 and then immediately replaced by pink following the next release
Apple recently has introduced the pink colorway into its products as it delves more into the colorful side of tech again. Things you can buy in pink from Apple if you want to stay on theme:
iPhone 13, 15
iPhone 15 Plus
iPad 10th Gen (2022)
iPad Air (2022)
Apple Watch Series 9
0 notes
Text
iPad Pro 10.5” (2nd Generation) in Gold w/ Apple Pencil (1st Generation)
Tumblr media Tumblr media
more of this
10K notes · View notes
hellsitegenetics · 7 months ago
Note
Following you is so amazing because I could just be reading an already random or normal post and directly below it is a computer voice saying letters and then a picture of a snail
String identified: gaagcactagaaaaatacttactcagttatactaa
Closest match: Cabera pusaria genome assembly, chromosome: 9 Common name: Common White Wave
Tumblr media
(image source)
788 notes · View notes
feelmyskinonyourskin · 1 month ago
Text
Judex, Judicum, Infantem - Chapter 2
(Eventual)Reader x Matt Murdock x Frank Castle
previous chapter | next chapter | series masterlist | my masterlist
Tumblr media
summary: You try to put Frank behind you and fall into bed with Matt. Unfortunately, now you also have to tell him the news that you're pregnant.
warnings: SMUT/18+ (don’t interact if your age is not in your bio) AFAB Reader. No use of Y/N. Mention of pregnancy. Pet names. Angst.
wc: 4,185
*I never give permission for my fics, manips, or any other original creation I post on Tumblr to be copied, posted elsewhere, translated, or fed into any AI program. The only platforms I currently post on are Tumblr and AO3. Thanks!*
Still a few weeks earlier
You rubbed the palms of your hands into your achey eyes as the words on your computer screen blurred again. After what went down between you and Frank a few days prior, you were having more trouble than normal focusing on tasks at work. The sparse amounts of sleep you’d gotten over the past few nights wasn’t doing you any favors either. Between bouts of crying over the “breakup” (If one could even call it that. You and Frank weren’t together) plus the way your brain kept drifting to replay every conversation you’d ever had with Frank over and over again in your head; you’d found it hard to get a restful night of sleep. Despite how your eyes burned and your body ached when you laid down in your bed each night, you just couldn’t get into a deep slumber.
It also didn’t help that your neck still had a crick in in from sleeping on the floor mattress at Frank’s shitty hideout. Or it was from having your spine twisted oddly as he railed you into bliss and oblivion? Or both?
Frank was clearly never going to come around and you knew moving on would be best, but wallowing in your own self pity was a maschochistic habit you just couldn’t seem to get out of. Also, if you accepted his feelings about the two of you and moved on, then you’d have to let go of the small glimmer of hope that just maybe you could be enough for him to finally want to move on with his life and love someone else. You weren’t sure you were ready to do that.
“Huh, I didn’t know they sold White Diamonds to anyone under the age of seventy.” A smooth voice cut through the buzzing in your brain, turning your attention away from staring at your computer.
“Murdock!” You exclaimed at the handsome figure leaning against the door frame to your office.
All too happy to see a familiar and friendly face to distract you from all the work you weren’t getting done, you gave him a look up and down as he stood before you. His navy suit was tailored perfectly to his lean figure and you couldn’t help but smile at how he adjusted the red-framed glasses on his face.
“I know you have a bloodhound nose there Mr. Murdock, but even I’m impressed you can identify the specific perfume I tried from a client gift basket yesterday.”
You rose from your chair to greet him with a hug. The way his taught, muscular frame enveloped you sent a jolt of butterflies through your stomach and you wondered if he could tell how his handsome charm flustered you every time you met. The clean scent of his cologne cut through the stale air of your office as you breathed him in. The wool of his suit was soft as you ran your hand down his arm and pulled away a bit.
“Mr. Murdock, really? Wow, okay. We’re going formal today? If I’d have known, I’d have worn my tux.”
Matt always seemed to always know just what to say to get you giggling.
“I figured I’d keep the illusion of professionalism at work. I mean, I could call you another name; starts with a D and rhymes with Shmare Shmevil”
Matt gripped at your elbow and spun you into your office, trapping you between his body and the wall.
Ow, that hurt your shoulders. That was definitely from when Frank had you—
“Watch it.” he chided with a lick of his lips.
His breath was warm against your face as he let out a dry chuckle at your surprised demeanor. He tilted his chin, searching for an answer from you.
“Sorry, Matty. Couldn’t help myself.” you giggled as he loosened his grip on you and took a step back, straightening his tie.
“Besides, even with out the alter ego and the super sniffer, only someone who is regularly intimate with women of that age range would recognize an Elizabeth Taylor perfume. Didn’t know you were into much older women.”
“Sweetheart, who I sleep with is none of your business.” Matt chuckled at your retort. “Besides, that kind of talk isn’t what I’d call keeping it professional.”
“Right, right. So what brings you in today?”
“Colleen emailed me. Said you had some new contracts that needed a look-through?”
The non-profit you worked for couldn’t afford to have a full-time lawyer on staff to review contracts and relied on pro-bono services to make sure everything stayed above board. Matt and your boss, Colleen, were buddies in college. Despite the fact he was a defense attorney and not involved in contract or non-profit law, she regularly roped him in to helping with the legal side of things.
“Right, I’ve got some of them pulled up on my computer right now if you have the time.”
“Always have time for you, old lady perfume and all.”
“Okay, now you’re just being rude!” you chided him
You held out your arm and led Matt to the conference room across the hall, letting him set up as you ran back into your office and grabbed your laptop. You had to take a deep breath before returning. Always flirty and confident, you were never bored when Matt was around that was for sure. But with your heart still pulling for Frank, it felt wrong to let yourself have even the little attention you knew Matt gave to nearly every woman he encountered. But still, you smiled thinking of spending the afternoon with Matt, even if it was just to review boring contract language. Maybe you were looking for any glimmer of hope that a man could actually desire you and not just push you away like Frank had.
“What’s this new clause in the contracts ‘public image addendum’?” Matt asked, listening to the details of the file via his screen reader
“You been following the news lately?”
“Yeah.”
“So you heard about the CEO of Caffeination Collective?”
“Yeah, but what’s a local coffee chain boss embezzling have to do with —”
“Well, Caffeination Collective signed a contract to be the main sponsor of our next gala three days before he got arrested. We tried to drop them, obviously, but they’re arguing we need to honor all the sponsorship placements of our contract despite the fact that they’ve shuttered all their locations and it looks like they won’t be back in business any time soon. Colleen thinks we should add a clause to all future contracts that if anyone we do business with does anything bad for PR, we can drop them.”
“Yeah, I’d say that’s a great idea.”
“She asked if you could review the language to make sure we’re covered going forward.”
Matt nodded.
“You know Caffeination Collective is headquartered in Hell’s Kitchen, right?” you added, spinning back in forth in your chair as you nursed your third coffee of the day
“Yeah, so?”
“Corrupt CEO disenfranchising employees and laundering money? Thought the Devil would have got to him before the cops.”
Matt adjusted his tie once more and grimaced at the mention of his alter ego, a pained look apparent in his eyes even as they hid behind crimson frames.
“Yeah well, I’ve been trying to lay low lately.”
“Since when have you ever laid low?”
“I have a lot of reasons to right now.”
“Hmm, sounds interesting. Shame you’re here to talk boring legal files, I’d love to hear more about it.”
Matt rubbed at the grey in his stubble and a crinkle appeared at the skin around his glasses as he smiled at you, hint of whatever troubled him at the moment washing away.
“Maybe if this doesn’t take too long, we could discuss it over dinner.”
“You’re incorrigible, Murdock.”
“And serious.”
“I don’t date lawyers. And I especially don’t date vigilantes.”
“You’re lying.”
Technically you weren’t. Frank was the only other vigilante you knew personally. While you’d just slept together the one time and had an odd ‘friendship’ before that, you had technically never dated him.
“Quit listening to my heartbeat.” you chided, tossing a paperclip towards Matt’s head, which he easily dodged
He chuckled.
“Come on. What is it? What’s the hold up?”
“I’m just too busy to get involved with anyone right now.”
“Oh, don’t give me busy.”
The air in the room suddenly felt warm as you mulled it over. You and Matt had always had great chemistry and the only excuse you really had was how desperately your heart was still hanging on to Frank.
“You deserve someone who can give you better.”
You knew you needed to move on. Frank made it clear he didn’t want to be a part of your life anymore after the two of you had crossed the line from whatever you had been to more.
And what better way to try than with Matt? Always handsome and suave and kind and funny. You knew the two men shared history and had complicated feelings towards one another, though you weren’t super clear on the specifics. You did not want to inform Matt of this situation and open that can of worms.
Fuck it.
“Fine, Murdock. Let’s get through these contracts and you can take me to dinner.”
Dinner turned into several rounds of drinks, which turned into a leisurely stroll back to your apartment. The restaurant he took you to was a cute French spot in Hell’s Kitchen, matching your love of cool and sophisticated with out being stuffy.You knew Matt was a flirt but were shocked with how easily the two of you connected. The whole evening felt natural, how care free and easy it was to just be yourself with him. In fact, you were having such a pleasant time with Matt, you hadn’t thought of Frank the whole evening.
“I honestly can’t believe the judge didn’t throw me out.” Matt concluded his story, a smile splitting across his face as he spoke
You let out a hearty laugh into the chilly night air as the two of you ambled down the quiet sidewalk through your neighborhood towards your apartment building. Matt’s hand was gentle as it held yours, letting you set the pace as he kept in step beside you.
“You always get away with the most asinine stunts in court. Only you Matty, would do something that would get any other lawyer a mistrial and instead win the case. And to play the whole blind card too in your defense? Classic. They let you get away with that?”
“Yeah, usually, actually.”
“Oh yeah, that’s the only reason you get juries and judges on your side.” your sarcastic tone had him shaking his head and grinning “It has nothing to do with how hot you are.”
Matt stopped, letting go of your had and facing you with a raise to his eyebrows as he leaned against his cane.
“You think I’m hot?” he asked, playfully feigning ignorance
You shook your head as you could feel the heat rising in your cheeks.
“Of course I think you’re hot.” you replied “You know I do, even without all your stupid senses; that by the way, you still need to explain to me how that all works.”
You gestured towards his face and were met with a chuckle. The carefree way he tilted his head, taking in everything he could about you as you stood before him made you feel unshielded.
“Next time.” he said, voice low and thick
“Next time?”
“Yeah. I mean, tonight was great. I want to do this again, if that’s what you want.”
“Yeah. Matt, I really did have a great time. It’s just…” you trailed off
“Who is he?”
“Excuse me?”
“Come on sweetheart, you’ve been holding something back all night.”
“I have not—”
“Don’t lie.”
“Fine.” you contested with a sigh “There was someone. Recently. But he broke my heart. And told me to move on. And I’m trying.”
It was the first thought you’d given to Frank in hours; how kind his eyes were when he spoke to you, how the low gravel of his voice resonated through every nerve in your body when he muttered your name, how soft and gentle his hands were despite all the violence they inflicted. Then you thought of the conversation you’d had when you last spoke, how he just wasn’t ready for the love you wanted to give and how it just seemed so easy for him to walk away.
As Matt stood before you, earnest and flirty in a way that always wooed you into giddiness, you too thought of how similar the two men were. All the traits that made you fall for Frank, present in Matt, with just a little more of that “has his shit together” factor.
“But?” Matt inquired
“But as handsome and charming and electric as you are, I’m still hung up. And I’m sorry that’s not fair to you Matt. I shouldn’t have agreed to —”
“No it’s fine, look I had a great time tonight. I always do when I’m with you. We can put a pin in this, call it a night and not let hard feelings get in the way.”
“No, that’s not fair. To either of us. I shouldn’t let this chemistry between us fade out because of...” you paused, shaking your head and trying to find the right words “You and me, this could be a really good thing.”
“It could be.” Matt agreed “Plus, wouldn’t hurt in helping you win the break up?”
“Who said I want to ‘win the break up?’” you said, giving Matt a playful smack on his arm, which cause him to jolt and fein injury with a smile “It wasn’t even really a breakup, it’s way more complicated than that.”
“Hey, just another thing for us to get into next time.”
“You keep saying next time.”
“I do.”
“You really want to be a rebound?”
“I mean, I don’t have to be. We could just take this slower until you’re ready. See where it goes?”
Winning the breakup. What a childish concept. Still, knowing Matt and Frank had some kind of rapport with each other and getting just a little bit of revenge by getting with someone Frank was acquainted with felt like an enticing idea. Why not make things a little complicated and messy for Frank if word ever got back to him and give him a little taste of his own emotional medicine? Plus, as he had proven all evening, Matt always made you feel special anyway, so there was no harm in letting yourself have a little fun.
Fine.
“Or you could take me upstairs and fuck me until I forget about him.” you spoke, unwavering voice cutting through the background noise of sirens and traffic and every other noise you knew he worked so hard to tune out
You swore you could hear Matt’s heartbeat pounding from his chest and you didn’t even have his abilities. He tried to conceal his nerves behind a faint giggle as he contemplated your offer, searching for any indicator from you that you were joking. Whatever he sensed from you told him you were serious, as his nostrils flared and his hand to tightened around his cane. He licked at his lips and shook his head as he opened his mouth to speak, but it seemed words were lost on him at the moment.
Matt Murdock flustered. You never thought you’d see the day.
Was it so wrong to egg him on when he clearly wasn’t opposed to the idea? You decided not, rocking your feet forward and meeting your lips with his. You kept the kiss soft and gentle until his hand slid up your jaw, pulling you in more. Heat ignited in your bones as he kissed you back, trying to swallow down the low moan that was building in the back of your throat.
It took all his will power to pull away, even just a fraction of an inch to speak.
“Yeah, upstairs.”
· · ─────── ·𖥸· ─────── · ·
Now
The door to Matt’s office was cracked open just a little and you could see his silhouette sitting at his desk through the frosted glass. You hoped he couldn’t hear the shaky breath you released as you approached the door, still unsettled on exactly how you wanted this conversation to go. The dampness of your palms was enough to leave a residue on the brass door knob as you softly turned it to enter.
Matt was kind. Matt was a good person. Matt would handle this well.
“Matthew?”
He cocked his head as you pushed the door open, a smile spreading across his face as he heard your voice. The air felt stifling and hot as the setting sun cast the room in shades of orange. Matt looked like he’d been carved by gods in the tangerine glow; perfect forearms flexing slightly as he waited for you to enter the room, shown off beautifully thanks to his rolled-up sleeves. He had at some point in the day loosened his tie and unbuttoned the top button of his shirt just enough so that a small bit of chest hair poked through. The glimmer of the fading day reflected in the red glasses that sat on his face. His looking so delicious was how you got into this mess in the first place.
“Visiting me at work? We’re crossing into some serious territory here.” he jested, rising from his seat to lean over his desk and greet you with a soft kiss on your forehead “Unless this is Colleen just sending you over with more contracts.”
You glanced down at the grey carpet beneath you, chewing on your cheek as you ran over the words in your head you’d been rehearsing all the way over here. Tugging at your sleeve, you finally looked up to face him. The kind way his eyes crinkled as he smiled at you would usually put you at ease on any other day, but under the circumstances it only made you more nervous to speak.
“No no, this is a personal visit.”
Matt’s eyebrows rose in curiosity. It was late enough in the day that both Matt’s office and the city outside were in a lull of quietness, making you feel extra exposed to the way you could tell Matt was observing you. Scanning every element of your body for some kind of hint to where this conversation was going and you were certain the vibes were not great.
“Is everything okay?”
You let out a sigh as you sank in the chair opposite him, tapping your fingers on the wooden surface of his desk in front of you.
“Look, I know we both said we weren’t really in a place for anything serious and this would just be fun between the two of us, no strings attached but…”
Your breath hitched in your throat as you tried to continue without crumbling into a sobbing puddle. Matt licked at his lips as he waited to hear what you had to say and you were certain he could still taste the saltiness in the air from when you had wiped away your tears earlier. Squeezing your eyes shut in an attempt to center yourself, you shook your head, let out a large exhale, then spoke.
“Matt, I’m pregnant.”
It came out as almost a whisper, strained from the tightness of your throat and how heavy it felt to say out loud. The tick of his jaw was the only indicator you had that he’d even heard you, as he stood there with his hands on his hips. He didn’t need to listen to your heartbeat to know you weren’t lying.
Never one to leave a moment of silence to linger, you couldn’t resist the bubbling up of all the hundreds of thoughts and you’d be having since taking the test. The carefully constructed phrases you’d rehearsed for this moment in your head were now lost to a cluster of intangible thoughts as you began to ramble.
“I’m so sorry, I thought I was being so careful. I mean I was. I was taking my pill on time every day and everything. At least, I think I was. You don’t have to say anything or do anything. I’m going to take care of everything myself. Unless you want to, I mean be involved or whatever. And I know this isn’t what either of us wants right now but I just never thought I’d ever have kids, like it wasn’t even on my radar and—”
Matt held out a hand, cutting you off. You sat there blinking, unsure what to do as you watched him pace around in a circle, large hand rubbing at the back of his head. His silence was troubling to you and it seemed each moment spent without knowing what he was thinking was taking an eternity. Was he angry? Or just in shock? Was he going to ask you to leave, never to speak to you again? Was he going to break your heart just as Frank had? Was this a big enough complication that made you worth discarding by someone you cared for again?
After what seemed like minutes, he rested his forearms against the back of his chair, turning his attention fully to you.
“Sweetheart, it’s okay.” he reassured. “We’ll figure it out together.”
“Matt, you don’t have to—”
His hand came up again.
“Do you know what you want to do? Because whatever you decide, I’m right there beside you.”
“Matt, you don’t have to. I mean we’re not exactly at that stage of this relationshi—”
With a scoff, he shook his head and smiled. “No, sweetheart. I’m serious. Talk to me.”
He finally pulled out the chair from under him, sitting across from you and clearly ready to listen. You let out another sigh, resting your elbow on the desk and propping your head in it as you slowly spun the chair back and forth, even more antsy to how he’d react to what you were about to say.
“I want to keep it. I never thought I’d be a mom. Never thought I’d get the opportunity. But it took me all of five minutes after I took the test to calm down and I just knew.”
A small smirk tugged at the corner of his lips as he listened to you ramble more.
“But Matt,” you continued “Please don’t feel obligated to do anything. I don’t want you to feel stuck or like you have to—”
This time he cut you off by reaching across the desk, taking the hand that was not supporting your head as it danced nervously across the desk in his.
“Okay.”
“Okay?”
“Yeah. Okay. I said I was beside you and I mean it. No matter what.”
“Are you sure, because —”
“I want this. Us. Together.”
“Together?”
Your heart clenched at the certainty in his voice. Matt’s eagerness to be with you, to make this work, had all the alarm bells going off in your head. This was not how things usually went for you; life, relationships, opportunities. No one had ever been this clearly all in for you without some form of repayment expected and you were just waiting for the catch of it all to come crashing down and break your heart. But then you remembered the other shoe that was about to drop and ruin this moment was the secret you still kept from him.
“Or,” Matt sensed your hesitation and gave your hand a reassuring squeeze. “We still don’t have to put a label on this. We can get you through the pregnancy and co-parent and just see what happens.”
“That… yeah that might be best. But um, Matt there’s one more thing.”
Matt’s eyebrows shot up over his red glasses as he tilted his head toward you.
“There’s a chance you’re not the father.”
You swore you saw Matt’s heart break into a million pieces as his face dropped and he sat back a little, letting go of your hand.
“Right…” he replied, looking more and more sullen by the second “We didn’t— I mean we never labeled this. You said you didn’t want to.”
“I’m so sorry Matt. But we agreed to keep things casual and if it makes you feel better, I only slept with him one time after you and I started—”
Matt nodded warily.
“Is it just one other guy or—"
“Matthew!”
“You can’t blame me for being curious!”
“It’s just one other guy.”
“Okay. It’s the one that you told me about, isn’t it?”
“Yeah.”
“Have you told him yet?”
“No.”
Matt rubbed at his chin, letting out a sigh.
“It doesn’t matter.”
“Yes it does.”
“No. I want this. Even if its not mine. Even if I have to co-parent with whatever other— I’m sure sweetheart.”
“You might want to rethink that”
“Why’s that?”
“Because I haven’t told you who else the father might be and you’re not gonna like who it is.”
NEXT CHAPTER
TAG LIST: @xxdrixx @a-leg-without-fear @echo-ethe @capswife @xoxabs88xox @allmyn1ghts @laaadygisbooornex3 @ninacotte @uncertified-doc @moth-murdock @danzer8705 @endofthelinegang @buckyssugarchick @hellskitchenswhore @pixviee @themikkapika @bisexualbith @labellapeaky @theoraekenslover @sexyvixen7
344 notes · View notes
kelaeri · 7 months ago
Text
The Many Languages of Dick Grayson
Apparently, according to Nightwing #54, he can speak 12, so I went on a little quest to see just how many I could identify.
Tumblr media
Starting off with The Essential Batman Encyclopedia, the entry for Dick Grayson lists him as being trained in French, Spanish, Russian, Japanese, Mandarin, and Cantonese with having some proficiency in an unknown Romani dialect. Given there are multiple examples of him speaking these languages throughout the comics, I am inclined to trust this claim. To start, we've got several examples of French (Gotham Knights #14, Detective Comics Annual #12, Nightwing #73, Grayson #10-- also featuring Spanish)
Tumblr media Tumblr media
In Grayson #1 he speaks Russian only briefly, but in Detective Comics #36 he speaks it throughout.
Tumblr media Tumblr media
As far as the Chinese languages go, while I believe Dick can speak Mandarin and/or Cantonese fairly well (Batman/Superman World's Finest #3), his Hanzi recognition and literacy could use some work.
Tumblr media
Similarly, when the Titans head off to Japan in Titans Annual #1, we have Nightwing speaking Japanese in battle; however, when it comes to the prospective job of being a manga translator in Nightwing #125, he claims he doesn't know Japanese, which leads me to believe he is only proficient in speaking Japanese/Chinese and struggles with the writing systems.
Tumblr media Tumblr media
So what about the languages not covered in the encyclopedia? To start, we have another romance language: Italian (Nightwing #72).
Tumblr media
Followed by some alleged German (Nightwing #51, JLA #44)
Tumblr media Tumblr media
And conversations in Farsi (Robin #175)
Tumblr media
While I've seen some Tumblr and Reddit posts claim he knows Kikuyu, The Power Company: Manhunter #1 only says he "brushed up" on his Kikuyu before going to Kenya, so it is unknown how much of the language he actually speaks, but to me it doesn't seem likely to be a lot.
Tumblr media
He also, to some unknown degree, speaks Tamaranean-- at least enough to hack into an alien computer (Action Comics #842).
Tumblr media
As far as unspoken languages go, Dick is fluent in ASL, which is proven numerous times when he communicates with Jericho (New Teen Titans 1984).
Tumblr media Tumblr media
And lastly, the two languages that remain rather uncertain are Romani and Cant-- largely due to the nature of the languages themselves and their representation in comics. "Romani," for instance, has several different dialects, and when Devin Grayson introduced it for Dick (Gotham Knights #20-21, Nightwing #91), she never specified which, and based on the lines she wrote, her research into the language was questionable at best. Writers since have recognized Dick's Romani heritage, but have not otherwise suggested he retained much of the language to be considered fluent.
Cant is an even wider term than Romani and can be seen as more of jargon for a particular language than a language itself, sometimes even being called a "pseudo-language." The colloquial term for American circus cant is Carny, or "Carny speak" as Boston Brand puts it in Batman: The Brave and the Bold #14 when he and Nightwing encounter a kid who speaks it.
Tumblr media Tumblr media
So... this leaves us with 11 languages Dick has notable proficiency in: English, French, Spanish, Italian, Russian, German, Japanese, Mandarin, Cantonese, Farsi, and ASL. And ~3 languages he has unknown proficiency in: Tamaranean, Kikuyu, Romani, and Carny/Cant (if you want to count it).
Maybe memory-loss Dick was including either Tamaranean or Kikuyu in that count from Nightwing #54, or maybe he knows some other language we haven't seen yet. Given how close the family is to the Al Ghuls, I personally think it would be cool if one of them was Arabic.
But anyway, hope you enjoyed this post! A lot I've seen covering this topic are very surface-level and label some of his more iffy languages as "fluent," so I hope this cleared things up. I've read tons of Nightwing, and I swear there are more examples, but sifting through the 1,000+ comics I've read of him is a lot haha. If y'all know of some others, let me know!
640 notes · View notes
Text
Macintosh SE "SuperDrive" (1989)
Tumblr media
3K notes · View notes
illmoraineakoi · 5 months ago
Text
Theory: The Newgrounds attack takes place On October 2nd, immediately after Dark and Chosen escape.
I’ve touched upon how I think the Timeline is a little wonky in this regard before, but I just couldn’t stop thinking about it.
And I think I’ve figured it out.
When Victim first escapes Alan’s PC, he first goes to Yahoo.
Tumblr media
I even made a joke about it in my last post, about how Alan’s taken the piss out of Yahoo before.
But, well, that previous time?
Tumblr media
The Flashback.
But moreso: Yahoo is the first thing Chosen and Dark are shown attacking during the Flashback.
Both Victim AND Chosen and Dark end up at Yahoo after they escape.
And there might be a reason for it:
Tumblr media
Alan’s PC was originally tethered to Yahoo. [It also seemed to have an offshoot connection to MSN, which it took me an hour to identify that logo as I was unfamiliar with it.] That was the primary webstring (tunnel, but I wanna call them webstrings bc world wide web) to his IP box. And His IP only originally has one webstring coming out of it.
Tumblr media
Until Victim does...Whatever THIS is. And causes ALL OF THE IP addresses to become tethered to the Outernet directly.
[Victim not being uploaded anywhere and coming directly from a PC in a rocket made of computer program parts might have significance on why the Barrier became connected to the IP Boxes, but that’s a different theory for another day.]
So currently, Alan’s PC has two connections to it: One that leads to Yahoo/MSN, and another that leads directly to the Outernet.
We all assumed that Chosen and Dark went right to the Outernet when they left his old PC, because it was implied that that tunnel was the same one Chosen had COME from and that he and the Color Gang were currently going through; a webstring that does spit them out into the Outernet.
Tumblr media
But they didn’t.
Dark and Chosen did not go through the Outernet webstring.
They went to through the YAHOO webstring.
Tumblr media
I refuse to believe it’s a coincidence that they ended up on Yahoo first, or just happened to choose to attack Yahoo first, when Yahoo is shown to be directly connected to Alan’s IP box.
They never went to the Outernet. They went from Alan’s PC DIRECTLY TO Yahoo.
Which means that the first part of the Flashback is showing the events of what Chosen and Dark did IMMEDIATELY after they escaped.
Yahoo was the first place they were spit out into, so they decided to destroy it too. Why not? They just literally got done destroying Alan’s computer, why not wreck more human shit?
Victim and Chosen/Dark’s paths differ after Yahoo.
Victim goes to Runescape, then Myspace, to the Singh Family IP Box, where he crashes out of and into GracesPC, where he’s taken to Newgrounds, and then he crashes into the Outernet.
Chosen and Dark, if the Flashback showed their complete journey, went from Yahoo, to Angry Birds, to StickPage, to Newgrounds.
Tumblr media
The websites are shown to have dozens, if not hundreds of webstrings attached to them. Each leading to different places: other websites, other programs, other IP Boxes.
It’s totally possible that Dark and Chosen just went through a different webstring than Victim did to end up at Angry Birds instead, especially if they stopped to destroy Yahoo. Victim just made a (somewhat straight) shot through. But they could have just picked an exit at random.
I made a diagram for it:
Tumblr media
It this theory is true, then it implies that StickPage is the first time both Dark and Chosen are seeing other living stick figures besides each other.
And that some HUGE implications.
Do Chosen and Dark realize what they’re doing, when they’re attacking stick figures?
Do they understand that other sticks are alive like them? That other sticks can be hurt, that they can feel pain? Do Chosen and Dark have a concept of death? Do they even realize they’re causing death to the sticks they’re attacking?
Dark was literally just created THAT DAY. How much does he know? How much does he understand?
How much knowledge does a stick figure possess, innately, when they’re created?
Chosen has been alive for 4 and a half years, but he’d been imprisoned and enslaved. He’d never seen another stick figure before Dark. All he knew was fighting, being forced to destroy pop-ups, and trying to escape. Does HE know the nature of other living things? Does HE know how to behave towards others of his kind? Does HE understand the concept of death?
Dark was made to kill Chosen, and the first moments of his life were spent attempting to fulfill that purpose. And then he went immediately into destroying the computer. And then immediately into destroying websites.
Dark had nothing to teach him that wanton destruction and mass murder wasn’t okay to do. He and Chosen simply did them, and he found he liked doing them. He didn’t have a moral compass to tell him it was wrong, and he didn’t have the opportunity to properly develop one. There was no resistance to prevent him from becoming a psychopath who enjoyed hurting and killing other living beings.
Because Chosen certainly wasn’t stopping him. Not yet, at any rate.
But Chosen...Chosen was older. Chosen had experienced different things from Dark. Chosen probably experienced pain and fear at Alan’s hands. (Victim’s backstory has got me fully doubting that Chosen was just left to twiddle his thumbs when he wasn’t being used as a pop-up blocker. Alan hurt Chosen too. Chosen just probably never died from it.) Was that enough to give him the basis for a sense of morality? Enough to instill him with the ability to empathize?
Tumblr media
Is that why Chosen pauses, when Mitsi dies? Is he starting to realize the full consequences of their actions? That they’re killing sticks?
Or does none of this even matter? Was Dark made from the start to be an evil psychopath and that’s why he is the way he is? Was Chosen made ‘normal’ and simply chose to be an asshole because he was angry?
How much of it is their nature vs their lack of life experience?
This might be the reason why Chosen is participating in the Newgrounds attack. It’s so early into HIS life that he hasn’t had those changes to his morals yet. This might be the START of that change. The instigating event. The things that start causing him doubt his own actions, that eventually blooms into distaste and guilt. That eventually allows him to see that Dark’s behavior isn’t right.
That allows him to recognize his own behavior isn’t right.
The Flashback attacks have set in motion the divide between them on what their characters eventually become: Chosen develops a sense of morality, Dark does not.
Both the party and the Flashback attacks are happening on October 2nd, 2011, mere hours after Chosen and Dark have escaped.
There IS one potential snag to this theory, and that's the escape portal.
Tumblr media
And that is, admittedly, a massive one.
That LOOKS like a Chosen-made portal. It even makes the same sounds as the ones in The Virus and The Chosen One Returns did.
But we never see nor hear what a 'normal' entrances/exit to a website looks like. We see Victim exiting them in side profile, not as they look from the surface level.
It's very possible that Chosen is just opening up the entrance into a webstring when he makes his portals.
Tumblr media
The webstring to the Outernet already exists. He's not MAKING a connection, just opening a door.
And a webstring from Newgrounds to the Outernet ALSO already exists.
Tumblr media
That's what I think the escape portal is, this webstring that was made when Victim fundamentally changed the entire fabric of digital reality by complete accident. Dude had a busy day that day.
Honestly, I don't think even The Chosen One has the ability to MAKE webstrings. They seem like they're fundamental connections across the internet that had been pretty well established before Victim did his thing. And that was a MASSIVE amount of energy that was released to create those new webstrings.
The entire way the internet digital space works feels very cosmic to me. Like some massive inspiration was taken from the universe in it's design. The IP Boxes look like stars, the websites planets, and they sheer nothingness in between feels like a vacuum.
I don't think it's IMPOSSIBLE to make new webstrings [I actually theorize Dark figured out how to do so with the cliff side portals] just...
Beyond Chosen's ability to do so himself.
Hence: the webstring between Newgrounds and the Outernet.
The wobbly weird-sounded hole in the ground might just be what they look like naturally. Or someone else opened it. We have no confirmation that's an ability unique to Chosen.
So that's my theory. Chosen and Dark never went to the Outernet before they started their rampage. They rampaged, and THEN probably went to the Outernet.
Tumblr media
Where they probably got stuck, for at least a little bit. Cuz, y'know, the Sky Barrier is solid. (Also hey Signh Family IP)
371 notes · View notes
luv4arinn · 2 months ago
Text
I Just Wanna Feel
Author’s Note: So—sorry for not posting in weeks, but I had a massive writer’s block, and well… I’m back! I was heavily inspired by THAT Robbie Williams song. Yes, I watched his biopic. Yes, I cried. Yes, I recommend it. And… surprise?! There will be a whole chronology with the others, all themed around Robbie’s songs! Yayy <3!! Consider it a gift? from me for taking so long 🥺. Love you all.
Pairing: Bayverse!Donnie x female reader
Tags: Intense fluff, nerd having an emotional crisis, extreme overthinking, unexpected kisses, Donatello’s mental breakdown, romantic panic, “oh no I messed up” but in HD, happy ending.
Tumblr media
The sound of the keyboard echoed through the room—a rhythmic, steady tapping that blended with the low hum of the monitors. The bluish glow from the screens cast irregular shadows across his face, reflecting off the lenses of his glasses with every line of code appearing and disappearing on the monitor.
Donatello was there, as always.
The work was easy. Thinking was easy.
It was like a well-structured algorithm: receive information, process it, execute a plan of action. The world had rules, patterns, probabilities—formulas that predicted outcomes with near-absolute precision. No matter how chaotic a situation seemed, there was always a logical solution waiting to be uncovered.
Computers don’t lie.
Data has no biases, no whims. It doesn’t suffer irrational fluctuations. It doesn’t beat faster without reason. It doesn’t have to remind itself to breathe.
But then…
There’s you.
And everything falls apart.
Not immediately. Not like a fatal error shutting down the system in the blink of an eye. It’s more subtle. Like an unexpected variable in an equation that had, until now, been perfect. Something that doesn’t fit into the rigid structure of his world—but something he can’t ignore either.
He thinks about it often. About how his brain operates like a well-calibrated machine, each thought clicking into the next like the teeth of a moving gear. Logic is his native language. Reason, his compass.
And yet, when it comes to you, all that logic becomes blurred.
The gears grind.
The code becomes erratic.
The equation fills with unknowns.
Because when you step into his space, when your voice disrupts the steady rhythm of his keyboard, when you lean over his desk without a second thought for the scattered circuits and switch off his monitor without warning…
His first instinct is to think. Analyze. Quantify.
What does this mean?
Why does his heart react this way?
Why does his skin register the shift in temperature more intensely when you’re near?
But thinking doesn’t give him answers.
Feeling does.
And that is terrifying.
Because feeling isn’t predictable. Feeling has no neatly arranged lines of code, no graphs to chart behavioral patterns, no equations with exact solutions.
Emotions, in themselves, are a chaotic system.
And you…
You are the anomaly he still doesn’t know how to decode.
Nights shouldn’t feel this short when spent alone in front of a screen. And yet, when his mind drifts to the memory of a laugh, the fleeting image of a glance, the echo of an accidental touch… time dissolves in a way not even quantum physics could explain.
When he feels the weight of his name on your tongue. Like an access key to a system he never thought anyone would try to hack.
And he watches you from the corner of his eye as you lean closer, and in that instant, every variable in his mind shifts. Every equation rewrites itself.
A shiver runs down his shell.
Feeling.
He knows because his chest tightens with an undefined pressure, a sensation he can’t attribute to any specific physiological variable. His heart rate isn’t elevated from exertion. He’s not under attack. He’s not in danger.
So why does his body react as if he is?
There’s no equation to explain this.
Because if there were, he would have solved it long ago. He would have identified the problem, broken it down into its components, eliminated any errors. But every time he thinks he’s close to an answer, another unknown appears, shifting all previous solutions out of place.
Music filters through his headphones, slow and melancholic.
“I just wanna feel, real love…”
A shiver runs down his spine.
His body reacts to the sound before his mind does. It’s absurd. It’s ridiculous. There is no logical reason why a progression of chords and a set of words arranged in a certain way should have this effect on him.
And yet, here he is.
Fingers hovering over the keyboard, motionless—caught between the instinct to keep working and the strange, undeniable realization that… he can’t.
Not because he’s tired.
Not because he lacks information.
Not because there’s a problem that requires more processing.
But because, for the first time in a long time, the data isn’t the most important thing.
The screen flickers with information he should be absorbing, but he isn’t. His glasses reflect numbers and graphs that would normally hold his full attention, but his gaze is empty, unfocused.
The room remains unchanged—draped in shadows, illuminated only by the bluish glow of his monitors and the faint blinking of LED lights from his equipment.
The mission had been difficult. The margin of error had been higher than he liked to admit.
It wasn’t often that his calculations failed.
But sometimes, calculations weren’t enough.
Sometimes, reality simply… refused to adhere to logic.
“Feel the home that I live in…”
His jaw tightens.
He doesn’t know how that song ended up on his playlist.
But he has a reasonable theory.
One that involves Mikey, his blatant disregard for personal privacy, and his insistent need to “help him connect with his emotions.”
(Sure. Right.)
And yet…
The lyrics hit him harder than he’d like to admit.
It’s not the melody itself. It’s not the chords or the rhythm. It’s the way the words seem to slip through the cracks in his mind, seeping into the spaces that logic has never quite managed to seal shut.
“I just wanna feel, real love…”
Donnie exhales slowly, his fingers still hovering over the keyboard, motionless.
He thinks about the battle.
The mistakes.
The risks they took.
Numbers flash through his mind like a simulation running in reverse—impact probability, the margin of error in his calculations, the reaction speed needed to avoid damage. Fractions of a second where the difference between victory and absolute disaster depended on decisions made under pressure.
But more than anything—he thinks about you.
He thinks about the way, at the end of the fight, you rushed to check if he was okay.
About how, without even thinking, your hands—warm, alive—ran along his arm, searching for injuries he had already identified and dismissed milliseconds before with his visor.
He could have told you it wasn’t necessary.
That he was unharmed.
That he had concrete data to prove it.
But he didn’t.
Because logic dictates that worry should be extinguished by facts.
But feeling…
Feeling dictates that your touch lingers, even after you’ve gone.
That the sensation of your skin against his stays beyond his capacity for reasoning.
That the light pressure of your fingers on his forearm still burns in his memory, like an unsolved equation looping endlessly in his mind.
“Come and hold my hand…”
Donnie closes his eyes.
He could turn the song off.
He could erase the anomaly from his system.
He could rewrite the equation, adjust the variables, find a way to rationalize what he feels.
But… he doesn’t want to.
Because for the first time in his life, the result of a problem doesn’t matter as much as the unknown.
He doesn’t just want to think.
He wants to feel.
He wants to understand why being with you feels like the only constant that truly matters.
And then—you arrive.
Without warning, without fanfare, without the slightest idea that the world inside Donatello’s mind is teetering on the edge of a collapse even he can’t explain.
The lab door slides open smoothly—barely a whisper against the silence, thick with static electricity and the faint murmur of music in his headphones.
He notices everything.
The shift in air pressure.
The sound of your footsteps, softened against the floor.
The faint scent of shampoo and fabric laced with the chill of the night.
The way the temperature in the room rises by just a fraction of a degree when you step inside.
But he doesn’t turn around immediately.
Because he doesn’t know what to do with the anomaly that you are in his equation.
He doesn’t know where to place you within the rigid parameters of his logical, structured world.
His operating system slows, his brain—so used to processing information with the precision of a surgeon—stalls in an endless loop, searching for a resolution that refuses to exist.
And then—your voice.
“Donnie?”
Soft. Not because you’re hesitant, but because you know him. Because somehow—through a method he can’t quantify—you can read the tension in his shoulders. You can see the way his fingers have stopped typing, even though the screen is still waiting for input.
He closes his eyes for just a moment, as if that alone might be enough to reboot him, to restore the control that feels like it’s slipping through his fingers.
He knows he should say something.
He knows he should act normal.
But his normal means efficiency, speed, precise answers delivered at the exact right moment.
And right now, every command in his mind is failing.
You watch him with quiet curiosity, tilting just slightly toward him—just enough for the air between you to feel heavier, more tangible.
“Everything okay?” you ask, voice soft in that way that completely disarms him. Then your gaze sharpens slightly, scanning him with quiet scrutiny. “Are you hurt?”
He doesn’t answer immediately.
Instead, he looks at you.
His mind runs an automatic analysis of your expression—eyes slightly narrowed, lips barely pressed together, the faintest crease in your right brow, as if you’re already calculating the probability that he’s lying.
Logic dictates that he should reassure you with data. That he should tell you his visor has already run a full diagnostic scan and that his physical condition is optimal. That there is no rational reason for concern.
But then his gaze drops.
And he sees his own hand, still resting on the desk—still tense.
And for the first time in a long time, he chooses to do something without overthinking it.
He looks at you again.
His throat feels dry. Without realizing it, he wets his lips—a quick flick of his tongue over skin cracked from hours without proper hydration.
Then, in a voice so quiet it barely sounds like his own, he asks:
“Can I… hold your hand?”
It’s not the kind of question anyone would expect from him.
And he knows it.
Because it doesn’t fit his usual patterns. It’s not something that makes sense in any logical context.
But right now, logic is utterly useless to him.
Your lashes flutter in subtle surprise, as if the words take a few extra seconds to fully register.
“What?”
His instincts scream at him to backtrack, to rephrase, to find a way to explain what even he doesn’t fully understand.
But he doesn’t.
“I want to…” He inhales, trying to reorganize his thoughts. “I mean, just—”
He shuts his eyes for a second, frustration flickering across his face. He has never felt this clumsy with words before.
When he opens them again, you’re still there. You haven’t moved. You haven’t looked away.
And somehow, that alone gives him the courage he’s lacking.
“I just… want to feel it.”
The truth escapes him so easily, so quietly, that it almost embarrasses him.
Your expression shifts.
It’s not amusement.
It’s not rejection.
It’s something softer. More intimate.
And without questioning it—without hesitation or unnecessary words—you let your hand slide over his.
Not hurriedly.
Not hesitantly.
Just with the quiet certainty of someone who understands exactly what he’s asking for.
And when your fingers intertwine with his, Donnie feels every equation, every algorithm, every carefully structured rule in his mind… simply dissolve.
As if they had never really mattered in the first place.
“Well?” you ask, your voice carrying a faint attempt at lightness.
Donnie knows you’re trying to sound casual, that you’re masking your uncertainty behind a relaxed tone. But he notices.
He notices the delicate dusting of pink on your cheeks, the almost imperceptible tremor in your lower lip, the way your thumb brushes against the back of his hand—like you’re adjusting to the contact just as much as he is.
And something inside him… softens.
His lips curve, at first unconsciously—a smile, small and barely formed. Then, from deep in his chest, a quiet laugh escapes, unbidden and genuine, as weightless as the air after a storm.
It’s not mockery. It’s not disbelief.
It’s something purer. Something real.
—Nothing, —he murmurs, his thumb moving awkwardly against your skin— Just… this is nice.
The confession catches him off guard.
Because he hadn’t planned it.
Because he hadn’t filtered it through his logic before speaking.
Because it simply happened.
And then, you look at each other.
Maybe for too long.
Maybe just long enough for the world around you to blur into a distant murmur, as if nothing else exists except the space you occupy together.
He finds himself mesmerized by you.
Fascinated.
But not in the way he is fascinated by a new equation, by an unexpected pattern in the data, by the perfect symmetry of a well-designed structure.
This is different.
This is raw.
This is visceral.
This is feeling.
His other hand, trembling in a way he doesn’t understand, lifts with a slowness that borders on reverence.
And when his fingers brush against your cheek, the touch is so light it feels like an experiment in itself.
He feels.
He feels the warmth of your skin beneath his fingertips, the way it molds so effortlessly to his touch, the way your body leans ever so slightly toward him—responding to an equation he hasn’t yet written but, for the first time, doesn’t feel the need to solve.
He feels the erratic pounding of his own heart, too fast, too unsteady, as if it has forgotten its natural rhythm.
He feels the heat gathering in his chest, expanding outward like a shockwave, defying all logical explanation.
And then, he hears you sigh.
Small.
Soft.
Almost imperceptible.
But he feels it.
He feels the warmth of your breath against his skin, the subtle vibration of your exhale in the nonexistent space between you.
Feels,
feels,
feels.
As if every one of his senses—once so meticulously calibrated to process information—has now been repurposed for a single objective:
You.
Your warmth seeping into his skin.
Your quiet, rhythmic breathing.
The barely-there weight of your gaze resting on him.
The familiar scent of you, imprinting itself onto some hidden corner of his mind he never thought necessary.
Just you.
Only you.
Nothing else exists.
Nothing else matters.
And then—without thinking, without calculating, without rationalizing it into exhaustion like he always does—
he kisses you.
It’s brief. Just a brush of lips.
A moment suspended between doubt and need, between impulse and fear.
A single heartbeat contained in a single point of contact.
And then—
He hears you gasp.
His entire body locks up. Every muscle goes rigid with a tension so sharp it’s almost painful.
His brain—so efficient, so precise, so relentless in its ability to analyze every variable in a situation—enters a total shutdown.
He stares at you, eyes wide, pupils blown.
Oh, no.
No, no, no.
He misread everything.
What the hell was he thinking?
You don’t see him that way.
Why would you?
Why would you ever?
Shame crashes over him like an unstoppable wave. His stomach twists, his skin burns, his heart clenches into an invisible fist that threatens to crush it from the inside out.
He pulls back, his hands loosening, his voice catching in his throat.
—Oh, God, I didn’t mean to— —he stammers, his voice cracking under the weight of his own panic. His thoughts are a mess of unsolved equations, of probabilities collapsing into a singularity of pure dread— I just… I thought it was a good moment, I—
—Yes.
Your voice cuts through his spiral.
His brain short-circuits.
—It was.
What?
His breath halts.
The air thickens, pressing in from all sides, as if the entire universe has stopped—right here, right now, in these words, in this reality he never accounted for.
And then—
You close the distance.
You are the one to bring your lips back to his.
And his mind—his brilliant, overanalyzing mind—
for the first time in his life—goes completely silent.
And he simply—feels.
214 notes · View notes
dragonnarrative-writes · 27 days ago
Text
Generative AI Is Bad For Your Creative Brain
In the wake of early announcing that their blog will no longer be posting fanfiction, I wanted to offer a different perspective than the ones I’ve been seeing in the argument against the use of AI in fandom spaces. Often, I’m seeing the arguments that the use of generative AI or Large Language Models (LLMs) make creative expression more accessible. Certainly, putting a prompt into a chat box and refining the output as desired is faster than writing a 5000 word fanfiction or learning to draw digitally or traditionally. But I would argue that the use of chat bots and generative AI actually limits - and ultimately reduces - one’s ability to enjoy creativity.
Creativity, defined by the Cambridge Advanced Learner’s Dictionary & Thesaurus, is the ability to produce or use original and unusual ideas. By definition, the use of generative AI discourages the brain from engaging with thoughts creatively. ChatGPT, character bots, and other generative AI products have to be trained on already existing text. In order to produce something “usable,” LLMs analyzes patterns within text to organize information into what the computer has been trained to identify as “desirable” outputs. These outputs are not always accurate due to the fact that computers don’t “think” the way that human brains do. They don’t create. They take the most common and refined data points and combine them according to predetermined templates to assemble a product. In the case of chat bots that are fed writing samples from authors, the product is not original - it’s a mishmash of the writings that were fed into the system.
Dialectical Behavioral Therapy (DBT) is a therapy modality developed by Marsha M. Linehan based on the understanding that growth comes when we accept that we are doing our best and we can work to better ourselves further. Within this modality, a few core concepts are explored, but for this argument I want to focus on Mindfulness and Emotion Regulation. Mindfulness, put simply, is awareness of the information our senses are telling us about the present moment. Emotion regulation is our ability to identify, understand, validate, and control our reaction to the emotions that result from changes in our environment. One of the skills taught within emotion regulation is Building Mastery - putting forth effort into an activity or skill in order to experience the pleasure that comes with seeing the fruits of your labor. These are by no means the only mechanisms of growth or skill development, however, I believe that mindfulness, emotion regulation, and building mastery are a large part of the core of creativity. When someone uses generative AI to imitate fanfiction, roleplay, fanart, etc., the core experience of creative expression is undermined.
Creating engages the body. As a writer who uses pen and paper as well as word processors while drafting, I had to learn how my body best engages with my process. The ideal pen and paper, the fact that I need glasses to work on my computer, the height of the table all factor into how I create. I don’t use audio recordings or transcriptions because that’s not a skill I’ve cultivated, but other authors use those tools as a way to assist their creative process. I can’t speak with any authority to the experience of visual artists, but my understanding is that the feedback and feel of their physical tools, the programs they use, and many other factors are not just part of how they learned their craft, they are essential to their art.
Generative AI invites users to bypass mindfully engaging with the physical act of creating. Part of becoming a person who creates from the vision in one’s head is the physical act of practicing. How did I learn to write? By sitting down and making myself write, over and over, word after word. I had to learn the rhythms of my body, and to listen when pain tells me to stop. I do not consider myself a visual artist - I have not put in the hours to learn to consistently combine line and color and form to show the world the idea in my head.
But I could.
Learning a new skill is possible. But one must be able to regulate one’s unpleasant emotions to be able to get there. The emotion that gets in the way of most people starting their creative journey is anxiety. Instead of a focus on “fear,” I like to define this emotion as “unpleasant anticipation.” In Atlas of the Heart, Brene Brown identifies anxiety as both a trait (a long term characteristic) and a state (a temporary condition). That is, we can be naturally predisposed to be impacted by anxiety, and experience unpleasant anticipation in response to an event. And the action drive associated with anxiety is to avoid the unpleasant stimulus.
Starting a new project, developing a new skill, and leaning into a creative endevor can inspire and cause people to react to anxiety. There is an unpleasant anticipation of things not turning out exactly correctly, of being judged negatively, of being unnoticed or even ignored. There is a lot less anxiety to be had in submitting a prompt to a machine than to look at a blank page and possibly make what could be a mistake. Unfortunately, the more something is avoided, the more anxiety is generated when it comes up again. Using generative AI doesn’t encourage starting a new project and learning a new skill - in fact, it makes the prospect more distressing to the mind, and encourages further avoidance of developing a personal creative process.
One of the best ways to reduce anxiety about a task, according to DBT, is for a person to do that task. Opposite action is a method of reducing the intensity of an emotion by going against its action urge. The action urge of anxiety is to avoid, and so opposite action encourages someone to approach the thing they are anxious about. This doesn’t mean that everyone who has anxiety about creating should make themselves write a 50k word fanfiction as their first project. But in order to reduce anxiety about dealing with a blank page, one must face and engage with a blank page. Even a single sentence fragment, two lines intersecting, an unintentional drop of ink means the page is no longer blank. If those are still difficult to approach a prompt, tutorial, or guided exercise can be used to reinforce the understanding that a blank page can be changed, slowly but surely by your own hand.
(As an aside, I would discourage the use of AI prompt generators - these often use prompts that were already created by a real person without credit. Prompt blogs and posts exist right here on tumblr, as well as imagines and headcannons that people often label “free to a good home.” These prompts can also often be specific to fandom, style, mood, etc., if you’re looking for something specific.)
In the current social media and content consumption culture, it’s easy to feel like the first attempt should be a perfect final product. But creating isn’t just about the final product. It’s about the process. Bo Burnam’s Inside is phenomenal, but I think the outtakes are just as important. We didn’t get That Funny Feeling and How the World Works and All Eyes on Me because Bo Burnham woke up and decided to write songs in the same day. We got them because he’s been been developing and honing his craft, as well as learning about himself as a person and artist, since he was a teenager. Building mastery in any skill takes time, and it’s often slow.
Slow is an important word, when it comes to creating. The fact that skill takes time to develop and a final piece of art takes time regardless of skill is it’s own source of anxiety. Compared to @sentientcave, who writes about 2k words per day, I’m very slow. And for all the time it takes me, my writing isn’t perfect - I find typos after posting and sometimes my phrasing is awkward. But my writing is better than it was, and my confidence is much higher. I can sit and write for longer and longer periods, my projects are more diverse, I’m sharing them with people, even before the final edits are done. And I only learned how to do this because I took the time to push through the discomfort of not being as fast or as skilled as I want to be in order to learn what works for me and what doesn’t.
Building mastery - getting better at a skill over time so that you can see your own progress - isn’t just about getting better. It’s about feeling better about your abilities. Confidence, excitement, and pride are important emotions to associate with our own actions. It teaches us that we are capable of making ourselves feel better by engaging with our creativity, a confidence that can be generalized to other activities.
Generative AI doesn’t encourage its users to try new things, to make mistakes, and to see what works. It doesn’t reward new accomplishments to encourage the building of new skills by connecting to old ones. The reward centers of the brain have nothing to respond to to associate with the action of the user. There is a short term input-reward pathway, but it’s only associated with using the AI prompter. It’s designed to encourage the user to come back over and over again, not develop the skill to think and create for themselves.
I don’t know that anyone will change their minds after reading this. It’s imperfect, and I’ve summarized concepts that can take months or years to learn. But I can say that I learned something from the process of writing it. I see some of the flaws, and I can see how my essay writing has changed over the years. This might have been faster to plug into AI as a prompt, but I can see how much more confidence I have in my own voice and opinions. And that’s not something chatGPT can ever replicate.
141 notes · View notes