OK correct me if I'm wrong, but I feel like the main 'yin/yang' parallel with Atsushi and Akutagawa is not something like 'this one is bad but secretly has a good side and this one is good but secretly has a bad side'.
I feel like it's more about 'who they are at their core vs who they choose to be'.
At his core Akutagawa is kind and at his core Atsushi is not. But despite this Atsushi tries every day to make the kinder choices and I love him so much for it. He has to work so hard to be good.
He wants to be a bitch SO bad I know he does but he tries his best to help people and be nice (sometimes he fails but that's OK <3)
Atsushi doesn't always WANT to help people, a lot of the time he's selfish and scared, but he does help people anyway. He keeps helping people over and over again. There's still some selfish motivation to it, and his initial motivation for helping people was because the headmaster told him that's all he was worth, but overall he does care about the people he helps and it weighs on him if he fails to save them. And of course, as the series goes on he starts helping people more because he can rather than because he feels like he needs to.
In Akutagawa's case, he's still capable of being kind but his environment led him into being someone who chooses to hurt people. But he's always been a protector at heart. In the start he was bad compared to Atsushi because he was choosing to hurt people and keep the cycle of abuse going. Just like how Atsushi developed in why he saved people, Akutagawa starts to get redeemed when he chooses to not just act on his rage. Not only does he start to spare people, but he speaks more kindly to them (apologising to Higuchi and telling Kyouka he's proud of her). It all culminates into the moment he chooses to help Atsushi and sacrifice himself for him, going back to his core value of being a protector. Even when he's finally revived, he keeps this role in his new position as Aya's Knight.
I kind of see the streaks of white in Akutagawa and the streaks of black in Atsushi not as their 'hidden sides' but as their fundamental selfs. That's who they are at their core, and their main colours (black for Akutagawa and white for Atsushi) are how they're presented to everyone else and how they try to have people see them as.
730 notes
·
View notes
hello!
i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).
i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.
my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.
bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.
okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)
String identified:
cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt
Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39
Common name: Marsh pennywort
(image source)
571 notes
·
View notes
hang on. I just need to talk about quinn's autograph for a minute because i have so much appreciation for the effort and intention he puts into it. (also i love linguistics/language/writing and how people sign their name is actually very interesting to me)
Been thinking about this (x) article from 2021 (and also very much demko saying "thoughtful" for his one word to describe huggy at the nhl awards this year. demmer u don't understand the implications of what you just said).
teammates chirping quinn for being a slow at signing because it's not a scribble or an unintelligible flourish...but he straight up doesn't give a fuck what they think because HE wants HIS signature to be easily distinguishable for FANS. like the awareness of how special that stuff can be for people. 💙 antoine agreeing that "you should always be able to tell the name without the number." YES!!! YOU GET IT!! (don't get me wrong, there can be iconic autographs that aren't legible whatsoever but idk. to me it's something about how it's a name and i'd like to be able to read it. it's so personal and a scribble doesn't feel personal).
i wanted to see how his signature has changed/progressed over the years, so i dug around a bit to see where he's landed at this point. let's back up to the beginning!
2018 (screenshot from this vid) -
huggy's first official nhl signature!!
his draft day signature shows he's still fully spelling out his first name. it also looks just very. teenage boy who can't do cursive.
BUT the elements are already there - heavy on the Qu, the Hu, (new nickname Q-hoo? like yoohoo? no? fine.) and the s. starting to stylize the gh.
*side notes: Qu is such a rough first letters pairing rip... it's a distinct shape. printing Q doesn't flow easily into the u while cursive Q is ugly (in my opinion) and idk if a lot of people actually know what a true cursive Q looks like (hint: it looks like a 2). also, "quinn" is hard just because it's SEVEN vertical elements back to back. i honestly think doing it in cursive requires more focus than printing. hughes is fun because it has the high and low elements right next to each other, which he emphasizes.*
2019 (nhl debut) -
oh boy. sill very choppy. still have those main elements of emphasis happening.
i feel like he probably hadn't started worrying about his signature yet (this was his first game, to be fair).
not a lot of connectivity (especially in Hughes)
the n has hints of what it will become later, though, which is cool to see!
2021 (from article)-
only writing Quinn now (only one dot for an i). maybe to speed it up, maybe just bc that's the nickname he goes by, maybe both.
seeing the connecting line/stroke between the g and h more prominently
s is looking more stylized as well
i think he's picking up the pen a fair amount still (maybe up to 8 or 9 strokes in this one?). so yeah, i'm sure it took a while compared to others...
2022 (from this silly vid)-
this is kind of not a 'true' signature to me bc 1) given the nature of the video i kind of doubt he would have put 100% effort into it (complete lack of stylized s) and 2) you can tell the surface/pen combo isn't great - see the jaggedness on the gh?
this is the most ~scribbly~ version i saw. like i said, idk if i really count this one but i don't want to dig around forever to find a confirmed 2022 signature
regardless, he seems to have sped it up and is better at the cursiveness aspect. Most of it is connected - i'd guess 5 total strokes for that version.
2023 (from wallpapers on the canucks' insta)-
definitely more committed to a "look"
Qu is kind of aggressive lol and the gh stroke isn't super smooth either. HOWEVER it is 100% a stylistic element he focuses on. also it's fast to connect them, so it probably feels pretty natural. just needed more practice on keeping that stroke aligned.
officially no dotting of the i anymore - just swooping up high (again, probably helps with speed)
we have the fully stylized s! i'm actually very fond of that part because lots of people will let the last letters fall to the wayside and basically just draw a line. he's kinda doing that a smidge with the n. but there's intention on the s and it looks very nice!
2023/2024 (from canucks' wallpapers & inhousemade insta)-
here we have our latest iteration
I reallyyy like the finishing on the n - it matches well with how he does the s, which is so pretty. such a fun letter to write lol
i think the gh line has been fully mastered at this point. and it's a good way to keep his signature legible but still give it a unique flair. not everyone's signature/name has that type of line so ppl can pick his name out rather easy i would guess.
i think huggy's probably settled on autograph style/look at this point. but i will still keep an eye out to see if he decides to try a new element!
thanks for reading and hopefully you found this mildly interesting ☺️
241 notes
·
View notes
Link, Captain of the Royal Navy of Hyrule.
Mer!Wars
Name: Link Mand'el Waræ
Nicknames: Captain, Wars, pretty boy, playboy, Mr scarf, holey pants...
Age: 24
Height: 1,83m (6ft)
Occupation: captain of the ship The Hyrule Warrior
~~~⛴️~~~
Summary
Link Mand'el Waræ, the young captain. Son of the head of the Hyrule port captaincy, link had his name marked in the history of the Hyrule navy for assuming the position of captain at the age of 19.
Because of his affiliation, many doubt his competence, believing that the position was given to him due to political corruption, but Link never lets himself be shaken by such rumors, always willing to prove that he is worthy of the captain position.
~~~⛴️~~~
Personality
- Loves to tease his companions, especially when it comes to women
- He likes to maintain his appearance by always being tidy and formal (legend says it's narcissism...but it's just ocd due to his military position)
- He is proud, self-assured and may sound arrogant but is kind and has a good heart.
- Because of his pride, he doesn't like to be questioned especially when he is acting as captain, but he always pushes down and tries to be open-minded to different opinions.
158 notes
·
View notes