#intro post??!!

[over-on-the-bench]

previous url: ow3nex1st5 -> tragedy-of-stars -> over-on-the-bench

mmmhhmhmhmh that time again guys, im on a roll!! NEW INTRO POST!!

heyoooo, ‘m kurt (i go by many, many other names too.) andd this is mmmyy super chill blog,,, i use he/its pronouns and am a minor, so, so stay away w/ yer not so holy shit if thats what you do. (more abt pronouns nd shit here -> :D)

i am irish, super swag irish guy here >:3 uuhehm..

im involved in a lot of sports/hobbies, those of which are: rugby, taekwondo, collecting shit (dr pepper bottles, lego and rocks.), writing (PRIMARILY ANGST. i will write you some angst if you ask and gibe characters and basic promt!!), roleplaying, annnddd now do not ask anything of this, but i work out. literally.

currently hyperfixating (i still dont think thats a word tf) on pokemon, heathers, jackass, tmc, six, simulacra, and so much more but i cant think of them off the top of my head.

i run several other blogs and those are: @kurtiscatchesstuff , @owenspictureblog , @abhainn-an-bhroin , @kitty-pins-supremacy , @imxaviernotyou , @thedayshiftneverends , @best-sibling-duo-around and @the-willows-weeps

uuuhrm, im really silly and accident prone lmao.

i ramble. a lot. so sorry if you witness me in a ramble mood.

any hate will be responded with a silly and/or goofy response cause fuck serious shit.

any tags i use will be put below this post,,,!

[I forgot who made this blinky thing, so if u know pls tell me so i can credit them :> ]

[am-i-the-asshole-official]

Welcome to tumblr's own AITA!

The askbox is currently: CLOSED

Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:

YTA=You're the asshole NTA=Not the asshole (the other party is) JAH=Justified asshole (you’re an asshole, but like, I get it) NAH=No assholes here (everyone is some level of justified) ESH=Everyone sucks here (you're all assholes) INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)

Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)

I've been talked into making a ko-fi, no pressure but if you want to throw me a couple bucks for keeping this train running, feel free to buy me a coffee! Never expected, always appreciated

[dhaaruni]

This early 2010s tweet is an eternal mood

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[amygdalae]

his joyful little twirl :^)

[bob-artist]

Hi, New People?

For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)

Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!

So, here's your chance to escape, if you so choose.

Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as

Canada geese.

Like... a LOT of Canada geese.

Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.

But, because I can't be bothered to make myself a consistent "brand," I also make

Very Gay Comics.

I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.

I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.

Lots more on that soon.

Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get

Canada geese

and

Very Gay Comics.

Cool? Cool.

[keefyrchik]

idk whos this horse killer guy but hes kinda hot

[khaopybara]

Ongsa, do you want me and Tinh to help you pursue Sun?

EARN PREEYAPHAT as CHAROEN, MILK PANSA as ONGSA NANNAPHAT and VIEW BENYAPA as AYLIN feat. FORD ARUN as TINH and JUNE WANWIMOL as LUNA episode 4 of 23 POINT 5

[over-on-the-bench]

scott's new intro ^^

hi!!!!! im scout [scott, tem or badger also apply for this], im a minor... and also contraversial 90% of times /lhj (sawtwt on my strap) i use he/its pronouns exclusively

im transmasc and bisexual and.. yeah

i occasionally do writing and very not popular opinions on all sorts, like my ao3, twitter and discord

i leave a lot of insensitive comments and jokes on touchy topics and will often not get tone so please use tone tags around me...

strawpage drop here ^^

if you need to reach out to me directly, my discord is ericjosephmatthews and my dms are open!!!!

[stardoomed-if]

Stardoomed is an 18+ drama/romance interactive fiction novel set in Los Angeles. Focus on relationships and avoid falling into bad habits; the road to fame is more filled with pitfalls than you ever imagined.

When destiny leads you, a newcomer to the world of K-pop, to become the last member selected for the most anticipated new group, Next Gen, the journey to fame seems like a dream come true. But behind the bright lights and smiles on stage, dark secrets and overwhelming challenges lurk.

Each member of Next Gen faces their own demons as they struggle to stay afloat in a world that loves and hates them in equal measure, a world to which you now belong. You'll be drawn into a whirlwind of drama, romance, and friendship as you navigate the complexities of life as a new idol.

With the fate of the group and your own career at stake, you'll have to make tough decisions, face your deepest fears, and discover what it truly means to achieve greatness in a world where success can be as fleeting as a star.

Are you ready to live the dream?

CW: explicit language, sexual themes, discrimination (homophobia, transphobia, racism), substance abuse, non explicit violence.

✦ Play as a male, female, straight or queer, question your gender, and challenge the world for something you didn't choose.

✦ Full customization: personality, appearance, style, nationality, and just like in real life, be judged by how you look.

✦ Choose your role in the group, are you a dancer or a rapper? perhaps a talented singer? or maybe... nothing.

✦ Become part of one of the most promising K-pop groups of the decade.

✦ Face the true face of the industry.

✦ Succeed as an idol or pursue your true dream, be a painter, an actor, a CEO—the choice is yours.

✦ Fight against your projective mother to regain control of your life or give in to her whims for a bit of her affection.

✦ Embark on a forbidden romance with one of your three group mates or the company staff, either way, they'll fire you when they find out.

✦ Meaningful decisions. Here, everything matters, even your weight, unfortunately.

✦ Choose between your mental health or stardom.

✦ THE MAIN CHARACTER

The fourth and final member of Next Gen seems to be more about luck than talent. Insecure, repressed, and with questionable mental health, they will need to learn to put themselves first and take control of their own life, even if it means destroying the almost nonexistent relationship with their mother.

✦ NIKO / NIKA ROMANOV [ro; m/f] see more

One of the choreographers at HYPE. Contrasting with their rough appearance and tattoos, they are a kind and warm person who, although their smile never fades, carries the weight of their past with them.

"Leave it all behind."

✦ HANNY / HANNAH SONG [ro; m/f] see more

Talented beauty blogger and one of the main makeup artists at HYPE. Cheerful, shy, introverted, and full of colors, they are as beautiful on the inside as they are on the outside. It's a pity they don't think the same.

"There's always a reason to be grateful."

✦ DEVON DILLARD [ro; non-binary] see more

A music producer at HYPE, with a distinctive style and incomparable talent, they have broken barriers and more than a dozen hearts. A free soul is what they are, and all they want is to have fun. Although you are increasingly convinced that everything is a facade.

"I'm too sober for this shit."

✦ JIHOON / JIWOO CHO [ro; mcs gender] see more

The charming vocalist and center of Next Gen. Charismatic and with an incredible sense of fashion, they have risen and made a mark in the industry. However, fame has its price, and forgetting who they are was what they had to pay.

"I dress to impress me."

✦ NIRA [ro; mcs gender] see more

Perfectionist is an understatement. Leader of Next Gen and main dancer, Nira is as demanding as they are talented. Some call them a prodigy, and yet it has never been enough. Perfection doesn't exist; that's something they soon have to face.

"My only competition is my potential."

✦ DANIEL / DANIELLE HAN [ro; mcs gender] see more

As outgoing and affectionate as a Husky, Dani is the main rapper of Next Gen. A streamer and gamer turned idol, not a bad combination… right? Well, it seems that things aren't so fun with a contract involved.

"My life is full of exciting possibilities."

DEMO TBA | COG FORUM TBA |

[dcandyland]

Welcome to Candyland!

Sit down, stay a while. Come marvel at the magic of this wonderful candy kingdom!

Remember friends! Follow the rules, and enjoy yourselves! Don't forget to be respectful to the folks here, they don't like rude children!

Warning! This blog may contain themes that are disturbing to some. Possible themes include:

Abusive themes

Blood

Body Horror

Cannibalism

Child death

Cursing and Swearing

Death

Disturbing imagery

Hallucinations

Kidnappings

Murder

Mild gore

Obsessive behavior

Religious themes or imagery

Scopophobia

Suggestive jokes and themes

Torture

Old Candyland archive blog -> @dca-candylandau-archive

[bunbun-hun]

🎀new side looking for old moots and new friends

🤍Not new

🎀21

🤍5’7(ish)

🎀Bi

🤍minors Dni 18+

🎀Sub

🤍hard and soft kinks

🎀Dms open

🤍side account made main account blah

🎀 BE MY MOOT

[dhaaruni]

She’s just like me fr

[most-normal-eccles-cake-ignorer]

while I was looking for gabriels in the intro, I noticed this redheaded person w dark clothing and lighthaired person w light clothing that appear to kiss in the theatre:

i'm making this about the 1941 kiss theory

---

edit oct 7: a few kind people have mentioned that they remember a post from the official good omens account (possibly on twitter) that said the two people kissing are War & Pollution, and the shadow beside them is Famine. (If you have the link please send it this way! I have done a fair bit of searching but with no luck and it's haunting me bc it must be real but i can't find it)

@0owhatsamsays also pointed out that in the X-Ray bonus video "Title Sequence Easter Eggs" Peter Anderson says there are specific characters from season 1 in the highlighted boxes, and as you can see, the kissing booth (top level, far right) is one with a little trail of stars coming off of it.

[golddust-if]

you're a wanted person. that isn't new to you, but after years of working, someone. no. something is after you.

you were taught by the best, your mother, she was an amazing woman but she was too trusting and in the end, that was her downfall. you won't make that mistake. you're a killer, but a righteous one. you kill those who deserve it, the disposable.

with your abnormal abilities, of which only twenty-five percent of the population is gifted with. you can succeed in what she was never able to do, rid the world of sinners.

you work for the slaughterhouse, a bar... with a dark side; in a rowdy part of the city. your mother was the owner but she didn't pass it down to you, she passed it your younger twin siblings. she believed you were far too talented to sit behind a desk, dealing with paperwork.

you've traveled all over the world, exterminating. you've claimed plenty of people, but perhaps this time you went after the wrong one. having no other choice you flee back home, but you aren't safe there either, you never are.

play with a customizable mc [gender (male or female), physical appearance, personality, sexuality]

protect those you care about or turn your back on them when they need you.

romance, befriend, or make enemies between any of the sixteen characters. four gender selectable, six male, and six female.

decide what supernatural ability you were gifted with; telepathy, telekinesis, or teleportation [figure out how to develop it and what other ability you have]

define your mc's signature weapon, fighting style and overall skillset; how you feel about killing, and the supernatural abilities you were gifted with.

this story is rated 18+ for sexual themes, substance (drug and alcohol) use, explicit language, and violence. [more themes might be added later]

the tattoo artist [male or female] [ro] wren price – partner in crime. they've been by your side since you can remember. always with a bright smile and cheeky remarks, you can't think about how your life would look without them. though they act differently with others, more serious, with a glint in their eyes you can't quite figure out. they never look at you like that.

the bodyguard [male] [ro] theodore price – the older brother of your best friend. there's no doubt in your mind that they're related. he's protective over you, although you can't hold that against him as that's what he does for a living. protect people. he's hard to get to know on a deeper level and you can't help but wonder what's going on in his mind.

the detective [female] [ro] rori hayes – now, if you weren't yourself, perhaps you could have been friends with her. but unfortunately for you... she's extremely suspicious of you and set to bring you to justice. she's recently been promoted and she cannot afford to fail, not when her family is counting on her.

the chief deputy sheriff [male] [ro] charles butler – good ole charlie, you're acquainted with each other. he can't say he isn't a little impressed with you. but you're endangering the citizens of his city and that includes his little girl. he may not have any evidence on you but you need to be brought down, and he's going to be the one that books you.

the model [male] [ro] julien ripley – son of the sheriff. he always looks uncomfortable with his own father. he’s never talked to you before and you’re almost positive he has no opinion on you. he’s a very well known face, although you can tell he doesn’t like being stared at and overall talking to anyone. *male mcs only

the journalist [female] [ro] sloane campbell – she's fast alright and always seems to know your moves. too bad she isn't on your side. always trying to announce to the world, where you are and what you're planning to do next. good thing she's overlooked at her job, consistently being handed stories that, even you know, aren't going anywhere.

the bartender [male or female] [ro] hale/hart vaughn – a family friend, and your sister's best friend. with their tantalizing words, they don't know the meaning of being serious. they are quite insufferable and you can't seem to be able to get rid of them. you have a feeling if you did, your own sister would come after you.

the florist [female] [ro] paris graham– at first glance she doesn't appear to be anything special, but that would be wrong. she's a firework waiting to explode and you want to be there when it happens. her work doesn't suit her but you have a feeling, that being a florist isn't all that she does. *female mcs only

the apartment owner [male] [ro] nolan adams – he knows about you and what you do, but he doesn’t give off the feeling of someone who’d go running to tell. you’ve always come back to lay low at his apartment complex when you need to and as long as you pay on time he doesn’t care what you do. 

the actor [female] [ro] ophelia wylie – a face from your past, one you can’t say you particularly enjoy facing again. she seems remorseful for what she did to you, in fact she looks like a completely different person and she’s offering to help you, but for what in exchange… after all, no one gives anything for free.

the crime lord [male] [ro] louis foster – of course you’ve heard of lou, you’d be an idiot if you didn’t. he's tried and failed to recruit you and he never fails. you’ve been warned before, it would be a mistake to make an enemy out of a king.

the informant [male] [ro] vincent sutton – it’s rare to ever see him out, only ever seen accompanying lou. if you had the ability to feel fear, you’d fear him. he shows every sign of being against you, but then again, it seems as if he does that to everyone around him as well. 

the chef [male or female] [ro] mateo/melanie olsen – you see them quite often, as their restaurant is one of your favorites. they always serve you with a smile and if they do know you, they play oblivious. they're just happy to have a customer who enjoys their food.

the doctor [female] [ro] eileen yates – serene and calming, a voice who always knows exactly what to say. she may look innocent but she’s far from it, you’ve known her for years yet you don’t truly know her, for all you know eileen may not even be her name. 

the accountant [female] [ro] felix price – the youngest of the price siblings, she helps out with all the money coming into and out of the slaughterhouse. she’s always been compassionate and reasonable. you can't imagine her hurting a fly.

the rival bar owner [male or female] [ro] kinslee dean – they own a bar just a couple streets down from yours. it’s always been a problem and they’re actively trying to shut down the slaughterhouse. but they’re surprisingly level-headed and want to 'handle' this problem with logic.

the owner of the slaughterhouse [male] archer – your younger brother, he’s honestly kind of a mess. he was not ready for this responsibility but he’s trying. the mischievous boy you grew up with, you don’t know where he is anymore.

the owner of the slaughterhouse [female] iris – your younger sister, she’s always been loud and bold. but she’s changed too, she’s calm and collected. she’s trying her best to help her brother along too.

the sheriff [male] lazlo ripley – a pompous man with nothing else to do but terrorize those he thinks are inferior to him. 

DEMO [Coming Soon]

warning: this story is still under development, all elements are subject to change!!

[ordinorultor-if]

Welcome to Ordinor Ultor!

You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME. 

15 years ago, your Liege had your parents executed for a plot they had no part in.

Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.

But one day, your Liege goes too far, and wrongs one of your siblings - personally.

You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.

Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).

Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.

Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?

Interact with your friends and family, possibly including your foreign cousins.

Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?

Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.

Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.

Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.

I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said... FIRST DEMO OUT

I hope everyone enjoys!