Worth It
Pair: Mingyu x f!reader
Genre: Smut smut smut. Pwp. Fiancé!Mingyu, established relationship. 18+ only (MDNI).
Summary: Basically what happens when you tell Mingyu you’re his for the whole night.
Warnings: Mingyu in a white button down (this deserves a warning, yes), pwp, slight soft dom!Mingyu, very brief mention of dying but more as an expression, marking, oral (f. and m. receiving), unprotected piv sex (stay safe, children), wall sex, fingering, hand job, multiple orgasms, cum eating, brief light spanking, biting (it's actually just nipping), light anal rimming, squirting, overstimulation, use of color system, dirty talk, praise, use of pet names (good girl, greedy girl, baby), Gyu actually being really sweet if you look at the tiny details, mention of a married Jeonghan, speeding while driving (do NOT do this). Please let me know if I missed something!
WC: 3.5k
Author’s Note: I was working on 2 other wips when Mingyu just wouldn’t leave me alone. This is the result of that. Not my best work and not thoroughly proofread. But it is what it is. I just really needed to get this out of my system because the man is killing me. My inbox is very much open if you wanna thirst on Gyu with me!
Smut directly under the cut
“Gyu, if you keep touching me like that, i’m gonna wanna suck you off” you warned, swatting your fiancé’s hand away from your thigh
“I don’t see why that’s a problem” He shrugged happily, knuckles gripping onto the steering wheel tighter, excited at your proposition
“It’s a problem because you always close your eyes when you cum. You’re going to crash the car. I’d like to get fucked tonight, not die in an accident”
Mingyu laughed at your statement, not even disagreeing in the slightest bit. Yes you were both horny, but safety always came first, especially when it came to you. He wasn’t so sure what came over you. One moment you were both happily celebrating the wedding of your friends, and the next, you were whispering the dirtiest things in his ear during what he thought would be a romantic slow dance with you on the dancefloor.
Who could blame you though? Your fiancé looked every bit of scrumptious in his white button down today, plus he perfectly played his role of doting fiancé through the night: always holding your hand, always keeping you in his line of sight in the rare moments you two were separated, and always whispering 'i love you's'. He tried to be nice and not rush out the wedding venue right after the dance, and he succeeded for a while, but as the party drew on, it was getting more difficult to hide his boner so he practically dragged you to the car whilst waving a quick goodbye to your friends.
"It's not my fault you're getting me riled up the whole night" he reasoned
"It's also not my fault I'm engaged to the sexiest man in the world"
Mingyu raised his brow at you whilst stopped at a red light, "it kinda is though... You did say yes when I proposed"
"Then you better show me it was worth it" You challenged
Just as the lights turned green, Mingyu could feel his dick twitch in his pants and he swore he never pressed on that gas pedal faster than he did.
He couldn't even wait for you to unlock your doors before he was already kissing down your neck, his whole body pressed onto your back so you could feel his hard on. The feeling of his wet tongue on your burning skin had you fiddling for the wrong keys "Gyu! Slow down! I need to get us in" You pleaded with your source of distraction, "I'm yours the whole night, just let me get our keys right"
"That's funny, you definitely weren't telling me to slow down or wait longer while you whispered all those things on the dance floor... But I will take you up on the offer of having you all night. That is noted" he said the last sentence in a low growl, sending chills down your spine.
Thankfully, the right key finally clicked and your door flew wide open. Mingyu drove you to the closest wall, your head lightly thumping against the hard surface.
"shit! sorry baby" Mingyu's eyes grew wide, his hand immediately reaching over to the back of your head, worried he had just hurt you.
You couldn't even care less, pushing your lips back on his for another kiss but Mingyu stopped you with his free hand, keeping you at half an arm's length. "No, no. I need to know. Are you okay?"
You saw just how quickly his eyes went from horny to caring and it got you even more turned on.
"I'm okay baby, hardly even felt it" You rushed out, reaching for his neck to draw you closer to his lips again. This time, with his full cooperation.
It was everything but calm and collected. Mingyu didn't even leave you any room to fight for dominance as his tongue explored your mouth feverishly.
He groaned when he felt your nails scratch lightly at his chest, his buttons now all undone and giving you access to his tanned skin. You slowly made your way through his chest, leaving love bites where you could and stripping him off the shirt. When your knees hit the floor, you excitedly unbuckled his belt and unzipped his black slacks, exposing his very hard cock that was fighting for release from the confines of his boxers which you eventually freed.
His angry tip momentarily brushed your lips as it sprang up against his stomach and Mingyu let out a moan from the brief contact. He just about died when you gently held his shaft, your tongue sticking out and just centimeters away from where he wanted you. It was as if time stopped for Mingyu. If he just knew where his phone was, he would have definitely memorialized this in a photo.
Mingyu's precum was right there and you just needed to taste it, swiping your tongue fully on his tip before swirling it around him. You heard him curse which only prodded you even more, your thumb gently pressing down on where your tongue was just a few seconds ago as you slowly started to pump him up and down with both hands. The harder you worked him up, the more precum oozed out of him and everytime it did, you repeated the motion of pressing down on his tip before twisting your hands on his length.
"Fuck baby, pleaseee" His voice strained. There was something about seeing that diamond ring on your finger as it wrapped around his cock that always got him in a mess
"Hm?" you blinked innocently, looking up at him through your lashes
"Mouth.. Tongue.. Please, I—" He stuttered and that was all you needed to finally get your lips wrapped around him, sucking with a fervor that had your fiance's eyes rolling to the back of his head. The taste of him sending a gush of wetness between your legs.
Mingyu's mouth hung wide open, letting every whimper and moan come out in full volume as you slowly took more of his length with every bob of your head. You retracted when you were half way through, making sure your tongue was dragging on the underside of his cock to add to the sensation. A string of saliva connecting your lips to his dick.
"Been wanting this the whole night" you mumbled before letting more of your saliva drool onto his cock, earning a groan from your fiancé
You pumped him several more times with your hand before your mouth took him in again. This time, you took your time swirling your tongue and sucking him in, slowly making sure you were able to stuff as much of him down your throat.
"Babyy— fuck, k-keep going" He encouraged. His large hand still behind your head, not pushing but also not letting you move away.
You relaxed your jaw more and willed yourself to breathe through your nose. You moaned when he hit the back of your throat and it set goosebumps all over his body, a strained call of your name reverberating through the walls of your house. Your fingers covered what the rest of your mouth couldn’t and you synced your movements enough to have Mingyu jerking in no time
"So fucking good. Swallowing me so well"
Your tongue continued to move back and forth on the underside of his cock while your throat continued to spasm and your hand played with his balls. When you had adjusted well enough, you squeezed his right thigh to indicate you were good to go and he could fuck your face.
And fuck your face, he did.
With your mouth open wide and tongue sticking out, your fiancé went to town. His hand now fisted your hair in a ponytail as his cock continuously rammed through your throat, hitting the back every single time. You thanked yourself for wearing your toughest waterproof makeup and setting spray because at the rate Mingyu was going, you were definitely tearing up and drooling. As his movements stuttered, you held tightly to the back of his thighs so you could swallow as much of him as you can.
Mingyu closed his eyes shut at the feeling of your tight throat squeezing his cock, "Shit, baby I- I'm so c-close"
You moaned one more time, setting him off as his pelvis jerked and you saw his head fall back.with a groan. Thick spurts of his cum coated your throat and it only made you moan against him harder, fully adding onto the stimulation your fiancé was feeling. You swallowed thickly with all he had to give you, milking out Mingyu to the very last drop.
"FUCK" He exhaled, finally stilling you by the shoulders and slipping out. You gasped for air and wiped your face with the back of your hand, a tantalizing smile staring up at Mingyu
He noted how you swallowed him dry and wiped the tears that stained your cheek.
"My good girl.”
You smiled at him, proud of the work you've done and the praise you got. "Your good girl" you repeated
"Cmere" he called, helping you up hastily and trapping you against the wall for the second time that night
His hand found its place again behind your head, cushioning it from the wall, while the other was hiking up your long silky dress.
"Gyu..." You inhaled sharply when his mouth latched onto your collar bone, sucking hard enough to leave a bruise. Just then you felt his fingers cup your pussy and you both moaned at the feeling
"Fuck baby, no panties?"
You shook your head, biting your lower lip to contain the cheeky smile forming
"Why didn't you tell me? We could've gone home as soon as Jeonghan said 'I Do'… y/n, you're leaking" Your fiance stated the obvious when he brushed your thighs, not even giving you the chance to answer his question
“All you, Gyu”
You saw his pupils blow out at your statement, a cocky smirk written all over his face, two thick fingers immediately slipping into your wet hole “What’s that?”
“S-shit..” you gasped, “it’s you. All cause of you.” you repeated, body jerking at the way his fingers hooked on your insides
“My good girl already so wet just sucking me off huh? Didn’t even need to touch you to have your sweet pussy soaking"
"oh my go— Oh god"
If the squelching sounds you could hear weren’t enough an indication to how wet you were, surely the slippery sensation in your pussy and thighs were
"Jump" you heard Mingyu demand and you lifted your feet off in no time. His strong arms supporting you by the thighs, his hands just below your pussy where he definitely felt some of your juices dripping. You wrapped your arms around his neck as you were now perfectly sandwiched between the concrete wall and your human wall.
"Mingyu" you mewled, forehead dropping to his shoulder when you felt the tip of his cock slip right into your cunt. Your body involuntarily moved higher but Mingyu was quick enough to pull you down, sheathing a few more inches of his length inside you
"Look at you, so wet, you don't even need prep to take me" He praised, pushing another inch further into you as another strangled moan ripped through your throat
Soon enough, your pussy was contracting against Mingyu's dick, the slight pain present awhile ago was now coming in waves of pleasure for you.
"S'good thing you're soaking baby 'case you're tight pussy's sucking me in so well"
Mingyu couldn't stop whispering dirty things in your ear, prodding you enough until you were exerting all your upper body strength to bounce on his cock. A couple times he would completely slip out with how wet you were but he was always quick enough to sheath himself back into your hole before you could fully whine.
"babyyyy" You moaned, the orgasm suddenly appearing hot in your heels already. "m'close. Please.."
"Please what, m' love?" Mingyu thrusted deeply, hitting your gspot with perfect accuracy. If he hadn't held you so tightly, you were sure you would’ve fallen out
"Cum... P-please. Please let me cu--" the last word dying in your throat when he fully withdrew his cock only to push it right in with double the force of the last. You were seeing stars and the knot in your stomach was holding on for dear life.
"My good girl wants to cum?"
"YES!" You cried out, "Please.. was good. I w-was good"
Mingyu chuckled, thoroughly enjoying how broken you sounded when begging for release. With a low whisper to your ear, he let you have what you asked for "Let go, baby"
If Mingyu wasn't back to being fully erect awhile ago, then he is now with the way your gummy walls clamped so tightly around him, your orgasm flowing through you as your fiancé moved his body against yours in soft body rolls to help you ride out your orgasm.
"so good, Gyu. So good.. so good" you chanted with hushed tones
When he felt you calm down, Mingyu planted a kiss on your temple telling you to 'hang tight' when he suddenly lifted you off the wall and made large strides to the stairwell of your home, all while still being inside you. In a moment, he opened your bedroom door, stopping at the light switch for you to flick it on.
"Y/n" he called you in a tone that sent shivers down your spine. He was now standing at the edge of your king sized bed, eyes staring deep into your soul. "Dress off" he demanded.
It was only then you realised how he had been fully naked since forever ago while you were still definitely covered in silk and cotton. You threw the material on the floor at the same time Mingyu slipped out of you and threw you to the bed, your body lightly bouncing on the mattress sending you into a giggles
"I love you" you declared to the man still standing tall with his arms crossed at the edge of your bed. Your eyes glanced at his cock that stood against his stomach, still glistening with your slick, before raking up his toned abs and then back to his face.
"I love you baby" Mingyu replied with a smile that boasted his canines
It was romantic really, but only for a few seconds, because when Mingyu saw your cum drip out of your hole, his pointer finger made quick work to scoop it up and plug it back in your hole. The gasp you let out had him flashing you a devilish grin, one you knew all too well.
He lifted your legs slowly, placing them over his shoulders while he maintained eye contact with you, his face inching closer and closer. The smell of your sex just making his dick twitch for the nth time that night. When he deemed himself close enough, he blew cold air on your pussy, enough to make your hips buck up, immediately latching his mouth onto your wet folds. A strangled moan of his name was the first thing he heard, followed by the lewd squelches his mouth made against your cunt.
"Ooohhh my goooood, Mingyuuuuu" you drawled out when his tongue entered your hole, slurping all the cum he had just caught a few seconds ago
He beamed when he finished swallowing your juices, his face lifting up with a toothy grin, "So sweet. All mine" he declared, before licking a fat stripe from your hole to your clit.
Your moans got louder the more he controlled your writhing in bed, not at all caring that you were about to get wrecked with another orgasm with the way his mouth was making out with your pussy: licking through your folds, sucking and swirling on your clit, pumping his tongue in and out of your hole. He felt your fingers run through his hair before harshly pulling at the strands but it only prodded him more. Taking hold of your legs, he raised them forward so you were now folded in half. A growl rumbled through his chest when he saw just how puffy your pussy got from what he did.
Mingyu delivered two light spanks on your ass before he dove back in to nip and suck at your skin before soothing it with his tongue. The feeling of his teeth grazing your inner thigh was a welcomed addition to every sensation you were feeling down there.
"Keep going, Gyu" You panted, "Please"
Your fiancé didn't need to be told twice, making sure he didn't leave any area of your pussy uncovered. Between the light spanking, sucking and nipping, the skin on your thighs were now blooming a bright shade of pink.
He knew you were close when your right leg trembled with a jerk.
"Cmon, baby. Be my good girl and cum for me.."
Your eyes met his briefly before pushing his head down to meet your hip. Your orgasm was right there, you could feel it wanting to fall, to break, but you needed something more you couldn't exactly pin point. You squeezed your breasts with your free hand but to no avail. Your fiance's tongue was slurping from your hole, his nose stimulating your clit, yet it wasn't enough.
"Gyuuu.... So c-close, pleaaase! N-need mo-oore"
It's a good thing Mingyu knew your body more than you did, because the moment you felt his thumb tease the tight rim of your ass, you didn't only cum, you squirted.
“FUCK, YES” Mingyu celebrated
A silent scream racked through your chest, knocking all air out of your lungs. If your ears weren't just ringing so loudly, you would've heard Mingyu moan out more curse words before diving into your cunt to lap up everything he could. In just a few seconds, your back was arching again as you fought to push his mouth off you. Your whole body was shaking from that earth shattering orgasm, your pussy feeling like it was on fire as overstimulation crept in.
Mingyu laced his fingers through your hand but his attempt to ground you was contradicting the words that came out of his mouth.
"Don’t push me away, baby. Thought you needed more? didn't think my good girl was gonna be a greedy one tonight"
He was chuckling at how far gone you were, mumbling incoherent words to him. All he could really make out was the occasional call of his name.
"Baby.." you groaned desperately when you felt him leave light kisses on the knuckles of your hand that he was holding
"Hmm?"
"I—" you stammered, between the wetness of your sheets and your insides still trembling, you weren't really sure how to string words together
"Does my greedy girl want more?" Mingyu's brow raised, the tone in his voice suggesting that he was not done with you yet. You felt his whole body hover over you, a comforting warmth that made you feel safe and loved despite every single dirty thing he was just doing to you.
"You can give me more, right baby?" Your fiancé asked while one hand pumped his hard cock languidly
"you did say I could have you the whole night… you meant that, right?"
Mingyu saw you look at him in a daze, nodding eagerly even though he knew his words were still registering in your brain
"Y/n, baby… color." He cleared out, wanting to make sure you really did want this. He could read you well in moments like this, but even if he did, Mingyu always made sure he heard the words from you.
He saw you pause and he was ready to drop everything, ready to scoop you in a cuddle then run you a warm bath while he changed the sheets. He could care less if he didn't get to cum a second time tonight, at least he had his fair share awhile ago. But he waited patiently for your words.
The silence lingered long enough that he felt like asking the question again, just in case you didn't hear him.
"G-green, Gyu" you choked out, your throat feeling dry as the desert "But... could I get some water, please?" You asked, your face wincing at how difficult it was to form that one sentence alone.
You were sure it had only been two seconds since you asked, yet your fiancé was already helping you sit up, a jug of water with a straw in hand so you could quench your thirst. Mingyu gently cupped your cheek as you drank, his thumb caressing your skin before planting a soft kiss on your forehead
You smiled gratefully at him after drinking probably half the jug, "Thank you, babe"
He drank some water too before settling it down on the floor, and then facing you. The crinkles on his eyes were showing and despite having his hair stick out in odd places, he still was the most handsome man you've laid your eyes on.
"I love you, y/n"
You closed the gap between you, a chaste kiss on his lips despite getting a slight taste of yourself. "I love you, Gyu"
Your hand held the back of his neck, the mischievous glint in your eyes making a reappearance after that necessary water break. Mingyu's devilish grin followed suit too when you uttered your next words, a redeclaration of how this all began.
"I'm yours the whole night."
2K notes
·
View notes
Saw you took specific requests. Here's mine:
Jamil with a religious reader who gives him a protection talisman.
Fun fact, prayer beads are used in multiple religions as they help count prayers (Christianity, Islam, Buddhism, Hinduism, etc).
So let's say reader comes from a world where magic exists but it's exclusively on religious grounds. Meaning if you wanna do magic you gotta pray to the right god or make a deal with some form of mythological creature.
Reader knows that Jamil's is always in danger due to the constant assassination attempts on Kalim, so they make a set of prayer beads and ask a diety to bless it in order to protect their boyfriend (could be Allah, Indra, Shiva, Buddha, Susanoo, whichever). Jamil accepts it and heads back home appreciating the sentiment but not really believing.
Except any form of danger keeps getting thwarted. Drink/food he's trying is poisoned? Conveniently spills over/has a whole in the bottom. Accident happens? Conveniently pushed out of the way. Someone tries to hurt him/kill him? Struck by lightning and straight up dies.
Not even his own parents are safe. They try to slap him to "discipline him" then they get zapped (lightly tho).
you know!!! I love this prompt so much... I'm a religious studies major so this kinda stuff is so ^w^ to me I get so excited.
summary: giving jamil a protection spell
type of post: short fic
characters: jamil
additional info: reader is gender neutral, the existence of religious beliefs in twst is. confusing. so we're keeping it vague, not proofread, reader is yuu
Perhaps it was because your world was still considered "magicless" by Twisted Wonderland standards, or perhaps Jamil was never superstitious to begin with.
Either way, he wasn't exactly as excited as you'd been hoping for.
"It's nice. Did you make it yourself?" he asks, inspecting the beads. "A bracelet?"
"Prayer beads, actually. And yes, I did,"
"It's well made. What's the purpose?"
You hesitate. The nature of religion in this world is still confusing to you, although you can surmise there's got to be some kind of belief system. It's best not touching on for now.
Besides, Jamil has never been much of a believer in higher powers. For good reason.
"For protection," you explain. "Not that I think you can't handle yourself. But I worry about you over break, you know..."
He's quiet for a moment, inspecting the gift in the palm of his hand. And then he tucks the beads away in his pocket and smiles.
"I'll keep them with me, then. Thank you,"
Even if he's not exactly keen on the idea that these things will make his life any less terrible, they're from you.
And so he keeps his promise, and tucks them away after you part.
By the time he's "home" (back in Kalim's family home) he's all but forgotten about the little blessing at the bottom of his pocket. Not that you can really blame him- "vacation" is more of a title than a reality when he's back.
The first incident happens not even a day after.
The al-Asim summer mansion is certainly nothing to scoff at. Though it's only one of many, this one in particular houses a large sum of physical treasures, line with gold and ivory, stuffed full of spices and all the makings of a feast that could feed thousands, a shining jewel of the desert.
Jamil is not all that impressed.
Especially when it comes to navigating such an ornate building on orders. The polished-to-perfection floors present a challenge when you're carrying three crates worth of grain to the kitchen on the lowest floor.
Damn these stairs.
Though Jamil may not be a religious man, he still asks whatever deity may be up there to smite the slippery spiral staircase he's descending.
His arms strain to uphold the weight of the boxes, and his legs strain to keep a good footing on one of the many long and elaborate and narrow servant passages designed specifically so that the unwanted workers of the family can slip by undetected.
Quiet, diligent, and he has to be quick, too. Kalim is expecting him for a game in one of the many lounges soon.
Another unfortunate "vacation". How he'd much rather be spending it with you...
For a brief moment, Jamil swears he can feel the beads in his pocket warm against him, reminding him of their presence.
And then he slips.
The crates free themselves from his careful grasp and tumble down the stairs, creaking and thudding but mercifully staying intact.
Jamil, however, isn't made of wood. He winces as he feels himself tilting forward- and then... somehow, a strong draft pushes him on his back.
He lands just shy of his tailbone, luckily not hurting anything, except for his pride.
What a turn of luck.
The next happens at dinner.
Jamil keeps his earlier blunder to himself. His pride is damaged enough as it is, after all, and so he tries his best to conceal how shaken up the experience left him by moving swiftly across the kitchen.
"We have a dish ready for you to test," someone shouts.
He sighs. How many more evenings of this will he have to endure?
Though, he reminds himself- this may always be his last.
The thought makes Jamil chuckle as he's handed a hot dish and a clean fork. He can only stop to smell the roses for so long, so there's no chance of savoring such an exquisitely prepared meal before he's off to another part of the kitchen.
Just as the fork digs into the food, the dish slips out of his hand and shatters on the kitchen floor. Everyone falls silent.
His eyes widen. "How- ugh. My apologies,"
Now this is just getting ridiculous. How clumsy can he get in one evening? He's usually much more careful...
"Look," the head chef says, the whole kitchen crowding around the food as it dissolves.
Jamil's stomach lurches. Cyanide. It has to be. If he'd eaten that dish right there and then...
The kitchen is swiftly cleared out, and he's sent back to the lounge.
it only gets stranger from there.
What Jamil initially wrote off as clumsiness and luck seems to become a pattern-
a flying arrow at the archery range just narrowly misses him when he bends down to fix his sandal.
The al-Asim family tiger (because of course they have one) chooses to toy with a visiting prince rather than him in the courtyard.
A strong draft pushes him on his rear end seconds before a sandbag falls from an under-construction part of the mansion.
He would call it fortune if he believed in such a thing.
By the end of the vacation, everyone is absolutely perplexed by his string of good luck. Jamil isn't unfamiliar with how dangerous his family's position in life is, and he's had his fair share of injuries as a result, but this time all he has to show for it is a slightly lesser sense of annoyance than usual.
It's only the end of the trip where he ponders (unfortunately aloud) about the string of coincidences, and the beads in his pocket.
Kalim goes on to babble about Jamil's "good luck charm" to anyone who will listen, much to his annoyance.
"Oh, I want one too! Can you ask them to make me one, too?" he says, folding his hands in a pleading motion. "It's so pretty!"
"It was a gift. But... I suppose I can ask..." he sighs, and then smiles to himself.
Of course you'll come up with some excuse to say no. Because, for once, this charm is all his.
266 notes
·
View notes
I wanted to redesing and rewrite Miraculous for a while. Then thought why not share my ideas so here is Chloé Bourgeois. (Duddeee I forgor the wingss?? 💀)
In my rewriting, power system is different. I will explain it on my further posts. Here I want to tell you more about my version of Chloé aka Queen Bee.
Chloé’s character is similar to show version. (First two seasons) Mommy issues, struggling with social relationships, bully… The difference is I keep the redemption arc :D In my version Ladybug and Chat Noir get their miraculouses when they were in high school. But show will take place at their twenties when they are in university. We will have flashbacks about high school years and how they got their miraculouses. Chloé also gets her miraculous in high school but it will be taken from her by Ladybug. This events will be similar to show too. Chloé won’t reveal her identity to everyone but will do wrong things to fix and seem like a hero. Her plan was to impress her mother as Queen Bee so later she can reveal her identity to her and make her mother proud of her for once :’) (Damn you Audrey)
Her only friend was Adrian for her whole childhood (same goes for Adrian) thanks to Audrey’s business with Gabriel. I thought her whole feelings towards Adrian is platonic but in her high school times she thought she has romantic feelings towards him because she never had friends other than Adrian and never had romantic interest. That’s why she will be clingy towards Adrian in high school.
In last year of high school after Ladybug took Bee miraculous from her, Marinette will try to fix her relationship with Audrey like in the show but it won’t work and Audrey probably say some really heartbreaking things and this will make Chloé angrier. She will blame Marinette and will be ruder to everyone (espacially to Marinette) at school, Sabrina will dump her (yaaay), Ladybug won’t trust her about an akuma attack (there are no akuma in my story tho but i want you to know what i am referring to rn) and Adrian will talk with her about her actions and how he doesn’t want to keep being friends with her anymore if she continues. She will get akumatized too and hurt her teacher (forgor her name) and Sabrina. She will collapse and leave Paris. I am not sure where she will go, probably i will make her go another country at Europe.
She will change her contacts so Adrian won’t be able to reach her. She will go therapy there and will be emotionally better. I feel like she would study child psychology maybe become a teacher or something. I also thought she will take self defense classes too since Ladybug told that she doesn’t have enough experience on fighting and they ve been getting educated for years to hold a miraculous, when she took bee miraculous from her. ( thats a lie tho it has only been a few months not years lmao)
After 2 or 3 years she will return to Paris (when show takes time at)for a few days just to see her father and apologize to Sabrina, Adrian and Marinette. I thought Sabrina won’t even wanna listen her. So she will decide not to see Adrian because she will think he doesn’t want to see her either. Then she will find herself in the middle of akuma attack. She will see where the akumatized item is. Ladybug and Chatnoir will be surprised to see her there of course but they are in the middle of fight. Chloé will try to tell where the akuma is but Ladybug will immediately tell Chatnoir to take her somewhere safe and he will. Chloé will tell Chatnoir that she knows how to defeat the akuma and she is sorry for being a bad holder back than. Adrian is so confused seeing her friend after years of course but can’t say anything (you know ,secret identity 🤷). Akuma will be defeated and he will go to Chloé to thank.
So then she will go to bakery hoping Marinette will be there in university break and hoping at least Marinette would like to listen her like back then. And as she hoped, Marinette wants to listen her. I might make a comic with this scene later. Right now I don’t have the words to describe the dialogue in here. But it will be about how she came to apologize and she is now a different person but how she doesn’t expect to be forgiven since Sabrina didn’t. And I thought Marinette would hug her seeing how in the edge she is and she might cry :’’(
I know I know it is so plane but i am not good at writing. I just tell what my ideas are. It is not the end. I will write about what happens later but first I should make posts about other holders and power system. Powers are different in my version so story might be confusing without knowing them. Bee miraculous also has slightly a different power. So first I will tell about them. Then I might try harder and write the story better hehe.
About Zoe btw I don’t even know if I want her to exit lmaoo. No hate don’t get me wrong but she is not even a character in the show. I am not sure what to do about her yet.
Thank you for reading, I appreciate that. 🪐🌟
=====Turkish translate======
Bir süredir Mucize’yi tekrar tasarlamak ve yazmak istiyordum. Kendi kendime dedim ki neden fikirlerimi paylaşmayayım ve paylaşmaya karar verdim. Ta daa Chloé Bourgeois! ( kanatlarını çizmeyi unutmuşum ama çaktırmayın)
Benim alternatifimde güç sistemi farklı. İlerki postlarımda açıklayacağım. Burada daha çok benim tasarladığım Chloe’den diğer adıyla Kraliçe Arı’dan bahsetmek istiyorum.
Aslında Chloe’nin karakteri dizidekine yakın. (İlk iki sezondaki) Annesi ile sorunları, sosyal ilişkilerde sıkıntılar, zorba biri olması… Fark ise ‘redemtion arc’ ını çöpe atmadım. :D Benim versiyonumda Uğur Böceği ve Kara Kedi mucizelerini lise okurken alıyorlar ama hikaye üniversite yıllarında, yirmili yaşlarında geçiyor. Lise yıllarında yaşadıklarına arada ‘flashback’lerle değinmeyi düşünüyorum. Chloe de mucizesini lisede alıyor ancak Uğur Böceği ondan geri alıyor. Bu olaylar da dizidekine benziyor. Chloe kimliğini herkese açıklamak yerine önce Kraliçe Arı olarak annesini etkileyip sonra ona kimliğini açıklamayı düşünüyor. Böylelikle sonunda annesinin onunla gurur duyacağını düşünüyor. Dizideki gibi sorunlar çıkarıp sonra kahraman gibi davranıp insanları kurtarmış gibi gösteriyor kendisini.
Küçüklüğünde tek arkadaşı Adriandı. O da annesi Audrey’in Gabriel ile olan işi sayesinde. Aslında Adrian’a karşı tamamen platonik sevgi (arkadaş olarak seviyor yani karşılıksız sevgi anlamında değil) beslediğini düşünüyorum. Hiç bir zaman romantik hisleri olmadı ama Adrian’dan başka arkadaşı olmadığı için ve daha önce hiç romantik duygular hissetmediğinden Adrian’a olan duygularını romantik sevgi ile karıştırdığını düşünüyorum.
Lisenin son yılında Uğur Böceği, arı mucizesini ondan alıyor; Marinette Chloe’nin annesi ile olan ilişkisini düzeltmeye yardım ederken işler ters gidiyor ve Audrey, Chloe’ye kalp kırıcı şeyler söylüyor. Bu Chloe’yi ilerki günlerde daha agresif yapıyor, Marinette’i her zamankinden daha fazla aşağılayıp olanlar yüzünden onu suçluyor, Sabrina dayanamayıp onunla ilişkisini kesiyor (yürü be Sabrina), Uğur Böceği akuma saldırısı konusunda Chloe’ye güvenmiyor( akumalar benim versiyonumda yok ama şimdilik anlaşılmak için akuma diyeceğim) ve Adrian böyle biri olmaya devam ederse onunla arkadaş olmak istemedi��ini söylüyor. Bunların hepsi Chloe’nin duygusal olarak yıkılmasına hatta belki akumalanarak sevdiği insanlara, şu adını unuttuğum öğretmenleri ve belki Sabrina’ya, zarar vermesine yol açıyor. Tüm bunlar Chloe’nin Paris’ten ayrılarak başka bir Avrupa ülkesine gitmesiyle sonuçlanıyor.
Burda Chloe iletişim bilgilerini bile değiştiriyor ve Adrian dahil kimse ona ulaşamıyor. Terapi alıyor. Üniversitede çocuk psikolojisi okuyor belki de öğretmen olmak istiyor diye düşündüm. Hatta bazı dövüş sanatlarını da öğreniyor çünkü Uğur Böceği mucizeyi alırken ona yeterli savaş deneyimi olmadığını ve kendilerinin yıllardır eğitim aldığını söylüyor. ( Yalan tabii. Sadece bir kaç aydır çalışıyorlar yıllardır değil.)
2 ya da 3 yıl içinde ( hikayenin geçtiği zaman ) Paris’e dönüyor. Sadece bir kaç günlüğüne babasını görmeye; Sabrina, Adrian ve Marinette’den özür dilemeye geliyor. Sabrina onu dinlemek bile istemeyince Adrian’ın da aynı tepkiyi vereceğini düşündüğünden onu görmekten vazgeçiyor. Marinette’i görmeye giderken kendisini akuma saldırının ortasında buluyor ve Uğur Böceği ile Kara Kediye yardım etmeye çalışıyor. Kahramanlar Chloe’yi gördüklerine çok şaşırıyorlar ama savaşın tam ortasındalar bu yüzden Kara Kedi onu alıp daha güvenli bir yere götürüyor. Chloe, Kara Kedi’ye akumanın nerde olduğunu söylüyor ve önceden kötü bir kahraman olduğu için özür diliyor. Adrian eski arkadaşını gördüğüne çok mutlu oluyor tabii ama hiç bir şey söyleyemiyor çünkü gizli kimlik şeysinden. Akumayı yeniyorlar tabii ve Chloe ye teşekkür ediyor.
Daha sonra Chloe Marinette’ i görmeyi umarak pastanelerine gidiyor. Ve umduğu gibi Marinette orda oluyor. Burdaki sahne hakkında daha sonra bi çizgi roman yapmayı düşünüyorum şimdilik dialog kafamda tam değil ama basitçe Marinette’den özür diliyor, artık eskisi gibi olmadığını ama yine de Sabrina gibi affetmek zorunda olmadığını sadece farklı biri olduğunu bilmesini istediğini söylüyor. Burda Marinette’in ona sarılacağını düşündüm bu da yaşlarını zor tutan Chloe’yi ağlatacak.
Biliyorum biliyorum anlatımım aşırı düz ama yazmakta iyi değilim. Sadece kafamdaki fikirleri aktarıyorum. Bu son değil. Devamını yazacağım ama önce diğer Mucize kullanıcıları hakkında ve güç sistemi üzerine postlar yapmak istiyorum. Neleri değiştirdiğimi bilmeden hikayeyi anlamak zor olabilir. Yazım şeklimi de daha akıcı ve güzel hale getirmeye çalışacağım.
Zoe’yi sorarsanız onun hakkında ne yapacağımı henüz bilmiyorum. Onu hikayeye ekler miyim emin bile değilim. Açıkçası dizide hiç bir kişiliği olmayan bom boş bir karakter. O yüzden emin değilim.
Okuduğun için teşekkür ederim. 🪐🌟
436 notes
·
View notes
(for that timeloop post,, uhm this relates to the whole body horror thing ((not too much just a brief mention)) so if rn u don't wanna see that SCROLL AWAY!!! OR DELETE ME!! OK disclaimer ends here)
oh man but what if Law did say room anyway and there were impossible scars on your insides... like littered everywhere, they're not fresh but old, almost phantoms that make no sense, because if they were real you would've died. how would he react to that? maybe not when he noticed them crying but after weeks or months, dunno, where they keep skipping his more thorough check-ups (where he uses his devil fruit) since they're anxious about the pains? and think that somehow there are signs of their previous deaths and the mention of them makes it hurt more and more and they just can't do it. but they can't bring themselves to say it because who could possibly believe them? if Law doesn't, it would just feel even worse, won't it? even if they understand his point of view. maybe they even die in front of him and it gets harder to just hold all of that in,,, oh boy. if you think about continuing your oneshot i'll eat it like a starving animal!
pairing: law x gn!reader
contents: slight body horror, slight gore, timeloops, suicide done to restart the loop, hurt/comfort, happy ending,
word count: 1.6k words
note: OHHHHH I LOVED THIS IDEA OH MY GOD. absolutely so smart. anon your mind is huge and i had so much fun doing this request. <33 i really hope you enjoy :33
playlist: caribou - tanya tagaq
a sister fic to this
This had never happened before. You had experienced hundreds of loops, maybe even thousands, and this was the first time Law saw fit to scan you with his Devil Fruit.
Maybe you were getting sloppy. You had a strong immune system so you never got sick, and the first time Law scanned you for your general checkup upon joining the crew, there was nothing of note. You wondered what changed, as if you hadn’t died more times since you joined his crew than you had in your entire life. Maybe it was because the more you suffered, the more reckless you became, throwing yourself into the fray with little regard for yourself. You could take a bullet for your crewmates, so you would. It was as simple as that.
There was a first time for everything, you supposed. A first death, a first breath, a first kill; there were uncountable firsts that one could experience, and you had experienced most of them.
Not this one, though.
You had tried to avoid it for as long as possible. Your captain was a man who carried burdens, ones almost as heavy as the ones on your shoulders. If he knew how many times he failed you — or how many times you failed him — you knew he would take all the blame for himself. As if you hadn’t been the one lying, and fighting, and dying over the course of countless lifetimes.
Law blinked a few times before his brows furrowed and his eyes narrowed. You fidgeted under his stare. If his reaction was anything to go by, he found something horribly wrong with you. While you had experienced slow deaths before, you had never experienced what it felt like to waste away from disease. Maybe you’d find out this loop, you thought, trying to feel nonchalant about the idea and not like you were about to throw up.
“Um. What’s wrong,” You tried.
Law shushed you, the blue glow from his room still surrounding you. You bit your tongue, fingers playing with the hem of your shirt to try and take your mind off of whatever he could have found.
“This can’t be right,” He muttered, one hand cradling his chin. He pointed to your chest. “There’s a scar inside of you, it looks like a puncture wound through your lungs. When did that happen?”
Three loops ago when you fell off a building and onto some rebar. That was a particularly awful death. The last thing you remembered before everything went black was Law’s panicked expression as he tried to put you back together again. There was terror in his eyes. You tried not to think about that part.
“And here,” Law continued, pointing to your abdomen. “There’s a scar running across the length of your stomach. It almost looks as if you were previously disemboweled.”
You had been. Multiple times. It was a common and very disturbing loop ender that you tried to avoid if you could. Watching your organs fall out of you in a steaming heap was never something you liked to experience, but for some reason, your opponents kept aiming for the gut. You wished they’d aim for the heart or the head more often. At least then it’d be quick.
He didn’t stop there, jaw falling open when he stared directly where your heart was. “When were you stabbed, Y/N-ya, this looks recent.” Law blinked a few times before realization dawned on his features. His eyes shot to your face, expression going from open to unreadable in seconds. “How did you survive without my intervention?”
Your mouth was dry. How were you supposed to respond? There was no way you could tell him that you had died on his watch more times than you could count. Law didn’t deserve that. Your captain was a good man, one you loved admired far too much to allow this to weigh him down. He would take your failures to heart, completely discounting the amount of times that he had saved you from having to start anew.
You must have been quiet for too long because Law was speaking again. “Answer me.”
“It’s from a long time ago,” You said.
That was a lie. It was from the previous loop. A quick death by your own hand over the cold corpse of your captain. If Law didn’t survive, there was no point in continuing, and if there was one thing you had grown accustomed to, it was taking your own life after one loss too many. You knew how to make it quick, no suffering. So with a precise hand, you drove your knife into your chest and let the timeline begin anew.
When you saw Law again, whole and alive, you vomited. You were under the impression that he believed that you simply ate some bad seafood, but from the concern that was slowly etching its way onto his features, you weren’t so sure of that now.
“Don’t lie to me.” Law’s eyes flashed, barely contained frustration needling at the corners of him. “None of this makes any sense, half of these injuries should have killed you. The other half would have needed to be treated.”
The truth sat on the tip of your tongue. You felt selfish and needlessly cruel for your desire to tell Law what was really happening. Your eyes burned, and their glassy sheen didn’t go unnoticed. Law handed you a tissue, expression softening.
“I- um.” You hated how your voice cracked. It had been a long time since you told someone about your Devil Fruit. You always died, and they always forgot. For a long time, you thought it was better that way, carrying this weight on your own. The way Law looked at you, though, it made you want to pour your soul out to him. Every pain, every loss, every death lain at his feet, and for once, you could stand unburdened. “It’d be wrong of me to tell you.”
Law’s eyebrows knit together. “Now you’re being stupid.”
“No, I’m not. You’ll regret asking once you know. Don’t pretend like you don’t carry the weight of the world on your shoulders, you don’t deserve my troubles on top of that. It’s better for both of us if you just forget what you saw.”
With that, you stood and made to brush past Law and out of the room. He grabbed you by the shoulder, not allowing you to go any farther. Though his grip was firm, it didn’t hurt. If you really wanted to, you could wrench yourself away from him.
“You’re trembling.”
Your lower lip wobbled, your resolve ebbing away by the second. “It’s complicated.”
“So tell me.” Law’s lips twitched upwards ever so slightly. “Doctor’s orders.”
You let out a small huff. He didn’t deserve this, but there would always be another loop. This current one hadn’t been going so well, and by your estimation, it would take at least three more before you managed to reach your next checkpoint. It wouldn’t hurt to tell Law what he inevitably wouldn’t remember. You steadied yourself with a deep breath and turned to face him, his eyes met yours with a mix of concern and exasperation.
“It’s my Devil Fruit,” You started. Law leaned back on his heels and crossed his arms, attention solely on you. Your heart thundered in your chest. “I’ve died so many times.” Without your permission, your breath hitched. Law’s hand encircled your own with a small squeeze, encouraging you to continue. “It, um, brings me back, I guess. I’ll die, and then wake up in the bunkhouse days earlier, and I’ll be the only one who remembers what happened. All those scars you saw were what killed me in a previous loop.”
He was silent while he chewed on his words.
“How many times have you died since you joined my crew,” Law finally asked.
Your hand was still in his and you gave it a squeeze. “That’s not fair. I know what you’re doing and I won’t let you do it.”
Law’s shoulders slumped as he brought his free hand to pinch the bridge of his nose. “I believe you. It explains a lot. I noticed you cry in your sleep sometimes.”
“You watch me sleep?” The tips of Law’s ears were tinged pink while you laughed.
“I was worried so I checked on you.” With a sigh, he began to lead you out of the clinic to his office. “Come on, you’re telling me everything you can remember. We’re going to come up with a plan.”
Humoring him, you followed close on his heels. It didn’t matter how long or how hard you planned, there was no accounting for the unpredictability of the universe. This comfort wouldn’t last long. Soon, you would be dead again and the cycle would start anew. That didn’t mean you couldn’t enjoy sharing a space with your captain, listening to him meticulously craft tactics to keep you, and everyone else, alive.
It wasn’t until four days later you found yourself breathing, though covered head to toe in blood, with the rest of the crew. Everyone was safe and sound, and Law wouldn’t stop looking at you with a smirk on his face. When you found yourself next to him, he bumped his shoulder against yours.
“I told you my plan would work.”
Just like that, for the first time in your life, you were no longer alone.
166 notes
·
View notes
Fish Lips Part 5
Ship: Aonung x Kiri's twin sister!Reader
Warnings: Language, bullying, gore, fighting, talk of war, injury and blood, slow burn, enemies to lovers (not really a warning just some people don't like that trope), death of (a) character(s), not proofread
Words: 2,170
Keys: (y/n) = your name,,(y/i/n) = your Ikran's name,, Neural Queue= the braid extension of a Na'vi's nervous system that allows them to link up to animals and Ewya,,(y/II/n) = your ilu's name,,
Chapters; Introduction || Part 1 || Part 2 || Part 3 || Part 4 || Part 5 || Part 6 || Part 7 || Part 8 || Part 9 || Part 10 ||
Spoilers for Avatar: The Way of Water A whole ass lot.
Did I tell yall I love ya??????? Nicest ppl ever, I just wanna hug ya n squeeeeze yaa. Okay funny story, my cat King Cinnamon is an insane orange cat, and I was watching Avatar again (It's literally on replay every time I write these fics) and he would only attack the screen when Jake was on the tv. I made him stop ofc, but it was hilarious, HE WOULD HUG THE TV AND TRY TO BITE JAKES FACE LMFAOOA. I don't think he likes Jake much (He is an avid tv watcher btw.)
I deleted this chapter like six times cuz I hated it, I still do but I'm tired of redoing it so I hope you all like it. Ik I said slow burn and it seems like I'm rushing but dw this story still has a long way to go.
It had become a routine of yours and Aonung's to sit on 'his' rock at night, normally just a silent moment between you both. Almost every night you would swim to the rock, and he'd be right next to you ten minutes later. Sometimes he would speak, other times you would, but normally it was just enjoying each other's company.
It has been four months, but you still weren't on the best of terms in your opinion. He'd still let out an insult here and there and you'd jab right back. You took notice of the drastic difference in his behavior towards you, especially lined up next to your siblings.
You didn't understand what was so special about you, you were practically a carbon copy of your brothers, especially Lo'ak who Aonung seemed to dislike the most. Well, technically both of you acted like your father when he was younger, according to your mother.
Rash, irresponsible, and shoot first, ask questions later. Of course, you'd just roll your eyes at that, you couldn't imagine your father getting into stupid fights and arguments. Which was in fact what you were doing in this exact moment with Lo'ak.
" You broke my necklace, you bitch." You yelled, the last part in English, and Lo'ak glowered at you, Tsireya cocked her head at you in confusion.
You stuck out your broken necklace, the beads missing and some handpicked rocks you got from home. His ears went back." Wasn't me!" He snarled, ears going back and smirk from his face falling." You were the only one in the Marui before it was broken." You pointed at his chest; he smacked your hand away.
" It wasn't me, stop always blaming me!" He yelled and you rolled your eyes." Oh yeah then-"
" Knock it off!" Kiri yelled at you two, glaring as well as she could as Tuk braided her hair. You both glared at each other." Mother fucker." You hissed in his ear quietly, and he side eyed you.
" Dickhead."
" Twat face."
You both covered your mouths and giggled to yourself at the childish insults, completely forgetting the argument you were just in." You guys should teach me English! I wanna know what you're saying!" Tsireya stated and you both looked at each other.
" Lo'ak can teach you." You smiled at her patting his back. Aonung, Rotxo, and Neteyam swam over. They were teaching Neteyam how to hunt under the water so that they could take him on hunts.
" What's up." Rotxo waved his hand in greeting, and You all waved back. " I'm trying to convince them to teach me English." Tsireya announced and Neteyam looked at you and you shrugged in response.
" I already caught on to one." Tsireya spoke proudly and you raised a brow." Oh yeah?"
" Yeah, 'bitch'." She repeated your words and you and Lo'ak cringed as Neteyam whipped his head at you two." That's...not really a good thing to say." Lo'ak explained and you snickered quietly to yourself.
"Oh, apologies." She went a bit lower in the water in embarrassment." What does it mean?" Rotxo asked and Aonung eyed you as you giggled with Lo'ak, he had been watching you a lot more, but you pretended not to notice. Neteyam rolled his eyes." It's an insult usually towards girls."
Neteyam glared at you, and you shrugged, you really didn't know she was going to catch on and take interest in your small talks in English with Lo'ak. It normally wasn't even a full conversation; it was more throwing insults and giggling about it afterwards. it was a little game you guys did, having childish humor like the two of you have it was just between you guys.
" Why are you insulting Lo'ak with a female insult?" Tsireya questioned and everyone turned to you." Because he's a big baby girl." You teased taking a braid in his hair and twirling it to piss him off.
He smacked your hand away as you snickered at his annoyance." Anyways, what do you wanna do today?" He asked and everyone looked at each other. " I'm gonna go fix the necklace you broke." You exclaimed huffing at Lo'ak who rolled his eyes." That's what you get for calling me a female insult." You saw a smirk on his face, and you rolled your eyes back at him.
" Seeya." You waved at them, and everyone said goodbye, except for Aonung he just gave a small wave. When you got out of the waters Kiri called you over.
"Yeah?" Kiri nudged her head towards the water where everyone else was." You have an admirer." She teased as Tuk moved her head back into place." Stop moovingg." Tuk whined, you turned your head a bit to catch Aonung flick his eyes back to your big brother. You shook your head." Nah."
" Yes so. He's been staring at you the entire time." You rolled your eyes and waved a hand at her." Okay, whatever you say." She shook her head and went back to her conversation with Tuk as you walked towards your Marui.
When you got back to your families pod your mother was there with Ronal. They stopped and turned to look at you as you awkwardly stood at the entrance." Oh, sorry." You gave a half smile and Ronal's face flickered to the necklace in your hand.
" My, you're quite the crafty one." She put her hands out, gesturing for you to place the necklace in her hands. You did so hesitantly." It was almost finished but it got broken." You explained rubbing the back of your neck.
She ran her hands along the rocks and beads, after an awkward silence she looked up at you." Would you like to help me craft sometime?" She asked, going back to looking at the necklace." Me? Sure!" You grinned at her, and she nodded.
" It's gorgeous dear." She complimented and your ears darkened. You bowed your head a bit in thanks." Thank you." You breathed and smiled, Neytiri handed you a basket as you began to turn and leave.
" Please grab some more fruits for dinner on your way back." She ran her hand over your hair affectionately and you leaned into her touch before she pulled away patting your shoulder.
You gave her a smile before you left to the woods behind the branches of woods that made up the Metkayina village. As you walked slowly through the batch of woods you heard the sound of footsteps behind you.
You turned around, Aonung staring at you with his unbothered stare that he has been giving you all week. You both just stared at each other awkwardly until you cleared your throat to speak." Are you following me?" You smirked and he looked away for a moment before meetings your eyes." No." He responded, surprisingly no smug or rude comment.
You squinted your eyes at him." You've been acting weird." You waited for a response, but he just started walking past you." I'll show you where the best place is to pick fruits if you zip your lip." He smirked at your face; annoyance plastered on it.
You raised an eyebrow at him." Fine then looks like you won't be sharing this amazing fruit picking location because my lips aren't gonna seal for you." You walked past him and continued straight. You didn't hear anything as you continued to walk forward, so you thought he was gone.
" Man, that boy." You mumbled, flicking a branch in front of you." What about me?" His voice rang out and you let out a quick scream. " Jesus Christ, man!!" You held your hand to your racing heart, he let a loud laugh." Who is Jesus Christ?" He asked and you scoffed." Some famous guy from Earth."
" That's a weird thing to yell out after being scared, do I look like Jesus or something?" He asked, his face looked serious, but his eyes were glistening with mirth. It was your turn to laugh." Not even close!" You bent over the basket you were holding your ears and cheeks a dark purple.
When you got done laughing you looked up at him, he was watching your face the whole time. A peaceful silence broke out as you stared at each other as you gained your composure." I still don't like you; you know." He spoke matter of fact, and you rolled your eyes.
" We were having a moment." You turned forward and began your walk again, which this time you noticed his presence." Why did you follow me out here?" Your question booming through the quiet forest. He didn't respond until you turned around to give him a quizzical look.
" I just wanted a walk, is it a crime that I accidentally ran into you." He shrugged and you squinted your eyes at him." In the same spot as me?" You quirked a brow at him, he folded his arms across his chest." It's a pathway bound to be walked on." He argued and he pointed forward.
" Plus, your headed to a beautiful spot where I like to sit." He took a step towards you with a smirk." Wanna join me?" He quizzed but you didn't by it. How come every time your alone and he shows up he claims you're on his spot or area.
After a few beats if silence, his smirk slowly turning to an annoyed pout." Fine don't, you're missing out though, on a great view." He was really trying to convince you to come without actually saying it.
" Oh please, I am the greatest view." You joked and his eyes roamed you up and down before he shrugged and spun on his feet." Hey what was that for?" You hissed at him, and you tugged his arm as you followed him through the trees.
" Aonung?" You looked up at the boy who was giving you a mischievous look. " Look." He poked your cheek directing your face forward as he moved a large leaf out of the front of you. " Woah." You breathed; a waterfall was in front of you with a lake surrounding it.
" See told you." He walked towards a rock and sits on it; you follow close behind looking at all of the plants surrounding the water." Do you have these in the forest?" He asked and you shrugged." Waterfalls and lakes yeah but some of the plants are different."
You admired a flower that was near Aonung's leg, and he looked down." How'd you find this place?" You asked, he placed his feet in the water." Well, it wasn't hard to find I just used my eyes." You scoffed, you moved onto a different rock, placing your mother's basket next to you.
You dipped one foot into the water, moving your feet in the warm water. You could feel his eyes on your and you turned your head his way." You've been staring at me." You spoke, and he turned his head fully towards you.
" I haven't." He scoffed in denial, and you rolled your eyes, smirking at him. " Well thanks for showing me your lovely place, I still don't like and I need to go get fruit for my mother." You stood up and he got up as well." I'll show you the fruit spot."
You unconsciously smiled at him which made him give you a quizzical look." What?" He asked and you wiped the smile from your face." What, I wasn't' smiling."
He rolled his eyes and gestured for you to follow, you picked up your pace and fell beside him as he walked you towards this fruit pocket of a sort. It was a peaceful silence that followed your walk towards the fruit but the whole time you were wondering as to why he was being so nice to you today.
" That necklace you had in your hand in the waters with Lo'ak," He broke the silence, but pausing to make sure you were listening." Who is it for?" You shrugged at his unusual question." It was more for a reminder of home, but since it lost some of it's pieces I don't think I'll finish it." You stated, smiling at the thought of Ronal's compliment of it." Why do you ask?"
" No reason." When you reached the area Aonung helped you pick some but reminded you he was doing himself a favor and not there to help you. When you got done picking you headed back with him, it was almost late afternoon, so you had to hurry it up.
" I still don't like you, forest girl." He reminded you once you reached the point where you went your separate ways." Yeah yeah, don't think I like you either fish boy." He shook his head and walked away. Today was definitely an odd day, but peaceful nonetheless, you felt like you were finally starting to fit in.
────────────────────────────────────────────
Taglist; @akinatrix , @willowbrookesblog , @lovesickbtch , @ao-sleepy , @elli-aesthetics , @ducks118 , @aeclark04 , @audigay ,@lola-bunn1 , @curlszx88 , @kidwithaheavystick , @weridpersonhelp , @yeosxxx , @tsamiaxoo , @shartnart1 , @tsukette , @daphne000 , @amarillyssnowdrop , @neteyamsmate4life , @stitch-lele , @purplefsh , @dumb-fawkin-bitch , @goodiesinthecloset21 , @theghostofshadows , @aonungs-tsahik , @simpliheavenli , @bob-the-ikran , @littleshybunbun , @werelosingdaylight , @ijwsbdinp , @xoxovienna , @findingourtreasure ,
1K notes
·
View notes
"I want to try something," David says one Friday evening, after they've gone to bed.
Joe sighs, rolling his eyes in as long suffering a way as he can manage and plopping the latest adventure of Dick Tracy on his bedside table.
"I told you before, I'm not going fucking diving, if you wanna—"
"Not that," David cuts off impatiently no doubt remembering the way Joe called the entire practice a nutjob's hobby.
"Well I ain't going horse riding either," Joe says, irked by the interruption.
"What? Oh, you—just because I said I don't mind horses one time—"
"Please, like I didn't see you make puppy eyes at that pony."
They'd found it right there, on their street, munching on the flowers on Mr. Berkowitz' windowsill and causing quite the fucking ruckus. Half the neighborhood was gawking, wondering how the fuck it had come there and how to make it leave, when it had somehow come out that David's sister had used.to.ride horses and he'd accompany her sometimes. Promoted to the rank of local expert, David was then tasked with catching the pony—took about five seconds and a bit of quiet muttering—and hold it until the proper authorities could be summoned.
It was painfully easy to see David had grown fond of the beast in record time (faster than he'd grown fond of Joe back at the beginning, at any rate) and that he was sad to see it go. Also, if Joe had had any doubt on the subject, the mulish expression that appears on David's face would have tipped him off. Nothing makes him stubborn like Joe being right about a thing he doesn't want to admit to.
But hey, they must have both matured a bit since the war: Joe doesn't keep pushing (yet) and David ignores the jab in favor of pouting:
"I meant in the bedroom."
"Jesus Christ," Joe says, because that's who he usually blames when David gets some kind of harebrained idea in his head.
David rolls his eyes at that, and Joe would scold him except, well. David may have a penchant for making sex more complicated than it really needs to be—Joe had never thought fucking could require accessories before he started having his way with David on the regular—but there was one particular episode involving a blindfold and Joe's mouth on David's ass that would be hard.to describe as anything short of a resounding success. Joe likes simple dick-in-hole stuff if left in charge, but sometimes hearing David out pays off.
"Fine," Joe says eventually, "let's hear it. With any luck it'll get it out of your system."
"If you're going to make fun of me then—"
"Jesus, sweetheart, don't be such a wilted flower and spit it out."
"I want to play a game," David sighs after a moment, audibly frustrated. "A game of trust."
Joe stiffens immediately, and not in the fun way. What the fuck is a game.of trust anyway? Is this a fucking test? Is there a correct answer he's supposed to give if he wants to keep this thing he and David have been working on for over five years stable? Is that what it is about? Because if so—
"I mean," David continues, clearly having sensed Joe's sudden step back, "I want—I want to have the initiative, this week."
The whole week? Granted, Joe's off work, but still. And besides:
"The fuck you mean, you want the initiative?"
"I mean," David says, clearly clinging to that overly factual composure he uses as a defense sometimes, "I want to be the one to start things, between us. And I want to be sure you won't."
"Webster," Joe warns, if you think I'm gonna let you—Fuck, I don't even know, you asking if you can tie me to the bed or what?"
"No," David says immediately.
He doesn't sound like he's lying, but he's also turning deeply pink in a way that makes Joe wonder if he should consider using the bedsheets in unprecedented ways. It's an idle thought, but it makes him feel immediately and needlessly embarrassed, so he groans:
"Then fucking what?"
"I just—I don't want to tie you up!" David repeats. "Just. If I start something, you could just. Keep your hands to yourself."
"And what, just lie there and think of England?" Joe provoques, and David finally leans away from him under the light sheet they use in summer.
"No! Jesus, Joe you make it sound so—I just want to be allowed to tease you a bit alright?"
Joe scowls at him.
"So like. Tying me up with a promise instead of strings."
David let's out an exasperated sigh but nods anyway. Joe should probably say no. It's stupid and unnecessary, and it's not like David minds when Joe's the one in charge, quite the contrary. In fact, Joe's starting to think if anyone's ever going to get tied to their bed it's likely to be David. But then there's. Mmh.
See, the thing about the blindfold was: Joe may have complained about how ridiculous it was right down to the last minute, but the way David reacted to it was—well. Resounding success. But even before that, there'd been something intriguing. A current of curiosity Joe would rather chew his own tongue than admit to, but which had run shivers down his spine anyway.
Right now, there's a tingle behind Joe's ribs, and so he only Rob's David for a few minutes more before he pretends to feel very magnanimous and ask:
"So that's it? No other rules, just... No touching you?"
David hums and tilts his head, and Joe's suspicions are confirmed: this is a game of control. And David played Joe like a fucking fiddle by calling it a game of trust. Fucking hell. Well, two can play that game, and it may not be this week but someone's definitely gonna get fucked until they beg for mercy in the future.
"Yeah," David says. "And, you know."
Yeah. There was an incident early on when Joe hadn't quite realized David had been serious when he'd laughingly told him to stop touching him after he came. David isn't shy, and a solid push of his thigh against Joe's head was enough to get him to actually stop, but it seriously soured both their moods for a couple days. Since then, they've learned to be a little more careful when they play those games where one of them might say stop without really meaning it.
And, well. David's games are often irritating and tend to bring Joe pricklier attributes back to the surface, especially at the beginning, and Joe knows himself enough to realize he might not be able to stop his mouth from running away from him. It's good they've always been good at hearing each other past the mouth noises.
Armed with this knowledge, the tingle on Joe's spine shivers south, and Joe hears himself ask:
"When do you wanna start?"
David, beaming rolls them in bed until he can pepper kisses all over Joe's face, and by the end of the ensuing solid—normal, classic—bout of lovemaking that follows, he's all but forgotten his question.
ETA: More from this first draft in reblogs.
ETA 2: Currently publishing a cleaned up and fleshed out version of this over on terresdebrume @ AO3 for those who would like more of that kind of porn :P
55 notes
·
View notes
Nagi's "Hidden Path"/ Loophole
*featuring Isagi, Bachira, and Rin analysis*
I've been thinking a lot about how Nagi represents a "hidden path" in Bluelock, and the ways in which it seems the main manga and episode Nagi disagree on whether he should succeed- the key issue being his relationship with Reo. He plays soccer for their collective dream in a manga where depending on another character for your motivation is treated as soccer suicide, which should doom him, but his own manga starts with the statement that his genius is shaped by Reo - framed as a good thing.
I've said in the past that maybe Nagi will succeed by Episode Nagi's standards, but fail by Blue Lock standards, and I still think that would be an interesting path to take, but rn I wanna discuss the alternative that Nagi succeeds by both standards, even if to a lesser extent in the main manga since Isagi is the MC. And we're assuming here that his relationship with Reo isn't permanently severed in a way that makes him more similar to every other Bllk character bc that would make him much less interesting and also remove the "hidden path" aspect that we're expecting here.
So for him to succeed by both standards, I think what essentially needs to happen is that Nagi represents a loophole or caveat in Blue Lock's philosophy. And to understand why that would be the case, we'd have to understand WHY playing for anyone but yourself is a bad thing in Blue Lock. And there are plenty of examples to draw from.
Isagi and "All for One"
We can start with the "One for all, all for one" team Isagi was in- the most extremely dependent soccer we see. I'll be drawing from Isagi's Light Novel for this, because it really just spells it out. First, let's look at the reasoning for that "all for one" given in response to Isagi's request to shoot more:
“Up until now, You could have won matches with your individual skills, but high school isn’t a piece of cake... We win together, and become stronger together! If you do that, then you'll have double the joy! And half the sorrow!”
The reasoning given here isn't that the resulting soccer is better at winning games - rather there is an emphasis on safety. "the world is tough", "If we stick together, there's half the sorrow". And within that emphasis, is the implication that the individual isn't enough.
We can also see complacency in this ideaology. When Ichinan loses, the coach says
“You fought well. It’s frustrating, but this is what Ichinan is capable of now. The third years are leaving after this… and some of you might quit soccer after today but you can be proud of the days you fought together as a team."
"To me, Ichinan’s soccer team…is the best team in Japan!!!”
Within this dream doping that Ego rants about later on, we can again see the acceptance on the individual not being enough - "You fought well... but this is what Ichinan is capable of now." We also see within the dream doping the injection of safety and lack of perceived agency. Because we are one unit, there is no blame, no frustration, no need for improvement. The point is the team, not to win, so be proud.
Most damning is the way we see this reflected in Isagi
There’s no need to take a risky battle. If they lose, it will be his fault and he will feel bad for the team.
He makes an exquisite pass to Tada's feet. A perfect last pass.
What's emphasized here is the risk in making an egotistical decision for the whole team in believing himself good enough to make that shot himself. What essentially happens here is a devaluing of the self - " I'm not good enough on my own, its safer to trust others, trust the system, not your instincts" And that forces Isagi to not live up to his fullest potential, to chase what he wants. Until Blue Lock that is.
Bachira and the Monster
Bachira is probably the character most directly "punished" in the narrative for playing for someone else. Though I feel like punish is the wrong word because this problem with his ego reared its head and was resolved in the same game - once he realized the problem, Bachira resolved to solve it
According to Bachira's explanation
"...Until now, I was afraid of playing soccer by myself. I guess I wanted you to come save me. But, once I tried fighting on my own, like I'd done as a kid, I realized...
And so the problem with his habit of looking for another player when playing instead of focusing on himself was again the perceived lack of agency, and devaluing of the self. Longing for someone to play soccer with led to a dependency that negatively impacted his decisions on the field
So that's why his moment of growth was breaking through all on his own to steak back Isagi and win - ignoring the idea that he should wait for someone else to help him. He needed to believe in his own agency/value to prove himself on the field and achieve his goals.
Rin and Sae
I recently took a look at Rin's Light Novel and there was a line that stood out as kinda similar to Bachira's old habit of passing to an imaginary monster before coming to Blue Lock
he understood why things were not going well. Neither their coach nor his other teammates have the slightest idea of Rin’s image of play in his head.
(If it was Nii-chan, he would have made a pass here……) he thought so many times during today's practice. He jumped out in front of the goal to a position where I said, “Here!” but his teammates were like, “Huh?” “There?”
So whether you're passing or shooting, a reliance can develop, huh...
(How do Bachirin shippers feel about this parallel? haha. And what does this say about what Rin says to Bachira "But afraid of fighting alone. It is a soccer looking for someone. That luke-warm ego won't make my heart dance". Cus it seems Rin is criticizing Bachira for doing the same thing he did. What does this mean about how Rin feels about himself? (I mean.. he did already call himself lukewarm later but was he thinking about himself in that moment?))
In the light novel, I think it becomes clear one reason why Sae is so against Rin using him as his reason for soccer - it definitely affects how Rin plays when Sae is away. And since Sae becomes aware of the competition outside Japan during his time abroad, he knows that Rin's mentality as it was wouldn't be enough and thus wanted to spare him the suffering and have him give up. And this is in combination with the idea of "I've found out, that I'm not strong enough to hold you up. If you rely on me you'll fail" At least, this is my interpretation of it - but moving on-
With Rin’s last pass, they score a shot.
If his Nii-chan had been there, he would have passed the ball to him in front of the goal and he would have scored it directly….. He stopped thinking.
No pass is coming. That is now the reality. Anyway, the team won for the first time in a long time.
We see a lack of agency and a reliance on others once again - "If only Nii-chan was here". Like with Bachira, Rin is waiting for someone to "save" him, which limits what he chooses to attempt and stifles his potential because of how it limits his perceived agency.
We can also see this limitation in how he wants to be 2nd best after Sae - not best (de-valuing). It causes Rin to seal off his ego in order to catch up to Sae, by being more similar to Sae instead of developing according to his own unique talents/ego.
In order to catch up with his Nii-chan he saw off at the airport, he has to make the team’s victory his top priority. To do so, he must hold himself back.
Hold back the you who was trying to steal the goal with everything you have using that sense of smell for the goal and assemble an attack as a team play.
Even after Sae's return he's always on Rin's mind, and this still limits his soccer. It's only after Rin declares himself lukewarm and rejects the stories others create through their relationship with him that he is able to go all out by embracing his own personal style, rather than focusing on others.
Back on Topic!
So in summary, what is wrong with depending on others? What causes Blue Lock to default to individualism? Ultimately it seems like its the resulting lack of perceived agency - the idea that you can't do things without other people present. By constraining yourself into a narrative with other people, you limit what you can do, and you limit what you think you can do by molding yourself to their vision. Thus, your potential is stifled.
How can Nagi and Reo become an exception to this reasoning? Well, maybe Nagi's decision to leave Reo during 2nd selection is part of the key.
We know from Episode Nagi and Manshine that Nagi wants to improve for the sake of his and Reo's collective dream. And he (correctly) identifies following soccer that challenges/excites him as the proper way to improve.
Here, Reo identifies them playing together as a must, but Nagi corrects him and saying that them being the best in the world together is a must, saying (in his head T-T) that he likes being with him, but that in order to protect their dream, Nagi needs to change.
It's actually pretty much spelled out here. Nagi says he's fine with Reo playing with other people, but insists that Reo stay with him till the end. Its ok to play soccer with others, but keep me in your heart always. In other words, I don't mind not playing together, but you and our end goal is always in my heart.
This is different from Isagi, Bachira, or Rin's situation because in those cases, the team/monster/Sae were considered as key to success. However, in Nagi's case, success is key to Reo. It's completely reversed. It's that nuance of "I play soccer to play soccer with you, to win with you" vs. "I play soccer for you, I win for you". Because "playing together" is not a requirement for winning, it no longer acts as a constraint that restricts agency. Nagi's concept of being together separate from playing soccer together saves their partnership from being the same as the others and frees him to (for example) join Isagi to improve.
You can see more of this in epinagi
The Tag Game
You might say this is a bad example because Nagi relies on Reo to get him un-eliminated, but by Nagi's "I figured you'd do that, Reo..." we can guess that this was more from laziness than a belief that he needed Reo's help. Indeed, when Reo's in danger of being eliminated himself, when their dream is in any real danger, Nagi takes it upon himself to solve the issue
They didn't solve the problem relying on teamwork/partnership or anything. Nagi solved the problem because they're partners.
Playing Against Barou
The next time their dream is "Challenged" is when Barou says "Becoming the world's best striker means you'll be alone until you die", essentially a challenge to the viability of Nagi and Reo's dream. Nagi's response to that is to run off and instigate a 1v1 with Barou
So again, rather than deny Nagi options, his partnership with Reo provided the motivation to act out on his own.
Playing against Team Z
Even when they play against team Z, we see this in action. Nagi plays a more reliant soccer, his dream/Reo is challenged when he sees Reo's face, and Nagi decides to act out on his own.
Nagi will rely on Reo for the sake of laziness, but when it comes to their dream, there's this pattern of deciding to rely less on Reo, take destiny into his own hands, and make an effort. It's really that nuance of doing something to be with someone vs. doing something for someone.
Beyond 1st/2nd Selection
Brief mention here of Nagi's eyes shining when Reo says "But it's not enough" when Nagi praises him. I think this might be Nagi thinking its a sign that Reo in fact has not forgotten their promise and is also working to achieve it - consistent with the idea of being together without necessarily playing together (Whereas Reo is thinking the other way round - improving for the sake of playing together because that's the only way to be together)
So, where this theory hits its roadblock is the Manshine City Arc, where Nagi asks for Reo's help. But because of all the ominous foreshadowing afterwards, in addition to Ego's words that Nagi's deep ego (implied by timing of skull imagery +all the scenes I just listed to be Reo/dream-centric) is about to be tested, I think their dynamic is bound to change in some direction within the next game. So, their relationship is still in development and the theory isn't necessarily debunked.
**edited in addition** I think the key is that regardless of their behavior, the core of their partnership (ie their internal feelings) isn't dependency, but rather reciprocated faith and commitment, though especially with Nagi's communication and introspection issues, it may take some time for them to figure that out because Reo has no idea the faith that Nagi has in him. Reo actually assumes that their partnership can't exist without dependence - assumes its over when that dependence fades because Nagi will have no reason to stay with him, but this is him insecurely misinterpreting Nagi's intentions. They also can't really flourish until Nagi figures out his ego/motivation, though that's luckily foreshadowed to be addressed.
I think with how Reo misinterprets Nagi's motivations on a shallow level in 207, and how Nagi's motivation is foreshadowed to be addressed soon, we will get nagireo communication soon timeline wise (not real life lol). And hopefully with that communication, Reo's insecurity + Nagi's motivation can be addressed and they can begin to figure out a functional partnership within Blue Lock.
But really the key here is that faith and devotion don't necessitate playing with only each other in mind, while dependence/reliance does.
In terms of what will happen, I think we might finally get a confirmation of what Nagi's ego is - it certainly fits with their conversation in 207, where Reo tries to give a substitute that doesn't really fit. I'm not sure what would happen once Nagi and Reo have the clarity of understanding what Nagi's ego is though...
In Any Case!
I'm running out of fuel but just to let ya'll know I was thinking really hard about what the difference was between Nagi and Reo's dynamic in comparison to partnerships or teamwork criticized by the main manga and I did not expect the difference I came up with to be the difference between reliance and devotion. "I am not enough by myself" vs. "I will make myself enough for you". I still wonder if I'm just biased?
Plz lmk ur thoughts
link to a continuation of these thoughts - Hiori's Words, Reo's Insecurity, Nagi's Enforced Indifference
135 notes
·
View notes
Invades your inbox
Hihihihi!!! I wanna ask, what are some songs that remind you of J+H :33??? ((/nf))
HELLO!! :33 THANK YOU FOR THIS ASK! THERE ARE SO MANY KVKSKVKSLC
OKAY, SO! First of all, *casually drops my J&H inspired playlist* all the songs I mention are on here, (WHICH ARE ALL SONGS THAT REMIND ME OF JEKYLL AND HYDE (all songs I've been recently obsessed with, someday ill go back in my liked songs lmao) AND SOME REASONS FOR SONGS ARE SUPER SPECIFIC, PLZ DON'T BULLY ME PEOPLE 🙏) so if you mayhaps wanna listen to any of the mentioned songs, they're there :3
BUT, ONTO THE SONGS AND REASONS!
Of course there's all the Will Wood songs from this list I did forever ago, but there are some other Will Wood songs I didn't put on there, like -Ish (which reminds me of Jekyll) and Cicada Days (which is literally University Lanyon and Jekyll)
Onto the various artists!
Pray To God For Your Mother by Dance Gavin Dance- BIG Jekyll song to me. "Dependent on the medicine to keep my colors vivid", " part of me wants to believe that I will not come apart at the seams, that I will learn from the cut when I bleed", "blame it all on the lamest dude, blame it all on the payments due", " didn't think id have to answer for the lies I told myself, at least not so soon" I MEAN CMON
Lights Out by Mindless Self Indulgence- for Hyde, the little adrenaline junkie.
Mr. Doctor Man by Palaye Royale- Jekyll energy, ofc. "Mr doctor man questions his hands, lost his mind, clinically fine, but he found a way to cope, needle in his throat"
Necromancin Dancin by Bear Ghost- Hyde, but instead of it being, ya know, the dead, it's him unleashing the nightmares on Jekyll. "Now we've found it, I'm astounded, every town will be surrounded by a throng of marchin' death, delicious the riches that glisten ahead!" Plus all the dancing references work bc he unleashed them at that party :3
Ghost Town -Revisited- by Trickle- Jekyll, once more. "So sick of this city's disguise, it glowing on the surface but it's drowning in lies", "Is there a reason that I'm wanting to hide when I look into the mirror just to see empty eyes?", "ghost that tried living a tired life, I'm haunted by the memories I buried inside"
Evelyn Evelyn by Evelyn Evelyn- Jekyll and Hyde, another one where basically all the lyrics are spot on lmao, but I will say I see the feminine voice as Jekyll and the Masculine one as Hyde :3
Turn The Lights Off by Tally Hall- Jekyll and Hyde
There's also a lot of Chonny Jash ones! Obviously The Ballad of Dr Jekyll and The Mr Hyde Jive, but also:
A Devil's Tricks- this one is literally just Jekyll and Hyde, idek what else to say lmao. Like, this dude sitting in lowkey self loathing while his mind tells him bad things? Not to mention the accuracy of the lyrics in general. Id list them, but then id just be pasting the whole song 💀
End the Dance- Lanyon and Rachel being the ones caring, and then switches to Jekyll. Once again don't really know what lyrics to throw in lmao
Banana Man- Jekyll and Hyde, with the whole banana thing being Jekyll becoming Hyde. "Forget all your morals and go with the flow, forget about the bad the good is all you know, and forget about the voice that's lying deep inside, the one that's screaming and screeching proclaiming wrong from right" "tomorrow morning on the plane, no banana makes you go insane. Floating back to busy town, no banana makes you want to frown"
Don't Take It Personally- EOUGHKEKOGKD another angsty Jekyll and Lanyon song.. "You can surrender your heart, but it won't be enough, don't take it personally I'm afraid of love" "if the drugs aren't in my system, then what the hell has blurred my vision?" "My wrist and my heart where you kissed pulled apart" "so just keep playing your part, and ill keep calling your bluff, don't take it personally when push comes to shove"
Push- Jekyll, ofc pushing all his friends away. "I see you trying to slowly turn your back on them, the shadow of who you were when back when you felt condemned"
I also have a bunch of other CCCC songs but idk how to explain why my mind thinks they fit, so I'm just gonna list them and idk, some might get brief explanations
Ruler of Everything- Jekyll trying to stop Hyde from going out, then Hyde literally ruining his life.
Dream (Outro to Calamity)- kinda specific to my little "Whole Jekyll" AU (as most of these are to some slight degree)
The Mind Electric- Hyde
Be Born- also Hyde
Light- Jekyll and Hyde
Good Day- Jekyll
Just Apathy- Jekyll, with Hyde as mind
Two Wuv- Jekyll
Greener- once again, Jekyll
Mucka Blucka- Jekyll and Hyde, (and my "Whole" Jekyll)
We're gonna Win- Jekyll and Hyde (except eventually getting along)
There's some on my playlist ik I didn't mention, but I think this should be good for now, LMAO, AGAIN THANK YOU SO MUCH FOR THE ASK GJSKKVKD ILY GUYS 🗣️🗣️🗣️
30 notes
·
View notes
I traveled fifteen hundred miles to meet you
Maverick x daughter!reader
series masterlist
my masterlist
summary: you begin training and quickly make a name for yourself
a/n: soooo I decided to get rid of the hangman romance that I was gonna put in, and kind of wrote over the scenes as hangman x phoenix (sorry) I didn’t wanna get rid of a whole section ..
ps : sorry for the wait :’( i’ve been swamped with life stuff
warnings: PTSD, child abuse (mother- daughter), feeling unwanted, violence ? canon typical mostly, death, loss of a loved friend
The drill is simple in theory.
Shoot down Maverick, you win.
But, like your unfortunate lack of skill playing eight ball, the execution is getting there. The first team to go in is too cocky.
He gets them, easy.
Hangman and Phoenix give him a run for his money, but not by much. You’re up next, with Hangman as your wing man.
Strapping into your jet feels almost surreal. It’s an awesome feeling to be back.
It’s not until you’re in the air that the flashbacks start.
You and Hangman take off, having decided pre-exercise that you were going to try to divide and conquer: one of you as bait, the other lying in wait for Maverick to take it. You, as the pilot with the best evasive skills and maneuvers, drew the short stick as the bait in the experiment.
you know that Hangman is notorious for leaving his wingmen behind, so you’re going to be looking for chances to give him a little of his own medicine.
“Ready, team?”
You’ve become more comfortable with the notion that Maverick is your dad.
It hit you, while you were lying awake last night, that maybe you should be mad that he left. Your mom always had been angry at him, but could you really blame him for leaving the crazy woman who gave birth to you?
the answer is no, because you did the same.
“Ready when you are cap’n.” You flick on the proper controls and Hangman gives you a Shaka sign, signaling his okay.
And then you’re off.
The rush is exhilarating. It’s not until you can hear Maverick behind you and Hangman warning you that he’s on your tail and you need to shake him that the flashbacks start.
You grunt, forcing your jet up and over in a backwards barrel roll to escape Maverick’s targeting system. You begin a classic evasive maneuver, the realize he’s not even on your tail anymore.
“Majesty! he’s on me!”
“Shake him, then!”
But you follow your radar to where Hangman’s getting chased in a high speed game of tag, and readying your targeting system.
“Majesty, where are you?” Hangman shouts into the comm. You hear the familiar beeping.
He’s done.
You’re on your own.
Majesty! Keep moving! there’s still a mission to complete!
the rough voice of your former commander rings in your ears as you pull up in a steep climb, about to try a new maneuver.
(Y/n). I’m sorry. Duchess’s vitals aren’t looking good.
You metaphorically slam the breaks in your plane (which you can’t do because there are none) and let yourself free fall. It’s a special trick that you and Tae always practiced.
“What the fuck kind of maneuver was that?”
Maverick’s rough voice breaks the comms. You click your targeting system on and hit him. The beep over the comm would be music in your ears if you weren’t stuck in the past.
“Wake up! Y/n, we need to go fly before training starts!” Tae, your best friend and wingman (wingwoman?) has always been an early morning productivity person. You always joke about her absolute inability to sleep in, even when you’ve stayed up till three the night before engineering new tricks and stunts to try the next morning. “I have an idea!”
“Uh oh,” you say through a yawn, already tossing on your uniform and tying your hair back. Tae rolls her eyes, then practically sprints out of your dorm room, you got on her heels.
she collected me, up off the ground where you abandoned things
“That was some damn good flying out there,” Hangman tells you. He’s bought you your first mocktail of the night - a fancy-looking ombré concoction that Penny’s cooked up for you. “If only I’d been alive to see it.”
“Don’t you worry,” Phoenix butts in. “We all saw it, and we also all saw her hang you out to dry!” her tone is just a little too gleeful. “Now that’s something to toast to!”
“You wound me, Trace.”
You toast with Phoenix, then excuse yourself from the pilot’s table, seeking some fresh air. You’d snapped out of your flashback, but Tae’s laugh still rings in your ears. You make your way out to the deck and lean on the railing overlooking the beach and the ocean.
“You’re one helluva pilot.”
You rub your nose with your forearm.
“That’s what I keep hearing.” You close your eyes, wondering if you should confide in him or not. Probably not. He’s your instructor, not your dad.
I mean, he’s also your dad.
“whatcha drinking?” You steal a glance at your drink, which has faded to a dull pinkish orange. Maverick’s holding a bottle.
“Some kind of mocktail Penny came up with.” you take a sip of it. “I don’t drink,” you add after a moment.
“Well, you’re better than all of us, then.”
You grin and shake your head. Looking out over the water, it’s easy to forget why you’re here and be transported back to the past.
“Now that,” Tae begins, setting down her gin and tonic on the table and admiring the multicolored mocktail Penny concocted. “That is what I call a mocktail.”
You take a swig.
“See, Duchess, Apollo was wrong. Mocktails can be fun!”
“I never said they weren’t!”
This is the last night you have at top gun, and, appropriately, you’re a spending it at the Hard Deck, which is a newer bar that just opened. You’ve made fast friends with the owner and her daughter - Amelia.
You glance outside and gasp, standing up.
“Come on! look at the sunset!”
You rush out to the front deck, wide eyed and giddy at the pure beauty of the sunset. Tae trails behind, watching you watch the colors paint the evening sky.
“Can you believe it’s over?” You ask her. “No more coming to the Hard Deck, no more Apollo or Clipper, and pretty soon we’ll be deployed on the other side of the world.”
Tae sighs.
“You know what I think? I think this experience will stay with us forever. I’ll always remember the pranks we pulled on the guys and the late night beach walks. It’s like graduating high school. or the academy. This chapter of life is over, and we need to move on.”
You give her a wry smile.
“You know, you may be a dumbass ninety five percent of the time, but you do give some damn good advice.”
“Want another?”
you nod.
“You’re a damn good pilot. You’re top of the class for a reason. Don’t you ever forget that.”
you meet her eyes.
“Duchess-“
“Hey. You with me?”
Maverick snaps his fingers in your face, trying to snap you out of your daze. you shake out your neck.
“Yeah. Sorry. What were you saying?”
“I was telling you I’ve never seen a plunge like that executed correctly, and then you zoned out on me.”
You focus your gaze on a spot on the horizon.
“Yeah, uh, I was just remembering.. something.”
He looks at you, doing a once-over, face skeptical. He almost looks.. concerned? Again, you wonder, if you were in another life, would he be worried for you, his daughter, instead of you, his pilot.
“Anything you wanna talk about?”
Yes. You’ll understand. You’re probably the only one here who would.
You smile sadly.
“Goodnight, Captain.”
he filled the holes that you burned in me at six years old
The next morning, Maverick sends you all an email to wear “beach clothes you can run around in”, so you, Phoenix and Halo all put on your shorts and sports bras, and Halo puts on a t-shirt. The email also ordered you to meet in front of the Hard Deck, so that’s what you do.
You leave significantly earlier than the rest of the group specifically to see Amelia, who you still haven’t seen since coming back to the base. You tap your knuckles on the doorframe, drawing her attention. She looks at you, looks again, gasps and sprints towards you in some kind of flying tackle- hug.
“Hey!” You exclaim, squeezing her tight and spinning her around in a circle. “You got big!”
Amelia giggles into you.
“Mom told me you were back. I almost didn’t believe her.”
“Well, I couldn’t just never see my favorite tea party partner again, now could I?”
Amelia pulls away, observing you. Her eyes brighten as she remembers your tea parties from when you were in Top Gun.
“I’d forgotten about those! And Tae would bring those little cucumber sandwiches!”
Her face falls in a frown.
It’s like a sneak attack, having someone mention her in passing. You’d been up almost the whole night before trying to calm the memories that have been resurfacing since your return to Miramar.
“I miss her.”
Sometimes you forget that Tae was almost as close to Penny and Amelia as you were. She would always come with you to watch Amelia and hang with Amelia and Penny on the slow nights.
“Me, too.”
“Well, look who the cat dragged in.” Penny comes over to you from the storeroom and hugs you. She then holds you at arms’ length and looks you up and down. “Now, I know you’re busy, but tomorrow isSaturday, and I’d love for you to come for dinner like we used to.”
The unspoken with Tae beats down on you. You glance out of the window to see the rest of the squad gathered there in varying forms of swimwear. Most of the guys are wearing obnoxiously printed swim shorts, obviously wearing no shirts.
“That sounds… great. I’ll be by. Text me, okay? I have to go.” You give Amelia another squeeze and beeline out of the bar, joining the group of your fellow pilots.
Maverick’s the last to get here, wearing a white shirt and a pair of jeans, holding two footballs.
He introduces the game: dogfight football, offense and defense at the same time. It doesn’t really sound like there are very many rules in the game, only that you get touchdowns occasionally.
He also divides the teams. You and Phoenix are together, Bradley too.
And then you’re starting and you have actually no idea what you’re supposed to be doing; you never were adept at playing football.
You’ve been paired up with Hangman, who must be going easy on you, because you get past him every time, even scoring a touchdown once. About half and hour in, he strikes a deal with Phoenix.
“Okay, Trace. Here’s the deal,” he says between plays. “The next touchdown, if it’s your team, I’ll buy a round for everyone the next time we all go out.”
“okay,” Phoenix glance at your team. You’re all looking pretty skeptical, as you should. “What’s the catch?”
“I my team gets the next touchdown…” he drags out. He leans in and whispers in her ear. Her face breaks into a cautious smile.
“Deal, Bagman, but I’m just warning you, that’s an awful deal on your part.”
He shrugs, flashing you a perfect smile.
The next touchdown goes to Halo, who’s on Hangman’s team, and everyone turns expectantly to him, wondering what the bet was. He walks up to Phoenix, dips her and presses his lips to hers.
You let out a wolf whistle. She breaks the kiss and flips you off before pulling Hangman in for another one.
Coyote’s making a point of covering Bob’s eyes. Rooster has a hand over his mouth, pretending to retch and you jog over to him, patting him on the back, face splitting in a smile.
Penny shares a look with Maverick as they watch the two young people kiss. She’s smiling, and that makes him smile.
“What do you think of her, now that you’ve flown with her?”
She nods at the pilot in question.
There’s so much he can say about her: smart, confident, thoughtful. Reckless and sassy and a little bit too stubborn. She’s talented, anyone can see that, maybe even the best on the squad, but she’s holding back.
She’s hesitant to fly with anyone but herself, even leaving her comrades out in the open in favor of shooting down the enemy, which is surprising, considering her most recent deployment.
Her deployment. He finally got around to looking into that, the incident that sent her into leave for more than half of the last year.
The report had been brief: routine patrol, they had gone to investigate a distress signal, not enough ammo or fuel. Someone detonated a missile too close. Duchess went down. Majesty took down three bandits in the span of five minutes before her aircraft was too damaged to continue flying.
There had been no saving duchess. she was waterlogged and impaled with a scrap of metal before Majesty was even there to save her.
Very, very traumatic.
It reminds him of Goose.
he’s surprised she’s even willing to fly at all after that.
“In all seriousness?” Maverick looks out over the game. She’s awful at football. Can’t throw a spiral. “She’s a good kid. Even better pilot. She’s been the closest to finishing the course out of all of them.”
She glances over at the two of them, waving to penny before jumping for the ball.
“She reminds me of you,” Penny tells him. “You’re more similar than either of you know.”
Admiral Kazansky, AKA Iceman has been a mentor to you since the beginning. He’d taken a liking to you and your reckless flying when you’d first joined the Naval academy. Said you reminded him of a friend of his. You’d always thought he meant his wingman, and he had, but more recently, you’d realized that his wingman was the one and only Maverick, AKA Pete Mitchell, AKA your dad.
You knock on the door and his wife lets you in. Her eyes are red and puffy.
“Sarah…” you say, hugging her. “It’s back?”
she shakes her head.
“we don’t know. he can’t even talk without the pain coming back.”
You squeeze your eyes shut.
“Maybe I shouldn’t-“
“He’s in his office,” she tells you gently. “You know he always wants to see you.”
You purse your lips, smiling tightly.
“Thanks, Sarah.”
You ease the door to Ice’s office open, He turns to face you. He’s paler, gaunter, and wearing an overcoat and a scarf. you know enough to know he’s not doing well.
“Hey, Ice.”
He points at the seat across from him.
Right. He can’t talk.
“I had to see you.” You sit down and reach into your purse. “Kevin sent me this.”
You pull out the wrinkled, folded photograph and hold it out to him. His shaky hands pull it taut as he squints at it. You hold your breath, waiting for some kind of surprise to show on his face. Something, anything.
“Did you know? Is that why you kept me around?”
Your voice shakes uncontrollably. Like most things recently, you want to be angry, but you just don’t have the strength or conviction anymore. You just want to know.
Ice hands you the photo back and types on the computer.
Yes.
No.
your breath catches.
“How long?”
Since we met.
You sigh shakily.
“Why? why didn’t you tell me?”
Ice stares at you.
You stare back.
“How long did the doctor say you have?”
Weeks.
You gnaw at your lip.
“I don’t want to lose you, too.”
You’re not going to.
You shake your head, wiping under your eyes, trying to stop the tears from falling.
Losing Ice hurts. He’d always been there for you when you needed to talk. Even now, when he can’t use his voice.
He clears his throat.
“Tell… him.” His voice is raspy and wet. It grates on your ears like it must on his throat.
you nod vigorously.
“I will. I just… I want him to like me, you know? before he feels obligated to, I mean.” you stare at the picture of the two of them on Ice’s desk. “I don’t even know if he’d be happy to know.”
He will.
there’s a soft knock on the doorframe. It’s Maverick. Of course it is.
You grip Ice’s hand.
“Looks like your next appointment is here.” Your laugh is wet. “Bye, Ice.”
You nod to your father as you leave. his brow is furrowed in confusion, but he nods back.
Penny and Amelia’s house is one thing in North Island that’s always stayed the same. the smell of candles burning constantly, amelia’s artwork hanging on the walls, (which, admittedly, has gotten a lot better over the last few years) and the little bits of clutter scattered around the house.
You’ve dressed up a bit, put on some makeup and washed all the gel out of your hair for the occasion. when you get there, Amelia drags you to her room almost before you can say hello to penny.
“Okay. Where’s the fire?” You tease, once the door is shut and you’re sitting on Amelia’s bed. She’s giddy in anticipation to tell you her news.
“I have tea,” she whispers conspiratorially. You lean in.
“Lay it all out for me.”
“Mom had Mav over last night.” her tone is smug. She’s obviously very happy to be able to tell you this news. “He tried to sneak out but I caught him. And,” she looks around and lovers her voice even more. “He’s coming over for dinner tonight!”
“No!”
“yes!”
“That’s crazy.”
It’s crazy that you literally keep running into him. It’s not like you’re avoiding Maverick, per se, but you still don’t know how to break the news to him.
Hey man, great lesson today. Oh, by the way, I’m the daughter you didn’t even know you had because my mom ran away when she found out she was pregnant. Yeah, I know it’s fucked up. If I was on good terms with her I would ask why, but she only calls me when she’s drunk.
That’d go over well.
Amelia crosses her arms.
“That’s my tea. Now, tell me yours. Tell me about Top Gun.”
You look around her room. She repainted the walls a shade of yellow that you love. There are pictures hanging on the walls. One, a big one over her desk, is your favorite picture: a selfie you took of you, Amelia and Tae when you took her to Malibu to learn to surf.
“I love that picture,” you admit. Amelia nods, getting up to remove it from the wall. “Top Gun’s… not the same without her. Nothing is.”
Amelia’s always been wise for her age.
“I see her everywhere. I mean, I know I don’t, but I do.”
You smile tightly.
Grief sure is strange. Even Amelia feels the loss of Tae heavily.
There’s a soft knock on the door.
“Girls! dinner!”
“What were you two talking about in there that was so important I couldn’t be part of the conversation?” Penny asks over the steak she’s prepared.
“Oh… nothing…” you take a sip of water.
“Just how Y/n’s in looooooooove,” Amelia singsongs.
You shoot Amelia a dirty look.
“We were actually talking about how the two of you have been canoodling.”
Maverick stops, his fork hanging in midair. Penny’s expression is priceless.
“Yeah, I mean why else would Mav be invited to Saturday dinner?” Amelia asks. You nod along with her sagely.
“This used to be a girls night,” you explain to him. “When Duchess and I were in Top Gun.”
“ah,” is all he says.
You pat your pocket, remembering the gift you had brought for Amelia and Penny.
“Actually, we were just talking about how Tae and I would take Amelia out on the weekends,” you tell Penny. “And I just remembered I brought this for you guys.”
You take the strip of photos from your pocket. It’s a photo booth strip from a long weekend taken to Disney. All four of you are smushed into the booth, wearing matching Minnie ears, leaning into each other and grinning.
“I have a copy, so you keep that.”
Penny admires it, sad smile forming on her lips. Amelia peeks over her shoulder, grinning. You avoid Tae’s eyes. They used to pierce you. The still do.
“I’d like to toast.” Penny raises her glass, setting the strip down. “To new beginnings.”
“to new beginnings,” you agree.
You don’t get very far into dinner before your phone rings. You decline the call. five seconds later, it’s ringing again.
Decline.
“Do you need to take that?” Mav asks (he’s gotten you to stop calling him sir, finally.) and you shake your head.
“It’s my mom. Hang on.”
Penny and you share a look. She raises an eyebrow. you shake your head.
Nothing to worry about.
You’re suddenly very hot as you excuse yourself from the table. you’re not quite out of the kitchen when you pick it up.
“Mom?”
“Y/n? Is this my disappointment of a daughter?”
you sigh into the phone, staying silent. Her jab sends tears welling up in your throat. Spending time with Amelia and Penny has always reminded you of the mother you could’ve had.
“Where’s your deposit? Where’s the money you owe me for giving you life and a roof over your head?”
You hurry to ease the door shut. The deposit. Goddamn. She’s sober enough to remember it. Ever since you moved out, you’ve been wiring her deposits every month to make sure she keeps living. You’d hoped it was enough to send her to rehab, but she refused to go.
“The deposit?” you say faintly, heart dropping.
Her voice gets thin and screechy over the line. You can’t bring yourself to pull the phone away from your ear as she spits barbs at you. You cover your mouth to muffle the wet sobs escaping your throat.
“You never wanted what’s best for your family! You left me for the Navy. You’ve never done anything right and that girl - Tae - died because of it.”
She’s never gone there before.
And you’ve never had anyone lay it out for you.
“Mom. mom. mom, stop!” You gasp out. “Everything I’ve done if for you! The money, the house, I stayed. For you!”
You don’t hear the porch door swing open.
“I didn’t owe you anything! I never did! I didn’t ask for you to have me!”
Your mother begins to argue with that, that you forced her to have you. You cut her off with a gut wrenching cry.
“I JUST WANTED YOU TO LOVE ME!”
You tear the phone from your ear and slam your thumb on the red button.
“Y/n.”
Penny.
You drop your phone, defeated. Penny reaches out hesitantly and uses her fingers to wipe your cheeks.
She’s hugging you and you’re crying before you can even know what’s happening.
To new beginnings.
begged you to want me, but you didn’t want to.
“Rooster.”
he’s pissed, drinking his second bottle.
“Rooster.”
You sit down next to him.
“What do you want?” he snarls. You gingerly put your hand on his shoulder.
“Are you okay?”
He leans into your hand. You sigh.
“Phoenix and Bob are gonna be okay. I went to see them before I came here. They’re not injured. Just shaken up.”
He slams his bottle on the table. You finch away.
“Did Maverick send you?”
“what? No.”
Surprisingly, it had been Hangman who told you that Rooster was sulking in the Hard Deck. He’d seemed worried about him, so you went to check up on him.
“He likes you, you know. Thinks you’re a good pilot.”
“I am a good pilot.” You nudge his shoulder. “But so are you. So are Phoenix and Payback and Coyote.”
“He pulled my papers, you know. So he must not think I’m that good.”
You hesitate. this has always been a sore subject for Rooster. Saying the wrong thing could result in making it worse- not better.
“He flew with your dad, right?”
Rooster rubs his face and takes another swig from his bottle.
“Yeah. But I’m not my dad. He thought I’d-“
“Maybe he was just scared, you know? Maybe he cared so much for you that he didn’t want to lose you.”
If he had known that you were his daughter, would he have pulled your papers, too? Or would he have wanted you to be like him, be a pilot in the Navy?
“whose side are you on?” Rooster snaps. “You’re saying the same things I’ve heard my whole career. No one thinks the great Maverick could make a mistake, I guess.”
“that’s not what i’m saying, Bradley!” you take a deep breath. “Like it or not, he cares about you. You’re the closest thing to a -“
You cut yourself off, because, strictly, Rooster isn’t the closest thing he has to a child that he has. You gulp back the words.
“Y/n? Are you okay?”
“Can I… tell you something? But you have to swear not to tell anyone else.”
“I won’t,” Rooster promises. You hold out your pinky, and he stares at it. You raise your eyebrows at him. he looks around, no doubt making sure there’s no one who would make fun of him for pinky swearing, and interlocks his pinky with yours.
You reach into your pocket, retrieving the wrinkled, folded picture and hand it to him.
“That’s my mom,” you say, pointing to the woman. “and that…”
“That’s Maverick!” Rooster looks triumphant in his revelation. “So, what, Mav dated your mom?”
“No! Well, yeah, but that’s not what i was trying to tell you. Look at the date on the picture.”
Rooster squints and brings the paper closer to his eye.
“Wait. That’s..”
“twenty six years ago, and ten months after that was taken, I was born.”
Rooster drops the picture, mouth falling open. He’s staring at your face, no doubt picking out features reminiscent of Mav’s. You shift uncomfortably.
“What. The. Fuck.”
“I know!”
“Does he know?”
You hesitate. He might. There’s been a lot on his plate, though, and your last name could be forgettable if they only dated a couple of months twenty some years ago.
“No. I don’t think so.”
Roosters eyes widen.
“Wait so I can’t tell anyone?”
he groans when you nod.
“Y/nnnn you can’t just dump this on me and tell me I can’t tell anyone! That’s too much pressure!”
You snap your fingers in his punting face.
“You listen to me, Bradley Bradshaw. If you tell a single person I will hunt you down and slice you into tiny pieces and then cook you and let Hangman feed you to his horses.”
You cackle at the pure, unadulterated fear in his eyes. “That’s right. I remembered your deathly fear of horses, bitch!”
He’s pale, but his face breaks into a smile.
“I’m glad you’re back to normal, Majesty. You had me scared there for a second.”
You know what he means. Since Tae died, for a while, you had no will to do anything or see anyone- in other words, you were super duper depressed. Lately, you’ve felt lighter, like you can laugh and smile again without feeling guilty.
Here’s to new beginnings.
disclaimer: I know absolutely nothing about how planes work or flying or anything like that
118 notes
·
View notes
I read a bunch of soapshipping fanfics today and I love how so many of them give Tyler actual flaws and treat him more human than he ‘actually is’ in the movie and…I wanna share some hcs i have that make Tyler ‘not perfect’ as well. I get the point that in the movie Tyler was supposed to have none bc the narrator needs to drool over him & see him as godlike but whatever. That man has issues. You can especially see this during when he was going Joker mode when he was getting beat up by Lou. Anyways this is going under a cut bc it’s long
————————————————————————
• I’ll start with the out with one that’s most common which is that Tyler is soooo bad at sharing how he’s feeling or being super heartfelt. The only person he even tells his true deep emotions to is the narrator after they’ve been together for a while. I feel like he would be that way due to how he was raised and or trauma. Getting him to admit to feeling uncomfortable is hard too. He wants to come off confident all the time so he will just smile at whatever is thrown at him even if it’s making him upset or anything like that. Also of course he has a hard time expressing how just deeply in love he is with the narrator and how much he cares about him. (Which causes problems for them both but they work thru it. Nothing could keep the narrator away from Tyler at the end of the day.)
He wouldn’t admit it but I think maybe he also resents himself for not being able to say certain things easier. He knows he hurts the narrator sometimes when he’s not saying ‘the right things’ and he genuinely doesn’t mean to hurt him in that way.
•He can get pretty jealous. Not like how the narrator feels like he’s about to kill himself bc someone even glanced at Tyler but like, if Tyler thinks someone is being a little too friendly to narrator or if he thinks the narrator might enjoy being around someone else ‘too much’ he gets all huffy, smiles threateningly, and either interrogates the narrator over ‘what that was’ later or just roughs him up some when they are in private again. He hates the idea so much that the narrator could look up to someone the same way he does Tyler. He has questions going through his mind along the lines of how are they better than him? What does he see in them? Do they make him feel more loved? And etc.
Hypothetically he should know that the narrator would rather die than touch anyone else & that the narrator sees him as a God but,, Tyler is just like that :/
•Ok now for a not widely accepted hc about Tyler. I don’t think he’s that good at writing or reading. He’s not terrible at it but I think he really didn’t give a shit about most things in school besides history. (He could probably give a big whole speech about how bad school systems are)
He doesn’t really care that he’s not that good at either of those things but does get a little embarrassed about it when the narrator points out he spelled something wrong. He will just grumble about “who cares?” or “whatever dipshit.” The narrator doesn’t mind that Tyler’s not the best at it and helps him out when he needs to without picking on him.
•Kinda canon but he’s a act before thinking type of guy in most situations. He prides himself on it for the most part but also there is times where it doesn’t end well for him. He will defend himself about whatever he did ‘wrong’ for a while until he finally is some how able to admit he’s sorry and shouldn’t have done something (only to the narrator. He doesn’t care that much if it’s anyone else that isn’t especially close to him)
•I think he had a self h*rm problem growing up. He doesn’t do it anymore now that he’s older bc he has fight club and whatnot. I think SH helped him come up with FC since he thought physical pain always helps solve mental pain.
He doesn’t hide the old scars since he can blame it on like a ton of different things and people don’t have a reason to doubt him. Like he can say he got them from years of fighting, while running away after getting caught doing stuff he shouldn’t, stuff like that. Sometimes he also just doesn’t lie about it and just says straight up what they are from. It just depends on who and how he feels that day. Like mostly the only ppl who know what they are really from are the narrator & tylers close family and maybe Marla.
Not to be cringe…I know the “he kissed my scars 😢😢” things can be cringe (believe me I would know) but I think Tyler thinks it’s sweet when the narrator does kiss his. The narrator hates that Tyler ever felt like he had to do that (but at the same time is okay with fight club??? Lol) The narrator has stayed up in bed while Tyler is sleeping and just looked at all of them and thought to himself about how Tyler must of felt, why he felt like he had to, and all that.
•My man has some kinda mental illnesses. I couldn’t say what but he just does. He’s a very impulsive man and can become very manic is all I can really say.
•He will get ideas and plans in his head and focus on them a little too hard and it’s hard to pull him out of it. The narrator is really not someone who should be fussing at people for not sleeping but he does anyways. He offers to work out whatever plans or ideas Tyler has while Tyler rests. Sometimes Tyler will let him & sometimes not. If not, the narrator will at least stay close to him so they can talk about whatever is on Tylers mind.
•He actually used to hate his laugh a little when he was a young teen. He got over it after a couple years and now doesn’t give a fuck what others think. He will laugh as loud as he wants in a quiet room if he wants to.
•Going back to that manic thing, I think the narrator can usually calm him down. It especially helps if he’s holding Tyler and pulls him away from whatever has him worked up. Narrator will run his hand up and down Tylers back or just talk to him soothingly. Tyler is usually thankful for it once he’s calmed down.
•Canon-ish again but Tyler can get a bit in over his head with some stuff. He believes he can do just about anything which leads him to getting into situations where he finds out he actually has little to no idea what he’s doing. He had this problem as a teen too like he’d say stuff like “Sure I could fix your fence!!” or just like little odd jobs around the neighborhood and he actually doesn’t have much of a idea what’s going on but It helped him learn how to do all kinds of different things in the long run. He just always finds a way to make things work more often than not in his own ‘Tyler’ way.
•Okay often he really doesn’t genuinely care if someone wants to listen to his speeches/knowledge or not. He likes sharing them since he knows they’ve helped others but he’s been doing that for as long as he can remember even at inappropriate times. Like I dunno, as a kid at a funeral I could see him just telling some random person there about how he knows how bodies decompose, how bodies slowly rot and what each stage looks like. (I think that’s why he loves the narrator. He loves how randomly weird he is as well.)
•He needs attention all on him. He loves it so much and feeds off of it. His favorite kind of attention is from the narrator and he will get snarky and whatever when he feels like he isn’t getting enough from him but also he just thrives off attention from anyone in general. It’s what makes him carry himself so confidently. He knows people are dying for a minute of his time and to be the idealized version of himself he puts off.
•He doesn’t allow himself to cry in front of others. More than likely it’s because of his father saying boys shouldn’t cry or be weak. He knows it’s bullshit deep down but he still holds that mindset for himself. (If another dude is crying like the narrator, he won’t give them much shit for it.)
•My final idea for right now….he hates the doctors and all things like that. He can say a ton of reasons why but the main ones are he just feels super uncomfortable at places like that because either 1. He doesn’t want them going on about how bad his or the narrators health is & being really worried for them and questioning them.. or 2. He just finds it hard to be as snarky or smart to ‘em. They all don’t usually fall for his bs unless they are a part of fight club or project mayhem.
86 notes
·
View notes
Mikoto Kayano from MILGRAM-DID (canon)
"UAGHHJH…. mikoto is canonically a DID system!!!! he has an alter named John who killed somebody once BUT LIKE THAT ASIDE he’s so cool guys. they are the system ever. he also has an alter named midokoto and guys you Need to understand. they’re SO good. they’re so toxic but they’re learning and they have so much potential. Mikoto refused to accept that he was a system for the first season/trial of MILGRAM and tbh dont we all! and in the second season he realized and guys… .,..,…. in the second MV John sings 'I’ve got you, leave it to me!' and it’s SO protector-coded….. PLEAASSEEEEE MIKOTO HES SO GOOD"
Additional
"Just wanna add some more stuff to Mikoto Kayano’s description. And apologies in advance for this being a bit too long
To be clear, Mido doesn’t actually exist and is a fanon character originating from an older theory. Currently we only know of Mikoto and John in the system. It’s also very unclear who is the actual killer but I’ll elaborate on that more. And in Milgram everyone’s a killer so he’s not the only case here.
I really love Mikoto and John and their story so much.
Mikoto is the host alter and the one considered as the prisoner 009. He’s a people pleaser who obsessed with being normal and acceptable to people. He doesn’t inherently understand social concepts and relationships and tries to force himself into such. His whole social attitude is him deliberately acting that way so people can accept him. He’d do anything to please other people even if it makes him uncomfortable. And this habit is breaking him down on the inside along with being stuck in an abusive job.
His obsession with being normal makes him hate John which is really sad. He feels that having DID would make him weird and crazy and completely erase any sort of efforts he made to be normal and socially acceptable and have him be ostracised by everyone, which is sadly the truth in this current world. Because of this he’s scared of John and projects all his sufferings onto him, that he’s deliberately trying to ruin his life and do all these horrible things just for the sake of it. He even blamed John for attacking Mahiru even though it’s extremely obvious that it was Kotoko who did it. Mikoto saw her as a friend even though she really wasn’t and doesn’t want to believe that she did it so he blamed it on John.
I think Mikoto might’ve actually known he was a system for a while as lots of the lyrics in his first trial song, MeMe, seem to imply this. He wants to know why John is like this and is scared of him. And he’s lying to himself and desperately trying to convince himself that it’s not true. Even acting clueless when Es bought it up despite having attempted to talk to John beforehand.
Now for John, he is the protector alter and isn’t considered to be the prisoner. I absolutely love John so much. He’s obsessed with protecting Mikoto to the point he’s ruining his life, just like Mikoto’s obsession with being normal. He’s extremely paranoid of other people, and believes them all to be out to hurt Mikoto. Because of this, he lashed out and acts violently around them to make himself seem more threatening as for them to not go near Mikoto. This is in direct contrast with Mikoto’s behaviour of wanting to be friends with everyone which John is trying to stop as he’s scared for his safety under the belief that other people are dangerous. Even though he’s trying to protect Mikoto from this he’s actually making things worse for him as this is heavily stressing out Mikoto who’s biggest fear is social rejection and could stop someone reaching out to help him. And John knows this. He’s questioning if he’s truly Mikoto’s saviour and has started to believe that he’s ruined his life, for if only he was never born. But his paranoid mindset is inherently rooted into him so he can’t stop behaving this way.
John’s entire identity revolves around him being Mikoto’s protector, so for this it feels to him as his entire duty in life he had failed. His entire life is focused on Mikoto and he believes he can’t be his own person with hopes and dreams because that’d be getting in the way. He also demonised his DID and believes he can’t be a proper person because of that, and believes his condition is what’s making him violent even though it’s truly not, and just has a strong sense of fight or flight.
For his whole life John has never been treated as a person and never treated himself as such, so when in his second trial voice drama, Neoplasm, when Es wasn’t immediately scared of him when John fronted and started threatening Es, he backed down. This was the first time he wasn’t treated as a monster and because of that he dropped his persona and started to reveal his true self. John is a more stoic and rational person and was confused when Es actually accepted him instead of fearing him. It definitely seems he’s been trying to make an effort not to get angry and violent on an impulse as when he got upset and started yelling at Es, he calmed down and started breathing, and tried to talk in a more calm matter. But because of this he said how he wished he had stayed a monster.
And about the whole murder situation. John desperately tries to convince Es that he’s the killer, claiming he just killed a bunch of random people who annoyed him although this statement is very contradictory. When Es started to get suspicious of his statement John immediately doubled down and tried to convince them that Mikoto is weak and innocent and could never hurt anyone and was basically yelling at Es that Mikoto is completely innocent and that he is the murderer.
Even though the story deliberately makes it unclear who did it this behaviour seems to me as John trying to take the blame for Mikoto, as he wouldn’t want anything bad to happen to him because of that. It’s just a theory and it’s a long one but I believe that Mikoto is the killer, and the trauma from the incident along with his denial coping mechanisms lead him to repress the memory. And in the first trial when Es bought up the idea that he may have repressed the memory he started having a panic attack which caused John to switch in.
I really love how Milgram is treating DID with respect in Mikoto’s story and how the murder wasn’t because of his condition, but the result of the situation he was in and all the trauma he was going through, a murder which anyone could commit. There’s also a time where it was implied that they were co conscious in the second trial interrogation questions where at one time the handwriting started changing a lot and becoming more shaky in a style that didn’t fit either Mikoto or John’s regular handwriting. And there was one answer which heavily implied he was disassociating while writing. Mikoto’s story is one that’s easily misunderstood and may initially lead people to believe that Mikoto is the poor victim and John the evil perpetrator. But it makes a lot more sense when you realise that that’s their perspectives and is influencing the narrative. Ah- I might’ve gone on for too long about this I’m just really normal about them ok."
31 notes
·
View notes
G Witch Onscreen Text: Episode 22
Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.
<< If you forgot, Episode 21 will remind you of What You Can Do Now
Or you can go to the Masterpost.
It's the dawn of a New World.
After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.
TEXT:
(Lefthand side)
- Link Strength with Aerial currently
(Middle)
System Report
-Permet Inversion Reactor
STATUS:
Permet fluctuation reduced to [???]
Topological heat exchange catalyst replenished
Permet inversion reactor output decreased to 61%
Permet field stabilization in progress
(Righthand side)
- Link Strength with Gundnodes currently
Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...
I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.
It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....
The news report Rouji presents is from PNB, and the headline is:
Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero
- Assembly League fleet devastated, evacuation warnings issued over wide area.
- Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."
It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.
The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).
We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.
Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force.
In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.
I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.
Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.
But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.
And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).
On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.
Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)
Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.
Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.
In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.
At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.
Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.
In the end, it's not violence that allows Suletta to rescue Miorine. It's love.
And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.
When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.
Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.
And sometimes, he's still your dad.
Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.
It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...
It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.
Rolls up my sleeves
(Left, Top to Bottom)
Quiet Zero - Current status summary
MOBILITY
- After restart, movement velocity of enemy basepoint is predicted to increase
- Velocity of each enemy MS also predicted to increase by average of 37%
- Evasive Maneuvers of main unit will be complex
DEFENSIVE FUNCTIONS
- Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach
- Defense barrier strength 67942049
- Very difficult to invade domain while mutual defenses of basepoint and MS are linked
(Right, Top to Bottom)
WIDE-AREA DATA STORM CONTROL FUNCTIONS
- Expands data storm domain and stabilizes it over a wide area
- Domain is predicted to expand further in future
DATA STORM DOMAIN
- 60%
PERMET DISPERSAL SYSTEMS
- Permet dispersal index exceeds 200
- Permet density x 27.1
- Density increase is accelerating
REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES
- Increases interconnectedness of overall enemy
- Each MS appears to become a sub basepoint
- Basepoint and all Gundnodes are linked
- Link multiplexing confirmed, jamming impossible
A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.
In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links
(Baori Pack)
- Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions.
- Can also be separated from the main unit...
The 'Daedalus' multi tool system...interessante...
In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).
When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.
If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.
I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.
Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!
Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions
I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.
The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.
If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.
In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.
'CGG' functions as a blank space between words.
So, for example, if you wanted to write, "I love you, Suletta." The code would be:
GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT
In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)
I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.
You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.
But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice.
(The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)
Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.
Sibling fights....
It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...
To find out, Click here to go to Episode 23 >>
Or maybe the Masterpost could remind you.
31 notes
·
View notes
Gorgeous
Inspired by "Fear of you" from @sleepwalkersqueen
Note:The first chapter is done! My current goal is to write a chapter for each week but maybe it will take two weeks sometime but that is an issue for future me. I am really excited to see some feedback and how you guys like it:). On another note, while I try my best to keep a relatively straight line and facts with the original story some things might be wrong, please feel free to correct me if it happens ♥️. My current goal is a total of 5 chapters since I only want these to be a relatively short story that doesn't rewrite too much stuff happening in the original story because I obviously don't just wanna rewrite the fic. Please enjoy!
next>>
Warnings: I am not a therapist so please take everything written here not as a prime example or as a fact, mention of torture, curse words
Chapter 1
I always wanted to see what more Tartarus had to offer. I wanted to explore every single floor there was. Meeting a new and more dangerous villain each day. Getting to know their thought process, if there really was a bigger masterplan behind it.
Answering my questions that spiraled in my brain like an endless loop. Are they actually wicked? Do they have any sign of humanity in them? Are they just broken souls? Can such a broken mind be fixed? Cliché I know.
All these questions are the real reason why I wanted to work here. Luck was on my side at the time I applied, because they wanted to test out if a therapist might be able to help them with their work (Which basically summarized that they wanted to get more information out of the patients).
But even when I worked with them they still continued with the methods they used before. This did not help make progress since I also had to work with their new experienced trauma which was already bigger than the universe.
If I am honest they were hesitant to hire me, since I graduated young from university and had no experience whatsoever. It took over a month and another month of internship to make them believe that I was cut out for the job. Even now they still don't fully trust me with their whole system. After all, I was a weak point for them.
Once I had the job I was more than thrilled. Finally able to do what I dreamed of since I was a kid. Even though there was still much to achieve. Of course, there is also the aspect of trying to make them stop their own ways for mine to finally be able to bloom just a little bit.
Seeing the number two pro hero walk up to me one day with his mighty steps that sounded like mountains crashing together I would lie if I said I didn't feel my heartbeat stop for a moment. Let alone when he talked to me for two seconds before giving me all I ever wanted with his angry and demanding attitude.
The moment I was granted this wish of mine I regretted it. Not because I stopped believing in my dream but because seeing the actual part of no one should know is frightening. Frightening might even be an understatement.
Their voice, movements, and the way their bodies looked were scaringly disgusting. The air smelt rotten and it was cold not only because of the temperature. People are being drugged out of their brains to keep them calm, they all look like corpses that have been exposed to warmth and air for too long.
From my plain observation, it even seemed like mutants are treated worse than the other prisoners. Which is a common thing even in normal standards of society. I cannot even blame them because mutants can be incredibly scary.
Tartarus. A name that ran a chill down each villain's spine. A place where the moment you step into you may never escape alive. Rumors spread across the underground like wildfire. About what will happen once you are captured and what you have to endure.
The villains that are imprisoned in Tartarus don't make the facility this scary I realized. Maybe the good people think that they are the reason for all this talk, but this is where they are wrong.
"Do whatever you want"
Just remembering those four simple words made my skin crawl. Goosebumps spread across my body. A sentence you might say to a child that you have no interest in dealing with. Or maybe to your trusted hairstylist.
But not to a licensed therapist who is capable of either destroying you or building you back up. Or to the guards who held the interrogation.
The meaning behind the words held something so incredibly heavy I wanted to forget every memory of someone saying these words, no matter who or when.
Because they meant it. They didn't care if I did my job right or not because I wasn't even supposed to be there. I could do whatever I wanted with the person in front of me. The people who have no way of defending themselves because of their chains and quirk suppressors.
-------------------------------------------------------
The air in the small bright room was filled with tension that I created by possibly the worst mistake ever. The guards who were still in the room with me looked at me confused. The only comfort I had at the moment was that the person I directed the mistake to couldn't answer at the moment. But even seeing his eyes shoot up was enough to make me rethink my life choices.
I can clearly feel my face losing its color out of shock from my totally unprofessional behaviour.
"you're so gorgeous"
Whatever ghost possessed me to say that clearly needed new activities to entertain themselves.
With the love for everything I possessed, I cleared my throat and sat down on the chair at the table they provided.
"You can take off the muzzle" my voice rang through the empty room with an echo. It left a chill in my body hearing it so metallic.
The guards hesitated for a moment before they actually started doing their job. They left the room when I gave them another glare, signaling to give us privacy like I asked them to.
Takami-San looked physically exhausted yet his eyes remained sharpness that you don't see very often in patients around here. He had a big grin on his face that I wished I could just wipe off of his face, even if I was the cause of this.
For some reason, he stayed silent. Maybe it was because he was already taunting me or he was waiting for me to introduce myself, I couldn't tell.
"I am Howashi Amaya, I will be your assigned therapist" I introduced myself, a genuine and respectful smile resting on my face.
"Therapist? Sounds fake, they don't care about how fucked up I am" he tilts his head to the side, eyeing me up and down like a bird.
"You're right they don't care, which is why they told me to do whatever I want"
For some odd reason, he seemed to tense up from these words, I wonder why.
"So I decided to just do what I am best at"
"Being a charming girl?"
At that, I took a deep breath. I scrunched my face and looked down at my empty sheet of paper.
When I looked back up he was grinning again god he looked so good stupid.
"Actually no. I meant I will try to help you"
"Help me get out of this shithole?"
"not really I am afraid"
"Ahh shucks"
I waited for a second before actually starting my usual procedure. Which on second thought seemed to be a little too late.
"How has it been?" I click my pen while looking at him, ready to write down whatever I could tell from his response.
"Really? Do you actually ask people this in fucking prison?" His voice sounds raspy.
"I didn't ask how you felt, just how it has been. You could answer nearly everything on it. How you feel, how the people treated you-"
"fucking brilliant, you should get a medal for being a smartass"
"Thank you for calling me smart, I appreciate it"
I silently tap my pen on the paper. Waiting for any kind of reaction from him. As the silence settled I started to notice some weird marks on his neck, they looked kinda infected.
"What do you have on your neck there?" I gestured with the pen on my own neck.
As soon as the question was spoken he tensed and looked more traumatized than a baby chicken that just discovered the big scary world. He broke off the eye contact he previously held with me. His body huddled up in an attempt to look smaller and protect himself, probably with his wings but he wasn't able to do it. Uncomfortable if I need to describe it in one word.
I probably don't need a deeper answer to figure out why they might be there. I silently stand up and walk around the table. He tried to move away from my hands when I reached out but because of the chains, he couldn't move far enough away.
Ever so gently I pulled the collar down and placed my hands on the marks. A familiar warmth spread across my hands and I started to feel how the infected wounds closed and healed.
When I was done I took a step back looking satisfied down at him before returning to my chair.
"Aye... Of course, the doctor has a healing quirk" he mumbles silently.
"Do you have anything you wanna talk about?"
" Aye, why are you here? Never heard of someone like you even working here. Doesn't seem like their style to hire a fucking therapist to fix me or anyone really"
"Good question" I nod in agreement "The answer is simple, I am the only therapist around here. That is why you've never heard of me. The last question shouldn't bother you too much after all you have been here for quite some time and are already in debt worth more than my monthly check"
"Have you ever seen a therapist before?" I ask with a light smile on my face.
"Do I fucking look like it?"
Silence.
"Besides I don't need another bitch asking me any more questions, I have the sparkler for that"
"Sparkler? You mean the number two?"
"Nah I mean the nice guard's captain obvious"
Another silence.
"And I don't need anyone knowing about the stuff I tell him, it's private business." He said in an oddly calm voice.
That certainly amazed me, since I have seen all the recordings of their talk, except the first one. So he wasn't aware that everyone was still listening in. Maybe this will one day be their downfall, why would he be so stern about keeping this a secret if it wasn't necessary.
"Why should no one listen in?"
"Because I said so"
This will be a lot of fun.
"Well with me you can talk about everything you share with Endeavour. No one is listening or watching. I like to keep my talks up to my hands, especially what I share with the government"
And that was not a lie.
-------------------------------------------------------
The room was filled with the sunlight shining through the window above the kitchen counter. The light shone through the leaves of the plants sitting at the window.
It was peaceful. The air was fresh and smelled faintly of fish and rice.
The only sound that destroyed the peace was the TV that played the news
Yet the only real news would be that someone escaped Tartarus and that still isn't public information. I wonder what will happen once the public knows.
Once I turned the TV off the silence that came with it was broken with a call. When I read who was calling I felt my mood drop just a little bit.
"Howashi speaking, what can I help you with today hottest hero in Japan"
"He escaped me!" The man yelled angrily, ignoring my terrible joke.
"who escaped you?" I ask grinning widely.
"Takami! That fucking mutant had his brat stealing my wife's necklace"
He has a child? Now that is a surprise. Even a bigger surprise was that he was stupid enough to let his child steal something from him.
"And how is that my problem?" I ask while standing up and staring out the window biting my nails.
"You worked with him for five years! You know exactly what is going on in his stupid birdbrain" Endeavour yelled. I am not even sure why he is yelling at me, I would hear him loud and clear with a normal tone.
"First of all that is extremely rude talking about mutants like that, I am one as well after all, and not even different from Shinyo. Second just because I worked with him does not mean I understand everything he does"
"But you know where he might go"
I nervously tap my fingers on the kitchen counter. Closing my eyes to contemplate if I actually know where he might go.
If I break it down it comes back to one thing, he has a child and is currently taking care of them. But knowing he has unfinished business makes it counterproductive to take care of a child who has to be at least five or four years old. He probably didn't even know the child existed since he never talked about having one, only about his wife Nitsuki.
Nitsuki? Right, he might be searching for her so he can give her the child. But why wasn't she with them?
"I might have an idea but to be honest it is not crystal clear that he is with her"
"Her?"
"Takami Nitsuki, his wife. If he has a child he will certainly not have any time to deal with it and will try to bring it back. The only question I still have is if she really left the child alone and why he has to bring it back"
"Those are two questions and I want you to come to my agency to discuss this further" he demanded. Almost sounded like I didn't have a choice.
"Alright, I can fly over, when?"
"Now" and he hung up the phone after that. Not even a goodbye.
Once I was dressed and didn't look like I just got out of bed. I walk outside of my apartment building taking off my suppressors.
Once I felt the warmth on my back and my wings regrowing I took a small jump before dashing into the air.
I just hope this story will end on a relatively good note.
26 notes
·
View notes
OK, so normally I really don't like bringing up controversial or scary/disturbing topics, but I just came across this thing recently and.... ht tps: //m.yo utub e.com /watch ?v= u0YXBkKQnQA
Yeah ... :(
But, it made me really curious. How would your OCs Rafael and Magritte react to this phenomenon? How would it make them feel, what do they think?
(Of course I'm talking about when they're in the future, since ik their whole story takes place in the 2010s. But they are still Millenials, so Mags & Raf would be in their 30's and 40's respectively by 2023-24)
(And yes I am aware they're from Canada and this problem is mostly in American (from what I've seen))
I'm especially curious how Magritte will view it, since well... she's someone born with a significant condition that makes it hard to focus, sit still, pay attention, or have certain awareness of her surroundings, etc. (all the things the lady mentions in the vid) How would she feel knowing there's now millions of neurotypical children with the same problems but for a different reason?- Because of their overindulgence/obsession in social media/technology. (really do wonder what the neurodivergent GenZ & Millenials think about this phenomenon and how it's gonna affect the Gen Alpha ones)
Also - and I know I'm really reaching with this one but - how do you think they would combat or prevent this issue with their own child? Assuming they ever decide to have one in the future.. 😅
Yeah, sorry for that whole essay of a question. 😅
And you don't have to respond if this is too deep or personal of a topic for you (believe me I really don't wanna think about how this a reality either), but if you do, I really recommend you watching the vid in full.
so, for context, the video talks about how the current generation of kids are preforming at grade levels much lower than their current grade, and are presenting behavioral problems--that are, apparently, a result of phone overuse. [/simplified]
Raf would kinda deliberately avoid putting too much thought into it and wouldn't have much of an opinion aside from "it sounds like a very complicated situation" and "when in doubt, blame the parents [/hj]"
Margie, though, has some strong opinions about North american school structures/cirriculums haha. the children and technology aren't the problem. The world is changing, it will always change. Standardized grade school is a relatively new structure, and it has hardly changed at all since it was first concieved, especially compared to how much the rest of the world/society has changed since then. School systems have not and cannot adapt fast enough to accomodate the rapidly changing job market, technology, advancements in psychological understanding, etc. And, to Margie, the fact that schools apparently can no longer teach kids in an effective manner is proof to her that the public school system is becoming obsolete and needs to change or be replaced with something more suitable for the current era. Because, after all, "anything you learn after 4th grade is kinda useless in real life application anyways, I haven't retained any of it, lmao."
Margie really very dislikes the public school system and considers it an extremely stressful waste of her childhood 😂 she coulda spent all that time...learning and playing music instead of getting yelled at by teachers and parents and made to hate subjects/activities she might have loved if they had just been introduced to her differently.
As for their own kids, they can't have 'em and don't want 'em haha
27 notes
·
View notes