Tumgik
#so therefore it looks more natural
snekdood · 5 months
Text
people dont know what liminal means anymore. im gonna stab someone. an empty parking lot is not liminal THERES SO MUCH SPACE EVERYWHERE AND NO WALLS TF YOU MEAN
#nvm im wrong#but still the post i saw didnt seem liminal at all#i dont count outdoor spaces as liminal unless everything is perfectly pristine and trimmed#maybe im thinking of hell actually#grass trimmed under an inch#perfectly clean roads w no cracks or bumps#ROUND FUCKING TREES#SQUARE FUCKING BUSHES#nevermind the lack of biodiversity#bricks that look like they havent aged and have no chips or EVEN bird poop or ANYTHING.#nothing worn or weathered by time#yeah thats hell#mayeb i could consider that liminal. but like. just a regular outdoor place? naw...#and the above description i gave is physically impossible (and should remain that way death and decay is natural fuck immortality)#so thats kinda why i dont agree w wikipedias desc of liminal w the image of a playground w/o kids bc the grass isnt Perfect#so therefore it looks more natural#the episode of spongebob where everything is chrome in the future? liminal#empty playground but the grass is still different colors? das just a haunting image reminding the viewer of the state of our world#n capitalism n stuff#u know what im sayin dhfsafdggfsd.#there should be kids yes. but thats not the 'liminal' aesthetic (which i hate btw idk if i made that clear)#thats making you think about how there SHOULD be kids but instead they're inside all day on tiktok or being radicalized by the alt right#sometimes both#and that ppl are scared to bring their kids outside bc of so much propaganda out there about being in public spaces in general
2 notes · View notes
allaganexarch · 3 months
Text
godddddd wasting time and energy on things that don't fucking matter has got to be THE worst feeling
#personal#i felt super embarrassed in my korean lesson today#because I didn't have a lot of time the last couple of weeks and I was trying to resolve the situation w the other tutor#when i should have just cut my losses and bailed#and look i know i'm learning there's literally no reason to be embarrassed etc but i am insane so that's not an option LOL#i should have somehow already known the contents of the lesson and therefore not needed the lesson hope this helps#but actually it was like i spent what little time i had preparing for the other lesson that was stupid and pointless rather than this one#and that just made me feel :( you know#in fairness to me my mental health was circling the drain literally until 2 days ago#so the last couple of days have just been like *sweeps up the carnage of various mental breakdowns and other insane behavior* LOL#but idk just generally feeling frustrated with myself even tho that's not super helpful#also frustrated that stupid bullshit has been taking up way too much of my time and energy lately#and it seems like the more i try to get the stupid bs out of the way the more it just dominates my life somehow#also super helpful that my brain's natural response to this state of being is 'well maybe you can't do anything right and should die :)'#like okay ty for your input LOL#despite how this sounds actually my korean lesson was REALLY good LOL#it was so good I just like got upset about wasting time on other bs you know??#anyway ty for coming to my nightly overshare i actually feel better now#love to shout into the void#exciting korean learning tag
2 notes · View notes
thatscarletflycatcher · 3 months
Text
If Percival and Nadine was to have a contemporary ya romance name (the typical of non-fantasy, non-myth retelling, non-spec novels, I mean), it would have to be something involving a metaphor of light.
That dark neo-noir radio drama starring David Morrissey (it IS really dark. The lengths I'll go to just hear the interpretative power of his voice. Anyways), called Don't Hold Back the Light keeps coming to mind again and again. The imagery of dawn and sunrise keeps coming to me, in part through the songs I feel fit the story in partial ways (Keane's Bend and Break, Rick Astley's Rise Up, James Blunt's Bonfire Heart, even the melody of Lionel Ritchie's Stuck on You), but also because it feels thematically pertinent.
Both find themselves in night, not only in the despair, and tiredness, and hurt and brokenness, but on the idea that they had their day in the Sun, as life is metaphorically a day, and that it is over, and yet they linger. BUT where they are at the beginning, the idea of a new day sounds scary. And exhausting. There's a sliver of hope deep, deep down, like a candle on a window in a faraway house in the middle of nowhere. But for the most part, they'd like to hold it back if they could. And yet that feels wrong to them.
#look I'm not saying the idea or the imagery aren't like... extremely common#but they feel fitting#have been thinking about this within the frame of It's a Beautiful Life#Nadine is a bit like Mary in the way that she had a dream and a goal and she was laser focused on achieving it#but in her case it all went wrong really fast so what now?#Unlike George Percival has no sense that he has done more damage than good#he was a good son! he made his parents happy! but they are dead#he was a good brother! but his sister is married well cared for and far away#as the heir of Avensley? well does that mean anything at this point? it was already a dying relic by the time his father inherited it#he thinks himself too broken in mind and body to be a good husband and father in the future#sure there's a death of his own professional dreams#but they aren't renunciations from his pov#the alternate good was such a clear direct personal duty that it isn't like there was an alternative for him#not to count the things prevented by things completely outside his control like war#he's passively suicidal because he thinks of himself as just having outlived his usefulness#so anyways it is all about new beginnings and therefore naturally about dawn and light#incidentally I have been obsessed ever since I watched The Lake House with the idea of Architecture being tied to light#and the concept of a LI that is an architect which is such an unexplored concept?#and I feel it is very interesting in terms of how precision and the mastery over force are crucial to i#but also the idea of the builder of home and shelter#unfortunately it has made me realize the unintended implication that James as an aviator destroys shelter#and Percival as an architect builds them#which cannot be helped at this point but is definitely not a sort of love triangle thing#James was essentially a good man in his time and place and not a bad husband for how long their marriage lasted
2 notes · View notes
crescentmp3 · 9 months
Text
my hair has been cut!
1 note · View note
isfjmel-phleg · 2 years
Text
I think I finally figured out what Josiah did that resulted in his getting sent off to school a year early as a punishment.
Not earth-shattering, but it's taken me like three years to find an answer for a backstory that's fairly significant for him, so it's nice to have something to work from.
15 notes · View notes
mariacallous · 2 years
Text
Tumblr media
"getting warmer buddy!" fuck the fuck off already
7 notes · View notes
totallyfluxd · 1 year
Text
read the starless sea in like three days and I am. hmm. not capable of expressing how beautiful it is and how deeply it gripped me and hhhhhh I need a sequel about kat actually!!
0 notes
hxltic · 1 year
Text
imagine bokuto fucking you so good from behind
Tumblr media
you’re laid flat on your stomach, where he has two large hands digging into the small dip of your back. He’d already fucked you out, so now with every dragged curl of his hips, it feels ten times longer. He’d go slow before increasing speed.
Sweat is dripping down your body and wetting your hair. He does that lopsided full grin of his and brushes his own sweat droplets from his forehead, before shifting weight completely to his palms and slamming down almost fully parallel to your body. You were pinned. Your walls tugged against the length of him, massaging his cock in a way no fist can. You were tight but so fucking wet, and with every slap of his forgotten balls you get closer and closer to what,, your 4th orgasm?
“H-ah fuck! Oh m’god Ko-“
The bed rocks with every roll, your chin slowly falls with the weight of your head, and your eyes droop inconsistently. You start to mumble to no one into the covers.
“Mmph, fills s’gud,” you’d whine.
“Just hold out for me alright baby? You’re takin’ it like a fucking champ.”
He adjusts one hand to disperse along the whole portion of your back, allowing him to grab one arm and fold it into his hold. He copied the movements for the other while your hips naturally rise. You, him, and the bed bullied the supporting wall together, causing scratch marks of dark grey to stain it. With the loss of cognizance, you didn’t notice how he wasn’t as horizontal anymore, but was pressed more on his knees. The strength he even has to do that is insane— and honestly, you wish you could admit it—but you were too distracted by the slight upward angle this entailed.
If your eyes weren’t rolled back, they were now. Your jaw hung slack when they first shot wide, portraying on your face the exact feeling of ecstasy that ran through your veins. Bokuto noticed how you became stagnant for just a split second. Idle, even.
You then shivered and shook as you sporadically pushed your hips back in an escape. Of course, this was futile with no arms.
“H-Oh my fucking god Kotarō,” your voice was higher than he’d ever heard it.
He just roughed you up towards him, grabbing you by the fat of your ass connecting to your hips, and slipped himself back in like nothing happened. When you tried to wiggle away, you successfully got him to let one hand loose, but the consequence was that one shoulder was on the bed and the other wasn’t, so now your neck was craning to look at him by the side in doggy.
Thrusting into you in a new position where there was nothing left of his dick to see, you could’ve screamed. There was no buildup or anything, he hit the same spot about twice a second, but you were out of energy. In this moment he sacrificed speed for power. With a mindless, animalistic groan, you pushed against him from inside and came. The mixed-haired man smiled once white started to peek out whenever he thrusted. Your ass stained red along with your tightly held wrist.
So you laid there and took it all instead, half mentally here and half not. He only laughed that boisterous laugh from behind you and forced your hips down. They’d ricochet off, then return with momentum. It was hot and wet, a lewd scene with your mixed sounds and his loud grunts. And you know when Bokuto wants something, he goes all out.
He knew you knew the safe word, and he knew you knew when to use it; therefore, he’d fuck you until you could barely think. You loved it.
He’d taunt, “You tryna run away?”
“Hummph”
“sorry babe, what was that?”
“n’mm.”
“close enough.” he concludes breathlessly.
12K notes · View notes
ssahotchnerr · 7 months
Note
no but imagine pre-relationship aaron with fem!reader who can fall asleep anywhere & in the most uncomfortable positions known to mankind 💀 aaron is both terrified and amazed bcs how do you keep doing that 😧 but then every time he sees you like that he slowly & carefully arranges you in a more comfortable position 🥹🫶🏻 & the team gives him shit for it 💀
(luvie can I be 🪷 anon 🥹🫶🏻)
makeshift
omg stop i love that cw; fem!reader, bau family banter, pining aaron <333
falling asleep in a federal prison, may seem like a hard thing to do. surrounded by the worst of the worst, distant yells from the inmates floating down the hall, the mere location itself. but apparently, not for you.
the facility was currently on lockdown, meaning no one was going in or out, and therefore you were stuck overnight. as a result, the warden offered one of the locker rooms to be strictly the bau's 'break room', so to speak.
after his last, rather unpleasant interview of the evening, aaron was hellbent on a fresh, but not very good, cup of coffee. as he pushed the door open and entered, his focus diverted straight to you.
you were laid across a steel bench - eyes closed, hands clasped over your stomach, absolutely gone to the world. however, if you moved an inch - or probably less - would you completely topple onto the hard floor.
"you're kidding." aaron deadpanned as he looked at you in pure astonishment, coffee long forgotten.
"she's been like that for thirty minutes now." jj commented from where she was leant against one of the sets of lockers, head bent down as she scrolled through her phone. "but are we surprised?"
"nah," derek snorted lightly. "but hey, better than the floor."
"tell me about it." a low grumble came from reid, somewhere.
aaron's face pulled into one of discomfort, his brows drawing into a line above his eyes. the surface you were asleep on, had to be cold, for starters, by nature of the material and the a/c was still kicking in high gear despite the cooler temperature outside. the flat metal had to be highly uncomfortable, no cushion underneath you at all, most likely digging into your shoulder blades. you'd inevitably be waking up to an angry back, which aaron knew from experience - from past events where you miraculously drifted off in questionable positions.
eager to lessen the outcome, aaron shrugged his suit jacket off his shoulders. he balled it up, situating it snug under his arm.
next, he crouched beside you, cradling your head in his hand as he lifted it gently. at the movement, you stirred, a small noise escaping you and aaron froze, waiting for you to settle back down before resuming his actions. part of him feared his current, drumming heart would somehow rouse you more.
but once you had, he slid his jacket underneath your head - a makeshift pillow. it wasn't much, but it would at least alleviate some of the pressure collecting in your neck, and you wouldn't be as sore when you awoke. the next thing he had to figure out, something to lay on the ground, on either side of you, to soften the fall in case you were to-
"that's real cute hotch." derek grinned, grabbing aaron from his thoughts. "when you make up my bed next, can you add one of those pillow chocolates? thanks."
"funny."
aaron stole a glance at you, a calmness brushing over him and the ends of his lips daring to tug upwards into a smile. he couldn't help himself - sure, he wished you weren't fast asleep on a bench that could cause potential harm if you budged, but it didn't hide the fact that you were, well, you.
his hopeful, hidden attempt didn't go unnoticed by one person though, who naturally had to open their big mouth.
"that's nothing compared to that case in montana," aaron shot dave a pointed look to quit it, but only got a wink in return. "hotch practically carried-"
"dave."
"aaron." dave quipped back, an eyebrow quirked high in amusement, but fell silent. although, his witty expression didn't falter, as if he were noting to aaron that it wouldn't be difficult at all to be persuaded to continue.
"whoa whoa there, rossi," morgan straightened his posture, a hand out. "go on."
3K notes · View notes
etherealkissed88 · 8 days
Text
how i manifest when i feel anxious •°. *࿐
Tumblr media Tumblr media
i decide i have what i want…
when i feel anxiety -> i let it pass while knowing its only a human reaction
◦ since i am beyond just a human (i am limitless imagination/self), i know any anxiety is below me and it has nothing to do with my limitless self. i have exactly what i decided i have, regardless of any anxiety.
know anxiety usually comes from a fear of failure
◦ so, i cannot limit myself based on what i see or what i negatively assume my future will look like bc i am always beyond the 3d, no matter what feelings/anxiety my human self experiences.
◦ i become indifferent/i dont care about what i see or what i assume i will see because i know everything comes together in the 3d once i change self/know its done. fact: everything always comes together and works out in the end. being indifferent to the 3d = being indifferent to emotions, anxiety and everything that doesnt serve you.
dont fight it, dont avoid it, tackle it head on
◦ acknowledge you are experiencing anxiety bc you are. yes it can feel like shit but it doesnt have to affect who you are being (whatever version of self you are embodying). again, i can choose to be indifferent to this anxiety. you dont have to be scared of the anxiety. it is a natural human response. cry if you need to, let it all out. dont try to suppress it bc that will only come to bite you back in the ass, believe me.
◦ take care of your mental health in whatever ways necessary. when i used to experience anxiety, i used to take walks in the park, clear my head, meditate, express myself and my emotions through art and journaling, etc. remember nothing you do (or feel) in the 3d has to affect who you are being/your state.
"how can i still have anxiety yet still be a desired version of me?"
anxiety has no affect on anything unless you allow it to change your identity. you are the one with power, the anxiety is only an experience, similar to breathing in oxygen and using our sense of touch; its all neutral. when you start surrendering to the anxiety, you are creating and accepting negative stories that you create based on the feeling of anxiety. allowing that anxious feeling to change your state/identity is surrendering to something you view as more "powerful" than you. stop transforming that anxiety into a state that you embody based on the false, negative stories u imagine.
remember a 3d experience or anxious feelings doesnt have to influence who you are being. an example: a model who knows (fulfilled) that she is graceful and beautiful can have anxiety about doing her catwalk. the anxiety is normal, she can experience the symptoms of anxiety (shortness of breath, dry mouth, shaking) but her core identity/state is still a graceful model. the anxiety is only a temporary feeling. usually when we experience these feelings, they occupy all of our attention in that moment which is why it seems so scary but in reality, its not that big a deal. know that anxiety is just a feeling. you are safe. you can still experience shitty feelings while knowing you are a bad bitch!
you dont always identify with everything you experience. for example, a lot of people experience good things and still identify as people who are unworthy of good things. so its really up to you to choose what to identify with.
i know my only job is knowing its done
◦ if i just decided its done, as the operant power, as i say goes, therefore its done. so my job is done. anxiety is part of the 3d, not my limitless self, imagination. so i can be indifferent and experience it without identifying with it, the same way people manifest what they desire while experiencing their shitty circumstances daily (because they do not identify with those shitty experiences).
◦ ive heard/experienced situations were we know its done yet we cried and felt like shit, and what we wanted still manifested into the 3d. bc anxiety is only a feeling. do not allow your feelings to take hold of your state, but if it does, its never the end of the world... just get back in the state. 3d shit/anxiety doesnt have to intervene with who you are being/what you identify with.
kisses, jani ☆
2K notes · View notes
murdrdocs · 2 months
Text
do you believe in us?
Tumblr media
description. from a young age, you and PAUL ATREIDES believe you belonged to the other, and foolishly thought you could one day marry. not even an unlikely marriage between your parents will diminish those beliefs.
includes. STEPCEST, SMUT MDNI 18+, fem!reader, oral (f receiving), childhood best friends to stepsiblings, instigator paul, appearances by lady jessica, duke leto, and duncan idaho, sparring, sneaking around
wc: 5.3k+
a/n: title from us by movement. artwork credit to revol404 on instagram. ao3 link
Tumblr media
When you were younger, you saw Castle Caladan for what it wasn’t. 
In nearly all of your memories, Castle Caladan was warm and bright. The sun shone into the large windows, illuminating the gray hallways and providing a comforting warmth that seduced your young mind into seeing Castle Caladan as one of the residences from the fairytales your mother would tell you. In these memories you were always running and smiling, often hand-in-hand with your best friend. Your first love. 
Paul Atreides. 
Castle Caladan was the home of the person you cared about most. Therefore, visits were vacations. They were scarce, becoming more rare the older you got, but that only made you treasure them more. 
You and Paul would spend the entire day together, even going as far as to sneak out of your allocated bedrooms and tiptoe into the chambers of the other. In the morning, the maids would find two little bodies sharing a bed, hands reaching out to touch the other in the empty space between you both. 
And as you grew, you traded running around the halls for playing each other in chess. Playing throughout the fields was traded for walking along the shoreline. 
Sneaking into each other's bedroom only changed by the nature of intentions. You still ached to spend more time together, but the innocence of it was lost. In the solitude of the night, you would make up for the time lost during the day to Paul’s training as the heir, and your duties with your mother and Lady Jessica. 
When your mother broke the news, she misled you. 
“You will be permanently living with the Atreides family,” came her carefully chosen words. If she had not trained you, maybe it would’ve taken you longer to catch the implications. Maybe you would not have understood what circumstances had brought this upon your family until you were packing, or even until you were already en route to Caladan. 
Instead, it’s then and there that you realize how your chances have been lowered to none. 
Your mother had said your name, her tone as dry and disappointed as her eyes. “You will never be able to marry him. It is as I said.” 
And that was that. 
Your best friend becomes your step brother in the blink of an eye. Together, you made up the new and noble siblings of House Atreides. 
Your mother and Paul's father were married, and you and Paul now shared a last name. It was an immovable fact, no matter how often you and Paul attempted to convince each other of the opposite in moments of intense desperation. 
No matter how many times you tried to convince the other that marriage is a procedure that could be reversed should the need ever arise, you both knew that a reversal would be unlikely.
Duke Leto married your mother despite his clear love for Lady Jessica for security. If he could manage to commit such an act onto the one he loves, then there would be no undoing this.
Now, you see Castle Caladan for what it is. 
As beautiful as it is dreary. As cold as it is large. As encompassing as it is comforting. 
You sit at the breakfast table next to Paul and across from your mother. Lady Jessica sits at the end of the table, and Duke Leto, your stepfather, is absent. 
There’s no small talk, just the silent scraping of utensils against expensive china and the occasional audible gulp of fluid down throats. 
Every so often, you throw a curious glance Paul’s way, and the look he throws at you is in similar fashion. You both feel the stiffness in the air. 
Paul raises his eyebrows. He nudges them towards your mother and then his mother, and does the same with his eyes for emphasis. 
You slightly widen your eyes pointedly, your way of saying I know without having to say it. His lips pull up into a small smile and then you both turn back to face your plates. 
The tense silence continues for a while. Your mother addresses Lady Jessica. Lady Jessica addresses Paul. Your mother addresses you and Paul. 
And then your plates are cleaned and Paul is standing. 
“May we be excused?” 
It’s surprisingly a clear day outside, and you did not have to speak to Paul to know that he intended for both of you to enjoy the agreeable weather before Caladan was inevitably submerged in water once more later in the night. 
“You may be excused,” Lady Jessica confirms. 
You’re in the midst of rising from your seat and pushing the chair out from under you whenever you catch Lady Jessica’s eye. She does not say anything to you, but she does not need to. 
Just the cold gaze of her blue eyes alone are enough to make you sink back into your seat. From behind you, Paul calls your name. If you were not locked in a trance, you would have looked at him, you would have found the soothing blue-green of his eyes instead of the petrifying chill of his mothers. 
“I’ll see you later, Paul,” you tell him on your own volition, but you think that is what Lady Jessica wanted you to say anyway. 
She waits until the dining room is cleared of anyone other than you two before she begins to communicate. 
“You and my son…” Her words taper off and you are too busy focusing on the way her lips have only moved to take in another bite of her breakfast, and not to speak to you. 
While you understand the ways of the Bene Gesserit, it never fails to amaze you. 
“Ma’am?” You are playing dumb and both of you are aware. 
Still, Lady Jessica elaborates, “You both have had feelings for the other since you were young.” 
There is no room for denial so there is no reason for you to attempt it. You nod twice, casting your eyes down to your lap where your hands lay restlessly. You begin to pick at your nails as Lady Jessica continues. 
“And are those feelings still present?” 
Your answer comes entirely too quick. 
“No!” Your voice echoes around the room and you cringe. 
Lady Jessica lifts an eyebrow. She senses your dishonesty. 
You chew on your bottom lip for a moment. “Yes, ma’am. But we have not acted on them.” 
When she communicates this time, it is with her voice. 
“Good. You are a smart girl and your mother has raised you well. I’m sure you will make both of us proud.” She finishes off her food and sits straighter, wiping her mouth free of nonexistent residue with a white cloth. “Now I’m sure you have things to be getting to, right, dear?” 
You have never been happier to leave somewhere. You say your goodbyes as graciously as possible and leave the dining room. 
You’re in the training room exhausting yourself with slightly shaky jabs at the practice dummy whenever the door opens. There is a split second where you’re prepared to turn around and throw the next jab at the intruder, but then he speaks. 
“If I were Gurney I would chastise you for fighting with your back to the door.” 
You speak around your heavy  breaths. 
“Eyes in the back of my head, remember?” 
Your reference is one that goes back to you and Paul’s young teenage years. A phrase you confidently proclaimed once you and Paul both had begun extensive training, learning combat that could protect yourselves and your—then separate—family names should the need ever arise. (To this day, Paul is more formidable in combat than you are, but back then you could confidently hold your own.) 
Gurney had taken over training then, and he had allowed you and Paul to train together, solely because you were visiting during one of Paul’s less intense training sessions. 
(You believed that Gurney always had a soft spot for you and the Atreides heir. Not nearly as obvious as the one held by Duncan Idaho, but its existence is present within the weathered man.)
When Gurney had chastised you for fighting with your back to the door, you quickly quipped with a claim that you had eyes in the back of your head. When Gurney tossed a rock at your back, not big enough to provide more than a bruise against your skin, you were able to block it without turning around. 
Gurney was impressed. Paul was stunned. You attributed it to pure luck. Yet since then, it was never let go. 
When you begin to notice Paul approaching you, you credit your awareness of his movement to knowing him more than you knew your surroundings. You weren’t the most skilled warrior. Your mother belongs to a notable house, which forced you to learn slightly more than the basic survival skills. Some chastised her for withholding you from Bene Gesserit training, or perhaps more in depth training that would harden both your body and your mind. As far as she cared, you could hold your own in a fight, and that is all you needed. 
But you knew Paul. The ins and outs. Sometimes, late at night when you would allow the sickness of infatuation to fall upon you as you gazed at the stars, you liked to think that you and Paul were intertwined. You liked to convince yourself that your souls were intertwined and codependent. 
It is hard to dispute that claim when you know based on intuition alone that Paul is right behind you. 
(You can also feel his body heat and his presence behind you, but in your mind that is not nearly as romantic.)
You spin around to face Paul, your arms raised and body tensed with preparation to fight. 
Paul eyes your posture, cocks his head to the side, and mirrors it. 
It’s over quickly. 
Paul has your dagger thrown to the side within the first three movements. He has your hands restricted in his grasp in the next two movements. With just one more movement, he has your cheek and chest pressed against the wall with your hands bound behind your back. For just a moment more, he stands a respectable distance away from you. 
With the space between you both, the position could be passed off as friendly. The position could pass as the competitive nature it resembled. 
Until Paul takes a step closer and flushes his crotch against your backside, making you well aware of the stiff form within his trousers. 
For just a moment more, you let yourself revel in the feeling with your eyes closed, the rate of your breathing evening out now that you aren’t exerting yourself. You shimmy your hips just a bit, nestling Paul’s erection between your cheeks as best as you can with lack of movement and layers hindering your abilities. 
But then the moment is gone. You push it away when you speak. 
“Paul,” you intend for the syllables of his name to be a warning. At first, they come out as a pleading whine, so you clear your throat and try again. 
“Paul.” This time, it is firm and demanding. 
When Paul hums, it is against the shell of your ear. The proximity allows you to feel his voice instead of just hearing it, and you are instantly reminded of the times Paul had been on his knees between your legs and using the vibration that came from him to bring you pleasure you have not felt since. 
“We really shouldn’t.” You’re trying to convince both him and yourself. 
“Why shouldn’t we?” 
The question should not have to be asked. It is a question that should not need to be answered, for you both know what is preventing you from having the other in ways from before. 
You do not answer. Your forehead thuds against the wall, your warm breath rebounds against the wall and hits your lower face when you exhale. 
Paul starts to gently rock his hips into yours. His free hand, the one not restricting your movement, presses flat against the cement structure. 
When the pleasure increases, and your desire follows, you lift your head and let it lull to the side, resting the side of your skull against the toned muscles in Paul’s bicep. You start to give in. 
Your lips part in a moan devoid of any sound as Paul asks you again. 
“Tell me, my star. Why shouldn’t we?” 
He lets go of your hands, instead using his own for a more important cause. His palm glides up the side of your shirt until he reaches your breast. You cannot feel the warmth of his touch through your layers, but just the pressure alone is enough to have you choking around your words. 
“Because it’s not right, Paul,” you eventually tell him. 
Paul tuts. The hand on the wall meets your waist, his fingertips pressing into the area as he uses his grip to pull you back against him. 
“What d’you mean it’s not right?” He kisses the side of your neck and at this moment, you are considering letting him take you here and now. “It feels right, doesn’t it?” 
You’re nodding before he even finishes speaking. 
You had not realized just how bad you missed Paul until now. Your mind has conjured up images of him in your sleep, perfect replicas of his face created from memories of your time spent together and imagining what could be if you just release your inhibitions. When Paul gently sinks his teeth into the skin along your shoulder, it dawns on you that with just a bit more time, your dreams could easily walk into the waking world. 
Maybe you were just about to give in. Maybe Paul would have convinced you to let him finally have you. 
Either way, the moment is lost whenever Paul steps away from you, taking away all of the contact points in one singular move. 
You turn to face him with your eyebrows furrowed and your eyes already beginning to sting with rejection whenever the door opens. 
You turn your head, both stunned and grateful to see Duncan Idaho walking through, his stride strong and purposeful until he notices you standing in front of Paul. 
He takes a moment to cast his eyes between both of you. You watch his gaze flicker around the room, no doubt taking in as much information as he could, before he lands on you. 
“Didn’t know you were joining us today, Eyes.” It is no surprise that Duncan pulls on the same story from before for your nickname. Just as you have yet to let the anecdote go, he has yet to let the nickname go. 
“I’m not,” you tell him, attempting to subtly adjust your garments. It is clear that you were not as subtle as you could have been whenever Duncan eyes you up and down. You swear there is something akin to knowing on his face. 
“I was just leaving.” 
“Don’t leave on my accord. Paul could use more of a challenge, isn’t that right?” Duncan smiles teasingly and finally looks at your stepbrother. You do the same. 
(You are surprised to see that Paul does not look as flustered as you anticipated him to. You hope you did not pull the short stick.)
“Oh … yes.” Paul turns to face you with a smile similar to Duncan’s on his lips. “Join us … little sis.” The term of endearment sounds foreign coming from him. That is not the only reason why it makes you cringe. 
You understand that both of them are making a joke at your expense. There have been a few times where you foolishly joined Duncan and Paul during their sessions, only to get knocked on your ass by Paul and goaded into getting back up by Duncan. The cycle would continue until you could do nothing but lay in bed the next day, praying for a speedy recovery so you would not waste a day that could be spent in Paul's presence. 
Now that you live here, that one issue would be taken care of. Still, you prefer to be able to comfortably move around without bruises and aches restricting your movement. 
Although your mind is already made up, you cannot help but attempt to defend yourself. 
“Who says I haven’t gotten better?” 
Paul smirks. You both know that while you have improved, he has too. He will always be ahead of you. The compromising position you were in only a few minutes ago serves as proof. 
“Have you?” Duncan asks. 
Your reply comes in the form of dismissal, which you do as politely as you can, adding only slight annoyance to your tone that you could only display in the presence of Duncan and none of the other members of House Atreides. 
“Enjoy yourselves. Paul, I’ll see you at dinner.” 
Paul nods once and then you leave with the boisterous sound of Duncan’s laughter escorting you out. 
Dinner is much like breakfast. 
Duke Leto joins this time, which allows for much more conversation. But the stiff and tense air still permeates the dining room. It takes you half of your entree to decipher exactly where the energy is coming from, but it is so clear once it is revealed that you cannot help but beat yourself up over your previous confusion just a bit. 
Different from earlier in the morning, your mother sits at the head of the table with Duke Leto on the other end. Lady Jessica has been casted off and forced to sit across from you and Paul. She appears uncomfortable in the seat, constantly readjusting herself between quick statements that clearly express her discontent at the new arrangement. 
You would have focused more on the dramatics of your family dinner table if Paul were not toying with you beneath it. 
You are incredibly thankful that he kept his hands to himself, but his feet are just as insistent. Just as restless. 
They poke against yours constantly, not in an attempt to gather your attention as you would consistently send looks his way. Never were they returned. He would either be discussing his day with his father, talking to either of your mothers, or focused on the diminishing food on his plate. 
There were a few occasions where you thought Paul’s actions were accidental. You would draw your foot back, but when his covered toes found yours once more, you knew it to be another one of his games. It was juvenile and childish, but you found yourself allowing it to happen. 
You would take any form of Paul’s touch, so long as it did not compromise too much. 
You repeat your philosophy in your mind over and over again like the sayings of the Bene Gesserit whenever Paul approaches you. 
You stand in the center of your bedroom in your night clothes. Your curtains are still open, exposing the vast nothingness that the sea presents itself as since the sun has set. The stars twinkle above, and you had already prepared yourself for a night of tracing constellations before Paul entered. 
He stands in front of you, dressed just as down as you are. His hair is still a little wet from bathing, and you briefly recount the many times you played with the curls until they began to dampen and eventually dry. Each time, his hair would look unkempt in the mornings, but Paul never cared. He claimed that his hair was just a reminder of the night he spent with you. 
You would pretend to be unaffected by his sweet talking, only to flush at the memory of his words later in the day. 
“Are you listening to me, my star?” His words pull you from your senseless daydreaming. 
“What was that?” 
Paul’s lips tug up in the corners as he dips his head for a moment. When he looks at you once more, he takes a step closer. 
You knew why he was here in the first place, but the advance of his hand reaching for your waist still has your breath hitching. 
“I was wondering if you would let me have a taste of you.” 
He stares at you, waiting for an answer. Meanwhile, you are losing yourself as you continue to look into his eyes, analyzing the way his long and dark eyelashes add depth to them for the millionth time. 
Eventually, the raise of his eyebrows cue you. 
“Paul,” you start with a soft tone, an attempt to keep it neutral. But Paul knows you just as well as you know him. Possibly even better. 
He senses the impending rejection woven in just the syllables of his name. 
He sighs. He pulls you closer by your hips. He rests his forehead against yours and presses his hands into your lower back. 
He says your name. No, he breathes it. His breath hits your lips before you part them. With his next exhale, you inhale. The pattern continues until Paul prepares to speak, but you interrupt him. 
“She knows.” 
You do not have to specify exactly who you are talking about. 
Paul sighs again, this time as if he is defeated. 
“Of course she knows. My mother is all knowing, didn’t you know?” He speaks with faux amusement. He’s lighthearted, and the emotion is completely misplaced. 
“We can’t go back to doing this, Paul.” 
He begins to speak over you, but you continue. 
“Paul, we can’t. No. No. It’s too dangerous. It’s too–”
“We can. Yes, we can, my star. Look at me–” 
You do as told, removing the touch of your foreheads from the others to look at each other head on once more. 
“What are you so afraid of?” 
The question is so simple. The answer is, too. It is one you have run over in your head day in and day out since moving in just a few months ago. It is the same response you reminded yourself of whenever Paul would touch you, even if it were just an accidental graze of his knuckles against yours. 
The difficulty comes with admittance. 
But in the safe confines of your bedroom, with nothing but the moon, stars, and sea as a witness, you open your mouth. 
“I’m afraid of losing you.” 
Paul shakes his head gently, sending little water droplets flying. 
“You will never lose me. You know that.” 
“Yes, I will, Paul.” 
“No. Why would you say that? We live together now. We’re bound together.” 
It takes a moment to wring yourself out of Paul’s touch, and when you do, he keeps his hands suspended in the air without making any attempts to straighten his posture. He looks dejected. 
You approach your window, staring off into the distance as you say, “Exactly. We are bound together in ways that will never reach marriage. We cannot get married.” 
Paul’s footsteps are near silent as he approaches you. 
“Does that mean you cannot be mine and I cannot be yours? What we have will always transcend marriage, my star.”
When you do not bother to respond, there is a resounding thud. 
You look to your side to find Paul on his knees before you. You, the bastard daughter, have brought the heir of House Atreides to his knees. Like this, with the low lighting in your bedroom reflecting the highest points of his cheekbones and emphasizing the valleys along the plane of his face, it is easy to remind yourself that Paul Atreides is just as much of a bastard as you. 
You two are in this together. Why should you not be together as well?
You are already planning to accept when he begs. 
“Please? Just one taste and I will let you be if that is what you wish. You have my word.” 
Typically, Paul is a man of his word. When you were kids and you accidentally knocked over a vase, a gift from another of the houses, Paul never told a soul just as he promised. When you had the tiniest crush on Duncan and let Paul in on the secret, he never told. He had given you his word both times. 
It is this time when you first are made aware of Paul’s capacity for dishonesty. 
Either way, you lift the skirt of your nightgown. 
Paul fits between your legs without much difficulty at all. While it may have been a while since you allowed yourselves this delicacy, it is as easy as breathing to return to the routine. 
Paul begins to lick and suck at your essence with appreciation derived from deprivation. His hands press into the fat of your backside, either to hold you steady or keep you flush against him. In any case, you are securely pressed against Paul’s mouth and he has no intention of letting you go anytime soon. 
You feel similarly, throwing your leg over his shoulder and digging the heel of your foot into the defined muscles of his back. Your hand presses against the glass plane beside you when Paul puckers his lips and sucks along your clit. 
The position calls for some maneuvering. You bend your standing leg, then grip Paul’s curls with your freehand, pulling him just a little closer to your center. His tongue has slid down to your hole and bringing him closer has bumped his nose against your clit. The bud catches the ridge of it, and you shamelessly run your hips side to side in an attempt to catch it again. Paul, noticing your efforts, does it for you. 
He grabs your ass just a bit tighter, adjusting your robes with one hand before returning to his handfuls, and then he shakes his head just enough to provide the stimulation you were searching for. He dips his tongue into your entrance, brings it back out, and repeats the movement. Coupled with the alternating shake of his nose against your clit, and your recent abstinence, you are close sooner than you would have preferred. 
You sacrifice your minute control over him when you free his hair from your hands, and instead imprison the linen fabric of your gown within your grasp. You pull your garb up, scrunching the fabric into your hand to get a look at Paul. 
When his eyes are revealed, they are already casted up towards you. They crinkle at the corners as if he is smiling at you, and the shape you feel against your cunt is confirmation. When he peels away from you there is a visible erotic sheen across his lips. 
“I forgot how good you taste.” 
He speaks to you casually, in a fashion to the conversations of nonsensical small talk you had been subjected to earlier in the day. 
For some reason, this makes your head spin. 
You nudge your hips back in Paul’s direction and he does not have to be told to return to work. 
There is so much slip and slide between your legs that you cannot tell what is your arousal and what is his saliva. The combination of fluids multiples whenever Paul slides a finger in your entrance, slinking it along your insides before he finds the spot. He pays extra attention to it, watching you as he slips another finger in to join it without much time in between. 
You have not been aware of the volume of your moans until Paul begins to flick your clit with his tongue, after which a croaky sound slips past your lips and it is entirely too loud for the circumstances. 
Your hand slaps over your mouth before you can stop it. 
Paul shakes his head, removing his lips from you but not his fingers. He chastises you. 
“Don’t do that to me, my star.” 
That is all he has to say for you to remove your hand and continue to let the sounds that encourage him spill out. 
(Luckily, your sleeping quarters exist further away from the other’s.)
It is only a few more moments before your lower abdomen tenses and an orgasm seizes control of your body without much warning in advance. You grip your robes for stability, press your fingers into the glass of the window, and keep Paul close with your leg wound around his shoulders. 
He had no intention of leaving at all. He continues to lick at you, now incorporating a loud slurp that is seemingly intended to clean you up.
When the twitching of your muscles has ceased, both of your feet have rejoined the floor for only a minute before Paul has your legs wrapped around his waist. 
He carries you off towards your bed. 
“May I continue?” he asks as he lays you on your back at the foot of the furniture. 
There is no hesitation when you tell him, “Please do.” 
You heard the hushed whispers echoing throughout the hall, spreading information that should have solely remained private to your personal quarters.
"They appear to be close. Too close," came from the voices of your maids, spoken with excitement as the thrill from sharing tales that did not concern them flooded their bodies. Like always, they were in small huddles, bodies curved into each other, their postings abandoned as they assumed that no Atreides would be wandering the halls at this house.
Except you were.
Your lightweight garbs noiselessly tap against your ankle with each careful step, freed from the extensive jewelry you were usually kept in throughout the day. As of late, your mother has been presenting you as a jewel in an attempt to delude the Houses into forgetting that you are a bastard. House Atreides wanted for you to be seen as the potential for great alliances. 
Paul was presented the same.
Marriage became the topic of conversation more often, and you and Paul played the parts you needed to. 
You played the parts necessary to continue this. 
His door is cracked just enough for you to silently slip in. 
“They were talking about us again.” The lack of romance within Paul’s greeting words do not matter as much when his hands wind around your hips. 
Still, you can’t help but tease him just a bit. Your hands find his shoulders, palms easily gliding back until you can comfortably tug at his dark curls. 
“Could you at least tell me you missed me before we dive into Castle gossip? What happened to romance, Paul?” 
He smiles at you like he had been expecting you to say something along those lines. He leans in, pressing his lips to your cheeks and then your nose.
“Hello, my love. How I’ve missed you so. I have no idea how I lasted this long without you.” He is exaggerating. It has only been a couple of days since you and Paul last met into the hours of the night. 
You scoff and gently slap his shoulders. You do not bother hiding the effect of his words on you. 
“I heard the maids talking on my way down here.” You dive into repeating the words echoing around the concrete castle walls, but the way Paul looks at you is distracting you. His green eyes plainly flicker from your eyes to your lips, back and forth, back and forth, with a speed that says he does not want to be caught in the act. His lips, slightly chapped but no less appealing, are parted, allowing his tongue to briefly appear before disappearing back into his mouth. 
You let your words taper off. 
“You can kiss me, you know.” 
He nods once. When he speaks, his voice is a gentle whisper. “I know. I just didn’t want to interrupt you.” 
“Luckily I’m done now.” 
Paul kisses you with familiarity. 
You knew that no matter what, you and Paul would be married off to others. But in your deluded mind, you figured that you might as well have fun while you could. You might as well pretend that Paul Atreides was yours, and you were his, until eventually that would be forced to change. 
2K notes · View notes
hoseoksluna · 1 month
Text
LIQUID STARS | jjk
Tumblr media
pairing: fuck buddy!jungkook x f. reader (feat. bam)
genre: angst, smut
word count: 11.8k
summary: to seal the deal, you give jungkook what he wants—your kiss, your cunt and your virginity.
playlist: liquid stars / pinterest board: wine
warnings: size kink, heavy dd/lg themes, provocation, dry humping, dirty talk, mentions of porn, oral sex (f. + m. receiving), multiple orgasms & countdown, dom/sub dynamics, reader has daddy issues (like the writer), first time, jealousy, inner child healing, plushie used during intercourse, jungkook fucks her numb & dumb, praise kink, cum eating, pet names and the establishment of a title, bondage, raw sex, tummy bulge, desperation, pain felt during intercourse, squirting
note: as difficult as it was to write this, i'm immensely thankful. this changed my life; it healed me and i'll dream about it for a long, long time. i was as exhausted as oc once i finished this, because i truly did give my all. everyone, this is part four to my series 'wine' and therefore the very end. this is the very beginning of jungkook's and oc's relationship. can be read as a standalone as there aren't any quirks from the other parts (except for bunny), though if you wish to read them now, now is the perfect time. now you can see the beautiful gradual development of their relationship. please, enjoy as you read and let me know your favorite parts bc i need to talk about this. heed the warnings as there are dd/lg themes that can be uncomfortable for some. thank you! and thank you for all the love on this series. i'll never forget it. i love you, guys. ʚɞ
side note: give some round of applause for 3D daddy provider jungkook everyone!! he deserves it!!!
Tumblr media
Silky lilac bows adorn the tops of your pigtails that cascade down in loose braids, sprawled on the cotton of his pillow and on the soft belly of a bunny plushie. There are still traces of sunlight left on the bedding, which dissolve, little by little, into nothingness as the large star goes down, saying goodbye. It’s lightweight, the atmosphere—homely almost. And much to your surprise, you feel relatively at ease, despite the fact a man lies on top of you—a man you have a certain liking for. 
It was natural for you to end up here and you, yourself, wished for it, even. Deemed it was only right after the man took you around for a walk while his silly Doberman guarded each and every step both of you had taken in sync, especially so when he persisted in buying you a small plastic ring of the same bunny you’re lying against. He didn’t even forget about his own canine friend waiting outside patiently like the obedient dog he is, and fed him the snackies he got for him as soon as he returned from the shop. You swore Bam was as giddy as you when he received his gift. 
Now the ring glints in the last rays of the sun. His, too. 
While yours is as white as the cloudy morning sky, Jungkook’s is as black as the drowsily dozing night sky. You think it’s the perfect contrast between the pair of you. Not that you should be noting these things, considering you’re just friends. But his skin is satiny soft, painted in impressionist tattoos, while his muscles, that his well-fitted T-shirt graciously allows you to see, are strong. You’re sure he could just lift you and throw you around without much of a strain. And it certainly doesn’t help that he’s such a striking image of pure beauty. How could you not notice these intertwinings when they’re this lovely?
You like him—without a shadow of doubt. Can feel the call of an emotional attachment forming the more he studies your skin with the tip of his index finger, embellished with the Miffy ring, and it’s owed to the fact you’ve never been touched this way before. No one has ever come this close, no one has ever been interested in the moles scattered upon your shoulders, in the veins that make the pathway to the column of your neck. No one has ever gazed twice at them—but Jungkook?
He hasn’t stopped looking at them ever since he laid you down in the middle of his bed. 
How could you stop such a call? Such a lull, such a magnetic pull. You know you should, but for the meantime, you simply don’t want to. Can’t lose this moment, can’t lose this once in a lifetime opportunity—
Jungkook presses his lips against the prominent mole in the center of your left shoulder. Those pretty, puffy lips, closing against your skin, the smallest dart of tongue swiping past. It shocks you for a moment before the feeling dissolves beneath, adjusting within the freshness of your system. How could you refuse such dynamic poetry, expressed against your own forlorn body? When it’s so blatant that it’s natural, that your body willingly accepts it without a fight. 
You couldn’t. 
Stretching your fingers between the thick strands of his hair, you close your eyes to savor the feeling of being wanted. The movement of his mouth, going even as far as to the first vein rooted in your arm—following it with those half-closed pillows. Up, up until he finds the line of your collarbone. Jungkook pauses there, simply breathes against you before he interperses little pecks there, nibbles and gentle swipes of tongue. The lining of your top won’t let him go further down, so he changes direction—relies on the pathway of your veins to guide him to your neck. And there… at the first contact, you grip the roots of his hair. 
His kisses and nibbles are much harder here. And what’s worse, he takes the sensitive skin into his mouth and sucks. You fail at containing the whimpers that break out of your mouth and Jungkook reacts to them. Hums ever so deeply, rocks his hips against the mattress. You wish you were a bit bigger so you could feel the collision, but you’re just so small compared to his large form. You imagine he’s writing down the poems collecting inside of him with each cursive roll of his tongue. Wonder if there���s enough paper on your skin for all his words. 
“You sweet little thing,” Jungkook coos onto the crook of your neck, dragging his lips up and down before he stops at your jaw. You feel the warmth of his breath and his body heat seeps into yours, creating unity, blackening the ink. It feels strange, it feels so new. Brisk and springlike, like fresh air in a stuffed room. You want to stay here for a long time, tasting the wholeness of spring captured in him. You want his words to flush you red with the tinge of the entire sunlight that opens the buds of flowers during all seasons in a loop. “Can I kiss you?”
You haven’t gone beyond the innocent touching of hands with him. You brim with a tight feeling of thankfulness that he asked you such a graceful question, although something else steals your attention entirely. 
“Little?” you say, the smile on your lips pulled so taut that it quivers ever so slightly. It makes you crazy that he calls you that, but you play the game. Revel in it. “What do you mean little? I’m bigger than you.”
Jungkook cocks his brow at you, mouth falling into a lopsided grin. He sits back and you feel a whiff of coldness pass by the perimeter of your body, as if someone opened the window and let the winter air in, when it’s just his brief distance that caused it. The forming attachment in you tenses and before you can think about your actions, your hand finds his knee, his thigh and traces slow patterns there. Jungkook suddenly squeezes your waist, surprising you, and the ecstatic fluttering of butterfly wings break havoc all over your body. The solidness of his hands, their weight, their firmness, giving life to your body, meaning. You note how his fingers touch when he has his hands enveloped around you like that. And the inkling that your body matters in his hands like that slips into your mind, spreading through its axis. 
You bite your lower lip. A small ache begins to grow in your intimate parts. It’s so nice to be wanted, to be considered good enough to be touched, to be kissed. 
“You? Bigger than me?” Jungkook squeezes your waist again. Sucks in a breath through his teeth. Smiles softly; in a way that you find unbearably endearing. “No, you’re just little. Just a tiny, little bug. So tiny in my hands.” 
For the breath he inhaled, you exhale it. 
He leaves his hands there when he bends over you, hovering his lips over yours. His weight, his heat. You sigh against him in relief, in a newly blossoming excitement that he’s back again. You spread your legs wider, feet grazing his calves—
“Let me kiss you, please.” 
You’d give in, but the game is just so pleasurable. 
Your laugh is but a breath. “You wanna kiss me?” 
You exhaled, he inhaled. 
“Don’t ask stupid questions.”
“Since when do friends kiss?” You cock your eyebrow at him just like he did, prodding your tongue on the inside of your cheek. 
He hovers a little bit higher above you, hanging his head in defeat, sighing. Places his hands in fists on either side of you, caging you in. 
“Premium friends do,” he mutters, lifting his head, face all serious. You dig your toe into the toned muscle of his thigh, twirling sweet little circles, gliding up and down. Watch as his eyes lid and he tries to control it. “Don’t do that or I’ll fuck you.” 
Your body panics, but you will it to relax. 
“Does that come with the premium subscription?” 
Jungkook purses his lips, supports his weight on one hand as the other, the tattooed one, grips your jaw. He squishes your cheeks, bites his lip once—seemingly ponders whether he should play your game or not before he lets go of your pout, but still keeps his hand there. He traces the shape of your lips with this thumb, feeding his desire to kiss you with scraps. 
“Yes,” he utters. “Kisses, orgasms, my dog. It’s all—”
Orgasms, not just sex. Orgasms. 
“I get to take Bam?” 
Jungkook tuts at you. “You get to take me,” he corrects you. “Though, can even such a little thing like you take me?” 
Probably not. Definitely not. 
“But what about Bam?” 
He looks at you as if he couldn’t believe the words you’re saying, turning his head slightly to hear you better. Then, he scoffs, running his tongue across his lips swiftly, letting them express the enjoyment of your provocation by stretching into a smirk. He places his hand back on the right side of you, thinking over his words. 
“Bam is mine, but you can pet him. You can kiss him.” You can hear the feigned venom in that word as he spits it and you grin, pleased with yourself. You enjoy doing this to him. “And if you’re good, I’ll let you take him out for his walkies.” 
You gasp slowly, fingers absentmindedly gripping his thigh. Butterflies buzz you with a mere hint of arousal and to convey it, you wet your top lip with the tip of your tongue. The dominance, the principle of proving to him whether you’re deserving of something. Your heartbeat quickens, reaching for him with each swell. 
Oh, you’ll be good. You’ll be good until he’s sick of it. 
It seems he’s as pleased with himself as you were with yourself, reading your body language as he beams down at you, dimples poking holes in his cheeks. You want to stick your fingers there, pinch the skin at the corners of his mouth. Feel them, kiss them—
“Deal.” 
Jungkook blinks at you. He most likely expected you to be difficult. You like the look of surprise on him. A sweet kind of glint perches itself upon his irises. You’re at awe of how he manages to be so adorable and alluring at the same time. You could never understand it. You deem he must be otherworldly. 
“A kiss to seal the deal?” he tries, raising his brows, lowering himself to his elbows. 
He skims his lips across your cheek, descending to your neck. Places one, singular kiss there. Lifts his head to hear your answer, a soft curtain of hair falling across his forehead. 
You make a face as if you’re thinking about it. 
Jungkook groans. 
It’s cold, the way he turns away from you and it startles you—but then he slides his hands under your back and lifts you with ease, sitting you down on his lap. He moves you from the muscles on his thighs to the hardness of his intimate parts and you groan at the feeling of it. You’re wearing an airy short skirt with tights and knee socks underneath, the barrier so thin that you feel the solid, thick shape of him right under your femininity. 
You rock against him once. Jungkook lets out a sound akin to yours, fingers flexing—hands almost reaching for your behind before he decides against it and keeps them planted against your back. 
He desires your consent. And that makes you feel light-headed. Tipsy on the wholeness of him, on the pleasure coursing through your body. 
You rock your hips again—and this time, Jungkook whimpers. 
You take your hands and, slowly, you make a pathway down his chiseled chest. He twitches against you when your fingers pass by his nipples, his body following and squirming along. And once you reach the definition of his abdomen, your hands rise and fall against its quickening movement as his lungs heave. You’re mesmerized by his reaction to your touch. It’s as if it was his first time as well and something about that makes you woozy, savage and absolutely feline. 
And something about the way you’re allowed to do as you please, whereas he’s not, strengthens that state of mind, enriches it, thoroughly worsens it. 
You want him. 
It began with a ring and ended right here. 
And the process of your decision starts at his hips, finalizes at the pebbles of his nipples and finishes completely at the sides of his neck. He gives you the same, if not better, reaction, his manhood moving against you, and it’s settled. 
The giving of virginity to seal the deal, not just a kiss. 
Hovering your lips against his, you slip your hand to the place where you’re connected to feel up the shape of him. You moan onto him, vigorous power seizing you, propelling you to wrap your fingers around him. The breaths Jungkook emits are desperate, tortured, wafting over you, intoxicating you. It fills you with confidence unlike any other that you’re able to coax such a thing of beauty out of him—that you, the artist, have the upper hand momentarily while he doesn’t. 
And he waits, depends on you. You want to cry due to how happy it makes you, due to the way it suffuses an empty part of you, left abandoned by someone who should’ve taken care of it a long, long time ago. 
Because of that—if it’s kisses that he wants, you’ll give him as many as his body desires as a thank you. 
“You’re so hard against me,” you whisper. 
Jungkook grips your waist hard. 
“If you want it, you have to seal the deal,” he mimics your intonation, voice deep, tingling your tummy. 
“I want it.” You clutch both of your hands on his jawline, thumbs finding the invisible dimples. 
“Kiss me, then.” 
You whimper at the longing to do so. Your tummy clenches, butterflies inside swarm around and—
When you close your lips against his top lip, they burst into smithereens. Jungkook sighs in relief, enveloping you in his warmth. 
The kiss is hungry. You expected his first taste of you to be careful, contemplative, but he goes all in. Takes charge of the lip lock, swallowing you whole, moving against you, uttering low sounds that make your head spin and you just comply. Accept that you’re the one who submits to his craving and you find yourself liking it; find yourself wanting to deepen your submission. 
You wrap your legs around his waist, your head tilted as you reciprocate all of those hard kisses. When he comes up for air, he just gazes down at you, out of breath. One hand still on your back, the other cradles your cheek. There’s something puzzling in his eyes, as if he was fighting something within. You’re radiated by that energy, heavied down by it, letting him pet you like a puppy while you wait for the next step. 
“You’re so good that I’m considering letting you take Bam out,” he breathes, curling a wisp of your hair behind your ear. “Sweet little thing.” 
He pecks you once. You grind against his manhood and as he shortly groans onto your mouth, you splutter into giggles. Behind you, as if he heard him, the dog peeks his head out of the door, giving his Daddy a questioning look. Jungkook chuckles. 
“Bam, house.” 
The dog leaves and Jungkook sinks his fingers into your hair, sighing. Kisses you, again without tongue—only does what you’ve allowed him, but you overflow with the desire for more. He’s so considerate, so respectful and while you’re grateful for it, you want to break it. Your trust in him, made whole by all that he’s done for you, settled within you, made a bed in the sensitive parts of you that now shine. He doesn’t need to remain there—you want to go beyond that. 
“Touch me, please.” You look up into his eyes as you say it, willing them to see with all your energy how much you want him. 
He rubs soothing circles on your back. “If I touch you, I’ll fuck you, sweetheart.” 
You lift your butt ever so slightly and bounce down on him, your skirt furling. Jungkook moans, pleasing you to the core. It’s bratty of you, but it serves him right for being so stubborn, so firm in his control. You want to break him. 
“Can’t you see how much I want that?” you purr, bunching the cotton of his T-shirt in your fists. 
He merely shakes his head, licking his lower lip, fucking with you. He tugs on one of your braided pigtail, the other hand gliding to your hipbone. “This little girl is horny? I couldn’t tell.” 
A yellow light, sleepy in nature, spills through the blinds, latching onto the side of your neck. His eyes flick to it and his teeth sink into the wetness of his lip. He looks back at you when he says, “what was it that made you horny? The neck kisses?” 
He straps both of his hands to your hipbones now, adjusting you so your sweetest spot rests against his cock, rocking your hips like he wants them to. He swallows down his noises, makes room for yours. You figure he wants to hear them. 
You think about what made you horny. His respectful behavior. An electric spark spasms in your core at the memory and you roll your body against his at the impact—nipples pebbled, grazing below the hardness of his pecks. You moan loudly. He breathes heavily, can’t for the life of him contain that, gripping you with strength that will surely leave bruises. You add it to the list. 
His control—the momentary, delicious lack of it, too. The dominance that follows it. His noises and how unrestrained he is when it comes to them. The allure and the attractive charm of his looks, blended with that insufferable cutesiness. His hard cock. The neck kisses, too, of course. 
You summarize your answer and you tell him, “you.” 
A hitch in his throat. “Fuck.” 
Fuck, indeed. Fuck the steady rhythm—Jungkook speeds up your movement, the pace so fast your pigtails and your ribbons bounce, tits following suit. Your breath falls in step, moans echo within the walls of his room. He kisses you harshly, but that doesn’t silence you. He swallows your noises down, grunting. 
“You wanna know what made me hard for you?” 
You nod your head, lips forming a natural pout at the loss of contact. 
“Those fucking pigtails of yours. The knee socks. How tiny you are in my hands. Seeing you lose your fucking mind when I kissed your neck. Those marks I left behind, hm, fuck yes. Those marks made me crazy,” he mutters, staring you down. “And you know what else?” 
You wait for his answer as white flashes blind you, your roaring orgasm beckoning you close. He doesn’t stop rocking you against him, not once. Fills your brain with emptiness with his words coated wet by his dominant energy. You feel your own wetness soaking the fabric of your panties. 
“Your brattiness,” he says. “I want to fuck it out of you and make a good girl out of you that won’t misbehave again with her smart words.” 
A faint part of you, half affected by the pleasure he gives you, arises to stand up for you. “But I was good and you said so.” 
He clicks his tongue, disapprovingly shaking his head. Slows down the pace so you’re able to hear him loud and clear, your orgasm backing away. “You see the thing is with little bratty girls like you, even when they act good for me, there’s still that dark little side of them that hides. Unless I fuck it out of them, they play with me. And trust me, I like the game until I don’t.” 
You frown at him, but a moan betrays you. A fight throngs inside of you, his dominance yet again permeating you, causing you to flourish, but on the other hand, you don’t like being added to the mix. You want to be the only one—and it makes you angry that he had someone like you before you, that he even said it altogether. Though unfortunately, that’s something you can only keep to yourself. 
The forming attachment breaks, splitting into two, with the knowledge that your wish is futile. You understand he said it for the sake of the role-play that you both naturally, wordlessly established through sexual attraction, but you still have a lot of getting used to within the dynamic. He’s experienced, you’re not. Though, when you think about it, he doesn’t know a thing about your purity. You never told him. 
You blame yourself for your own pain. It’s your fault—you should’ve had a conversation with him about it before you let him do anything to you, instead of playing flirty games with him. You wouldn’t have gotten hurt, if he knew you were a virgin. The thought of what you’ve done stains you, makes you feel filthy, but you will it to kneel inside of you like a wounded animal. You need to be strong if you don’t want to storm out of his room in tears. 
No attachment, no liking. 
Just sex. 
There’s still a frown to your face, despite the fact you set yourself free with your decision. Jungkook chuckles at it, oblivious to your internal storm. 
“You didn’t like that, did you?” You didn’t like being compared to other girls he’d been with; there’s nothing to be said of the like about the role-play aspect. Being called bratty did rouse a moan out of you. “You prove my words right.” 
You roll your eyes. Jungkook grips your ass hard and spanks you. As the sting reverberates, along with it comes the realization you got what you wanted. 
You broke him. 
And now you have to face the repercussions. 
Good thing you’ve sobered up from the stupefaction of your arousal. 
You cradle his face and kiss him deeply in effort to change the narrative. No feeling of affection from earlier hangs upon your heart and you find that it’s easier like this. No strings, no pain. It relieves you—so much that you sense a layer of lightness to your body and tiny, manageable tears well in your eyes. You get to enjoy this after all. 
There’s radiance to your eyes, rooted in hope, and true softness to your words when you say, “I want you to fuck it out of me. I want you to be my first.” 
You want to be different—your pride is uninfluenced by your decision. If he fucks it out of you, the new narrative you’re longing for will fully take place and make living through this bearable. You know you can’t have him the way you’d like, but if fate wrote that you’re to have him this way—you don’t mind altering it to the little desires you’re allowing yourself to have. 
Once in a lifetime opportunity. You can’t lose it. 
Jungkook is left astounded by your words, eyes widening, shock evident on his features. Like your words, he softens, unclenching his fingers from your suppleness, the darkness in his irises making a way for gentleness to come through. He rubs the small of your back, hands ascending to your spine, feeling the clip of your bra, until he finds the nape of your neck. He holds you there, tenderly, as if you were a porcelain doll he now was careful not to break. 
The change in his demeanor is stark. It surprises you as well—and like everything that has happened within the hour, it isn’t something you expected from him. The emotion that emerges from the roundness of his eyes touches the hardness of your decision, tries to get through, pokes a gap inside, letting the light in. 
He tucks his darkness back inside. Strokes the back of your head, the silky ends of your ribbons sifting through his slender fingers. You relax against him and your body does it for you. It welcomes his tenderness, glad for the truth to be out. You fight against it—against yourself, willing your decision not to break but remain firm. 
No strings, no pain.
But to no avail. The light spreads. His light. Celestial twinkles of stars, small parts of him that make him who he is. 
“You’ve never had anyone before me?” he husks, regret glossing over his eyes, holding your head firmly as he awaits your answer. More stars spill like liquid. 
You shake your head ‘no’, your chest tightening. 
He kisses you and there’s something different about the way he does it. Now you can sense the carefulness you searched for earlier and you taste the primal core of loving care in the movement of his lips. The kisses are long, deep. As if you’re a different person now, a girl unlike any of the ones he mentioned. Someone who matters, someone who’s solid. You’re back at the beginning. 
A lump forms in your throat. 
“You sure about this?” he asks. 
One part of you, greater and illuminated by his stars, wants it gently like this, with flowers of innocence and purity besprinkled across his features, never leaving you out of his sight, taking care of you. But you fear that if you allow him to be tender, your heart will choose him again and cling to his side. The other, more faint part of you, affected by your decision, thinks it’s better to stick to the role-play, for there’s the aspect of illusoriness that will not bruise anyone’s hearts, especially not yours. It will make you horny, Jungkook will get you off and, glowing, you’ll go home.
You can’t decide. It’s too much of a heavy weight to bear on your shoulders. You can’t do it.
You need him to say the word. You need him to decide what will be the face of the trajectory of your premium friendship. 
Flowery or deceitful? 
A small candlelight in you hopes for gentleness and purity before your fear unfairly puffs it out. 
“Yes, I’m sure. I want you.” 
Jungkook lays you down and, at last, you feel his manhood against you. He bends to pepper apologetic kisses along the column of your neck and you feel the authenticity of his regret, thrumming against you warmly. Your breath hitches in your throat, the principle of the candlelight in you not being a high hope after all—
“I’m sorry. I should’ve gone about this better.” A kiss to your cheek; you stifle your sobs. “I should’ve checked in with you, but I jumped straight in. This was a mistake on my part. I’m sorry.”
He blames himself, not you. 
You want to remain stoic, but his authenticity beckons yours to come out and envelop him whole, gives access to your emotions and you can’t stop the miniature teardrop from flowing down the side of your nose. Neither can you stop the words that follow its footsteps. 
“I should’ve told you first,” you whisper, sniffling. Jungkook furrows his brows at the expression of your pain in tender emotion, wiping it away. “But I was bad—reckless.” 
He chuckles softly, caressing your hair. “You’re an angel. Sent to my side for me. You weren’t bad. I didn’t mean what I'd said.” 
His words, his touch, the kiss he adds to your cheek to punctuate his sentence—Jungkook erases everything that has just happened. 
Newness rushes in your chest, the pouring of spring into summer permeates your whole being. You hear the birds sing, the rustle of flimsy flower petals on tree branches as the warm wind grazes it with its touch. Jungkook seals this feeling by pressing a kiss to your sternum. 
He said it, so it must be so. You trust him. 
The firmness of the cage around your decision unlatches. Doesn’t fly away like the birds. Is a little bit afraid of peeking out. The candlelight returns to light up the room around that cage, blossoming into the sun. 
“We don’t have to do anything, if you don’t want to,” he says, looking up at you from the place where he dragged your top down to kiss your skin. 
The sun rays in you absorb all of the darkness. The firmness extends one wing. 
You run your fingers through his hair. Figure the only thing the summer in you is missing is the heat. You want him, you want sex and you don’t want to think about feelings or consequences. You don’t want to choose between anything anymore. You just want to enjoy yourself. 
“I meant it when I said that I want you to be my first,” you say, fingers curling around his ear. Jungkook leans into your touch and it’s as if he’s massaging the wing to alleviate it from a cramp due to being tucked in for so long. 
“Okay,” he sighs, taking your hands and pinning them on the pillow and bunny above your head. He sits up, examines you and you wonder if he can see how truly fragile you feel. “Do you trust me?” 
He’s had half a year of going out with you, mingling his life with yours, spending money on you and treating you like an absolute treasure to build your overall trust. And what he did just now? How he erased your pain? Your nod is immediate; you don’t need to think twice. 
“Of course I trust you.” 
“Good.” A soft smile. “I’ll make sure your first time will be beautiful for you.” 
Your heart thuds. His words steal all the breath in your lungs, smoothing out the surface of your body for his stars to fill. Tears prick at your waterline. 
“Are you scared?” 
You’re an empty canvas. 
“Not anymore.” 
Jungkook nods, gladness pulsating off of him. “I’ll be here the whole time. I won’t leave you, not even once, okay?” 
“Okay.” 
He finds the zipper on the side of your skirt and yanks it down. “How many times do you wanna come?” 
The ridiculousness of the question makes you laugh and you hide your face beneath your palms. “To be honest, I don’t expect to come at all. It is my first time after all.” 
You marvel at the honesty seeping out of you. His work, no doubt. 
Jungkook frowns, ridding you of the skirt, fingers hooking under the hem of your top. At the reveal of your pink, flowery, see-through bra, he stops altogether, stunned. He fondles the material, grazing over your soft nipples, at last reaching the embroidery of the small petals. He gasps in wonder, eyes flicking to your intimate parts to see if you’re wearing a matching set. 
The same flowers adorn the suppleness of your tummy. 
Jungkook smiles at his discovery. Is hasty as he drags the nylon of your tights down your legs, along with your knee socks. 
“I’ll decide how many times you come for me, then.” 
Heat pools in your femininity. There it is, the dominance that you love. Yet this time, it’s laced with his gentleness. Heaven on earth—a meadow full of flowers in the middle of summer. Like the ones on your lingerie. 
Joy grasps your heart. “Do I get to know before you start?” 
Jungkook chuckles, pressing a kiss on your tummy. “What, you wanna count them down for me?” 
You asked just because, but the idea excites you. You nod. 
Your response prolongs the rumble of his laughter and you feel its vibration as he kisses his way up to your clothed breasts. You’d think he’d focus his attention on them, but he straightens—reaches for something behind him and retrieves your white knee socks. He bunches them in his hands and puts them on you as if he were dressing a child. 
Paradoxically, goosebumps spread all over your thighs. 
Smoothing the material over your thighs, he lies back down against you, lips latching on the spillage of your breasts that your bra gives him. While it feels dizzying, you still want to know the number. You poke him in the bulging muscle of his arm and in the process, you flush his cheeks red. 
Jungkook pushes your tits together and licks over the line in the middle. The sight of the shine of his wet tongue against it drenches your pussy, ruining your pretty underwear, and you want him there, on your sweetest spot. Your nipples stand to attention and Jungkook listens to their call, thumbs brushing across them. 
You mewl, grinding your hips against his stomach. 
“Two times when I eat you out; two times around my cock,” he answers finally, awakening your butterflies. “How many times is that, then?” 
Amidst the pleasure, you do the math. “Four.” 
“That’s right. You think you can do that for me?” 
You’re not sure. In fact, you’re not sure of anything—lost in his touch, in his energy. 
“I don’t know,” you say, truthfully, skimming his face for a sliver of disappointment in his features. 
You find none. Only tenderness—round, soft eyes, brown in the light he radiates, nose and mouth buried in your tits, sucking on the skin, making you feel good. 
“That’s okay. We’ll try together. Nothing bad is gonna happen to you if you don’t come as many times. Or at all. I promise.” 
Your chest clenches. You grab his face and kiss him, licking over his bottom lip before you slip your tongue inside. Jungkook grunts, rolls his own muscle over yours, tasting you, feeling you. He inhales sharply against you, once again taking charge of the kiss, taking each and every thought and negative feeling you had and crushing it to smithereens. 
He lifts you and switches places with you, sitting you down on his lap with your back supported by his chest. He roams his hands all over you—tits, tummy, hips, sides and thighs while he busies his mouth on your shoulder. As your eyes follow each movement, you notice the marks he embellished your breasts with and your arousal grows—so much that you take his wandering hands and hook them under the waistband of your underwear, guiding them down your thighs. 
There’s a change to his breath when his index and middle finger feels up the fleshiness of your cunt for the first time. Hard, raggedy and absolutely tormented. He glides those digits up and down your dewiness, listening for the squelching sound that makes his cock twitch beneath you. 
He moans onto your neck, nose tracing the column on its way to your ear.  “How do you touch yourself?” 
A sudden shyness overtakes you and you turn your head, needing to hide in his neck this time. You remain silent, the words lodged in your throat. 
Jungkook sees you. 
“Do you rub your little clit from side to side or in circles?” he questions, helping you answer. 
“I—I like both,” you whisper onto his skin, moving your hips so his fingers slip to your clit, the sweet spot where you need him the most. He grabs the back of your thigh and lifts it, spreading you open, meanwhile you chase the firmness of his fingers.
“Just like that, ride them,” he husks, eyes dazed, fixed on the roll of your pelvis. “Feels good, doesn’t it?” 
Head on top of yours, you nod, never ceasing your movement, transfixed, just like him, by the constant way the pads of his fingers fondle your clit before dipping between your lips. The heat of the summer tightens in your lower belly and it’s a desperate litany of begging what your mouth utters, despite the fact you’re not really sure what you’re asking for, but you let him hear it. You’re close, so unbelievably close, yet still have a road to walk on before you, and you close your eyes to feel the delight of his touch more deeply, only to find that you manage to do nothing of the kind. 
When you sense his eyes on you and by instinct you reciprocate his stare, that’s when you feel the depth you sought after. Mouth parted, pupils dilated, eyelashes a drowsy catastrophe, messy hair casting a soft shadow over the planes of his blissed-out face. You want to kiss him. You want to make him feel as good as he’s making you feel—
“Let me do it now,” Jungkook says hurriedly, sensing the nearness of your climax. 
“Yes,” you croak out, halting the movement of your hips—and ‘yes’ is the word that ripples out of your mouth a hundred, a thousand more times when he spreads you wider and rubs his fingers on your clit from side to side. 
He feels the pleasure in sync with you, accepting all of your yes’, twisting his face the moment yours does, quickening the rapidness of his hand once he switches to circles to carry you to your summer-breathed paradise. 
And when you come all over his hand, he slips two fingers inside your hole.
He stills the buck of your hips. 
You widen your eyes at the new feeling of fullness and, panicking and constricting around him, you look at Jungkook, who merely strengthens his hold around you. 
“Trust me,” he says, breathing heavily. He doesn’t move his fingers past his first knuckles; he lets you adjust to the size. Gives you a kiss full of tongue to distract you. “Does it burn?”
You begin to pant against his mouth, the high of your orgasm long gone. You’re uncertain to count it as one when it was so short lived, ruined by the sudden plunge of his digits. But much to your surprise, you don’t detect any burn in your walls that he speaks of, which you realize was his intention.
“No, it just feels a bit uncomfortable.” 
He kisses you again. You feel your lips go numb, eyes lidding at the pressure you feel as he sinks his fingers a little bit deeper and begins to move them sluggishly, your slick creating another ring for him around his fingers. You try to meet his thrusts as the visceral sensation of being filled by longer, thicker fingers settles within you and takes roots. You discover that movement is the key to parting the uncomfortable feeling and it steps to the side to let the pleasure walk forward.  
Jungkook presses his palm flat against your clit, guides the pleasure to envelop your body when he plunges his fingers deeper, past the second knuckles and fucks you in swift jerks. Your mouth falls open in a silent moan and he fills in the sound, expressing his fiery delight for you at the clench of your walls against him, accommodating for him, for his desire to stretch you out, so when he finally enters you, no pain comes to greet you. 
Deeper and harder—yes, that’s what feels good. You roll your body, becoming waves of the sea as wetness and the build up of pleasure—seafoam—is all your senses wrap around. 
“Feels good, baby?” 
His need to check in with you speeds up the nearing expansion of your orgasm. Pointer and pinky finger digging into the skin of your backside, you watch the in and out motion, the digits coming out wetter and wetter each time.
“Feels so fucking good. I’m gonna come. I’m so close.” 
It’s quicker. Way quicker than your first tiny orgasm. He slips in and out of you so smoothly—you’re obsessed with the sight, ravaged by it entirely. You grind your hips and fuck yourself back, picking up the pace but slowing down instantly when you feel yourself at the peak of your climax.
You want to prolong it. You love the feeling too much to end it too soon.
Jungkook stops your movements fully.
“I want to be the one who makes you come,” he murmurs. “I want to be the one who fucks your brain out. I want to feel you squeeze around my fingers. Fuck, I want it so bad.” 
His hand drifts to your neck just to hold you there, the other, the busy one, fingers you harder, your fast approaching orgasm blinding your senses. Your drenched cunt squelches around him, the sound so lewd it causes you to seek comfort—your hand flies to his on your throat, fingers wrapping around his wrist, the tip of your pointer reaching the fat bulb of bunny’s head on his ring. 
Harder and faster. A scalding fire burns you and you just take it. Loll your head back against his shoulder, giving him the space to grip your jawline. Flames grow closer and closer, leaving a layer of sheen on your body in its wake. You feel the sudden need to pee.
“Oh my god, Gguk—” Your muscles tense. Close, so close. “Gguk, Gguk—”
“What, baby? What’s the matter?” he husks, squeezing your neck once. “You’re gonna come for me? Gonna come on my fingers?” 
You nod quickly, too quickly. Flames of the sun, licking you. Flames of the summer heat. Just what you wanted. 
Jungkook opens your jaw, swirling his tongue around yours. “Let go. Come for me. You can do it, I got you—I got you. Come for me, baby, please.”
Obeying his desperate order, you do.
A small stream of your pleasure, a faint fountain, trickles out of you and into his hand. He gasps, in unison with your whimpers, and you’re transmitted elsewhere. The wildly colorful, blooming meadow on a hill, overlooking the languorous sea and he’s there. Reaches behind himself. Offers you his hand. The wind ruffles his black hair, sweeps it back and you’re giddy—as giddy as Bam, as giddy as you were in the moment the slid the white bunny ring on your finger—to take the last two of his slender fingers, the pinky and the ring, and sit with him by the edge of the cliff. 
“Did so well for me.” 
The whisper takes you back and you awake. 
You’re different. Incandescent. Of life, of stars and its light, of growing fondness for the man you sit perched on the lap of, whose fingers still remain sheathed inside of you. He changed you. Perpetually, absolutely. He changed you and made you into something new. Something that is softer, more elegant—smaller but assertive. Alluring and kind. Indisputably good. 
He fucked everything negative out of you with his fingers. Left the vast canvas of stars inside of you.
You’re no longer a plain spread of cotton, but a living, breathing artwork. His artwork.
Once he fucks you with his cock, you wonder what further internal changes are going to occur within you.
You feel a great deal of gratitude for him—and you want to reciprocate all that he’s done for you. You want to work hard at it. Spoil him. Make him whimper. You believe he deserves it.   
“You finger yourself often? How come you took my fingers so well, hm?” 
You’re panting, unable to speak. Absorbing the sharpness of the stars, acclimatizing to the change. 
“I guess you do, huh?” he deduces. “Good little girl, preparing herself for me.” 
For the life of you, you can’t catch your breath.
Jungkook kisses your cheek deeply. Pecks you on the same spot a hundred times, slowly taking out his fingers. Lets you see your slick coating his fingers and, softly, you gasp at the little ripples of wrinkles upon the tips of his fingers, mouth parting.
And then he sinks them into your mouth. 
His hardness twitches behind you and you moan, your daintily bittersweet taste making your head spin. And when you look at him, you’re met with the utmost pink-dusted adoration painted on his face. You kiss it, inhaling it, letting it flow into your system so it suffuses your bloodstream, letting him taste you. You may not feel your lips, but the sentient poetry of the stars begins to sing in you. His stars. You feel like a flushed floweret visited by a bee. Spent, but happy. 
Happy to be wanted.
Good, because he said you were.
As if internally intertwined with him, you feel the identical heat tinge your cheeks. 
He says nothing as he lays you down and spreads your legs back to the way they were. Though when he’s graced with the sight of your bare cunt in all her glory, his face says everything that his mouth isn’t capable of. Hunger and torture—lips agape, corners of the mouth shiny with the rush of drool and Jungkook wipes it away, then lowers his fingers to your clit, to your lips, becoming more acquainted with this intimate part of you that no one had seen before him. He traces your small hole, even going as far as to your other, tinier hole and you yelp, stopping his exploration. 
Jungkook merely chuckles, eyes darting to yours. “You’re so pretty.” You grow so hot that you think you must be on fire. “Especially there.” 
You mewl, shrinking, hands looking for anything to hold and finding his bunny plushie. You take her into your arms, inhaling a scent that could never be hers. You recognize immediately whose it is. 
Musk, vanilla, wood. 
The thought of Jungkook cradling her while he sleeps moves you and you pout. 
“How we feeling?” he asks, still caressing your fleshy cunt, dripping with dew. 
Overjoyed. Overstimulated.
Heavenly.
“Good.” 
A foxy smile. “How many orgasms was that, hm?” 
You don’t know where your shyness comes from and why it chokes all of the words you want to say. You bury your face in bunny for a moment, taking a breath to fight against it, so you can please him because that’s all you yearn to do. 
You open your mouth, but no words come out. 
Jungkook stifles a laugh and it makes you feel terrible. And it’s worse when he leans over to kiss you, turns his head at the last moment and faces bunny.
“Bunny, how many times did she come?” he asks her, offering her his ear to hear her answer. Looks at you. Widens his eyes. Gasps. “Two,” he mouths. Listens some more. Nods. “I know she thought she wouldn’t come at all. Crazy, right?” Then he lets out an endearing sound. “She said she’d believed you could do it the moment you said it. She’s so happy for you. How cute,” he coos. 
You giggle, the bridge in your throat loosening, light flooding you, over and over, until you think you can’t take any more of it. You feel so full, so happy and the sensation threatens to pour out of your tear ducts. 
It heals something within you—that he treats you like this at your most vulnerable state. Your inner child flares, the stars the strength that fixes her stoop, helping her arise, stand straight, stand powerfully. 
He smiles down fondly at you. “So what number are we at?” 
You hide your face behind your hands. “Two.” 
“What did you say? I didn’t catch that.” 
You drop your hands and with as much energy as you can muster, you repeat the number. 
He purrs, caressing your cheek. “Good girl.” As a reward, as if the praise wasn’t enough, he kisses you deeply. “Will you let me taste you?” 
You swallow his desire, but speak up your own, “I want to taste you first, please.” 
Jungkook hums, curses under his breath. He straightens and kneels before your form, fingers pinching the back of his T-shirt and pulling it over his body. You catch the sight of his broad shoulders, of each dip and muscle, and your irises grown in width. Him ridding himself of his clothes dishevels his hair and as he untangles his arms from the material, he smiles down at you, noticing your stare. 
He caresses the back of your thigh before his hand flies to his hard length. He palms himself once, then continues to undress—tugs his sweatpants down to his knees, though he doesn’t bother himself to fully take them off. The shape of him is more prominent through the fabric of his white Calvins, the bulge of his mushroom wet and pellucid, and you sit up, hand itching to touch him, to join his in making him feel good, but he cups your chin—forcing you to look up at him. 
He swipes his thumb over your lips. “You want it?” 
You nod. “So bad.” 
Jungkook curses again, the sound low and rough. 
“Touch it,” he orders and both of your hands listen, wrapping around his girth, squeezing beneath the head of his cock. The thickness of him makes you see the light of the stars that you sense fluttering feverishly inside of you. Your mind is too empty, too washed out by your orgasm, by the change that you don’t even think about how you’re going to take him. Jungkook hisses, tilting his head back before he looks down at you intently. “You did this before?” 
You’ve never seen one in real life before, let alone touched one.
“I’ve never let anyone get this close.” 
Jungkook strokes your pigtails. “How come you know what to do then?” 
Instinct or memory from porn you watched—you don’t know, it all blends together within the fuzziness of your mind. And you tell him.
“I watch a lot of porn.” 
Jungkook smiles coyly and it strikes you. You’ve never seen him smile this way before or, even, feel this way before. All you know from him is dominance, dominance and dominance. 
You release him from the confines of his boxers and repress your gasp. His ever glistening tip reaches just below his navel and the thickness of his girth obscures most of his pubic hair. Along with the sound of your surprise, you also have a hard time swallowing the saliva collecting in your mouth. 
“I want you so bad,” you whisper, needy eyes looking up at him. Shy, too shy to let your gaze linger at the most intimate part of him. 
He sucks in a breath at your words, hissing. And you need him inside of you all over again. 
Fuck fuzzines in your mind. You’re fuzzy all over. Wrecked with nerves, suddenly. Your hands tremble, hovering in front of his manhood. Jungkook covers them with his, soothing you, and guides you to his shaft. Wraps your fingers around him. Doesn’t let go. 
The feel of him under his supervision is slow. He allows you to take in every ridge of him, every vein—the softness of his skin, the warmth and the weight. Round after round, up and down, until you get familiarized with him. A trickle of his male essence drips down the side of him and your tongue instinctively darts out. Like your hands, Jungkook’s breath shakes and he anticipates your next move, despite the fact he’s in charge. 
He’s been patient all this time, giving you the time you needed. But that hardly applies when you have him in your hands, when you own his neediness. His whimpers while he waits coax your slick out of you, soaking the bedding beneath you and you can’t take it anymore. 
Neither, evidently, can he. 
“Baby, please,” Jungkook croaks out. Tortured, so terribly tortured. Grip tight and clammy around your hands. 
So vulnerable. 
You ache. 
You lick up a stripe of his essence on the side of his cock and Jungkook shudders. Shifting onto your knees, you show him the milkie on the tip of your tongue and Jungkook pulls your hair, tilting your head back. Kisses you nastily, licking into your mouth. Moans, lowly. Then, he holds his girth at the base and pushes your head. 
When you take him, a mewl ripples around the thickness of him. His eyes roll back and his grasp of your hair tightens, burning your scalp, adding to the fire. He lets you feel it out; lets you figure out what to do, testing your knowledge from the porn you’ve watched. And the tensing of his stomach divulges his strained effort not to fuck your mouth. 
You go slow about it. Swirling your tongue around that rosy head of his, along that delicious ridge, licking a flat stripe across that line of his slit. Getting to know him in all those intimate places, relying on your senses—on them to tell you what he likes. Your hand begins to move on its own, gliding back and forth in tandem with your tongue stimulating his sensitivity. You try not to think about how you can barely fit him in your mouth, because if you do—you’ll ruin his bedsheets. 
But then Jungkook hums in approval, sending a gush of wetness out of you and you whimper—you whimper at the worsening ache you feel, at the helplessness that pools in your system by being just so filthily wet and horny. 
He moves your hand faster. Breath jagged, bedroom eyes zeroing down on you. And then—
Jungkook moans your name. Over and over, clenching and unclenching his hand on the back of your head. 
“Don’t have to teach you shit,” he spits. “You just watch porn all day, don’t you? Naughty girl.” 
Losing control for a split second, he rams his cock into your throat—and you don’t panic, you don’t yelp. Instead, you groan. 
He pulls you away from him with a sharp tug. Kisses you harshly. Shoves you down into the pillows with one push on your sternum.
Bending you in half, he drinks your cunt. Lips immediately suck on your needy bundle of nerves and it’s so fast you don’t even know which part of you he’s focusing on because he’s everywhere. Clit, hole, clit, hole—sucking, licking. Alternating, alternating so swiftly and deliciously that you completely lose your mind. 
And then he lifts your hips and holds them in the air, wanting you to see what he’s doing to you. Like you, he darts out his tongue and teases you, hovering the muscle above your clit. Shiny, nimble, capable of doing unspeakable things to you. He watches as your pussy drools for him and he chuckles darkly. Tongue lowering to collect it, but unlike you he never does it. He lets the dew trickle down your skin. 
“Cute little pussy. So wet. Wetter than when I fucked it. You liked playing with me on your knees, didn’t you?” 
With your fucked out brain, you don’t think it’s taunting what he’s doing. You deem it’s just him reveling in what he’s able to do to your body—in the fact that he owns it, that he teaches it new things. The glint in his dusky, lustful eyes proves it. 
Jungkook drags a long stripe on your clit, making your eyes flutter closed and your teeth to sink into your bottom lip to cage in your moans. 
“Talk to me.” 
You can’t. You don’t know how to talk. 
He stares you down. 
No answer from you. Just hard pants. Pussy drooling. 
“I won’t play with you, then.” 
Panic. “No.” 
He cocks a brow at you. “No?” 
Silence. 
He begins to lower you down but you grip his forearm. 
“Jungkook.” 
Bent over above you, head low, he merely flicks his eyes to yours. Duskiness, such blackening duskiness in those orbs. 
“Beg.” 
All your muscles tense. Wetness gushes out of you. 
Lucky for you, that word he wants is the one you haven’t forgotten. 
“Please.” 
“Please what?” 
You groan in frustration. 
“Be nice or—”
“Please, lick me.” 
That dark chuckle. You feel yourself becoming obsessed with it. 
“Where?” 
A challenge. Your throat dries up. 
“There.” 
He shakes his head disapprovingly, making a sound that expresses just how much he didn’t like that. 
“Try again. Last chance, little girl.” 
The loving smile on his face says everything about how that threat is feigned. You hear it tell you—you have as many chances as you need. He’s merely encouraging you to step out of your comfort zone. 
And something about that mellow, hidden kindness gently ushers you to do just that. 
“Lick my clit, please.” 
A hum. A long stripe on that sensitive, thumping spot. A roll of his tongue forward and backward.  
“Like this?” 
You choke out a moan. 
“Yes, please.” 
“Or—” He blows on you, causing you to tremble. “Like this?”
He shakes his head against you briskly, not yet at a full tilt. Just like his, your body shudders in his hands and he tightens his grip on your supple hips. You can’t take it, the pleasure is overwhelming and—
“Look at me,” he orders and you open your eyes, immediately. “Like this?” 
Jungkook adds more pressure and rapidness to the movement, leaving you glazed sweetly in the sheen of his saliva. He moves your hips up and down on the firmness of his tongue and you scream, taking a strong hold of his hair.
“Oh my god, yes, fuck, Daddy—”
Shocked, Jungkook groans against your pussy, slowing down to ingest what your mouth has just uttered. It’s more than natural to call him by a title like this, instinctual, innate. It fits him so well and it drenches your pussy, your slick amalgamating with his liquid love. You’re certain he feels the rush.
Your Daddy. 
You roll your hips against his tongue. Dark and more dark, those eyes of his. Bottomless pit.
“Fuck yes, call me Daddy again.” 
The whimpers you let out are pathetic and Jungkook shudders at them, groaning. You whine the title over and over again, a verdant, dreamlike litany of your feminine sexuality pampered, cared for, supervised. Jungkook accepts the gravity of it all, each declaration propelling him to suck your clit harder, bruises forming on your hips from his deathly grip, black eyes never leaving yours, hypnotizing you. 
And when you come like this, it’s unification what happens. 
You’re bound to him and he’s bound to you. 
Daddy and little girl. 
Throughout your sexual experience today, you had a hard time accepting things but this—this is something that slept inside of you all your life and just now has been awoken to a flickering canvas of bright stars. You feel it blink, adjust to the piercing light, before it smiles dolefully—happy to be conscious, happy to be caressed.
Jungkook kisses you and takes his time. The taste of your femininity, the fresh coldness of your change, the strong wine of his desire. You’re drunk. You’re slurring your mewls. 
And one thing about unification, it’s a mirror. 
You swallow down the same mewls, uttered by his throat. 
“Daddy’s gonna give it to you,” he whispers, adjusting between your legs. “Will be gentle. You’re safe with me.” 
He rakes the tip of his length along the entirety of your little sea-kissed seashell. 
“You want it? You want Daddy’s cock inside of you?” 
Jungkook looks into your eyes deeply as he asks you that question, the tip ready at your significantly smaller hole. He peppers kisses along your jawline and chin. 
“I’m scared it’ll hurt,” you murmur, brows furrowed. 
He kisses your cheek, the corner of your mouth. 
“We’ll chase the pain away,” he promises.
Your frown deepens. 
“But what if it doesn’t fit?” 
You expect him to chuckle, but he does no such thing. He absorbs your worry by kissing you tenderly. Then he glances at your body. Remembers he never took off your bra and fixes his mistake. 
“You may be small, but you were made to take me,” he says and your heart skips a beat; you wonder if he understands the gravity of his words as they take roots within you, rising to bloom into splendid flowers. “Besides, my dick is tiny. You won’t even feel it.” 
It is so far from the truth that you burst into giggles. He laughs along with you—a mirror reflected. 
Stars and flowers. Sea and freshness. You were made to take him. You trust him. 
He kisses your breasts, licking over your nipple—but briefly. Holding his shaft, he asks if you’re ready. You nod, your fingers desperately searching for his and Jungkook notices. Sinking slowly inside of you, he grabs his bunny plushie and tucks her into the crook of your elbow. 
There’s a pinch of pain, blended with the feeling of discomfort as your walls stretch around his head. 
Seeing it painted on your face, Jungkook draws close, enveloping you and bunny in his heat. Pushes a little more in. You wail softly, the pain intensifying. Fear intermingles with your features and Jungkook—the worry in his countenance makes you almost weep.
“Hold onto me,” he says, brows scrunched, so—so serious. “Relax, baby. I got you.”
You hook your arms around his neck, bunny sandwiched between your chest and his. Jungkook saves this time to let you adjust around him. 
“I know it hurts,” he whispers onto your mouth, index finger, the ringed one, stretching to graze your cheek. “Just relax your muscles for me. It’ll feel good soon.” 
You nod, trusting him. 
He pecks you. Smiles. 
“How many orgasms are we at?” 
You roll your eyes, your own smile threatening your lips. “Three.”
Jungkook hums. Pecks you again. You feel your walls loosening, little by little.
A smug smirk. “You didn’t expect that, did you?” 
“You obliterated my expectations.” 
“Just wait until I fuck you properly.” 
You blush, eyes twinkling. 
“Pretty girl.” He kisses you and you feel your attachment forming again, though this time—newly. As light, as free as an entanglement of seaweed upon seashore, you and him. Connected. Bound. No fear, not even a hint of it. “I heard you watch porn.” 
Your flush deepens. Jungkook sinks a little deeper. A faint pain—nothing bad. 
“Who told you?” You laugh, the sound ridding you of your shyness. 
But Jungkook grows solemn.
“Tell me what kind you watch,” he whispers, angling his head to give you a tiny kiss. 
Your cheeks hurt from the smiling, from the onrush of emotions within you, sloshing to and fro. You feel hot all over.
“The one where all the focus is on the girl,” you whisper back. “The guy uses all kinds of toys on her and she just takes it. Comes so many times and there’s a countdown for it.”
Humming, he begins to nibble on the skin beneath your jaw, making your breath shallow. He pushes in another inch—and the pain is worse. You tighten your grip around him.
“And how many times do you come when you watch it?” Deep, deep is his voice, the calmness to your nerves due to the pricking you feel. 
“I don’t stop coming.” 
Jungkook swears under his breath and clenches his digits into a fist beside your head.
“And you finger yourself?” 
You nod, confidently. Another inch. He smiles at your confirmation of his deduction.
“How many fingers?” 
You scoff. “Just one.” 
“Well done,” he praises, kissing you once, keeping his mouth on you even as he asks, “ready?” 
You nod, again, even though there’s fright to your eyes. He sees it and he brushes his eyelashes against your eyelids while he kisses you, taking it all away. And he doesn’t stop, even as he pulls out and thrusts back into your heat. Gently, so awfully gently. 
He didn’t break his promise. 
Jungkook rocks his hips in slow, sensual, prolonged staccatos, moaning into your parted mouth. You’re so focused on him—on the bulging of his muscles on the either side of your head, the broadness of his shoulders, the slick sweat dripping down his neck, right from the top of his tattoo; on the sheerness of his pleasure as he moves in and out, carefully so as to not frighten you, that the pain quickly subsides. 
And there you feel it. 
The sensation unlike any other. 
He rams into you, seeing the wrinkle between your brows smoothing, the lust clouding your eyes as the delight spreads all over your body, bringing along little dots of goosebumps. The night sea, windless, still hot from the afternoon’s goodbye kiss. You feel it—and you feel it deeply, sinking inside of you with every inch of his manhood. So much that you meet his thrusts. 
“That’s it, baby. Fuck yes,” Jungkook murmurs, enraging the waves within. “Feels good, doesn’t it? Being fucked?” 
Stars and its light. He picks up the pace, hooking your leg over his shoulder, entering you deeper and deeper, giving you more than half. The thrill of feeling so full—you curse, you moan, you can’t hold it in, even if you tried. And Jungkook coos at your conveyance of the pleasure he’s giving you, never lifting his eyes off of yours, off of your features, your emotions. Surveying you, controlling you, making sure you’re okay—more than okay.
You sense the pressure coil deep within your core, the sense of your climax approaching and you’re astonished at how quick it is. You halt your own movements, needing—wanting him to be the one to get you there, the one who owns your orgasms. 
“Gguk, Gguk, fuck—”
“I know,” he breathes. “I’m gonna make you come all over my cock.” 
He fucks you harder, making you cry out. Deep, deep staccatos, so different from the slow, languid ones. You can’t catch your breath, the sea within you sloshes violently and then—
Softly, you sprinkle him with your fountain of pleasure. Not enough to drive him out, but sweetly enough to force him to groan against you and pound you harder into the mattress. Continuing as if you hadn’t come. 
You don’t have the time or the space to think about what just happened—he fucks each and every thought of you. 
“My little squirter,” Jungkook mutters, kissing you. “One more, baby. One more for me and I’ll paint you with my cummie. Hm, you want that?” You’re gone, flung out of this world into a tranquil island. The palm trees, the sea and his cock. Your emotions are numb, body limp. All you feel is his cock, ramming and ramming into you. “Or you wanna swallow it for me like a good girl?” 
“Swallow, please,” you croak out and Jungkook makes a sound of approval. Rewards you by giving you the full thing, filling you balls-deep. 
“You feel me?” He kisses you, tugging your bottom lip with his teeth. 
Glorious, glorious delight. You can’t breathe. Too much. 
“I feel you—” You lift your head to look down where you’re connected. “I—I feel you in my stomach.” 
Sitting back, he lifts your hips and palms the bulge just a little bit above your mound. Feels it move under him once he resumes fucking you. He replaces his hand with yours, keeping you distracted as he undoes the ribbon in your hair and ties your wrists with it. Right there above the bulge, where he fucks you. Then he latches onto your hips and jackhammers his cock into you, watching as your tits along with bunny bounce with each slam. 
“You look so pretty like this, tied up for me, taking all that I’m giving you,” he says, thumbing your clit, making you cry out. “Such a good fucking girl for me. I’m bringing you up so well.” 
“Daddy,” you call out and Jungkook nods.
“Yes, that’s right. Daddy is fucking you so good.” 
White flashes. Seafoam. The pressure in your tummy deepening and deepening. The roar of the night sea and your body following—you come all over him, painting him iridescent with your dewiness. His joggers, dragged halfway down his thighs, his boxers are all ruined—pelvis, thighs and cock glistening. It’s such a beautiful image to you that it suffuses you with energy and you begin to speak. 
“Please, come for me.” 
Surprised, Jungkook chuckles. “Don’t you have orgasms to count down?” 
The ever persistent need for control. You kiss him, slip your tongue into his mouth to shut him up and you struggle against your ribbon, for the feeling of kissing him without your hands makes you feel iffy.
“Five. I came five times for you just like you wanted,” you whisper. “You fucked me so good. I’ll never forget it.” 
And it’s the truth.
Jungkook pecks you once deeply, humming into the kiss. He pulls out of you and whilst he strokes his cock, his fingers tug down the ribbon around your wrists. You take your place on your knees, gazing with awe and hunger at his shiny length. And as if he needed it, he plunges his fingers into your mouth for more lubrication. Then, grabbing your jawline gently, he pulls you in towards his cock, letting your lips play with his tip the way you like it as he jerks himself off. You flick your tongue under the ridge of his head and his length twitches, stunning you. You do it again, more rapidly, and you don’t stop until Jungkook begins to tremble. Pulling him inside your mouth, then out, flicking faster and faster. Repeat. 
Jungkook grunts. 
“Yes, like that, princess. Fuck, I’m gonna come for you.” 
He announces it, but it still comes as a surprise when the first rope of hot cum spills onto your flushed cheek. You suck him harder for a moment before you stick out your tongue, eyes flick up, as he empties his balls for you, his hand never ceasing the swift tug on his length. 
And he just keeps coming. Rope after rope. Liquid star after star.
And you swallow it all. 
Spent, sweaty and breathless, he helps you swallow it. Dragging his fingers to the places your tongue can’t reach, he feeds you his cum and you suck on his digits. Your heart thuds in your ribcage, especially when he begins to play with your tongue, smiling down at you in that dopey way. 
He pats you on the cheek once you show him you’ve swallowed it all. 
“Good girl. Good little princess.” 
That you are. A changed person for all eternity.
“Is your tummy full?” 
You nod, beaming vehemently up at him, the aftertaste of the bitterness of his liquid stars still wafting through your senses.
The three forbidden words rise in your tongue, even though you don’t believe them—you think it’s just the opulence of new emotions and experience that forces those words on your tongue. But they remain adamant when he bathes you clean, when he brushes your hair and gives you his clothes to wear to bed. They provoke you right there on the tip of your tongue when he gives you his zipper hoodie to wear on his balcony once you tell him you need a smoke and he joins you, giving you his pack of cigarettes. 
And they come off the edge, in a different form, when you tell him of how he changed you while you hold his hand and he caresses your damp strands with a cigarette propped between his index and middle fingers, kissing your cheek. The smoke fixes a makeshift halo around both of your heads. One body, one halo. Bound.
“You’re such a lovable person, Gguk.”
What you don’t know is that those mere words changed the entire trajectory of his life. Yours, too.
Tumblr media
© 2024 hoseoksluna, all rights reserved.
BACK to masterlist / read part one, read part two, part three
3K notes · View notes
midnightwriter21 · 11 months
Text
demon slayer hcs: motherly hashira!reader x the hashira pt 2
characters: fem!reader x muichiro, sanemi, mitsuri, obanai
AN: this is a pt 2 for the request from @danielle-marie
READ THE FIRST PART HERE
Tumblr media
MUICHIRO
I LOVE THIS BABY SM U DONT UNDERSTAND
he's the hashira that ur most comfortable around
he was a hashira before u
but u get promoted and its an instinct
child.
must protect.
at first he probably gets annoyed by you
he's not used to someone caring for him the way that u do
but then one day ur sent on a long mission
maybe a few weeks long
and he finds himself missing something
of course he has no idea what it is that he's missing something
he completely forgot about u
but when you get back to the butterfly estate and he sees u
it clicks
he remembers
he missed you
he missed your overprotective nature
he missed your soft caring voice
he missed the way that you brush and style his hair
he REALLY missed that ^
walks up to u, grabs ur hand and tugs u away
doesn't care if you were talking to someone
and doesn't say a word
brings you to his favorite cloud watching spot with a tight grip on your hand
makes you sit down
and lays his head in ur lap
stop im squealing and kicking my feet from the cuteness
Tumblr media
SANEMI
my guyyyyyy
have i ever told yall that i love him?
only in every single thing i post
anyways
he HATES you at first
lmfao rip u
your shy and quiet nature reminds him of giyuu
and if theres one person sanemi can't stand
its giyuu
therefore he don't fw u
and doesn't pay u much attention
UNTILLLLL
he witnesses u pulling genya by the ear to the infirmary after a mission
and telling genya tf off for pulling som stupid shit during the mission
+100 respect right there
not only are u actually talking
but ur screaming??
at his brother??
and taking care of him at the same time?????
my guy is lucky if he doesn't pop a boner right there lmfaooo
starts paying more attention to u after that
and is noticeably a lot nicer and calmer around you
will blush beet red and deny tf out of it if the other hashira comment abt his change of heart
but def develops a soft spot for u
Tumblr media
MITSURI
SWEETEST HUMAN BEING TO EVER EXIST EVER
she loves u
ofc she does she's the love hashira
but in mitsuri's mind how could she not absolutely ADORE u
not only are you breathtakingly beautiful in her eyes
but she sees the way u interact with the younger slayers
how u genuinely care for everyone's wellbeing
if she wasn't looking for a husband she would wife u tf UP
she still might lol
mitsuri is gonna go out of her way to become friends with you
she's inviting u to her estate for girl's night with shinobu
she's dragging u along to her favorite restaurant for lunch
she's inviting u to join her at the hot springs to relax
she really enjoys ur presence
even if ur shy she thinks ur very soothing to be around
she loves when you do her hair!!
and when u cook for her??
mitsuri alrdy eats a lot
but if u made the food for her??
girl is not letting a CRUMB go to waste
loves the way u take care of everyone
especially when u take care of her
10/10 would recommend a mitsuri
Tumblr media
OBANAI
someone pls love this man
he needs it so bad
so dude had SHIT parents
like bad bad
so when he sees ur interactions with the younger slayers he's prob a lil put off at first
like ma'am?
this is the demon slayer corps??
we don't have time for all ur mothering and coddling
but then he's injured on a mission
and waiting in the infirmary for shinobu to show up and patch him up
and then u bust through the doors???
confused asf
shinobu is on a mission and you've been helping out in the infirmary
so looks like ur the one taking care of him today
and turns out his injury is bad enough to land him an extended stay in his lil hospital bed
and after a few days of u taking care of him
with ur red face and soft stuttered words
he learns that you're not so bad
and he actually enjoys being around you
and being taken care of
won't voice this tho
but when Aoi comes in to give him his meds one day he gives himself away by accident
with a
"where's y/n?"
he's a blushing grumbling mess after that lol
after he discharged best believe the next time he gets injured he's not even going to the infirmary
he's hunting u tf down
nobody else gets to take care of him except YOU
and thats period.
6K notes · View notes
sansaorgana · 8 days
Text
— QUICK LEARNERS
Tumblr media
PAIRING — Na-Baron Feyd-Rautha Harkonnen x fem!Reader
SUMMARY — You're sent to Giedi Prime to marry your distant cousin and become the new Na-Baroness. However, your new husband seems to ignore you. You come up with an idea how to gain his attention and you ask one of the Generals from your homeworld to teach you how to wield a blade.
REQUEST — (1)
AUTHOR’S NOTE — While writing my fanfic "Forbidden Fruit" I was inspired by the mediterranean and islamic cultures creating the Reader's homeworld. This time I was inspired by my own Slavic culture but as usual – the physical appearance of the Reader is not described. 💘 I really like coming up with all these new planets! Also, I decided it makes sense for the world inspired by the Slavic culture to be related to The Harkonnens, therefore Feyd and Reader are cousins but they're distantly related (as most noble people are, I guess).
WARNINGS — arranged marriage, blood – the Reader is injured, slight incest (distant cousins), SMUT, oral, hints of breeding kink, Feyd is a bit ooc in my opinion but... so what? he's cute 🤪
WORD COUNT — 7,840
🔞 THIS FIC IS 18+ 🔞
ENGLISH IS MY SECOND LANGUAGE.
Tumblr media
QUICK LEARNERS
Your father, The Tsar, worked very hard to make this union happen. Baron Harkonnen had wanted his heir and nephew to marry one of The Emperor’s daughters but your father’s relentless visits, letters and arguments finally worked.
Your family was cousins with The Harkonnen bloodline. You were more used to their culture and you shared similar values. Of course your house was not as important as The Harkonnens. In fact, your planet was under The Harkonnen rule and your father only governed it in their name although his family had been allowed to keep their titles.
Giedi Prime was an industrial planet without any nature which was the opposite of your homeworld. Morana was mostly dark green – a never ending forest full of valuable resources. Sadly, most of them were being transported to Giedi Prime for nearly nothing in return. Your father was determined for The Baron to make it up to your people for all the centuries of colonisation and turn their Grand Duchess into The Harkonnen Baroness.
Your home world was supplying Giedi Prime with important raw materials and fearsome warriors that were known all over the galaxy as ruthless beasts in combat. Growing up in such an environment, you would easily adapt to Giedi Prime even though it lacked the greenery completely. You would make a much better Baroness than any spoiled daughter of The Emperor. Those were your father’s arguments at least.
So, you were sent to Giedi Prime with dozens of heavy wooden chests filled with your most precious belongings. Everything you loved, everything that was defining you – it had to fit in these boxes. You couldn’t take the forests with you nor the rivers, the songs of your people, the smile of your mother, the warmth of the fireplace. All you could take were the dresses and jewels, a few books. And a burden of the realisation how big responsibility had been placed upon your shoulders. To make your parents proud and to become a good na-baroness… and then Baroness. To give heirs.
You knew Feyd-Rautha from all the official ceremonies. You had never talked to him before, he would only greet you with a head nod and a word cousin in his low, raspy voice that was sending shivers of discomfort down your spine. A few times before you had watched him fight in the arena. He was an incredible warrior but his combats were for show which was disappointing for a woman from Morana – a planet known for its art of warfare.
You weren’t scared of him and you weren’t taken aback by his Harkonnen nature nor looks. You were used to The Harkonnens visiting your planet or you visiting theirs with your parents for official events and celebrations. However, you were not pleased with this union either. He didn’t seem to be a pleasant man and you didn’t like the responsibility that came with this marriage.
Tumblr media
Your wedding was grand. Every governor and leader of the planet under The Harkonnen rule was invited. Your dress was white, decorated with traditional red embroidery of your people. On your head there was a flower crown made out of flowers that grew on Morana. But seeing all the people around you, you quickly realised it probably was the last time you’d wear something white. No one around was wearing any colour except for black. The only white clothes you could see were the ones of the servants.
The wedding party was a display of power and violence but it wouldn’t make a girl from your planet flinch. You focused on the cake and tried to remember all the advice your mother had given to you regarding your upcoming wedding night.
She had been straightforward with you. A strong Tsarina like her would never hesitate or shy away. She had told you it would be best if you took your husband from behind so you wouldn’t have to look into his face. And she had made it clear that the marriage should be consummated. No matter how much it would hurt.
You observed your new husband with the corner of your eye but he looked the same as his wedding kiss had felt – bored and unimpressed. Cold.
Around midnight he stood up to leave the table without making any announcements. Panicked, you glanced at your new servant girls and they nodded at you. So, you stood up as well and gathered the fabric of your dress to lift it gently and follow him down the corridor.
He walked fast, you could barely catch up. His silence was heavy between you two. After all, you were his wife now – you were supposed to share a life together – but he chose to treat you like air instead.
When the doors leading to his chambers opened, you entered them right after your new husband. That was when he turned around as if he was surprised. He looked you up and down with contempt and you realised that he had not been pleased with this union.
Perhaps because you were not The Emperor’s daughter. Perhaps he wasn’t finding you attractive enough.
“Cousin,” he drawled as usual.
“Can you not call me that anymore?” You sighed.
“Wife,” you swore there was a shadow of a smirk on his face. But he didn’t say anything else and you felt helpless. You didn’t know how to talk to him.
You tried to remember your mother’s words. You weren’t there to have conversations with him.
“Husband,” you nodded your head at him and he watched with tilted head as you approached his huge black bed and bent over.
“What are you doing?” He snorted at you.
You couldn’t understand. You furrowed your brows and turned your head around. His sneering facial expression embarrassed you but you stayed in your position.
“Would you rather take me the other way around? I didn’t expect you to be a romantic,” you commented.
“I do not intend to take you at all,” Feyd shook his head. “I’m going to sleep. You do whatever,” he shrugged his arms and began to undress.
Clumsily, you straightened yourself and smoothed out the wrinkles of your dress. Once he was in his underwear, without a word he got under the cover and ignored you completely.
You watched in shock as he began to drift off to the land of dreams. You had no idea what to do. Not only you had humiliated yourself but also you had failed to consummate the marriage.
You crouched down and picked up all the pieces of clothing he had scattered all over the floor. Like a dutiful wife already, you folded them neatly and put them away on the chair by his desk. Then you removed the flower crown and your dress, thanking all the gods above that it was not a complicated piece because you had no idea how you’d manage to do that without your servants’ help. You tried to be as quiet as possible while doing that, not wanting to wake Feyd up and cause his anger.
Once you were in your linen underdress, you decided to just join him in the huge bed and go to sleep as well. You were laying as far away from him as possible as you didn’t want to bother him. It was no easy task because he decided to sleep right in the middle of it like he had forgotten already that he was married now and had to share.
You didn’t understand the situation you had found yourself in. When the small orb of light by your bedside turned off, you stared at the pitch black room as all your limbs tensed. You could hear Feyd’s soft snores and the distant sounds of your wedding party, the firework splashes of white ink in the night sky. Yet, you – the bride and the new na-baroness – just laid on the edge of the bed, feeling lonely and humiliated.
Tumblr media
The weeks passed and you remained Feyd’s wife by name only. You shared your chambers with him but he was always awake before you and in the evening you were often asleep by the time he would join you in bed. There were days when you weren’t seeing each other at all. He was busy with training for his fights but also with fucking his concubines. You had found out about all of them from your servant girls.
The most important ones were three scary cannibalistic harpies. The servants were terrified of them because they could end up as their meal any time. There were also other women in your husband’s life but they were regular pleasure slaves and they did not matter as much. With his harpies he seemed to share some sort of bond.
Of course. Now it made sense. How could you even compare to such creatures? However, you did not even want to. You just hoped Feyd would finally be reminded – by his uncle or the medic – that he had to fulfil his duties and produce an heir.
You felt lonely and rejected. Your duties were not many and you quickly realised that most of them were nothing but a show off – just like your husband’s fights in the arena. It was probably because you were a woman and a new addition to the family. The Baron would never actually put you in charge of anything important.
Your only companions were your servant girls. You grew attached to them but they were no friends. Not because you thought of them as less but because of their timid personality. They were terrified of The Harkonnens and they were often trembling whenever they spotted your annoyance. Such a dynamic could not be a base of any real valuable friendship although your heart was breaking for them.
They had told you that the people of Giedi Prime liked you. You were not like your husband nor his family and you looked different because of the pigment of your skin and your hair. Sometimes, to your new black Harkonnen attire you would add a jewellery or a flower crown from your homeworld. The citizens of Giedi Prime adored the additional splash of colour. You expected Feyd-Rautha to scold you for that but he did not. He seemed not to care at all about you and what you were doing.
You had tried everything to get his attention and to seduce him. You had started to wear more revealing nightgowns to bed but he would ignore you. You had walked in on him taking a bath on purpose – pretending it was an accident. He hadn’t even flinched.
You had been asking him things about Giedi Prime and The Harkonnen history – making a fool of yourself by asking him things you had known already. He would always answer dryly and coldly; often without even sparing you a glance. Then he would go on ignoring you.
You had tried to move closer to him in bed at night. Pretending to be asleep, you had adjusted your body slowly until your arms touched. He had woken up abruptly and moved aside, stealing the blanket.
You nearly gave up but there was one more idea you were thinking of. You wanted to share a hobby with your husband. It could not be sex because he refused to touch you, which made you feel so unattractive that you didn’t even think of flirting with other men to cause his jealousy. His coldness made you feel ugly.
No, his other hobby was the blade. And you sometimes observed his training and they always made you miss your home. On Morana the warriors would train day and night just like him. You had often observed them with your father as he was telling you grand stories. And perhaps you were a lady, but you were your people’s Grand Duchess and you could handle the blade. Or so you had thought.
You found one of the generals of The Harkonnen army who was from your homeworld. He looked different than the rest of them because of his longer, braided hair and tattoos on his face that were your people’s spiritual symbols. However, like most of the important military men from your homeworld, he had been sent to Giedi Prime as a young boy to be trained under The Harkonnens. Such boys were some sort of a tribute in the same way your natural resources were. All those years spent under the black sun had made his natural skin colour a few tones paler. But amongst The Harkonnens he still looked the healthiest.
“General Bohumil,” you approached him one day after watching him train with other soldiers. He was putting his blades away as he raised an eyebrow at you, surprised to see you wandering around this part of the fortress.
“Slava, Grand Duchess (Y/L/N), My Lady Na-Baroness Harkonnen,” he bowed down. You smiled at the way he addressed you as it brought back memories of your homeworld where you were addressed as The Grand Duchess and with the word slava meaning glory as a sign of respect. “What brings you here, My Lady?” He asked.
“I was wondering if you’d find some time for me,” you began, a little nervously as he furrowed his brows. “To train me.”
“Train you, na-baroness?” General Bohumil hesitated. He was looking for the right words not to insult you in any way. “What does your husband think of such an idea, my Lady?”
“I don’t think he cares about what I do at all,” you admitted honestly with a shrug of your arms.
He would never say that but you could see the look in his eyes. You were a spoiled and bored noble lady in his eyes and he’d only waste his precious time on you. However, he was too scared to say no. Your question was not a proposition, it was an order. That was the way of The Harkonnens and that was the way your father ruled on Morana, too.
“Alright, my Lady. I can show you the basics,” he nodded. “We can start tomorrow. But I warn you, you can bruise or hurt yourself,” he added.
“I am aware. Those are natural consequences of a combat, General,” you smiled at him. “I will find you tomorrow,” you nodded and went back to your quarters, very pleased with yourself.
Tumblr media
The first week of your trainings – and you had insisted on them to take place every day – General Bohumil was only making you stretch and prepare your muscles for the future extortion. No whining about it could cause him to change his mind. But after the first week you were finally given a blade to hold. It was quite short and light but very swift to move. The handle was wooden with your people’s spiritual symbols engraved on it. It was a traditional blade of the warriors from Morana and it made you feel so proud to be your father’s daughter to wield it. It made you feel as if you were home again.
You were also given a shield-like device that would protect you from hurting yourself or from the General hurting you in an accident. You noticed that he wore one, too, probably expecting you to clumsily wave the blade around and possibly cause some harm with it.
“Repeat the sentences after me, my Lady,” General Bohumil began to show you the most basic moves. You nearly rolled your eyes at how easy they seemed to be but you wanted to be an obedient student and to prove to him that you were not just a bored noble lady. You really wanted to learn.
He corrected your posture and the position of your feet as he lifted your elbow and then he began to show you the same sequence again.
You had many traits that were considered to be positive – it could be seen now, in the way you obediently performed your duties, how you desperately tried to make your marriage work and keep both of the families proud. You cared about your family’s honour, you were aware of the responsibility placed upon you. You would never sabotage your union; you were loyal and proud.
But you also possessed some traits that were considered to be negative – impatience was one of them. You didn’t want to keep repeating the same basic sequence a million times all over again, feeling like a child with a toy sword. You wanted to feel the adrenaline already like your husband when you watched him in combat or the warriors on your planet. Not listening to General Bohumil’s warnings, you started to spice up the sequence with the moves you had only seen in the gladiator arena before.
“My Lady, please, that is too advanced. We will get to it in the right time,” he sighed, trying his best to contain his anger. As a military man he was all about discipline and if you were a common soldier, he would lash out at you, you were sure of that. But you were his Grand Duchess and his Na-Baroness and he couldn’t even scold you. He could only calmly try to explain.
But you wouldn’t impress Feyd with the basic combat moves. You were sure that if he caught you now, he would laugh with contempt. No, you had to be better than that. And you hated to wait.
“This stupid shield,” you turned the device off as General’s eyes widened, “it’s distorting my view,” you whined.
“My Lady, please, turn it back on,” he pleaded. “Your eyes will get used to it after a few weeks of training, I can assure you of that.”
“A few weeks?!” You sneered. “When you talk to me using such long amounts of time, I get discouraged already. You think I’m not good enough to master this art faster than that?”
“It’s not about your personal skills, na-baroness, I assure you. Every man needs time to get better,” he swallowed thickly as he watched you play with the knife in your hand. “Please, turn the shield back on.”
Like a spoiled child, encouraged by the fact that your little hand tricks with the knife came easy to you, you took a step ahead and attacked him. In one swift movement he defended himself as he crossed his knife with yours but you could feel he was not using his full force.
You tried one of the tricks you had seen while observing the fights and you tried to quickly take a step back and attack him once again but straight into his ribcage this time. However, you were not experienced enough to try such a move and the knife clumsily slid through your hand. You hissed out of pain as it sliced through the leather fabric of your pants and through the tender flesh of your thigh.
The General’s eyes widened as he turned his shield device off and approached you quickly. You were in so much pain, you were gritting your teeth but you refused to let out a scream or to sit down. You didn’t want him to see you like this although the tears were already pricking your eyes and you could feel the warm liquid dripping down your leg.
“Na-Baroness!” There was a worry in his voice but he used a scolding tone, not being able to hold himself back anymore.
“Don’t even mention it. I know,” you drawled through gritted teeth. “It’s my fault, I know.”
He nodded his head, relieved that you were not blaming your injury on him.
“You’re hurt, my Lady. Let me escort you to the medical wing,” he insisted.
“No, thank you. I will go there myself,” you told him. “I will be back when it’s healed,” you added and limped out of the door as quickly as your pain allowed you, too.
You wanted to be alone so you could finally start crying out of pain, although you made sure to do it quietly. You were thankful that the medical wing was close to the training section of the fortress for strategic reasons.
Tumblr media
Your servant girls had picked you up from the medical wing. They had been looking at you as if you were crazy but they hadn’t dared to say a word. Your thigh was now disinfected and bandaged and your servants helped you to change into a nightgown as they recommended you to go to bed earlier than usual and get rest. They left you alone in your chamber and assured that they would be nearby if you needed them.
But you weren’t sleepy. You felt ashamed and humiliated as you kept overthinking your stupid behaviour. You knew one thing only – you didn’t want Feyd-Rautha to find out about this accident. He would think of you as weak and foolish… and he wouldn’t be wrong.
You were laying on the bed and reading a book, making sure that your leg was covered by both your nightgown and the duvet. When Feyd entered the bedroom – earlier than usual – you started to suspect he had found out about your accident and wanted to see with his own eyes. You pretended not to pay any attention to him but you watched him from the corner of your eye as you struggled to focus on the book. He sat by his desk and sighed while reading some letters that had been placed there in the morning and you realised it was his time to perform his na-baron duties as he was supposed to deal with the paperwork. He hated this.
Knowing that he was already angry at the fact that he had to answer the letters, you were trying not to bother him at all and you controlled your own breath so it wouldn’t be too loud. On the other hand, you had to admit that Feyd-Rautha had never aimed his anger at you… so far. You had known about his nature before and although you were not scared of him, you had expected him to get violent at times. That had never happened, though. 
Sometimes you wished it had. Because at least he’d react anyway to your presence instead of treating you like air.
Deep in your thoughts, you lost your focus and dropped your book with a loud thump sound on the floor. You froze and glanced at your husband’s shoulders. He stiffened and you quickly leaned in to grab the book, forgetting completely about your new injury as the duvet and your nightgown pulled up and revealed your bandage.
Once you straightened your back with the book in your hand, you noticed the exposed thigh and quickly covered it, hoping that Feyd had not seen it. You looked up and your heart skipped a beat at the sight of him staring at you intensely.
“What is it?” He asked with squinted eyes.
He talked to you so rarely that you nearly startled at the harsh and unpleasant sound of his raspy voice. You wondered if you’d ever get used to it.
“This? A book, dear husband. Something about the politics,” you chuckled nervously as you waved your hand, playing a fool.
Feyd stood up and approached the bed as you watched with terror in your eyes. He aggressively tossed the duvet aside and your skin got covered with goosebumps. He lifted up the hem of your nightgown and you hated to admit how electrifying his fingertips felt on your thigh. He had never touched you like that before.
“Who hurt you?” He asked after seeing the bandage again. His cold eyes stared into yours with a burning gaze.
“What do you care?” You asked and shrugged your arms. “It’s nothing,” you assured. “An accident.”
“I care,” he assured you but without any delicacy. “As your husband I am responsible for taking care of you and your honour,” he pointed out. “And as my wife you are my property. Whoever raises their hand on you, raises their hand on me and the Baronship,” he added.
“I did it to myself,” you bit on your lower lip and he tilted his head, visibly in disbelief. “If you paid more attention to me, you’d find out more things about me and you’d know by now that I tend to be clumsy sometimes,” you hissed at him and tried to cover your thigh again but he kept his hand there.
“I do pay attention to you,” he stated. “I observe you. I know when you’re lying,” he clenched his jaw. “Why are you defending the person who hurt you?”
“I’m not lying,” you protested.
“But you’re hiding something from me,” Feyd was relentless.
“Then we are only fair,” you put the book down as you looked at him angrily. “Your whole life is a secret kept away from me. Can’t I have mine?”
“Women on Giedi Prime do not have the same freedom as women on your planet do,” your husband reminded you. “A wife belongs to her husband in a way he will never belong to her.”
“What a relief then that I am not your wife,” you raised an eyebrow and he pursed his lips as he gave you a questioning look. “Because you have not consummated the union and refused so far to perform your duty and secure our bloodline.”
“You don’t know what you’re talking about,” Feyd snorted and looked away. “Stupid woman.”
“I do realise I am a disappointment to you. I am not one of the Imperial Princesses and I am not as interesting as your concubines. Not important enough, not attractive enough,” you decided to finally take your chance and tell him everything you had been feeling lately since it was the first opportunity to have some sort of conversation with your husband. He still refused to lay his eyes on you again. “I feel lonely, abandoned and rejected. Homesick. I want to be a good wife. I want to be a good na-baroness. But you’re not even giving me a chance. Out of boredom, I asked one of the generals to teach me how to fight and I hurt myself during training. Yes, it was pathetic of me. Go on, laugh. Make fun of me,” you encouraged him ironically. “At least it will be the very first reaction from you given to me in a long time.”
“Stop it! Stop,” Feyd-Rautha barked at you as he stood up and turned his back on you. He clutched his hands on the chair by his desk.
“Does the sound of my voice repulse you, too?” You asked, angrily. Now, when you finally let all these things out, you didn’t want to stop.
“You don’t understand!” He exclaimed and turned around to look at you with so much intensity that you curled up on the bed, feeling small and vulnerable. After all, he was a strong warrior and you were only a wounded prey. Like one of the rabbits in the forests on Morana, hunted by the hound dogs.
“Then explain it to me,” you whispered. “You owe me that at least.”
“I hurt everything I touch,” Feyd’s confession was sudden and it shocked you both. After a long while of silence between you two, he continued. “Just like him. It’s what this whole family is like.”
“I thought you liked to hurt,” you pointed out.
“Not you,” he answered nearly inaudibly. It was difficult for him to confess those things. You blinked a few times in disbelief.
“Why not me?” You asked, carefully.
“You’re supposed to be my wife. But I… I don’t know how to be a husband,” he looked at you again. You could swear that his sickly pale cheeks flushed slightly. “I was never… taught,” he explained.
“I didn’t expect you to be,” you admitted. “I knew life with you would be difficult. I knew you enough to know that. But nothing could prepare me for being… ignored. Completely,” you made your own confession as your heart pounded in your chest. You moved closer to him and reached your hands out, taking his gently and he didn’t even flinch. He just allowed it to happen, so you squeezed his cold fingers. “I am sorry I am not the wife you wanted.”
“It is not about that,” Feyd looked into your eyes. “And I do not ignore you. I let you be here. Sleep in my bed.”
“Oh, I didn’t know that was already a sign of affection,” you rolled your eyes.
“Protection,” he fixed you. “I don’t trust anyone here. They all work for my uncle,” he lowered his voice. “And as my wife, you are under my protection. If you want to learn how to fight,” he sighed and let go of your hands to sit on the edge of the bed again and reveal your bandaged thigh, “although I do not approve of that, from now on, it will be me training you. Do you understand? I don’t want any other man to teach you. I would never let this happen,” his fingertips brushed on your bandage and you felt a shiver go down your spine.
“I understand,” you nodded, trying not to smile too widely. Not exactly how you had imagined it but your plan to get your husband’s attention seemed to be working.
Feyd looked at your face again as his hand caressed your hair and cheek. You got startled at that at first but then you relaxed under his touch.
“I didn’t mean to hurt you. I don’t know how to act around… a wife,” he admitted. “All I know is that she should not be treated like a common concubine.”
“So that is why you prefer to be around them. Because at least you know what to do,” you pointed out and he nodded. “You could have told me that.”
He laughed at your words, grinning with that black smile of his. It made you chuckle, too, as you realised how stupid your words were.
“That’s right. The Harkonnens don’t talk about their feelings,” you guessed.
“Our what?” Feyd squinted his eyes at you as his face became serious again. “I don’t know anything about the arrangement between your father and my uncle. But the way you acted on our first night together, it made me realise you are not here by your own will. It brings me pleasure when my concubines fear me but I do not wish for my wife to be scared.”
“I’m not scared of you, Feyd-Rautha,” you assured him. “I have never been.”
He looked a little surprised by your confession.
“You admired me then,” he seemed to be proud of himself.
“I wouldn’t put it that way,” you cooled down his enthusiasm. “You annoyed me,” you explained and he gave you a scolding look. However, he was more disappointed than angry. “You’re a spoiled Harkonnen brat.”
“Look who’s talking. Like you’re not a spoiled little noble lady who decided she wants to learn how to wield a knife out of boredom,” he pointed out.
“I know, I do not deny. Perhaps we are not a bad match at all,” you giggled and his eyes sparkled again. “I’m not used to warriors cheating in the arena, you know.”
“He says it is not the time yet to show my real abilities,” Feyd explained himself quickly, a little embarrassed that you pointed out his cheating. Honour was important to him and it was his weak spot.
“In the bedroom as well?” You raised an eyebrow, surprising your own self with your boldness. “Perhaps you have not been taught about being a husband but you surely know what your main duty is.”
“You’re eager,” he smirked.
“I am not a concubine but I am a woman like they are. I have my own needs and desires. You do not make it easy, ignoring me after coming to bed late at night, smelling like fresh sweat, blood and leather,” you pointed out.
“I fuck like I fight,” he warned you as his pupils darkened. His face was now so close to yours that you felt his hot breath on your mouth and his eyelashes tickled your cheeks.
“Is that a promise?” You whispered.
“You have no idea what you’re asking for,” he snorted at you and you felt your cheeks heating up.
“You’re right. You have to show me,” you teased.
“No,” he moved back suddenly and you felt a sharp pain in your heart. He was so close… you nearly had him. “I don’t trust myself around you,” he admitted. “You will show me,” he told you as you raised your eyebrow.
“Me?” You swallowed thickly as his words.
“I’m yours,” he said. “Do whatever you wish with me. If a child is what you so badly want, to make your parents happy, to make my uncle happy,” he explained with a hint of sarcasm in his voice, “then go on, explore, have fun. At your own pace.”
Your heart skipped a beat in your chest as you realised that he was inviting you to initiate an intimacy between you two. You panicked as you had never expected that he’d want you to take a lead in the bedroom.
“I do not want to have a child to make anyone happy,” you fixed him. “Anyone but me. I want to secure our position on Giedi Prime,” you explained.
“So dutiful,” Feyd smirked.
“We share some values, dear husband,” you nodded and moved closer to him with a soft hiss as your injury reminded you of its presence.
“Easy, wife,” he watched you and you smirked as you put your arms around his neck.
“Are you sure you’re not doing it because you’re avoiding the paperwork?” You asked and pointed at the desk with your chin. Feyd sighed and you giggled. “I knew it,” you bit on your lower lip and sat astride him.
The first thing you did was to take off his shirt. You had observed his body many times before and the sight of his hard muscles had been the most delightful one. You tossed the shirt aside and gasped softly at your husband’s smooth pale skin. You allowed your fingertips to explore every crease, every bump, every vein and every tendon. Carefully, you leaned in and breathed in his scent as your lips softly brushed his shoulder.
His body was a work of art. Daily workouts and trainings were working miracles. He was strong and flexible. The sight alone was enough to make you feel hot. You began to feel the wetness between your legs as you allowed your fingertips to explore the upper part of his body. You tangled your legs behind his waist and moved your hands to his back, feeling the bumpy skin full of thin scars scattered all over. You had noticed them before but only now you gained the courage to ask him about them.
“Was it him?” You asked and Feyd nodded, carefully watching your reaction. But you didn’t flinch or make a disgusted face. You were sad about it. The scars were old. He had to be a young and scared boy once, tortured by his uncle to turn him into the ruthless killing machine he was now.
You leaned in to place a soft kiss upon his cheek.
“Turn around,” you asked and he looked unsure. “You said I could explore and play. I want you to turn around,” you repeated and he nodded, hesitantly, before moving away softly, making sure he wouldn’t hurt your injured thigh. Then he turned his back on you and looked behind his shoulder to see what you were about to do.
You put your hands around his waist and moved closer, still caressing the hard muscles of his abdomen, you leaned in and left a trail of soft kisses up and down his scarred back. From the short conversation you managed to have with your husband you quickly realised that what Feyd-Rautha had never known in his life was tenderness. You wanted to be the first and only person to give it to him. You were his wife and that was your job.
He flinched at the feeling of your soft lips upon his scars but then he relaxed. You lowered the hands resting on his muscular chest and put them on his hips as you shyly hesitated for a while before finally placing one of your palms on his crotch. Innocently peppering his back with delicate kisses, your hand started to massage his bulge through the fabric of his pants. He groaned softly and you froze.
“Don’t stop,” he scolded you.
“Don’t talk to me like that,” you took the hand away and moved back. “You told me I could do it at my own pace. I am not a concubine to order me around,” you reminded him and he turned around to face you again, surprised by your tone. “I am not a shy mouse, Feyd-Rautha. You seem to be aware that women on Morana have more rights. I was raised by a strong Tsarina.”
“Forgive me, I am still learning,” he answered with an amount of sincerity that left you speechless for a moment. As if he really tried to be a good husband.
“It’s quite alright,” you caressed his shoulder. “Lay down for me?” You encouraged and he nodded, quietly.
Feyd moved up on the bed to rest his head on the pillow and you crouched down, waiting for him to be on display for your needy hands. The fact that this terrifying warrior that nearly everyone feared seemed to be so obedient for you just because you were his wife was making you even more and more aroused.
“You’re beautiful,” you murmured as you caressed his chest again. “I mean it.”
“So are you,” he confessed as he looked up at you and you shyly lowered your gaze. “I mean it,” he repeated your words.
“I haven’t felt very beautiful lately,” you admitted.
“I didn’t know,” he confessed.
You didn’t want to talk about it now. You lowered yourself to his neck and sucked on the soft skin only to soothe it with a kiss right after. You went down with your kisses, making sure to leave it upon every inch of his torso before you finally found yourself facing his crotch. His pants looked very tight at the moment. Too tight.
Shyly but curiously, you unbuttoned them and pulled them down with his underwear, watching his hard cock twitching at the feeling of your hot breath. His size impressed you but also made you anxious. You helped Feyd to get rid of his clothes completely and tossed them on the floor before leaning in again.
You grabbed his length carefully as he hissed out of pleasure, trying not to think of all the concubines he had before you – concubines who knew how to please him way better than you did. You hesitated before placing a delicate kiss on the tip.
“Be patient with me, I am only learning,” you looked up, giving him puppy eyes. He was looking down at you with darkened pupils and haze in his gaze.
“Have fun down there,” he growled and threw his head back. You giggled and went back to the soft kisses and kitten licks as your hand pumped his length.
“I’m glad you didn’t take me on our wedding night,” you admitted. “This is so much more fun,” you squeezed his tip and he bucked his hip with a grunt as you watched the black precum leaking out.
You had been educated enough by your mother, servants, medics and all the explicit books you could find in the library. You smirked and licked him clean before lowering your head and taking him as far down your throat as you were able to. You kept yourself steady by holding his muscular thighs but when you felt his cock twitching a little, you let go quickly; your drool mixed with his thick black precum leaked down your chin. Feyd looked up with an annoyed expression on his face but he didn’t say anything this time.
“We can have more fun once I’m expecting. Now we can’t waste any of that, can we?” You tilted your head and pulled your nightgown up to your hips before moving up and lining his cock with your glistening pussy. You swallowed thickly at the sight of how hard and big he was.
“Take your time,” Feyd put his hands on your hips. “It’s a lot to take,” he bragged.
“Oh, so you think I can’t handle it?” You raised an eyebrow.
Just like when it came to wielding a blade, you didn’t like being told that you couldn’t handle something. You were an impatient lady.
“I am your wife,” you reminded him as you slowly lowered yourself. The feeling of his swollen tip brushing your clit made you shiver but you bravely kept a poker face on. “I was made to take your cock and carry your children,” you added. “No matter how big it is, I’m going to take it.”
Feyd winked at you and your heart skipped a beat at that. He could be adorable at times, you had to admit. It made you happy that you could finally experience this side of him. It was worth all the pain your injury had been causing you.
You lowered yourself some more, digging your fingers into his shoulders as he tightened the squeeze on your hips, surely bruising them, too. You hissed and shut your eyes as you threw your head back.
The pain mixed with pleasure, the overwhelming fulfilment with an endless desire to feel him even deeper, to fill you even further, to make you swell and heavy with his children. When you finally sat fully on his cock, you let out a moan of his name as your walls twitched and squeezed him.
“Easy, wife, take your time,” he reminded you. His hands were keeping you down, not letting you move for a while. He was giving you time to adjust to his size and you opened your eyes to look at him below you. You gasped at the admiration on his face. All those weeks of feeling unattractive suddenly vanished from your memory.
You were a daughter of your planet. Morana was known for its fertile soil like you would be known for bearing his heirs. You were his goddess at that moment but you didn’t feel the need to be cruel towards your subject.
“I want you closer,” you breathed out and he nodded, sitting up very carefully, making sure not to hurt you. Once his back rested on the pillow behind him, you clinged to his chest and joined your lips with his in a kiss as your hips began to move slowly.
Feyd’s hands moved your hips and helped you to find the right pace and rhythm. Soon enough you were bouncing on that big cock with ease that came with desire. Feeling that you didn’t require so much of his help anymore, one of your husband’s hands moved down and rested on your bandage. His touch was unusually gentle and you moaned into his mouth, not breaking the hungry kiss even for a second.
After all those weeks of being left abandoned and touch starved, you just wanted to devour him. Nothing mattered; certainly not your wound, not the sweat, not the exhaustion. Your only goal was to chase the high that was coming.
Feeling that your movements became chaotic, Feyd cupped your face and groaned into your mouth as his own hips picked up the pace, taking control over you. You trembled and let out muffled cries of pleasure as he rutted roughly inside of you through your orgasm. Not long after you felt his thick black cum spilling deep inside of you as both of your bodies relaxed.
You broke the kiss and tried to catch your breath. Your husband wiped all the tears off of your cheeks and laid your head on his shoulder gently. You hugged his chest and cuddled him like that in silence.
“Do you remember what you promised?” He asked and you furrowed your brows. “That next time you want to train, you’re coming to me.”
“Yes,” you smiled to yourself. “But I am only learning,” you added, shyly. “I don’t want you to laugh at me.”
“If you’re a quick learner with the blade like you are in the bedroom, then you will soon laugh at me,” he assured you and caressed your back as you giggled into the crook of his neck.
“You’re a quick learner, too, Feyd-Rautha,” you looked up as he looked down, confused. “How to be a husband, I mean,” you explained.
Tumblr media
You watched the servant girls painting your husband’s beautiful body with the black war paint as you caressed your swollen bump through the fabric of your dress. They finished their job and took a few steps back with their heads kept low. One of them handed you the bowl of the black liquid and you approached him as he smiled.
You dipped your finger in the paint and drew one of the symbols of your people on his chest. He looked down, questioningly.
“And what does this one mean?” He asked.
“It ensures good favours of the gods and victory in battle,” you explained softly.
“You know that he hates it when you do that,” Feyd reminded you. Baron Harkonnen would prefer you to become a Harkonnen and give up your old ways completely instead of teaching Feyd more about your culture.
“I know,” you looked up. “That’s why I do that.”
In the beginning you had been indifferent to his uncle but the more you found out about him and the damage he had done to your husband, the more you hated him.
Feyd nodded at you and leaned in to place a kiss upon your forehead.
“Na-Baron, five minutes,” one of the servants reminded him of the time left.
“I will bring you the hearts of my enemies,” he cupped your face as he looked deep into your eyes while making a promise.
“I have only one enemy,” you reminded him, “and he is not in the arena today.”
Feyd nodded quietly. He put his hand on your swollen belly and caressed it.
“Take care of your mother for me for a while,” he said and you chuckled with an eye-roll.
You watched him put the last pieces of clothes and take his blades. You couldn’t wait for the day when he’d become The Baron and he wouldn’t have to do it anymore. Even though the fights were fixed, you still feared for his life. And to think you had used to find this practice unhonourable. Now you were glad that his combats were cheated.
“Slava, Feyd-Rautha Harkonnen,” you blessed him.
He turned his head around for the last time to wink at you playfully and give you his black grin.
“I’ll be right back.”
Tumblr media
MASTERLIST
903 notes · View notes
igotanidea · 2 months
Text
Stuck: Anthony Bridgerton x wife!reader
Tumblr media
A/N: seriously, I almost titled this chapter "idiot" , XD (and that's also the spoiler alert XD)
part 1 to too much
part 2 : not enough
part 3 : almost there
***
One year ago
„When will you get those irrational thoughts out of your head Y/N?”
“What irrational thoughts?”
“About marriage out of love. No such thing exist in the world, my dear and if you do not start living in reality you shall become a spinster!”
“Mother!” Y/N’s eyes grew wide at the harsh and unjust words. She was still so young and to almost be called an old maid—
“Do not raise your voice young lady. You shall marry this season otherwise you would be putting our noble house in a very compromising position.”
“But-“
“Ah! Do not object your mother Y/N. You’ll do as I say. I know what’s best for you and you shall follow the lead. And that is precisely why you’ll accept when Lord Bridgerton proposes to you.”
“Lord Bridgerton!? Which one!?”
“The viscount, dear.” Her mother fluttered her fan imperiously. “Lord Anthony Bridgerton.”
“There is no possibility that I-“
“Hush!”
“Mother I –“
“You’ll say yes.” The tone of voice became much more commanding, leaving no space for discussion. It was like Y/N’s fate has already been decided.
“And why shall I? Because the viscount has decided he has enough pleasantries exchanged with modistes and actresses and other ladies free of the burden of the title. Because mighty Lord Bridgerton decided it is time to tie bounds with a young noble lady, who will be naïve and foolish enough to look at his antics without as much as a blink of an eye. Who will – dear lord – bear him an heir to the title and be the perfect little wife he would order around.”
“Y/N Y/L/N!” her mother raised from the chaise longue with cheeks flushed due to her daughter impertinence. “You will accept the proposal!”
“I will not!”
“Your father has already made the appropriate commitments!”
“Commitments!?”
“You shall be courted like a young lady should and get married in the fall.”
“Mother!”
“It has been decided. Now, you go and make yourself presentable. Lord Bridgerton has announced his visit in the afternoon.”
***
The visit was a disaster, to use the light words.
It was clear as day that neither Anthony nor Y/N were fully content with this arrangement and subconsciously tried to discourage the other. That way, when one of them would actually break it off, said one would be to blame for the disgrace, that would undeniably fall on both families.
However-
Despite some many character discrepancies they were both pertinacious and individualistic, ready to go the greatest length to have one’s own way. Neither of them was even thinking of surrendering easily.
Therefore, during his first appointment as a suitor Anthony was met with cold stares, minimum exchange of words and very noticeable distance on his future bride’s part.
Immediately matching the atmosphere and repaying in kind, only doubled in intensity.
Getting burned with the tea in response.
Causing a lot of havoc, many fake words of apologies and even more words of assurance that is must have been an unfortunate accident and he holds no grudge.
For obvious reason the time spend in L/N;s household was cut extremely short and Y/N was send to bed without supper to think about her erratic behavior.
Next few visits were no better.
Especially not the one when Anthony and Y/N were to reveal to a wide audience the nature of their acquaintance by strolling on the promenade, beaming with happiness due to their soon-to-be marriage.
“Dear lord, you are to be enthusiastic.” Anthony hissed in Y/N’s ear grabbing her arm with a bit more force than needed “Smile.”
She put on a fake grin when they were passing by some familiar face, but as soon as the woman was gone she turned to Anthony throwing daggers at him.
“Giving me orders already, Lord Bridgerton?”
“Hopefully you can be tempered if we start getting you used to it this early.”
“Oh! Perhaps it should be you to change the perspective my lord. See the real face of a lady you decided to meet at the altar?”
“And here I though your wonderful mother raised you better.”
“Do not dare speak of my mother the ill way!” she almost yelled, almost yanking her hand free from his grip, stopping the walk and challenging him to do something reckless.
“Forgive me.” He became serious in an instant and the words of apologies actually seemed honest. “You are right, I overstepped.”
“Thank you.” She responded with a deep sigh. God knows how much it took for her to stay calm. Regardless of the on-going conflict and differences in views between Y/N and her mother, the young woman would never let anyone offend her family. Not even Lord Bridgerton. And he should know that straight away.
“Perhaps we have started off the wrong foot, Lady Y/L/N.”
“I believe so. Seemingly we have a way to bring out the worst in each other, Lord Bridgerton.”
“Is that a way to tell me I have already seen you on your lowest behavior?”
“Compliments, Lord Bridgerton, you have endured my greatest efforts to cause you dispiritedness.” Despite herself she let out a chuckle.
“I am known for my endurance even in the least favorable circumstances.”
“I shall keep on my efforts, nonetheless.”
“I am deeply convinced that this will be the case”
***
Dearest gentle reader,
It has come to this writer’s attention that the affection between Viscount Bridgerton and young lady Y/L/N is in full bloom.
Despite the initial misunderstandings and noble behavior, that hasn't deceived any member of the ton, even if have been well played, recent news and observation has shown that maybe there's less pretending and more truth to it. 
Much to the ton’s discombobulation, young pair has been seen laughing together while the viscount resorted to courting in the way that resemble his late father and Lady Violet Bridgerton manner.
This writer daresay that no elite member would have ever do as much as dream of Lord Anthony Bridgerton picking meadow flowers for his chosen one while walking in the fields, away from prying eyes. Neither anyone would ever think about the forever dreamer lady Y/l/n actually so close to fulfilling her dream of marrying out of love. Irrational thoughts, as someone may put.
It is yet to be decided whether the on-going courtship between lord Bridgerton and lady Y/L/N will be a source of impending scandal in the society or whether those two will actually succeed in keeping this lovable atmosphere for following years.
After all – real love is not easily found and even less easily kept once the obstacles arise.
***
Now.
“You are to be enthusiastic.” Anthony murmured taking Y/N;s arm and bowing to the passing nobles “Smile.”
Those words brought back some memories and she couldn’t help but chuckle at the irony of the history that was in fact repeating itself.
“What is so funny?”
“Your memory does seem so be failing my lord. Won’t you remember the last situation when you told me to express my happiness and contentment to the ton?”
“I—” Anthony cut off, letting out a deep, frustrated sigh.
“Seem like you do after all.”
“Y/N…”
“Been a while since I had to pretend I was content though, given the fact that I truly was, of late.” The hint of sadness and melancholy was not to miss and did not make it easier for Anthony to pursue on the apologies he was tirelessly pursuing.
“Y/N…”
“Good job on choosing the right name since the person, whose hand you are now holding for display seem to be too much for you, my lord. To say the full truth I am fairly surprised you chased me here instead of focusing on spending time with one of your-“
“Don’t you finish that sentence.”
“Oh, I shall not, god forbid. I shall keep the pretenses as any lady married into a good family will.” She send the brightest smile to some kids that were running around, preached by their parents, holding her walls up.
At this point, mockery and distancing herself from the entire unfortunate events, if not fight, was the only way to prevent the emotional and mental breakdown and falling into tears. She was hurt. She was deeply hurt on a level she never thought existed. Anthony’s behavior hit precisely in all the sensitive spots, leaving her overthinking and wailing inside. Reminding her of all the years in her family’s household, being forced to act according to the standards, which she constantly broke, defying all the rules of ossified society and paying a heavy price for being herself despite the odds.
Being called too much, constantly.
Until she met Eloise, which was freeing. Y/N could finally feel like herself, spending a lot of time with Bridgertons.
And then meeting Anthony.
And actually creating a happy story with him, believing she would once and for all be free of the typecasting and tag putting.
But he started behaving in the same way to which she was exposed her entire life.
Too much.
Not enough.
And it made her angry.
“Please do forgive me for not easily being shaped in the wife you want me to be.”
“Shaped? I never wanted you any different!”
“Is that so?” she raised an eyebrow teasingly and it got her furious glance of her husband’s and the tightening bruising grip on her wrist. “you’re hurting me. Again.” The emphasis put on the last word actually made Anthony realize that he was not made of stone, but the words he wished to say were not coming easily.
“Y/N…” he clenched his jaw. She was mocking and challenging him even now, when he was trying to admit he was wrong and trying to apologize for the wrongdoings.
“Yes, my lord?” she took a step back, smiling in that light way that made him even more furious.
 “I believe you wanted to spend time on an intellectual conversation with my sister. Forgive me-“ he bowed in a distant manner reserved for strangers rather than spouses “-for being as impertinent to interrupt ladies’ time. I shall withdraw and leave you to continue on your – surely important- exchange”
And with those words, much to the shock of not only Y/N, but also Benedict and Eloise, who were still following them, Anthony bowed again and started walking away, raising clouds of dust due to the speed with which he rushed off from the place where he left his beloved wife.
Feeling the weight of failure and heartbreak on his shoulders, without a single way to make up for his mistake and keeping the face of a viscount at the same time.
Convinced that she hated him and there was no way to regain her favor and affection.
next part (finale!) : Just right
@pietrawebster @chrissisheadisinclouds @fuzzym4m4 @gloomysel @urfavnoirette @dd122004dd @milkbummm @bevstofu @taniasethi @syraxnyra @christinabae @pandoraneverland @bevstofu @topguncultleader @jana-jaeynneee @myaa21212121 @ziarah @cat-lockwood @leaf-rose-thorn @elissanatok @lily3450 @nervousmumbling @budugu @frickin-bats @sillyfreakfanparty @amberpanda99 @nycthophiliaa @myaa21212121 @bananaadeleigate @everybodystaycalm @fmhcatt @sankareatheundead @cat-lockwood @1potato2rulethemall
1K notes · View notes
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes