#weird frog

[tamvmat]

"Can I keep him?"

Ink drawing of a totally regular normal frog

[cattern]

On my end absolutely not he annoys me but I’m curious about y’all

[omgwhatchloe]

[1001aus]

AU where Danny has spent a very long time in the Infinite Realms for one reason or another (time travel work for Clockwork, Ghost King business, fled Earth for some reason, decided he didn't jive with living under capitalism, realized he wasn't aging, whatever).

On his first trip out to the living world where he actually interacts with living people, he drops into a reality where the Justice League exists and gets curious about the Watchtower. It's definitely Earth technology, but it's way different than anything he's seen them build before. How cool! He has to check it out.

He gets intercepted. Danny's first introduction to the Justice League is Green Lantern, Superman, and Martian Manhunter. They're friendly enough when they realize he's just curious.

In the course of talking, his abilities come up. Danny talks about his ice and the time powers Clockwork started teaching him after AGIT.

Then one of them says something along the lines of "and you can fly."

Danny gives them a weird look.

"...and I can walk?"

Which is about the moment that they realize that, not only has Danny assumed that flight is normal for them (since all of the people he's met since showing up are capable of it), but he could have any number of abilities that he considers not worth mentioning.

[dutchs-blog]

Frog Bakes A Cake 🎂

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[welcometoamphibia]

[markscherz]

My mother and I have two masters degrees between us and yet somehow we could not figure out if frogs have lungs or not.

Can you help settle the debate?

All frogs have lungs except one! The bizarre Barbourula kalimantanensis is the only known frog to lack lungs. It makes up for this by being heckin' flat, basically imitating the bizarre pipids.

[amnhnyc]

Snoot boopers, this one’s for you! Meet the duck-billed tree frog (Triprion spatulatus). Found on Mexico’s Pacific coast, this species inhabits altitudes of up to 1,640 ft (500 m). Arboreal and primarily nocturnal, it feeds on invertebrates including crickets, grasshoppers, and spiders. Scientists have observed this critter using its shovel-like head to plug the openings of its burrows, guarding itself while it rests inside, which is why it’s also known as the shovel-headed tree frog. 

Photo: magazhu, CC BY-NC-ND 4.0, iNaturalist

[chetzale]

The best character in Scavenger's Reign

[nurssieee]

tearing up because of this guy. not because of his angsty character arc or anything im just looking at him. hes so fucking silly. i hate him. who gave this dumbass turtle the right to infiltrate my brain and mess with it. autism is winning again

[musubiki]

my best friend is the main character

[jimhenson-themuppetmaster]

[viveela]

Playing together as real friends

[dutchs-blog]

Helping Frog Move Into There New Living Room

[princessofwhiteshadows]