doing a better into post since some stuff has changed
I'm Ray, I'm a minor, I'm a boy, I'm from poland
I use he/him pronouns
I'm bilingual (polish&english) and I'm learning german and japanese
I'm neurodivergent
sideblogs: @artsss3ray @shark-spotted
platforms: my spotify, @/rosees3ray on everskies and pinterest
my favourite band ever is Wolf Alice (<333)
my favourite book ever is Solitaire by Alice Oseman
my favourite movie ever is Alice in Wonderland (dir. Tim Burton)
my favourite shark is the pyjama shark
I'm a child of Urania and a Ravenclaw (not much of a HP person tho)
I like sharks, music, reading, tea, drawing, skateboarding, old technology, cars, movies, flowers, astronomy, plants and posters
I'm interested in linguistics and languages overall, if you have any fun facts feel free to tell me!
I play the drums
I skateboard
I'm a dad of 7 children (plants) and one dried rose bouquet
I collect CDs and buttons
I have a dog, her name is Sara
my Best Friend is @ray-of-midnight-storm <333
my other good friends/favourite mutuals include: @mothmonsterr @sleepy-vix @a-wondering-thought @trolliworms @us-costco-official @myconidwitch and many others not mentioned here
fandoms include: dead poets society, good omens, osemanverse, riordanverse, spiderverse and many many more (feel free to ask me anything)
my favourite musicians include: Wolf Alice (ofc), Radiohead, Queen, Lamp, Alex G, Hozier, Blur, Gorillaz, Phoebe Bridgers, Taylor Swift, bôa, The Cranberries, Conan Gray, David Bowie and many many many maaaaaany more
27 notes
·
View notes
౨ৎ
evan rosier. he/him. 6teen. @bartythebabygorljr forced me to go on this but its quite nice, actually.
⋆˙⟡♡ thanatolgy; forensics sciences; taxidermy; witchcraft
@panda-is-pan is my twin sister and the other half of my soul
@reg-can-swim very interesting guy. would call him a good friend
@cas0meadows good friend too. girlboss and gossip
@bartythebabygorljr well. my best friend. sadly
this is an rp blog, if you dont like this type of things please dni
(main is @sleepinginmygrave)
23 notes
·
View notes
this is my poetry side blog !
hi, I'm kay <33
main blog where i just vibe: @jamespotterbbg
23 notes
·
View notes
·▫▫ᵒᴼᵒ▫ₒₒ IᑎTᖇO ᗯᕼOO ᴼᵒ▫ₒₒ▫ᵒᴼᵒ▫▫·
ᑎᗩᗰE : 𝙹𝚘𝚗 (𝚑𝚎/𝚝𝚑𝚎𝚢)
ᗩGE : 𝚖𝚒𝚗𝚘𝚛 (𝚞𝚗𝚍𝚎𝚛 18)
SᑭEᑕIᗩᒪ IᑎTEᖇESTS : 𝚂𝙿𝙰𝙲𝙴, 𝚌𝚘𝚕𝚕𝚎𝚌𝚝𝚒𝚗𝚐 𝚒𝚝𝚎𝚖𝚜, 𝚜𝚌𝚒𝚎𝚗𝚌𝚎 𝚏𝚒𝚌𝚝𝚒𝚘𝚗 𝚗𝚘𝚟𝚎𝚕𝚜 𝚊𝚗𝚍 𝚜𝚑𝚘𝚠𝚜 (𝚑𝚒𝚝𝚌𝚑𝚑𝚒𝚔𝚎𝚛𝚜 𝚐𝚞𝚒𝚍𝚎 𝚝𝚘 𝚝𝚑𝚎 𝚐𝚊𝚕𝚊𝚡𝚢 𝚜𝚙𝚎𝚌𝚒𝚏𝚒𝚌𝚊𝚕𝚕𝚢)
OTᕼEᖇ IᑎᖴO : 𝚝𝚛𝚊𝚗𝚜𝚖𝚊𝚜𝚌, 𝚙𝚘𝚜𝚜𝚒𝚋𝚕𝚢 𝚊𝚞𝚝𝚒𝚜𝚝𝚒𝚌, 𝚊𝚛𝚘𝚊𝚌𝚎 , 𝚏𝚒𝚕𝚕𝚎𝚍 𝚠𝚒𝚝𝚑 𝚊𝚗𝚡𝚒𝚎𝚝𝚢 𝚊𝚝 𝚊𝚕𝚕 𝚝𝚒𝚖𝚎𝚜
ᗩᗪᗪITIOᑎᗩᒪ : 𝙰𝚋𝚜𝚘𝚕𝚞𝚝𝚎𝚕𝚢 𝚗𝚘 𝚊𝚋𝚕𝚎𝚒𝚜𝚖, 𝚝𝚛𝚊𝚗𝚜𝚙𝚑𝚘𝚋𝚒𝚊, 𝚑𝚘𝚖𝚘𝚙𝚑𝚘𝚋𝚒𝚊, 𝚛𝚊𝚌𝚒𝚜𝚖, 𝚜𝚎𝚡𝚒𝚜𝚖, 𝚝𝚑𝚎𝚛𝚒𝚊𝚗𝚙𝚑𝚘𝚋𝚒𝚊, 𝚝𝚎𝚛𝚏𝚜, 𝚛𝚊𝚍𝚏𝚎𝚖𝚜 𝚘𝚛 𝚊𝚗𝚢𝚝𝚑𝚒𝚗𝚐 𝚝𝚑𝚊𝚝 𝚒𝚗𝚟𝚘𝚕𝚟𝚎𝚜 𝚑𝚊𝚝𝚛𝚎𝚍 𝚘𝚛 𝚍𝚒𝚜𝚌𝚛𝚒𝚖𝚒𝚗𝚊𝚝𝚒𝚘𝚗 𝚘𝚏 𝚜𝚙𝚎𝚌𝚒𝚏𝚒𝚌 𝚐𝚛𝚘𝚞𝚙𝚜 𝚘𝚏 𝚙𝚎𝚘𝚙𝚕𝚎.
✩₊˚.⋆☾⋆⁺₊✧✩₊˚.⋆☾⋆⁺₊✧✩₊˚.⋆☾⋆⁺₊✧
✩₊˚.⋆☾⋆⁺₊✧✩₊˚.⋆☾⋆⁺₊✧✩₊˚.⋆☾⋆⁺₊✧
𝚃𝚑𝚊𝚗𝚔𝚜 - 𝙷𝚊𝚟𝚎 𝚊 𝚗𝚒𝚌𝚎 𝚍𝚊𝚢 :)
20 notes
·
View notes
I'll probably add more to this post later but I just wanted to get some sort of intro out
16 notes
·
View notes
Welcome to tumblr's own AITA!
The askbox is currently: OPEN
Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:
YTA=You're the asshole
NTA=Not the asshole (the other party is)
JAH=Justified asshole (you’re an asshole, but like, I get it)
NAH=No assholes here (everyone is some level of justified)
ESH=Everyone sucks here (you're all assholes)
INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)
Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)
20K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Hi, New People?
For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)
Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!
So, here's your chance to escape, if you so choose.
Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as
Canada geese.
Like... a LOT of Canada geese.
Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.
But, because I can't be bothered to make myself a consistent "brand," I also make
Very Gay Comics.
I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.
I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.
Lots more on that soon.
Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get
Canada geese
and
Very Gay Comics.
Cool? Cool.
799 notes
·
View notes
She’s just like me fr
885 notes
·
View notes
Welcome to Ordinor Ultor!
You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME.
15 years ago, your Liege had your parents executed for a plot they had no part in.
Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.
But one day, your Liege goes too far, and wrongs one of your siblings - personally.
You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.
Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).
Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.
Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?
Interact with your friends and family, possibly including your foreign cousins.
Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?
Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.
Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.
Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.
I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said...
DEMO BY APRIL 29TH MAY 3 2024
I hope everyone enjoys!
518 notes
·
View notes
You're dead.
Or, at least, you should be.
You remember what it felt when the bullet pierced your chest, the blood rushing out too fast, too much to stop.
The man in red smirking above you.
And yet, here you are. Alive. Safe in bed.
One week before the day of your death.
Redo; Rewind is a story about time. Of an ordinary person working an ordinary office job. Sure, you might work for an info broker and, sure, you sometimes (often) commit acts of corporate espionage for said job, but that's just business.
This is something far beyond that ordinary life.
Time travel. It seems you of all people are capable of it. To manipulate time and bend it to your will. It may not be something you asked for, but you need it now more than ever.
Someone wants you dead. And they've already succeeded once. You can't allow it to happen again.
(Please note that Redo; Rewind is currently rated 18+ for depictions of violence/death, references to drug and alcohol use, explicit language, and heavy themes.)
Play as a customizable MC! Choose your MC’s appearance, gender, skills, and more!
Romance, befriend, or antagonize any of the 3 romance options.
Learn how to master your time control ability and use it to your advantage.
Avoid past mistakes and inadvertently come up with new, much worse ones!
Try not to die. Again. And again. And again...
Victor/Victoria Zhang [M/F] - Your boss and owner of VZSystems, the front for their true work as an info broker. Clever, professional, and cold—a classic business major. That's how they appear, anyway. Having worked for them for sometime now, you know that, despite their intimidating appearance, they hide a much softer side underneath. Will you maintain the status quo as employer and employee, or will you cross the boundary set by your positions?
August Astaire [M] - Hitman, assassin, whatever you want to call him, the man's a killer. That much is clear after he put a bullet through your chest. But is that all there is to him? As arrogant and cruel as he seems, you can't help but wonder if there isn't more to him than meets the eye. Maybe if you play your cards right you could even turn an enemy into an ally. But, even if he plays for your team, how much can you really trust him?
Amara Ingram [F] - Your coworker of about two months now. You don't know her well yet, but she seems genuinely kind, with a good sense of humor and a sharp mind. Since being hired, she's quickly earned her place, proving to be an invaluable asset with her skill in engineering and programing. Undoubtedly, someone you're glad is on your side, but could your feelings for her extend beyond the professional?
[Demo] - Available Here! (Last update: March 23rd 2024)
[ROs] - Additional Details Here!
667 notes
·
View notes
Project DARK is an 18+ character-driven SPY IF inspired by a rather eventful weekend binging on Mission Impossible movies. It can be described as Suicide Squad meets Mission Impossible. MC, a retired villain, will be a new operative in a team to bring down their old best friend.
You were a jewel thief and hired mercenary, outsourcing your skills at thievery and espionage for all types of...shady characters. Yeah, you were aiding in the possible destruction of the world in exchange for money, but details, right?
You were the best in the business alongside your partner, Spider. You're not supposed to get close to people in this business, but Spider somehow weaseled into your life and became your best friend.
But then they died, killed by operatives of Mission Shadow, the one organization that has been hunting you down since day one. You decided to retire, changing your name and identity in an attempt to make an honest and private life of what you have left.
Until Project DARK finds you.
Project DARK: an experiment to put the most together the most skilled shadow villains to train and defeat the biggest threat they've faced.
Your best friend, whom you thought was dead.
They need you and your skills. You know Spider best. No longer are you the villain, but a Project DARK operative joining as the newest recruit to the ranks.
Good luck.
Customize your operative from appearance, personality, gender identity.
Tailor your past: were you a merciful villain, or a merciless one? Did you make enemies or try to make friends? Liked for being kind and easy to work with or hated for being the literal worst?
Romance members of your team or your target, with some having special relationships.
Choose what kind of operative you'll be and shape the dynamic of the team.
Try not to fall into old habits and get sucked into the dark world of crime. You left that life for a reason.
THE TARGET | Spider [m or f]: your old best friend and the new target. They've been busy since their 'death' and have grown a network of connections that can dismantle the world as you know it. They're apparently planning something big. Big enough that the organizations of the world created Project DARK to take them down.
Special romance: can have had previous thing with them that was never confronted or simply have been best friends.
THE LEADER | Elias/Elena Steel: one of the best operatives, personally recommended by MI6. The only non-villain on the team, E is also appointed leader and doesn't like you much, considering the fact that a mission of yours ended with their closest partner dead. While you may have not pulled the trigger, E blames you all the same.
Strict and as cold as steel, it makes sense why E is the one with the team on their shoulders.
Special romance: enemies to lovers. E hates your guts.
THE SECOND IN COMMAND | Nick/Nina Sharma: second-in-command and a retired illegal weapons dealer, N is, surprisingly, E's closest friend. N has long given up that life, but before their new work as a operative, you knew them as a distant associate. You two have crossed paths on multiple occasions, most of them happening with them almost killing you or vice versa. N can't help but be nice, but you can tell they're not really a fan of you.
Special romance: may have had a lapse in judgement and have had a one night stand...or multiple.
THE BRAINS | Zane/Zena Omari: One of the most skilled hackers and a familiar face on the FBIs most wanted list, Z is on the team in order to be able to go back home without getting arrested. Oddly enough, they're not what the media says they are. Friendly, warm, comedic. Z seems to be having too much of a good time, even with the circumstances surrounding their presence.
THE WEAPONS EXPERT | Luca/Lucia Cruz: L doesn't know you much, and doesn't care to. Hyper-focused on the mission, L's disinterest in you is a breath of fresh air. You don't know what they did and how they got here, but you do know they were facing a life sentence. Still, things aren't always what they seem.
Maybe it won't stay that way.
1K notes
·
View notes
👥DEMO 👥 PLAYLIST 👥 PINTEREST 👥 COG FORUM
You keep having the same dreams over and over. It happened, years ago, before you left. You thought you had left Eastend behind for good.
It seems you can never truly escape your past. The Priest had warned you.
There's a girl you've never seen in your dreams. Yet, she seems so familiar - as a forgotten teddy bear you left in the attic of your home. She feels right, she looks wrong, she's wrong. Because she's not you, she says. And the two of you stand on the road...a bright light blinds you but the smell of iron reaches you. You do not need your eyes to deduce the ending of the nightmares.
Metaphorical dreams have never been your forte...except this is real. On the day you arrive, she's still alive. And smiling...laughing...walking with her friends. She looks like a normal girl of your age.
You black out - from the shock you think. The familiar iron smell being all too close, it makes you nauseous. At least, the earthen scent that lingers on your clothes counters it a little.
Why are you in the woods again?
....Why is there blood on your hands?
Welcome home, whispers the wind.
• Customize the vessel whether be it in looks, personality or identity.
• You are free to romance four of the cast. Maybe more, there are many eyes on you.
• Your choices will shape you as they shape the town. They will have consequences on the people around you and those who aren't anymore. Be careful you never know what effect the ripples may have.
• Explore your past to shape your future.
• Fight your nightmares should you be so inclined - or welcome them, there might be surprises in the deep dark part of your mind?
• Choose whether or not you'll doom your childhood town - although, that might not be left to you. Leaving is an option too, after all, you've already left once.
• Survive - or don't. You didn't think you were the only one who could save them, did you?
Eastend is rated 18+ for sexual themes, substance use, explicit language, explicit violence, death and more.
Beverly Arevalo [F,23], your childhood friend. At least, one of you perceived it that way. She has always been difficult to read and understand, you were one of the few who could years back. Maybe you can rekindle your friendship - maybe it will grow into more. The only thing you know for certain is that there are many unknowns surrounding Beverly.
Aina Valen [F,26] is that stereotypical preppy girl, at least what you know of her. You were never quite close when you still lived in town, but things have changed and so have both of you. Surprisingly enough, she works at the library now, having taken over her brother. You're not aware of what happened between them, only that she seems overly bored whenever you pass by the vitrine. At least she insists on telling you you are the 'spice' of her days, whatever that may mean.
Benjamin Li [M,26] his preferred nickname, Benji has always shown kindness to you and this didn't change with your unexpected return. He somehow always has a nice word for you or others in his vicinity, it's refreshing quite frankly. There are always critters following him around but they say animals are good judges of characters so that's a good sign, right?
Hezekiah Lyncroft [M, 24] was always a pain in your ass, even younger. Always arguing with you over anything and nothing, he was the reason for many headaches. Back then, there were rumours about his home life, ones you remember well. At least, he seems to be in a better place nowadays, even though he's still a pain to be around. But not all pains are bad.
+ familiar faces and strangers you've yet to meet
Demo stands currently at 5.8k words. It is meant as short introduction to the setting and story. Hope you enjoy despite the length :)
502 notes
·
View notes
you're a wanted person. that isn't new to you, but after years of working, someone. no. something is after you.
you were taught by the best, your mother, she was an amazing woman but she was too trusting and in the end, that was her downfall. you won't make that mistake. you're a killer, but a righteous one. you kill those who deserve it, the disposable.
with your abnormal abilities, of which only twenty-five percent of the population is gifted with. you can succeed in what she was never able to do, rid the world of sinners.
you work for the slaughterhouse, a bar... with a dark side; in a rowdy part of the city. your mother was the owner but she didn't pass it down to you, she passed it your younger twin siblings. she believed you were far too talented to sit behind a desk, dealing with paperwork.
you've traveled all over the world, exterminating. you've claimed plenty of people, but perhaps this time you went after the wrong one. having no other choice you flee back home, but you aren't safe there either, you never are.
play with a customizable mc [gender (male or female), physical appearance, personality, sexuality]
protect those you care about or turn your back on them when they need you.
romance, befriend, or make enemies between any of the sixteen characters. four gender selectable, six male, and six female.
decide what supernatural ability you were gifted with; telepathy, telekinesis, or teleportation [figure out how to develop it and what other ability you have]
define your mc's signature weapon, fighting style and overall skillset; how you feel about killing, and the supernatural abilities you were gifted with.
this story is rated 18+ for sexual themes, substance (drug and alcohol) use, explicit language, and violence. [more themes might be added later]
the tattoo artist [male or female] [ro] wren price – partner in crime. they've been by your side since you can remember. always with a bright smile and cheeky remarks, you can't think about how your life would look without them. though they act differently with others, more serious, with a glint in their eyes you can't quite figure out. they never look at you like that.
the bodyguard [male] [ro] theodore price �� the older brother of your best friend. there's no doubt in your mind that they're related. he's protective over you, although you can't hold that against him as that's what he does for a living. protect people. he's hard to get to know on a deeper level and you can't help but wonder what's going on in his mind.
the detective [female] [ro] rori hayes – now, if you weren't yourself, perhaps you could have been friends with her. but unfortunately for you... she's extremely suspicious of you and set to bring you to justice. she's recently been promoted and she cannot afford to fail, not when her family is counting on her.
the chief deputy sheriff [male] [ro] charles butler – good ole charlie, you're acquainted with each other. he can't say he isn't a little impressed with you. but you're endangering the citizens of his city and that includes his little girl. he may not have any evidence on you but you need to be brought down, and he's going to be the one that books you.
the model [male] [ro] julien ripley – son of the sheriff. he always looks uncomfortable with his own father. he’s never talked to you before and you’re almost positive he has no opinion on you. he’s a very well known face, although you can tell he doesn’t like being stared at and overall talking to anyone. *male mcs only
the journalist [female] [ro] sloane campbell – she's fast alright and always seems to know your moves. too bad she isn't on your side. always trying to announce to the world, where you are and what you're planning to do next. good thing she's overlooked at her job, consistently being handed stories that, even you know, aren't going anywhere.
the bartender [male or female] [ro] hale/hart vaughn – a family friend, and your sister's best friend. with their tantalizing words, they don't know the meaning of being serious. they are quite insufferable and you can't seem to be able to get rid of them. you have a feeling if you did, your own sister would come after you.
the florist [female] [ro] paris graham– at first glance she doesn't appear to be anything special, but that would be wrong. she's a firework waiting to explode and you want to be there when it happens. her work doesn't suit her but you have a feeling, that being a florist isn't all that she does. *female mcs only
the apartment owner [male] [ro] nolan adams – he knows about you and what you do, but he doesn’t give off the feeling of someone who’d go running to tell. you’ve always come back to lay low at his apartment complex when you need to and as long as you pay on time he doesn’t care what you do.
the actor [female] [ro] ophelia wylie – a face from your past, one you can’t say you particularly enjoy facing again. she seems remorseful for what she did to you, in fact she looks like a completely different person and she’s offering to help you, but for what in exchange… after all, no one gives anything for free.
the crime lord [male] [ro] louis foster – of course you’ve heard of lou, you’d be an idiot if you didn’t. he's tried and failed to recruit you and he never fails. you’ve been warned before, it would be a mistake to make an enemy out of a king.
the informant [male] [ro] vincent sutton – it’s rare to ever see him out, only ever seen accompanying lou. if you had the ability to feel fear, you’d fear him. he shows every sign of being against you, but then again, it seems as if he does that to everyone around him as well.
the chef [male or female] [ro] mateo/melanie olsen – you see them quite often, as their restaurant is one of your favorites. they always serve you with a smile and if they do know you, they play oblivious. they're just happy to have a customer who enjoys their food.
the doctor [female] [ro] eileen yates – serene and calming, a voice who always knows exactly what to say. she may look innocent but she’s far from it, you’ve known her for years yet you don’t truly know her, for all you know eileen may not even be her name.
the accountant [female] [ro] felix price – the youngest of the price siblings, she helps out with all the money coming into and out of the slaughterhouse. she’s always been compassionate and reasonable. you can't imagine her hurting a fly.
the rival bar owner [male or female] [ro] kinslee dean – they own a bar just a couple streets down from yours. it’s always been a problem and they’re actively trying to shut down the slaughterhouse. but they’re surprisingly level-headed and want to 'handle' this problem with logic.
the owner of the slaughterhouse [male] archer – your younger brother, he’s honestly kind of a mess. he was not ready for this responsibility but he’s trying. the mischievous boy you grew up with, you don’t know where he is anymore.
the owner of the slaughterhouse [female] iris – your younger sister, she’s always been loud and bold. but she’s changed too, she’s calm and collected. she’s trying her best to help her brother along too.
the sheriff [male] lazlo ripley – a pompous man with nothing else to do but terrorize those he thinks are inferior to him.
DEMO [Coming Soon]
warning: this story is still under development, all elements are subject to change!!
633 notes
·
View notes
INTRODUCTION / MASTERLIST - MARKSTER666 (18+) ♡
⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。
Hello everyone! I'm a 20 year old psychology student with a love for writing. Welcome to my one and only writing (and shitposting) account. I have a hard time sticking with one fandom, but I mostly write reader inserts being paired with canon characters. I do take requests as well! Please check my bio to confirm that requests are open.
A lot of my content involves mature subjects and I strongly advise anyone under the age of 18 to steer clear from my profile.
MASTERLIST:
Last Updated: 2/29/24
Total Works: 22
Hazbin Hotel:
SFW:
Alastor:
Every Thought, You. (Alastor x Fem!Reader)
Alastor Reacting To Stereotypical Activist Gen Zer
NSFW:
Alastor:
Breeding B*tch (Alastor x Fem!Reader)
Tentacles (Alastor x Fem!Reader)
Cleanliness Is Next To - Oh Wait. (Alastor x Fem!OC RP Thread)
Good To Be Back On The Air! (Alastor x Fem!Reader)
Kinktober Day #1: Dry Humping (Alastor x Fem!Reader)
Kinktober Day #2: Face F*cking (Alastor x Fem!Reader)
Kinktober Day #3: Begging (Alastor x Fem!Reader)
Kinktober Day #4: Masturbation (Alastor x Fem!Reader)
Kinktober Day #5: Daddy Kink (Alastor x Fem!Reader)
Kinktober Day #6: Overstimulation (Alastor x Fem!Reader)
Kinktober Day #7: Praising (Alastor x Fem!Reader)
Kinktober Day #8: Sound Kink (Alastor x Fem!Reader)
Kinktober Day #9: Mirror Sex (Alastor x Fem!Reader)
Kinktober Day #10: Orgasm Control (Alastor x Fem!Reader)
Kinktober Day #11: Face Sitting (Alastor x Fem!Reader)
Kinktober Day #12: Lingerie Kink (Alastor x Fem!Reader)
Kinktober Day #13: Deep Throating (Alastor x Fem!Reader)
Kinktober Day #14: Roleplay (Alastor x Fem!Reader)
Kinktober Day #15: Food Play (Alastor x Fem!Reader)
Kinktober Day #16: Car Sex (Alastor x Fem!Reader)
Kinktober Day #17: Toys (Alastor x Fem!Reader)
Kinktober Day #18: Uniform Kink (Alastor x Fem!Reader)
Kinktober Day #19: Morning Sex (Alastor x Fem!Reader)
Kinktober Day #21: Unprotected Sex (Alastor x Fem!Reader) -I skipped #20-
Anybody (over the age of 18) is welcome to show up in my dms and chat with me or put in a request! I don't bite.
It is NOT guaranteed that I will do your request nor is it guaranteed that I will do it quickly. I get writing blocks sometimes or I just genuinely can’t think of a good plot for your scenario yet but I’ll try my best.
SMUT / NSFW REQUESTS ARE ONLY CONSIDERED / ACCEPTED IF YOU HAVE CONFIRMATION THAT YOU'RE AN ADULT ON YOUR PROFILE. THANK YOU.
I have a pretty screwed up mind and will write about a lot so really, throw a prompt at me lol. I will also NOT do oc x oc, character x character, and character x oc.
FANDOMS
Helluva Boss
Hazbin Hotel
Five Night's At Freddy's
Harry Potter
South Park
SAW
WILL NOT WRITE (LIMITS):
P*dophilia
Scat / Pee / Vomit play
Female on Male Domination
N*crophilia
(If you have a taboo topic you want me to write about but I don't have it listed, feel free to ask!)
Vore
Thank you so much for visiting my blog and I hope I can hear from some of you soon!
⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆⋆。‧˚ʚ♡ɞ˚‧。⋆
553 notes
·
View notes
Intro
DEMO | 2 chapters, 80K words
In the underworld kingdom, where demons fight for survival against the abyssal monsters, you are just an Oracle. In the distant past the Oracles were at the top of the demonic hierarchy, but those golden days are long gone. You did what you were most afraid to do and now sit under arrest in the royal palace.
When the Abyss sends you a vision of a terrible disaster that will happen in the future, you make an inevitable “deal” with the Sovereign to try to change the future and improve your abilities, not only to become stronger and learn more about the coming disaster, but also in an attempt to achieve mind stability.
However, what has been happening to you since you received the vision makes you think that you are already slowly but surely losing your mind.
Will you be able to maintain your sanity and help others protect the kingdom, or will you become just another name in the long list of Oracles gone mad?
This is an interactive fantasy story with a heavy focus on friendship and romance (with strangers to lovers or enemies dynamic). The story is rated 18+.
Content warnings: violence, death, loss of sanity, trauma, possible sexually suggestive/sexual content, and more (the full list is in the demo).
Customize your Oracle: pronouns, traits, and appearance. Choose your full ✨ demonic form. ✨
Decide what you do for fun. Do you sing, dance, paint, play a musical instrument, or write?
Deal with the old friends who let you down.
What you did cannot be undone. Your reputation forever ruined, how will you handle the public’s new attitude toward you?
Learn more about the Oracles’ past and what truly drove their royal clan into ruin.
Maintain your sanity. Depending on your choices, you’ll either move closer to loss of control and madness or further away from it.
Decide what fate awaits you. You’ll have to make an important decision that will open two very different paths for you, influence the plot’s progression, and your relationships.
Will the victory be sweet?
✨ Vezriel, The Sovereign (m / f)
They have dark brown skin, long curly black hair, and black eyes with pale white flecks. Tall and of strong build, Vezriel cuts a robust but elegant figure, usually dressed in beautiful robes.
Vezriel seems a perfect ruler: they’re smart, calm, patient, know moderation, and always put demons’ well-being first. But you’re not so naive as to think this is their real face—many secrets lurk under the golden shell of the nobility. You never thought of meeting them in the past, but now spending some time with them is inevitable. Perhaps you will find out what lies beneath their mask?
✨ Osara / Osaron, The Heir (f / m)
They have warm brown skin, long wavy black hair, and silver, almost white eyes. O is tall and strong, their expression impassive most of the time, which makes them rather intimidating and unapproachable to some demons.
Vezriel’s only child and heir, O is their Chief Counselor, and they have a consistently good reputation. Their character reminds of their parent, though O is much more cold and reticent. Nothing seems to touch or shake their emotions, despite the known long list of ex-lovers. You don’t need their attention, but the circumstances have put you right under it. What will you make of this opportunity?
✨ Lazarus / Lazaris, the General (m / f)
They have beige skin, short/medium-length wavy blond hair, and golden eyes. Many small and big scars can be seen on their hands. L is tall and has a strong build. Despite their high station, they seem friendly and laid-back.
L rose from the bottom of the ladder and made a name for themselves, though judging by old rumors, their clean background wasn’t always so clean. They’re charismatic and popular but keep others at a distance—everyone except their friends… and you. L treats you especially well, but you’re not foolish enough to blindly play their game. What do they want from you?
✨ Ashmedai, the Royal Healer (f / m)
They have pale skin, long straight black hair, and bright red eyes. A large scar runs on the left side of their face, from their forehead along their eye and to their chin. Ash is tall and slender.
Ashmedai was sent to observe your condition after the incident and to help you with mind stability if needed. They performed their duties without showing any displeasure or impatience no matter how you behaved. Ash is secretive and reserved, and you guess their restrained temper is connected to the dark rumors surrounding them. Will they open up to you?
✨ Azarias / Azaria, the Royal Musician? (m / f)
They have pale skin, long white hair, and black eyes with narrow silver pupils. A tattoo of a snake with flowers curves around their neck. Az is tall and lean.
Ash’s younger sibling, Az somewhat resembles them in appearance, but their characters couldn’t be more different. Az is bold, humorous, and fickle. They know everyone—and everything about everyone—and enjoy a special favor from the Sovereign, which has allowed them to retain their place in the royal palace for many years. You’re concerned about their peculiar attention to you because there’s no reason for it—you two have never met before. Or… is there a reason after all?
468 notes
·
View notes