Tumgik
#thank you for tagging me!!! i missed doing these tumblr tag posts
dan-whoell · 3 months
Note
what are some phancoded songs?
@fryday has covered this a ton recently, but some I doubt anyone else will say:
How Far This Can Go by Bowling for Soup. The chorus??
Let’s take it fast to slow Hold our breath and jump into whatever this is Grab a coat and let it all rain down If we never stop believing, it’s gonna be alright But if we don’t try, we may never know How far this can go
It's very early days, but also every adventure they've had??? Like even as recent as resurrecting the gaming channel, if they hadn't taken the chance on doing that we might not be in the middle of whatever the phagenda is now. I also think about Dan being 18 and still not having coming to terms with his own sexuality, but still jumping into whatever was going to happen with Phil.
By the time the curtain's falling There'll be standing under and screaming out our names Can’t you hear the future calling Will go all the way and never be the same, yeah
I mean. Self explanatory. Makes me cry to think about everything they've built. And I love the love the audience has for them. I can't think about it too long or I end up a pile of goo.
Come Monday by Jimmy Buffett. I grew up listening to this man, I've done a list of some favorites. But this one specifically gives me dnp vibes.
Come Monday, it'll be all right Come Monday, I'll be holding you tight I spent four lonely days in a brown L.A. haze And I just want you back by my side
Again, I think about them in the early days, hanging on every visit and always trying to get back to their bubble together. But also Dan on tour. I wish I could remember who it was that made a post about why now as far as a potential rebrand/launching so hard into joint content again, and the tldr was after wad, Dan coming back and and being like 'Okay. I've done it solo, and I've realized I don't want to do this without you.' And that's the same vibes I get with this song. Being away from each other sucks, and I just want you back by my side.
I can't help it, honey You're that much a part of me now Remember that night in Montana when We said there'd be no room for doubt?
You know. Their lives are so intertwined. Phil literally said our life. They own a house together. They have their own fucking language. They know each other so well. I've said it before but although I don't believe in soulmates, they are the exception to the rule. As for the second half... I mean. Early days. Jump in. See how far this can go.
I hope you're enjoyin' the scenery I know that it's pretty up there We can go hiking on Tuesday With you I'd walk anywhere
It's the idea that everything they've done for 15 years, and everything they will do, they'll do it together. In the sense of a joint endeavour, or just supporting one another in solo projects. Them doing shit they'd never normally do on their own, but they have their soulmate by their side so how bad could it be?
(This one is depressing so apologies in advance)
Haunted by Spanish Love Songs. Sort of a Phil perspective on Dan's struggle with depression.
You're not haunted You just miss everything You're not a cautionary tale So don't you vanish on me
And you're not haunted It's just the devil in your skin It'll be this bleak forever But it is a way to live You're not alone You just miss everything When you're feeling like a ghost Would you come haunt me? Please come haunt me
I'm not gonna say a lot here, but I know what it's like to love someone so fiercely and be heartbroken that they cannot see themselves for who they are. I've also been the person who can't see it. I think a lot about Phil always being there for Dan, and I'd love to hear him talk about the experience of love in those situations. (And if he never does I totally get it, it's private and it's not really our business. Just from a relatability standpoint.)
This is in the same vein but Washington Square Park by The Wonder Years, specifically this:
She said, “I let this slide when we were younger You know you don’t have to write like this The whole world’s full of losers If you get a chance to win, (you should) take it!”
Like. Phil always trying to get Dan in colors. Dan face down on the floor and Phil being there to pick him up and distract him. I love a love song as much as the next guy but this is my bread and butter.
To end on a happier-ish note, Love Will Keep Us Alive by The Eagles.
I was standing, all alone against the world outside You were searching for a place to hide Lost and lonely, now you've given me the will to survive When we're hungry, love will keep us alive
Early days??? Phil being the first person that made Dan feel safe??
Don't you worry Sometimes you've just got to let it ride The world is changing Right before your eyes
Coming out??? Meeting so many queer fans on tour and that being a push to come out themselves?? HELLO??
Now I've found you There's no more emptiness inside When we're hungry, love will keep us alive
I think about the state of things now, how fucking happy they've been since coming back. How different it feels from when they started. There's always been laughs, always been fun, but there is so much joy now. I'm sure I've said it but personally my heart feels so fucking full when I see how far they've come. When I see what they've built for themselves.
Anyway I could go on and on about songs that make me think about dnp, especially stuff that's not top 40's pop or is 30+ years old, but I think I've yapped enough on this particular post.
8 notes · View notes
tanicus-caesareth · 5 months
Text
Tumblr media
guarana drama, damage control
13 notes · View notes
fluffle-writes · 4 months
Text
I wanna. Pick them up in my mouth and shake 'em around like a dog obliterating a squeaky toy
#you can tag anyone you feel this way about but I was thinking about Rook hunt in particular#tbh I feel like he'd picture the same - just with Vil and Neige#he wanta his oshis to be besties (he is just lime me fr) (just a liiiittle furyher frim reality)#(I view neigexVil as nore of a crackship until we get more Neige development/lore)#(our queen Vil doesn't deserve to be genuinely shipped with someone who's kinda 2D rn.#But I respect people who flesh out neige with headcanons - they write the dynamics realy well tbh)#(hopefully we get more RSA development at some point I think that'd be cool)#(plus I'd cry if TWST just. stopped. after the last NRC OB)#(I mean it'd make sense aince that's where the story is based and it'll probably end once Yuu finds a way home#- which feels close now thanks to Ortho)#(But at the same time I. have been following this since it first came out when I was about 16 - same age as the first year squad lol)#(and I feel like it'd feel weird if we stopped getting main story updates)#(Im rambling a LOT lol - probably because I'm tipsy haha)#(hope someone can relate to my lamenting of future woes though)#(Oh well - I should atop borrowing sorrow from the future and live joyfully with the now)#(I do miss my friends who've stopped being in the fandom though - and my friends who deactivated and idk how to contact now)#(sugarandmelody... zacrazyvalentine... I miss them. but we had fun#writing and stuff. and I suppose that's what matters in the end. that we had fun.)#at least - I hope they had fun too. and I kinda hope they think about me how I think of them sometimes.#have a nice day if you're reading this. I rambled in the tags a while and I understand that it's kinda long lol.#and probably riddled with typos#I'm tearing up for some reason haha. well it is what it is#I hope each and every one of my followers know how amazing they are - I hope y'all have a wonderful day - evening - or night#I wish I could hug people across the internet lol#I should stop posting on tumblr while drinky haha#tw drunk#tw drinking#i'll tag it just in case#don't wanna cause discomfort and stuff
12 notes · View notes
clowns-wine · 1 year
Text
Tumblr media Tumblr media
I'm back with some art I spent the whole day on (it's 1am and I'm tired) but yea I thought the improvement would be cool to look at and these two were made the same day so they're exactly a year apart!!!! (Time lapse below)
6 notes · View notes
whump-queen · 2 years
Note
HELLO!!! I love ur whumps can you add me to the general whump tag list?
aaaahh tysm!!!! highkey seeing you in my notes got me opening the Kane & Raiza masterdoc again,,, 👀👀
10 notes · View notes
Note
I have to ask about good dog bad dream <3
🥰🥰 oh i was HOPING for this one. ok so y’all may actually know a little bit already because it exists in the tags as tyler borzoituzzi but! good dog bad dream is the working document title/notes compilation for a fic that started with the premise of “well you see that’s actually not a dog that’s my blorbo from my hrpf shifter wolf au—”
and, because i have never formally addressed it or put it anywhere other than the tags, three important details about this fic:
this IS a semi-au fic about the detroit red wings, set vaguely in the 2018-19 season, because the wings sucked that year (but not as bad as 2019-20)
this is ALSO a fic that is mainly about tyler bertuzzi and dylan larkin, with some other wings thrown in because i've never met an ensemble i couldn't shove into a love story
this 100% exists because of mickey redmond calling tyler a junkyard dog every chance he gets and me every time going "okay but what if literally though" -> 🐺
#me 🤝 the detroit red wings hippo campus hive mind#liv in the replies#the way that this fic exists fully formed in my brain & i just need it!!! to come out as a narrative!!!#where is the brainworm to print fic button. where is it#also the way in which i’m just like ‘yeah the fic is tyler borzoituzzi’ ok but can we have a title please. like a real one.#because somehow out of 20 pages of bertuzzi-thesis-dog-related quotes i have not found a title. ???? help. i also have a whole titles note#for just collecting phrases to use as titles (sometimes with specific ideas sometimes just vibes sometimes like oh i like that phrase)#not to mention the fact that my quote doc for the bertuzzi thesis has a more embarrassing title but like it’s fine!!#UPDATE THE DOC HAS ACTUAL WRITING IN IT 🚨🚨 I REPEAT WE HAVE REAL NARRATIVE NOT TAG NOT!FIC#WE ARE AT A SOLID ALMOST 1K!!! THIS IS THANKS TO Y’ALL!!! don’t ask how long the document with notes is tho. also how many scenes are done 🙃#anyway i have had this reply written for like two days but keep not posting it because i wanted to be able to have something written to give#but also there’s another ask about good dog bad dream so this one will be info (boring) (sorry) and i will post a snippet in the next ask <3#me vs not wanting to spoil things vs literally the entire plot of this already written out in the tags: fight#tyler borzoituzzi#WAIT MY TAGS DIDN’T SAVE 😭😭😭#you’re missing the one of me going ‘🥺🥰☺️😭💕‼️🥹 thank you for the ask’#lmaooo tumblr out here like ‘bro you can’t do that every time someone sends an ask’ ok well watch me. what if i DO cherish every interaction#wip ask game
5 notes · View notes
Text
Me: Man I haven’t been on pixiv in ages, I should get back on there Me: [Is immediately bombarded by cp, gore, and a slew of blocked users whose work I still have to see because pixiv does not filter out the works of people you have blocked when you search for something] Me: Oh right. [Closes pixiv]
3 notes · View notes
sambusa · 3 months
Note
Hey, this is Taylor from a few years back. Sorry for the ask. I haven't used this app in a few years and forgot how to message lol. I was looking through my old account and saw yours was still up and running, and I just wanted to tell you thank you for the time you were my friend and how patient you were with me. You were a great friend and an even better influence. Hope you're doing good!
This was such a wonderful surprise... I have so many words and yet none at all. Thank you for being my friend, too, and for the kindness you showed me. I hope the future has treated you kindly 🥹🫶🏾
#and now a word from us kids#first of all if you dont know how to use chat its not ur fault its bc tumblr updated and changed 90 times in the last 3 yrs like WHO ASKRD#FOR ANY OF THISSSS#since the great tiddy ban of 2018 we have just gone farther and farther downhill yall 😒 tumblr never shld have tried to appeal to the ads#and its not like it even worked bc The ads we DO get are like facebook video level LIKE PLZ ABEG 😭#anyways i want you to know that when i finally read this ask (like forever late) i was travelling with my sister in TX mind you! and i#literally stopped walking on the sidewalk in 100 degree weather she was so mad at me but i was literally floored#i will never be able to express how much being your friend was healing to me too. and i missed you. and life is crazy#idk if you ever saw that one post on tiktok that went viral and it was an old lady and her best friend had “we were girls together” on#her tombstone like... i think about that all the time. something so beautiful about youth and IM YOUNGG WE R YOUNGGG but still.#thank you for being my friend and thank you for finding me again and i dont even know what words to say! but this was incredibly sweet#and i sat on it for 2 weeks bc i didnt know what to day and i still dont. but i hope you still remember how to read tags 😩😩#a part of me wanted to figure out how to answer this privately but also a part of me wanted this to be tangible somewhere so i apologize at#the end of the day i am still a tumblrina immortalizing things on my blog 🥹🩷#my sunshine#🩷🩷🩷
1 note · View note
anisespice · 2 months
Text
“ baby steps ” || tokyo rev.
Tumblr media
continuation of this post.
pairing: bonten x fem!reader [ mikey, ran, sanzu ]
warnings: mature content ahead. MDI. mature language, crude humor, ANGST w/ comfort (mostly in mikey's), deadbeat!bonten (unintentionally), not proof-read so there may be A LOT of errors :// mikey's is LONG, ran + sanzu's are silly goofy, mikey + sanzu's are a lil unhinged lol and i think that’s it :))
notes: can i just say thank y'all so much for showing "accidents happen" the love that i didn't think it would get, it was made on a whim so i'm so so so happy y'all enjoyed! i tagged as many as i could (or that tumblr would allow) sorry if i missed some of you :( thank you for your patience and let me know how you feel about this continuation format :) !! notes ii: also also, pt. 2 for "accidents happen" coming soon! notes iii: MY COMPUTER CRASHED AND I THOUGHT I LOST EVERYTHING BUT IT'S OKAY IT'S OKAY :'))))
tagged: @fantasycantasy , @illegalspacecow , @captaincyberqueen , @cherryblossiren , @niragiswhore , @awkwardaardvarkforever , @valentsoup , @lovely212 , @miffysoo , @yandere-kouhai , @i-am-just-a-girl-ur-honor , @wisteriarose214 , @kindadolly , @yuwaimo , @sweetbella1221 , @simpingfor-wakasa , @sirachano0dles , @yutahg , @slowlikehonee , @blurpleuni-squid , @haruchiyoreen , @istanstraykidss , @loyard176 , @msluccapotato , @luv444lay , @backgroundcharactera , @jegelskeranime
Tumblr media
Ever since you picked up your daughter, there’s been a hovering presence that wouldn’t go away no matter where you went. From the park, to the grocery store, all the way home it clung to you like a bad itch. Despite looking over your shoulder and being met without any sort of threat, that didn’t stop the uneasy feeling. And it only intensified when you received a knock on your front door.
You made a confused hum, checking the time on the microwave to confirm that it was indeed past the reasonable hour for potential visitors. Not to mention, you weren’t expecting anyone.
The hairs on the back of your neck stood up, instincts telling you that something wasn’t right, that your best option was to pretend you weren’t home. However, the person on the other side knew otherwise as they knocked on the door again, this time with more fervor. You inhaled sharply, taking hesitant steps towards the door until you were mere feet away from it. Eventually, you worked up the courage to look through the peephole, your brows furrowing in distress when all you could see was black—They were covering it. All the more reason not to open the door…
What if it’s a robber? Ridiculous, they don’t knock.
What if it’s just the neighbor? Why cover the peephole?
More and more did your mind swirl with endless possibilities, each one becoming less and less believable. Taking a long, deep breath, you doubled-checked the door-chain was on before slowly cracking it open. And as you attempted to peek through the sliver, nothing could’ve prepared you for the arm that forced its way through, startling you as you yelped, stumbling back as it made a grab at you.
Before you had the thought of shoving the door closed on the offender’s arm they grabbed the little chain, then yanked it clean out of the wall. To your terror, a dark hooded figure entered your home, head hung low, concealing their identity.
You began to hyperventilate, backing up to keep distance as they staggered further into your home before kicking the door closed behind them, effectively blocking you from the exit. Surely, someone heard your scream and would check in, or call the police. But, how long did you have before the intruder decided to make a move? Not to mention, your sleeping child just down the hall…
With that last thought in mind, you immediately steeled your nerves.
Even if you had to use your bare hands, you were going to do whatever it took to keep your baby out of harms way.
You reached for the closest weapon without taking your eyes off the figure, hands clasping onto a discarded umbrella that was leaned up against a closet door. It wasn’t ideal, but it would have to do. Taking a defensive stance, you prepared for what you assumed to be the inevitable.
“I-I don’t know who you are, or what you want…b-but if you don’t leave…my..my boyfriend will be home any minute! H-He knows how to fight, and he’ll fuck you up if you try anything!”
Your means of intimation fall on deaf ears. It were as if you hadn’t spoken at all. They just…stood there. Watching you from the darkness. That feeling, that hovering presence you’d been weary about all evening…there was no doubt in your mind it was because of this individual. Suddenly, they gave a watery chuckle, hand coming up to rub the lower half of their face as the chilling noise dissipated into soft snickers.
You sweatdropped. “I mean it! He’ll be here real soon, so you better get out of here before-”
“[_____]…” the figure finally rasped, voice heavy with an emotion you couldn’t decipher in the moment. You froze, eyes widening.
“…How the hell do you know my name?”
Without much urgency, they stepped forward into the light. Beneath the warm glow, it took you mere seconds to recognize the person standing before you. You gasped, trembling hands dropping the umbrella, it landing with a harsh clatter. Soft, mortified hitches in your breath echoed through the small space, memories flashing before your eyes as you covered your gaping mouth.
“M.. Ma..” you whimpered, throat tightening. A shell of a man, who gazed upon you with stormy eyes flooded with tears at the mere sight of you.
He gave another strained laugh, muttering to himself as he soaked you all in. “Needed to know.. Needed to know it was really you…”
Mikey eyed you up, intensely, eerily silent as he did so. Then, he took in the surroundings, the warmth, the interior, the smell of dinner—It truly felt like a home. A bitter pill to swallow once he reminded himself that you built it without him.
His sharp gaze returned to your stunned expression. He sneered.
“Must’ve been easy for you. To forget me and move on, just like that. Like I was nothing.”
You blinked, taken aback. All you could do was remain speechless, cemented to the ground with thoughts and questions racing in your head. Now matter how many times you opened your mouth, no sound would come out aside from choked whimpers.
“Do you know…how long I’d been searching for you? Been mourning for you?” He hissed through clenched teeth. “When you left, I thought… I thought someone had taken you. That I lost you all because I was too stubborn to say I’m sorry…”
As he spoke, Mikey slowly closed the space between you. The more he came into the light, the more you could see how the years had treated him. His cheekbones were more pronounced, the dark circles under his eyes as well. His lips were dry, cracked, his fair skin now ghoulishly pale. If not for the black hoodie you would’ve mistaken him as such; ghost of your past.
Your shoulders shook, hands hovering over your face as you gaped in disbelief. He’d been looking for you?
That night, that stupid fight you could barely remember…he made it crystal clear that he wanted nothing to do with you. He pushed you away. Pushed so hard that you almost believed he really wouldn’t have cared if you dropped dead. You knew he didn’t mean it, knew it was just another dark impulse…but none of that mattered when all your pregnancy tests came back positive just hours prior.
That night, you made the decision for the sake of your daughter. And also, for his sake. At the time, you were certain he wasn’t ready to be a father. He was quick to rage, merciless, losing himself to the darkness you tried to protect him from. If you had stayed, you were certain Mikey would’ve never forgiven himself if he lost control in front of his own flesh and blood, if the child grew to resent him for something he struggled to control.
You thought you were doing him a favor…but it appears to have done the opposite.
“And this whole time…you’ve been here, alive. Playing fucking house with someone else.”
You stiffened. Someone else? Your visible confusion only irritated him further.
He scoffed. “Don’t play dumb. You said it yourself. Too bad he won’t be coming home anytime soon. I’ve already got Sanzu and the Haitanis looking around for the bastard. And when they find him, I’ll make him regret sticking his filthy dick inside you.”
Confusion morphed into realization. You did threaten him with said hypothetical boyfriend…But, that was before you knew it was him!
“Oh, Manjiro…” you whispered. He glared, scorned.
“Don’t you dare pity me. I mean, you got the family you always wanted, right? So who cares who it was with, right? Congratu-fucking-lations.”
You shook your head, exhaling deeply as you held your face in your hands. For years, he thought you dead. Then, when he received word of your appearance, he finds you with child. And not once did he consider that child to be his? It’s like…he couldn’t fathom the thought.
If only he had looked just a little bit closer, he would’ve seen that she had his eyes. How they resembled those pools of ink that used to shine with so much hope back in his youth, so playful and full of love…those same eyes that now gazed upon you with contempt.
It stung.
He thought so low, not only of himself, but of you as well.
Taking a deep breath to reel in your emotions, tears began to well up in your eyes. He assumed they were tears for your doomed lover, further breaking his heart as Mikey clenched his fists to the point of nearly drawing blood. Luckily, even though you struggled to find the right words, someone else happily found them for you.
“Papa..?”
Both of you instantly drew your attention on the toddler standing near the kitchen, one fist clutching her blanket while the other rubbed the sleep from her eye. You glanced at Mikey, and he was stiller than stone. His once dead-stare had morphed into what could only be described as incredulous. Surely, he heard her incorrectly…
With a sniffle, you crouched down to address her, offering a soft grin as you nodded earnestly. “That’s right, sweetheart. Papa’s finally come home.”
The little girl blinked sleepily, taking a second to reboot. But, as soon as the words registered, a bright smile stretched across her face as she excitedly rushed towards Mikey, throwing herself onto his legs and hugging them like a koala as she chirped, “Papa, home!”
Said man hobbled a bit at the force, arms windmilling as he caught himself to keep from falling backwards. He didn’t know what to do with himself, especially when those big, round pools of ink opened and stared right up into his soul. Mikey’s heart nearly stopped. With a hitch in his breath, the gangster did everything he could to hold his composure, looking between you and the child as you both gazed at him with so much warmth…it was suffocating.
Sensing he was overwhelmed, you reached down to scoop up the bubbly bundle, holding her close as you eyed Mikey, apprehensively.
He resembled a cornered animal—Muscles stiff, jaw tight, eyes wild. After a moment, Mikey began to slowly back away into the shadows of your home, conflicted, devastated. It wasn’t until his back hit the door did he eventually fall to his ass, of which caused your child to giggle at how silly he was being. However, all you could do was hold back tears, watching as the reality started to weigh down on a man who just discovered he was a father.
Nervous, you gently explained. “I didn’t leave you because of our spat, Jiro…and I never moved on. I just…thought that I’d be doing more harm than good sticking around when I found out I was pregnant…I didn’t want to add any more stress on your plate, so I…”
Mikey didn’t respond. He sat there, stare vast and unfocused. But, you knew he hung on to every word. So you continued. “I wanted to tell you. But…I wasn’t sure how. At the time, I believed you had stopped caring about me altogether. And to hear you’d been looking for me, I-I’m…I’m so sorry. I’m sorry you harbored all that guilt. I didn’t mean for any of that to happen.”
Your daughter wiggled around in your hold, making small grunts in complaint. Her eyes were trained on his figure huddled in the dark, wanting to be acknowledged, wanting his attention. “Papa!”
Mikey flinched. He focused his gaze on the two you, haloed by the light emitting from the living room. You both were like salvation, reaching down to a broken sinner…How could she want anything to do with him? When he had missed so much already…
To keep from accidentally dropping her, you placed your daughter back on the ground, watching wearily as she wobbled all the way to Mikey, blanket in tow. You weren’t worried about him hurting her, far from it…if anything, he appeared to be the fragile one.
Eventually, she made it to her destination, standing before him with a curious, but eager expression as she rested a hand on his knee. Mikey watched her, took in all of her features, every last detail as he engraved it to memory. She was beautiful, just like her mother. One would think his genes didn’t stand a chance. But the eyes. That was all him. From his mother to his older brother to himself, there was no doubt in his mind that those were Sano eyes.
His lower lip quivered, reaching out hesitantly to caress her cheek. She didn’t cower away, merely babbled as she began patting his knee, allowing his thumb to rub over her chubby cheek. You clasped your hands over your mouth, growing even more emotional at the delicate moment. Mikey looked enamored already, eyes subtly sparkling from what you could see as they interacted.
“I-I told her stories, about you. And I made sure to show her photos, too. Old ones, but still you nonetheless. I wanted her to know who her father truly was. Despite everything else…”
Your daughter cooed, then placed her blanket in Mikey’s lap before climbing into it. Mikey didn’t dare move, rigid as she made herself comfortable. He looked up at you, looking for guidance, for reassurance. Your encouraging smile was enough for him to hesitantly place his hands on her small back for support, carefully adjusting so that she was stable. She laid her head on his chest and stuck her thumb in her mouth, sighing contentedly.
And, for the first time in years, he smiled.
Tumblr media
When you hadn’t seen her familiar pigtails bobbing around, or heard any of her excited chatter with the receptionist up front, worry couldn’t even begin to describe what you felt the moment you realize…your daughter wasn’t here.
As soon as the meeting looked like it was wrapping up, you politely excused yourself from the room. Masking your worry wasn't too difficult, but there's no doubt a couple people might've noticed the spring in your step as you exited. One of them being Rindou Haitani. He watched you speed down the hall with mild interest, corner of his mouth ticking up ever so slightly as he thumbed around on his phone beneath the table. Having been updating his older brother during the meeting while he was on his smoke break, he was more than eager to inform him of the storm that was no doubt heading his way.
Little did the younger Haitani know, he was already dealing with one.
"And then, Haruka-kun tries to take Momo-kun's bento box because she had cuter animal shapes, but Momo-kun already said no, and so Haruka-kun pushes Momo-kun, and then tries to take it! But I pushed him and hit him with my fist, like this," she clenched up her tiny fist and held it up to Ran before striking down on his forearm with all her might. It didn't even pitch. "Like that."
The lavender-eyed man merely gazed upon her with mirth. "Did you now?"
"Mmhm! And teacher got so mad, and said that she would tell Ma about me fighting, but she's stupid because Ma didn't pick me up today, and I told Haruka-kun if he snitches, I'll beat 'em up!"
Ran lowly whistled. "Quite the little menace, ain'tcha?"
She pumped her fists. "Yeah!" Then, she paused, holding a finger to her chin in thought. "Wait...what's a menace?"
"Ah, something you inherited from your old man." He ruffled her hair, much to her displeasure. Though her innocent jab earlier regarding his age still hit a sore spot, he was starting to like the sound of it. She, on the other hand, wasn't convinced.
"I already told you; Ma was on her happy juice when she said that. She said not to believe anything she says when she's on happy juice. It makes her do silly things."
Ran chuckled. He knew that all too well. The little girl wouldn't be in this world if not for your inability to hold your liquor. But judging based on how you've raised her so far, clearly you made the right decision keeping him in the dark.
He'll admit, he wasn't the best in terms of commitment. Throughout his day to day, Ran just didn't have the energy. With being in Bonten, keeping an eye out for his younger brother, handling business, dealing with numbskulls and disposing of their bodies, there was never a time to even consider settling down. One-night stands and on and off flings were the easiest choice. At least, until he stumbled upon you.
You were the whole package and more. Classy, independent, witty, and a looker to top it all off. When Bonten started collaborating with the organization you worked in, he couldn't help but to be drawn to you—Like a moth to a flame. It started out as the occasional bantering, trying to one-up the other, catch them off guard. Ran was smooth with his words but could never quite beat your sharp tongue. Thus, things escalated to something more flirtatious. Harmless, but it didn't take long before the months of tension between the both of you began boiling over...and throwing alcohol into the mix, it was the first time Ran finally felt like he had the upper hand. Seeing how poorly you handled just a few glasses of wine, it endeared him. Seeing a piece of you that no one else had the privilege to witness. Your sloppy side, the clumsy, whiny, touchy side. After that long, passionate night beneath the sheets, the one time you and Ran allowed yourselves the space to be vulnerable with one another...you found yourself pregnant. And Ran found himself being nonethewiser.
He wonders, if he hadn't left the next morning and completely ghosted you...would you have kept him in the picture?
Suddenly, his phone dings. Reaching back to pull it from his back pocket, Ran half expected it to just be another update on the meeting or Rindou cursing at him to hurry his ass back inside. But, it wasn't that at all. And at the sound of your kitten heels rushing out of the building and halting at the top of the steps, Ran didn't even need to look up to know who was glowering down from them.
"Hey, Ma! Guess what, the purple man isn't such a meanie after all!"
Ran snorted, finally looking up from his phone to greet the woman who not only still had his heart, but evidently his first child. You, on the other hand, weren't so thrilled to see him.
"Rika. Wait inside. Ma's got some words for the purple man."
He smirked. "Wanna say 'em over a glass of wine?"
"You son of a-!"
"Bad word!" Your daughter covered her ears. You flushed, your composure nearly slipping just by being in his prescence. Ran, immediately seeing the opportunity, teasingly pouts at you whilst covering her tiny hands with his larger ones, shielding her.
"Honey, please, not in front of the child. Can't have her repeating those dirty words at school, can we?"
You fumed, speaking through clenched teeth. "Haitani, as soon as I get her in this building, away from you, I swear to God, I'm gonna wring your neck."
He hummed, amused. "Well. Guess she didn't get her violent side from me after all. Speaking of which, did you know at school today-"
"Hey! No snitching!"
Tumblr media
“...What did you say?” 
You were hoping you heard the teacher wrong. Surely it was just your exhaustion taking the wheel. But, when her kind smile didn’t falter, nor did her gushes for the supposed “adorable display”, you immediately grew suspicious.
While heading home from work, you went to pick up your children from daycare. And when you arrived, the teacher merely informed you that it was already taken care of by your very handsome and very devoted husband. 
“I-I think you’re mistaken. My boyfriend and I aren’t married…”
The teacher, finally coming back down to earth, tilted her head in confusion. “Eh? You aren’t?” 
“Did he…say we were?” 
“Well, no. I just assumed since it was easy to tell who he was here for. Hikaru and Kaoru look so much like their daddy.”
You choked on your spit.  Hikaru and Kaoru look so much like their daddy. Hikaru and Kaoru look so much like their daddy.
You did everything in your power to keep from strangling the poor woman. Sure, she didn’t do anything wrong per say…but she sure did make a grave error. And your struggle to restrain your intrusive thoughts must’ve shown on your face from the way she placed a concerned hand on your arm. “Are you alright, miss? You look like you’re about to faint.”
“M-Mhm, yep, great, just peachy.” You squeaked through clenched teeth, sweatdrop on your forehead. “Could you um…confirm something for me?”
“Uh.? Er, sure. I’ll try my best.”
With tense shoulders and a tight smile, you asked, “Their…father…did his mouth have two scars in the corners?”
The teacher blinked, confused. Shouldn’t you already know that answer yourself?, she was probably thinking. And she would be right; you did know. But her simple, hesitant nod was the final nail in the coffin that was your delusion—Haruchiyo Sanzu had found you. And to make matters worse, he had the children.
Your smile faltered, twitching ever so slightly. Covering it with a forced chuckle, you cried, “Oh, that’s..wonderful! He’s always been self conscious about them, and I’m j-just.. beaming with joy that he’s embracing them more. Have a nice evening, Ms. Yuki.”
The teacher didn’t get a chance to respond as you quickly turned on your heel and began speed walking home. You’d apologize for your abrupt exit another day…right now there were more important matters to worry about. For instance—How on earth did Sanzu find you? How did he know about the twins and where they were? Oh, God…did he know about Satoru?
Dialing him up a few times only for the calls to go straight to voicemail weren’t reassuring in the slightest, having you rush across oncoming traffic just so you could avoid any further delays for your fraying nerves. You could see your apartment complex up ahead, heart thumping in your throat at the familiar, black SUV parked a couple blocks down. Had it not been for the heavily tinted windows and no license plates, you probably would’ve overlooked it. He knew where you lived. Stomach in knots, muscles stiff, nerves shot. You didn’t know whether to feel relieved or devastated. Your kids were safe at home, but at what cost? You stood in front of the building, rooted to the ground. Despite mentally preparing for this exact scenario for years, it all went down the drain the second you went to that daycare and discovered your children were missing.
It wasn’t until your phone vibrated did you snap out of your thoughts, shakily pulling the device out of your back pocket to check the notification.
from : unknown 1:06 pm     “ hi, mama.~ ”
Your stomach twisted. Attached to the message were two photos.
The first photo was of your kids eating McDonald's in the kitchen, happily cheesing and waving at the camera. You couldn't hold your choked gasp, hand coming up to hold your quivering lower lip—They were safe.
The second photo...was of Satoru. Tied to a chair, gagged, and beaten senseless. And standing behind him, holding him by his hair so that he could pose for the camera, grinning like a cheshire cat...
Another message pops up. Your grip tightened around your phone.
from : unknown 1:09 pm " daddy's home.~ "
Tumblr media
© 2024-2025 anisespice ッ all rights reserved. likes, comments & reblogs much appreciated!
2K notes · View notes
aces-and-angels · 2 months
Text
Tumblr media
artwork by raghad qanou follow: @rhq2744 verified ✔: no. 221 on el-shab-hussein/nabulsi's sheet
dear moots/lovely lurkers- please read 🖤
raghad has finally reached the very first milestone in her fundraiser! that's right gang, thanks to the continuous support of friends/strangers alike, raghad's family has raised a whopping ✨£5,095✨as promised, here is another beautiful original by miss raghad herself 🖤
for those who haven't gotten a chance to meet her yet, please allow raghad to introduce herself in her own words:
Hello everyone, I am Raghad Qanou, a second-year human medicine student at Al-Azhar University in Gaza, or rather, I was like that, before I lost everything, literally everything... Before the 7th of October, me and my family [8 members] were living in our cute house in the Shujaiya neighborhood in Gaza, after huge suffering to repair it and return to living in it after it was destroyed in the 2014 war on Gaza. My family and I were forced to leave our home and forcibly move under fire 7 times so far! All this to escape death and hold on to the last shred of hope for a decent life! excerpt from raghad's gfm campaign page (read full story here)
i first met raghad sometime in june after she messaged me here on tumblr. one of the first things she shared with me (besides her name lol) was this piece:
Tumblr media
title: waiting for a ceasefire "only hope and art keep us alive here in gaza ...." -raghad qanou
since then, we've been able to chat a handful of times-- i told her how much i loved her artwork and she excitedly shared even more of her work with me
raghad is a talented artist- a loving sister- a diligent student- a wonderful daughter- and someone who deserves a chance to live a life worth living. her whole family does
they continue to suffer through horrific living conditions and rely on y'all to help carry their burden. to reveal yourself so vulnerably to the world is far from easy. so often, we are told to grit our teeth and push through whatever ails us in silence. but this is a type of pain that cannot and should not be felt alone. and it will take everyone to band together so we can begin to heal
raghad's campaign still has a long way to go. to help things move along, i am proposing another art reveal ✨
if we can get raghad to £15K- i will unveil another beautiful piece from her collection of artwork!
Tumblr media
as of posting, raghad's family has raised £5,095 / £55,000.
for those able, please consider donating by clicking the link below + share this post so others may get the chance to help out too 🖤
tags for reach below cut (note: sorry gang, ik we're not really moots. if you're here- it's cause i pulled people from a post that promoted a gfm in the past. please let me know if you do not wish to be tagged in future posts. no hard feelings, truly 🖤)
@juneybug @kodigobacktosleep @apocalyptic-dancehall @imnotthepersonyouseek @toonirl 
@kingofthebookcase @kazehita @yonch @pinkdreamscape1 
@king-dail @caseys-soup-corner @shoogachi @killy @missusmousse 
@j0ckhead @whoopsiedaisy20 @squidie-tittie @dreamingamongthestars @trexpel 
@mischief16 @foulharbor @draginfyre16 @tangerinesteve @3amsnow 
@fruitpuddle @wallsong @selkiesmile @suzakus-canon-wife @turquoisewavesstitch
@loutrem @thatlethalsoul @visemes @orange-coloredsky @dweamdoodles
@just-a-girl-0001 @samrobotize @aunty-matter @gamelpar 
@roachie-paradise @queruloustea @ehjane @firebird963 @butchdykekondraki 
@dinofur @cthulhu-with-a-fez @purplenickel @ysngie @paper-mario-wiki
1K notes · View notes
hellsitegenetics · 7 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: according to democracy, yes
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
Tumblr media
2K notes · View notes
highvern · 7 months
Text
Tumblr media
Work Me Out
Pairing: Kim Mingyu x fem!reader
Genre: Smut, 18+
Warnings: working out, flirting, touching, almost car sex, making out, breast play, fingering, oral, face sitting, multiple sex positions, big dick mingyu, protected sex (gasp!), strength kink, dirty talk, choking, spanking :) lover boy gyu as always. let me know if i missed anything!
Length: ~5k
Note: y'all thought cheol rot was bad but the OG bias wrecker is back. dont come at me for gym terminology i go by vibes. replaced my gym crush with mingyu and this is what happened <3 i have a bonus/pt 2 in the drafts too but I'll wait to post it bc too much muscle pig mingyu is bad for the soul... and the [redacted]
to the anon that sent me a seok ask forever ago about his arms, im sorry i used it in this fic. but know i have a seok fic with exactly what you asked for in the works rn. everyone say thank you anon.
@bbychocolat do not hit my line about mingyu for at least 24 business hours i need to recover
Remember: Tumblr runs on reblogs and I run on validation in the tags and comments :)
read part II
read more here
This blog is intended for 18+ only! Minors/blank blogs will be blocked!
Tumblr media
Figuring out the ins and outs of a new gym isn’t easy but it isn’t impossible. Go too early and you’re surrounded by creepy men old enough to be your grandfather. Right after work is a sure way to experience hoards of gym bros crowding around machines like they own them. 
So you go as late as possible. 
Only a handful of people are dispersed through the large space. A few run on the treadmills lined on the catwalk of the second floor, several switch through different weights in front of the mirrors. You make your way through the maze of equipment towards the leg press; your final sets before you can go home and wash away the grime of the day.
Or you would if someone wasn’t occupying the one machine you need.
Peeping your head around, you notice a black backpack and matching water bottle on the ground. You glance around, unable to find a clear owner since the next closest person is halfway across the gym doing a different exercise.
Would it be that rude to take the machine out from under someone if they’re not even using it? You could probably get in all your sets before the person even came back if you moved quickly.
You wait a few minutes. How embarrassing would it be to have the mystery person walk back up the second you sat down? But after five minutes pass and no one emerges to claim the spot, you set about changing the weights out.
And just when you slip into the seat, you look up and find someone approaching.
He’s tall, he’s handsome, and he’s barely ten feet away. Your saving grace is that he hasn’t spotted you yet thanks to his phone. 
But that doesn’t last long.
“Oh! Sorry! Were you using this machine?” You ask, trying to sound cordial. 
“It’s okay!” He smiles at you. “Do you need it?”
Yes.
“No, I can find something else to do.” 
You rise to do just that when he stops you with a shrug.
“I don’t mind sharing.”
“Are you sure?”
“Yeah, I take long breaks between my sets anyway so it’s no big deal.”
So that’s where he went.
“Okay, thanks.”
“No problem.”
He moves to lean against the wall, face buried in his phone once again as you work through your set. Honestly you think he forgot you were even there until you start standing up and he pushes off his perch. 
Exchanging polite smiles, you skirt around him and snag your water bottle before occupying the same spot against the painted bricks. You try not to be a creep but watching the way the muscles in his legs bulge and coil with each rep is impossible to look away from. Especially when there’s just so much to look at.
He racks up twelve reps with ease and switches back off with you before wandering out of sight.
You work through two of your sets before he comes teetering back. 
“I tried putting it back to your weight.” You laugh, sipping from your water bottle.
“Three forty? Ouch.”
“What? Should I have made it lighter?”
“Try heavier. Like four hundred.”
“My sincerest apologies.” You mock, placing your hand over your heart. “I’ll remember that next time.”
He laughs again before slipping back into the seat and working through the motions.
This time you don’t bother hiding the way you watch him over your phone. He looks good, it’d be a waste not to watch the swell of his chest or the stretch of his thighs. The gym shorts and snug black t-shirt only exacerbate how cut his physique is. 
And if he makes a comment you can always twist your not so subtle gawking into a compliment about his form.
When he finishes his set again, he snags his bag and water bottle off the ground before turning to you. “All yours. Have a good night.”
“Yeah, you too.”
And he’s gone.
Tumblr media
Over the next few weeks, you learn mystery man works out at the same time you. He’s there when you arrive and remains when you leave after an hour and a half of sweating and gasping like a dying fish, only absent on Wednesdays when you manage the most last luster workouts of your life. The disappointment the first time you realized you were looking for the backwards cap sticking out amongst the free weights would have been embarrassing but what's wrong with a little eye candy while breaking a sweat? 
And what a great view he makes. Your brief peeks into the mirrored walls are full of nothing straining muscles and glowing skin. The first day he did arms in a cutoff tee will go down in history as the worst day of your life. Only rivaled by all the other days he works his legs in shorts accentuating just how nice his ass is with every squat.
Your friends all ask when you’re going to talk to him again. As if you’ll just walk right up and interrupt the best part of your day. No, you’d rather watch him move across the gym floor from the corner of your eye, throw him a friendly nod, and go about your business than run the risk of making things awkward.
Unfortunately, doesn’t possess the same desire to remain a friendly nameless face like you do.
His name is Mingyu. Or that’s what the employee with glasses calls him while they joke around one night. You don’t mean to eavesdrop but they’re loud and the only exit takes you right past the U-shaped desk. Mingyu throws a grin as you pass by on your way out and the flash of teeth spikes your heart rate higher than any exercise you’ve done that night.
When he officially introduces himself at the water fountain the next night, you have to bite the urge to tell him ‘I know.’ Instead you snort at his extended hand, providing your own name over the firm shake like you won’t be haunted by the feeling of the calluses on his fingers or the heat of his palm for the next week. 
What’s worse is how he says your name back, rolling the sound across his tongue and past his quirked lips. 
And the final nail in the coffin is when you leave and you see the way he turns in the glass doors to watch, bidding you a goodnight with your name signed at the end.
Tumblr media
Mingyu might be the worst gym crush in the world. Mostly because your thoughts of him extend beyond the brick walls he should only exist in. And partially because he’s caught you staring more times than you care to admit. 
Not as many times as you’ve caught him, but the point stands.
No, the worst part, you find out, is Mingyu is an incorrigible flirt. And he knows it.
Tonight you’re off schedule, runny nearly half an hour later than usual.; work clothes sticking to your skin as you make your way towards the off shooting hall housing the entrance to the locker rooms. In a rush, you step around another body only to end up in front of one much more familiar.
“There's my girl.” Mingyu smiles. “Thought you were skipping out on me.”
My girl. My girl. My girl, my girl, my girl….
There isn’t a thought in your head beyond the bold casualness he drops that bomb on you with so you nod awkwardly and force yourself not to sprint the next twenty feet to hide.
Half an hour later, when you catch him watching you in the mirror over his own weights, the bastard smiles like the cat who caught the canary. 
But you end up on top when Mingyu offers to spot you while doing weighted squats. He’s at your back, an appropriate amount of space between your bodies you wish he’d close. You don’t need his help. Your form is better than his (you would know, his ass and thighs give you tunnel vision when its his leg day). And the weight on the bar isn’t even enough to make you strain but why pass up on the offer? Especially with how Mingyu meets your eyes over your shoulder in the mirror with each dip.
And then he cheers ‘that’s my girl’ again when you re-rack the equipment with ease and it's over.
“Shit,” you grunt. 
Mingyu pops up from his perch between your breasts under your shirt, hair a mess and eyes glazed. “Good?”
“No, your steering wheel is in my back.” You wince, attempting to wiggle away and ending up further up his lap.
“Sorry, let me just…”
The seat flies back under your combined weight, throwing your forehead right into Mingyu’s chin.
“Fuck!” 
“Oh my god!” You gasp. “Are you okay?”
Mingyu’s head falls back as he releases a massive sigh. Each second that ticks by has you both coming to the same conclusion.
“Yeah,” you breath, sitting up. “I think this was a bad idea.”
“Oh…”
“I just mean like your car is small and you’re too big and I—“
The guffaw Mingyu tries to hide slips free too easily. “That’s what she said.”
“God, you’re gross.” 
Your nose crinkles as you rise up, using his chest for leverage. It feels as nice as it looks and its the worst knowledge you’ve gained in you life.
“Sticks and stones,” he hums.
“Well this was fun. I’ll ugh… see you around?”
When you try to shift back into the passenger seat to exit, Mingyu’s hands flex over your thighs to keep you in his lap. His sweats do nothing to hide his semi. Something he doesn’t even seem to consider as a concern given the way he unconsciously curls into you.
“Or we can go back to mine.”
He’s trying and failing to sound nonchalant. Like he won’t go home and fuck his fist in the shower with the echoes of your sighs filling his ears if you turn him down. You can see it in his eyes. What hinges on his offer and how much you’ll both regret it if the tension fizzles and dies in his SUV.
From where you’re sitting, it’s incredibly difficult to think with your head and not your hormones. Mingyu is hot, he’s nice, he seems decent enough. His behavior doesn’t hint at him being a creep. If he’s normal enough to fuck in his car, is he not normal enough to fuck in the comfort of a bed?
The thumb stroking your thighs and the hopeful eyes staring you down make the decision for you.
“Yeah, okay.” 
With his address in your phone’s GPS, you trail after his SUV in your own car. The roads are familiar because they’re the same roads you drive when you return to your apartment that turns out to be only three blocks closer to the gym than Mingyu’s. 
All this time he’d been so close and you never even realized. Did he think about you the same way you thought about him when he drove home? If he did, you’re in for a night.
Rolling into a space only a few down from where he parks, you pause to hype yourself up. 
People have sex all the time. It’s no big deal. I can do this. 
A knock at the window interrupts your spiral, finding Mingyu smiling sheepishly through the glass. The muscles in your chest squeeze when he opens the door and holds it for you to exit; and threaten to explode when his hand finds the small of your back and guides you towards the stairwell.
Footsteps echo down to the hall, Mingyu only a fraction ahead to lead the way to a non-descript door with a seasonal doormat that's seen better days.
“Ugh, this is it.” 
His apartment is shockingly clean for a guy your age. Not clean in the ‘I don’t own enough shit to even be dirty’ way. No, Mingyu’s apartment is cozy. There’s throw pillows and blankets on the couch. He has a lamp and bookshelf in the corner and the walls are adorned with a collage of artwork thoughtfully pieced together. Several personal photos are littered throughout, some with an obviously younger Mingyu propped next to what must be a sister or a cousin, a few of him with friends. One of him and a familiar man with glasses, their faces blurry but the glee clear as they’re frozen in time. Your lips lift with a soft smile at the personal touches bleeding into every corner of his space.
Turning over your shoulder you ask, “You and the guy at the gym are friends?” 
Mingyu’s watching you with something unidentifiable in his eyes, stepping forward to figure out which frame you're looking at until he’s only a foot behind you.
“Yeah, we went to the same middle school.”
“And this one?” You say, fingers tracing the edge of the wooden frame.
“My little sister.” Mingyu follows, still only a step behind.
“And I’m assuming these are your parents?”
“Actually those are Wonwoo’s parents.” He chuckles. “These are my parents.”
Mingyu’s arm reaches around to point at the correct photo, his chest brushing against your back.
“Wanna give me the tour?”
Mingyu manages to show you everything in five minutes. The living room and connected kitchen you’re already standing in, the door of the hall bathroom, and finally his bedroom. You take a seat on the edge of the bed, discovering the new smattering of details that uncover more about the man waiting with baited breath in the threshold. 
“Why are you over there?” You ask.
With arms crossed and shoulders up to his ears, Mingyu resembles a kid waiting to be scolded rather than a man who tried to hook up with you in his car less than thirty minutes ago.
“I’m nervous.”
You can’t stop the satisfaction from spreading to your face. “I make you nervous?”
Mingyu pushes off the door jam, shuffling forward until he’s standing a foot in front of you. “Yeah. I don’t really do stuff like this.”
“Stuff like what? Try and fuck girls in your car?”
“Haha.” Mingyu mocks, face descending until he rubs his nose with yours.
Your eyes slip closed when his do, breathing each other's air. “Stuff like what, Gyu?”
Your hands find the material of his shirt stretched across his shoulder. Each brush of his lips across your cheek, down your jaw, until he finds your ear.
“I don’t sleep around with girls I’m not dating.”
Oh.
“We don’t hav—”
“Which is not the best way to ask you out.”
You press him out of your space, far enough that you can look him in the eyes and see if he’s serious. The tips of Mingyu’s ears burn red but he’s looking right at you despite how embarrassed he clearly feels.
“You’re asking me on a date?”
“Ugh, yeah. I think it’d be fun. But you don’t have to! If you just wanna do this that's fine t—”
Whatever words Mingyu was trying to say fizzle on the tip of his tongue as you pull him into a kiss. He curls over you, pressing you further into his bed with every fervent pass. Wedging one hand under the small of your back, Mingyu lifts you up and carries you while he crawls to the center.
Your mind wanders to all the other ways he can manhandle you into the mattress.
He settles flat against you, hips cradled between your own while delving into your mouth. You fill your hands with his ass, dragging Mingyu’s covered cock against your core. A groan backs apart your lips as Mingyu falls into the curve of your neck. 
“This is a yes to the date by the way.” You pant now that he’s taken over, hands scratching up his back in an effort to get rid of his shirt. “In case that wasn’t clear.”
Mingyu’s clothes disappear over his head and across the room, yours following shortly after. The heat of bare skin on bare skin is better than anything until he takes one of your breasts in his palm and the other in his mouth. 
Every curse you know flies through your lips as he sucks and pinches until you're sore between the legs.
He takes the squeeze of your thighs and the rock of your hips as a greenlight, hands leading where his lips follow until it’s nothing but your panty clad core an inch from his face.
“This okay?” Mingyu asks in the fat of your thigh, tongue trailing fire across the skin.
You nod with a sigh, “Mingyu, please.”
He doesn’t need much more than that, the fabric barrier gone in a blink and his nose traces your folds until he’s dying for a taste.
Mingyu eats pussy like he doesn’t need oxygen. The path of his pointed tongue around your clit is nothing short of precise, meticulously tracing every ridge and curve until the sheets stretch under your fingers. When he flattens it to pay broader attention, your legs squeeze and Mingyu’s hands force them wide around his shoulders.
Your feet flatten on the bed and thrust up his mouth, wet and crude with fingers in his hair and your whines in his ears. Every suck of Mingyu’s mouth forces the muscles in your neck to lerch until they hurt and your head falls back. He takes pride in the way you drip for him, making the best mess he’s ever had the privilege to clean up.
You reward him with an lavishing praise at the next twitch of your insides, “Fuck, just like that.” 
Taking advantage of the slight arch in your spine, Mingyu’s hand sneaks under your back, fingers unforgiving as they dig into your ass. He curls your hips up and buries a finger in your core with mortifying ease.
Between your legs, Mingyu catches your eyes. Pupils blown wide, mouths bruised around stuttered breath. A matching set of debauched expressions. He’s more familiar like this; skin glowing with sweat, and hair matted to his forehead. Next time you see him at the gym you know it's all you’ll think about. Next time you're alone in your room, or the shower, or the grocery store. Or anywhere you’ve day dreamed about him before.
He leans back to watch the digit disappear, only to reappear soaking. “Feels good?”
“Give me another and it will.”
You savor the rhythm he sets, thick fingers working to prep you for what you felt under his shorts. His tongue is hard and wet at your clit, fingers stretching and spreading until your stomach dips and you nearly buck him off as your clit swells from abuse.  
Your fingers pluck at your nipples and Mingyu apparently likes to watch because he manages more enthusiasm, forces his finger to crook just the right way, and continues to suck even after you start screaming.
“Oh fuck, oh, fuck, fuck, fuck!” You chant, voice cracked.
Something sounding suspiciously like a ‘thank you’ drops into the mix but Mingyu’s the only one to hear it. In his opinion, he should be the one doing the thanking; you just gave him enough spank bank material for the next six months.
You don’t dislike the taste of yourself on his tongue, his lips, his chin, his cheeks, and even his chest when you flip Mingyu over and aim to return the favor. He blushes when you lap against the hollow of his throat; embarrassed from the way he goes boneless with such simple affection.
He sinks into the plush of the mattress, propped up by the mountain of pillows at the headboard. Mingyu’s stomach stiffens under your tongue and the twitch blooms a smile on your face. Predictable.
“Sensitive?”
Your nails raking up the shape of his thighs turn the denial falling from his lips into a whine, and it makes you wonder what other sounds Mingyu will make with his cock in your mouth.
The vein bulging along the underside of his length gives your tongue something to trace along as you lap from base to flared tip, sucking down until it shines from spit and pre-cum. You take all you can until the curve of your throat protests.
Mingyu’s big and he’s loud.
“Oh God, shit.” He babbles with abandon, hands fisted at his sides until his knuckles turn pale.
You focus on the cock in your mouth rather than how pretty Mingyu’s chest would look covered in bite marks. How a bruise on his hip would be just visible when he reaches over his head to do pull ups, and red streaks from your nails on his bicep would make a great accessory.
A hand lands on the base of your skull, gentle until it's not. His thumb dips to stroke the bulge of his dick through your throat as you take him deeper. And like some ridiculous porno theres still an inch you’ll never be able to take even if you do nothing but let him fucking your mouth until the only thing you taste is cum.
“Fuuuuck,” Mingyu groans from a harsh suck on the upstroke.
He distracts you with his tongue on yours, keeping you from diving back down and destroying his ego from how quick you almost made him cum. Your one solace is the lazy grip you have on the base of Mingyu’s length, fingers tightening around the head while he cants into the squeeze.
You think Mingyu is going to plant you on his cock and make you ride it until one of you is crying. But he keeps pushing and pulling until you’re kneeling over his face, knees cushioned in the pillows and hands against the wall to steady you while he dives in again.
His head shakes back and forth, tongue out to swipe messily at your clit as you grind into his face. The last grip of sanity you have gives you the mind to reach back, jerking Mingyu off while he eats it, a cycle of moans moving through you; him into your folds when you squeeze from a grating pass off his tongue that has you whining to the ceiling fan.
“Shit, need you to fuck me.” You whine but don’t stop curling against the latch of his lips, legs stiff with ache.
It’s Mingyu who brings things to a halt, raising you away from his mouth until you're left on your knees while he stands to rummage in the drawer for a condom. You listen while the paint of the wall cools your forehead.
The hand at the dip of your spine makes you melt when he checks in, “Still okay?”
Nodding, you find him over your shoulder with a thick swallow. Mingyu’s nose follows the slope of your muscles, lips untying all the knots he’s worked into them over the past few weeks.
“Want it like this?”
“Yeah.”
You drop until your chest meets the bed and arch until it hurts just to put on a good show. Mingyu shuffles behind you, knocking your knees wider with his own, palms molding to your ass and spreading it apart to take a good look like he wasn’t tongue deep inside your pussy already. The room is nothing more than the sounds of grounding breaths; Mingyu watching the way your torso moves around the air, releasing a long exhale before moving closer.
The feel of his chest against yours was great, but the hard muscle of it along your back, his chain caught between and leaving a definitive mark, is life ruining. It shreds the last bit of humanity you’ve been clinging to since you dragged Mingyu to the parking lot and tried to stick your hands down his pants while leant against the passenger door.
No matter how well Mingyu stretched you for his cock it was never going to be enough. Taking the first inch nearly splits you in half. But you're soaked and needy; nothing short of the end of the world is going to keep you from getting the satisfaction of feeling him in your guts. You take it with measured breaths and affirmations to relax. Slow arches of his hips work him in until he’s flat with your ass and whispering absolute depravity into your ears.
“Fuck, you’re tight.”
Arching your ass higher, you whimper, “You’re huge.”
Your ass stings under his punishing hand, thrown forward by an involuntary buck of his hips.
“Don’t say that.”
You turn until you can look over your shoulder again, meeting wild eyes. “You feels so good.” You moan, eyelids low and wrecked.
“Didn’t—shit, think you’d have such a dirty mouth.” He bites into the side of your neck, sucking a bruise like a depraved teenager. 
“I knew you’d have a fat cock.”
You get what you want so easily it's almost insulting; Mingyu’s hand forcing your face into the sheets and his hips rushing into you with pure need. Every prod into your cunt has you wailing. It’d destroy your self respect if you could think of anything beyond how he’s ruining you for anyone else.
Pillows topple off the edge of the bed as you scramble for a hold. Anything to ground you against the burn in your veins with every tight squeeze around Mingyu’s cock. His balls slap against your clit teasingly, more degrading than the way he has you bent in half. 
“Harder,” you beg.
Mingyu falls back on his haunches, pulling you with him until you're sitting up right. His arm comes into view, curling around neck until your throat sits in the crux of his elbow and his hand latches on your shoulder; a crude headlock he uses as leverage to keep fucking into you. You’ve been choked but this is infinitely better. Whatever Mingyu wants to take from you, he’s in a position to do so.
“Gonna cum?” He nips into your earlobe.
His hand shoves its way between your legs, swipe roughly against your clit before you can even hope to answer.
A pathetic nod is all you manage thanks to the muscles gathered under your chin limiting your mobility.
Mingyu let's go then and your hands prevent a crash into the headboard, putting you back in the same position as before but you have to work for it now; ass bouncing in his laps as you ride him. Finding your balance, you drop one hand to your clit as Mingyu’s pinch your nipples.
“Let me have it, let me make you come." Mingyu pants into your spine. "Fuck you look so good like this, shit.”
He keeps rambling, flying with you towards the edge hand in hand; both breathless from the slap of your thighs against his.
“Mingyu, feel so good. Oh my god, oh my g—”
The softness of the pillows greets you once again while everything flashes white. Mingyu scrambles behind, fucking you into the mattress while you soak his cock. Muscles twitching, teeth ground till they crack, you come and come and come while begging him to do the same.
Mingyu gives in without hesitation, all his weight behind his hips as he fills the condom; dragging you back with an arm around your waist. Every jerk of his cock against your walls from the force makes you vibrate until he’s slipping out, soiled and used against the back of your thigh.
The last thing you register is his lips finding your shoulder again, rubbing back and forth as he comes down.
You fall asleep under the heat of his body for who knows how long, content in the mind shattering numbness of what just happened. Mingyu seems to feel the same, dead weight hanging half off you so you can at least manage to breath.
When you wake, whether it's twenty minutes or two hours later, Mingyu is snoring into the pillow, still naked. His lips pout in his sleep and you swallow the urge to shower them with kisses thanks to the drool at the corner of his mouth.
Even without the covers, you're warm. The kind of heat that slips over your skin, sinks into your bones and keens for you to fall asleep and stay. But Mingyu asked you on a date, not to spend the night. And you’d hate to assume and ruin whatever this is before it as a chance to start.
“Where are you going?” He pouts.
You don't make it two inches out of his arms before he’s pulling you back, tangling them around you so there's no chance of unnoticed escape. Mingyu digs his nose into your cheek and waits for an answer like he has all the time in the world.
Something tells you if he knew you were attempting to head home, Mingyu would throw a fit. And what use is that when you want to see what a night sleep with a giant human furnace is like?
“Bathroom.”
Adding to the list of information you’ve learned, Mingyu is a stage five clinger. He latches on to your back, guiding you into the shower stall for a quick spray down that leaves half your face, part of your thigh, and almost none of him clean.
He falls asleep against the base of your skull while brushing your teeth, because of course he has a stash of extra toothbrushes under the sink just in case. 
And when you crawl under the fresh sheets, he pulls you into his chest, leaves a kiss against your forehead, and tells you he can’t wait for your breakfast date tomorrow.
Tumblr media
Taglist: @tomodachiii @cvpidyunho @miniseokminnies @ddaengpotate @arycutie @gaebestie @primoppang @gyuguys @mine-gyu @doremifasire @missminhoe @toplinehyunjin @crvs4vldtn @prettygyuuu
© highvern. copying/reuploading/translating my work anywhere is strictly prohibited.
3K notes · View notes
skythealmighty · 11 days
Text
can you imagine if like. object show characters were active on tumblr . i mean fans on here but his account is dead so. i mean itd be fun
#rocket talk #roc save #Fan come Back we miss you
(0 notes)
Tumblr media
💥 fans-fantastic-features Follow
OH MY GOD NEW TPOT EPIWODHWND IM GONNA GO INSANE ONE!!! TELL ME YOUR SECRETS ONE!!!!!!
1️⃣ theoneandonly Follow
:)
💥 fans-fantastic-features Follow
HELLO??
#oh my god HI . THIS IS LIKE IF A CELEBRITY CAME UP TO ME IN PUBLIC. #ARE THE OTHER ALGEBRALIENS ON TUMBLR??? #/WHAT/
(3 notes)
Tumblr media
🧪 test-tubular Follow
My best friend is pacing around my lab. I think a new episode's come out on one of his shows...
#I love him (/p) but he's going to become an unskippable cutscene very quickly
(0 notes)
Tumblr media
⛔ nowaynuhuh Follow
i love shrimpy but it feels like he rlly doesnt ... get what i mean you know 😔 at least hes trying to cheer me up? i just wish i had someone to really talk to when it comes to these weird things i keep seeing
💼 emotional-baggage Follow
hey, i completely understand how you feel! im going to be busy the next few days with a finale, but ive sent you a dm if you need someone to talk to ^-^
⛔ nowaynuhuh Follow
thanks, ill take you up on that later!
⛔ nowayhuhuh Follow
...suitcase?
#i dont think shes been online since that last post #i hope shes alright...
(5 notes)
Tumblr media
💰 goforthegold Follow
Reblogging this every time I miss my co-hosts!
💰 goforthegold Follow
:(
💰 goforthegold Follow
:(
💰 goforthegold Follow
:(
💰 goforthegold Follow
:(
🎮 iamnotmrkrabs Follow
Are you Okay
💰 goforthegold Follow
Take a wild guess.
(512 notes)
Tumblr media
🥈 5centwonder Follow
why do people keep messaging me about hotel things?? i barely even go in two's hotel!
🥈 5centwonder Follow
yowie, you all need a hug :(!!
#especially you baseball guy!!! #im giving everyone in the comments a nice warm soft cookie
(19 notes)
Tumblr media
🆚️ wordswithfriends Follow
Reblog if you think Flower winning BFB was a good choice, you like cheesecake, you hate Steve Cobs, you think Platinum is annoying, you're a fan of Dr. Fizz, you watch Jasonville TV, you think Glowstick's elimination was deserved, or you're gay
#they'll never know which one #i'm gay
(3,724 notes)
Tumblr media
🔌 electricalmusical Follow
WHY IS THERE INTERNET IN RJE AFTERLIFE HELLO
👑 kingofeverything Follow
OMG NO WAY
🎡 not-tally-hall Follow
GET OFF OF TUMBLR.
🔌 electricalmusical Follow
YOU HAVE??? A TUMBRL???????
🎡 not-tally-hall Follow
...no.
👑 kingofeverything Follow
reblog if u dont have a tumblr
🎡 not-tally-hall Follow
This is stupid.
(10,734 notes)
Tumblr media
🍿 stevecobseviltwin Follow
imagine needing to be Consistent to be popular
🖍 magic-crayons Follow
You know it girl!!!
🍿 stevecobseviltwin Follow
AYYYEEEE
#idk who u are but we should hang out Now
(3 notes)
Tumblr media
🟢 greenyguy Follow
🅱️alls
(42,853 notes)
Tumblr media
🎒 liam-plecak Follow
Oh my god I finally got this thing to connect to the internet. Okay.
Hello, Tumblr, my name is Liam Plecak. I'm sorry for the tag spam, but this is an urgent enough matter that I think warrants it.
For the past year and a half, I've been trapped in another universe with little-to-no communication to anyone else. I've been reading a few posts here and there, and I think some of you might be able to help with freeing me and my friends (I think some of you have powers?). Below is an in-depth description of where I am, what happened, and who did this to me. Please, if you can help, send me an ask.
Keep reading
💥 fans-fantastic-features Follow
oh my god? liam from hfjone is fucking real????
🎒 liam-plecak Follow
I'm sorry what
537 notes · View notes
bloomocha · 2 months
Text
❝ ARE WE STILL FRIENDS? (THIS CAN'T END) ❞
Tumblr media Tumblr media Tumblr media
ೃ⁀➷ you and kuroo have liked been friends since forever (highschool), but unfortunately, you both are too stupid to realize your feelings for one another. Until you do.
ꨄ︎ paring(s)! kuroo tetsurou x vball player afab!reader , slight sakusa x reader , slight kuroo x oc
ꨄ︎ warnings/content! 18+ content , timeskip! characters , fluff , humor , mutual pinning but both are stupid , friends to lovers , kuroo blabs , semi slow build up , tension , lots of emotions , slight insecure!reader , porn with plot (plot kinda wack) , kinda dom!kuroo , big dick!kuroo , dirty talk , kuroo is kinda a tease , oral ( f&m receiving) , fingering , slight boob play , unprotected sex , multiple orgasms , missionary → mating press (i think that's what its called idk) , not proof read at all LMFAO
ꨄ︎ word count! 26k+ (whoops)
ꨄ︎ author's note! hiii first post to tumblr lol :3 , this def went on longer than I intended (i got carried away whoops) , semi first time writing smut so pls be nice , if any of my tags r wrong feel free to correct me!! the spacing is also a little weird since I uploaded this from computer but I might go back in and fix it laatter ! hope u enjoy and sorry for the wait lol , i ended up in the hospital and got evicted (double whammy) but ayyee its here now !!
Tumblr media
11 years ago. April 13th, 2013.
You throw your bag over your shoulder after unloading everything from the trunk of Kuroo’s car. Once the space is clean, he closes the trunk with a gentle thud, breaking the silence of the cool morning, and turns to you to ask, “Is that everything?”
You nod looking down at your luggage and counting while trying to fix the twisted trap of your bag on your shoulder that apparently refuses to cooperate. You fumble with it, frustration building up as you mutter under your breath, “Ugh, why won’t you just…?”
Kuroo laughs as he watches you, he steps closer and reaches out, fixing the strap for you in a fluid motion. It slaps against the hoodie you’re wearing and his fingers graze your shoulder, sending a shiver down your spine. 
‘There you go princess,” he says, a soft smile playing on his lips. His touch lingers for a moment longer than necessary before he removes them.
“Thanks, Kuroo,” you say, kicking your feet at the ground. The reality of your situation hasn’t settled in yet and now the moment feels a bit awkward. You pull at the drawstrings of Kuroo’s hoodie, seeking familiarity in it to try and tide your feelings. Your eyes glance over the car, he had only gotten it recently, a gift from his dad for making it into college yet it already held so many of your memories. 
The time he spilled coffee on Bokuto during a road trip, when he almost crashed everybody arguing with Bokuto over directions, that one-time Kenma lost a Pokemon game disc resulting in three of you almost riping his car apart to look for it, him nearly running over Komori and Sakusa, Akaashi cursing him out silently for his interesting driving skills, the late night conversations and the silent drives where words weren’t needed, just his presence was enough. 
You look back up at him again, everything you want to say gets caught up in your throat, so you have to settle. “I’m going to miss everyone,” you whisper, a lump forming in your throat. The stupid late-night convenience runs, group dinners, and weekend adventures ran through your mind, seeming like nothing but a distant memory. The thought of leaving all that behind weighs heavy on you and at this moment you wonder if you're making the right choice. 
You’d been given an offer to join the u19 team, to represent Japan and play other girls around your age who were equally as talented as you were. An opportunity that anybody in your position would kill for, yet as you stand here right now, slight dread courses through you. 
The team is leaving for Brazil today to train and practice, and you wonder if there's still time to change your mind. You love the sport, ever since Kuroo helped you find the joy in it again but leaving everything behind, even if just for a while, feels more daunting than ever. 
Kuroo notices the look on your face. The way your eyes dart everywhere and the way you fold your lip underneath your teeth, something you always do when you're nervous. He playfully flicks your forehead, causing you to wince and frown at him, “Stop overthinking. You’re gonna do great, just like you always do. And after you win everything, you’ll be back before you know it.”
You give him another shake, trying to absorb all this faith he has in you and the reassurance, but the small piece of doubt still lingers. The entire tournament will only last a few months after the remainder of training and you know you’ll be back once everything is over, but those months seem too long. 
He reaches out to take your hand, his thumb tracing comforting circles on the back of it. “I know you’re scared,” he says softly. “It’s okay to be scared. It means you care, and that’s what makes you, you. And I think that’s my favorite part of  you.”
Water starts to build up in the corner of your eyes, you try to blink the tears away ultimately failing and ending up quickly wiping them off instead. Not wanting to cry in front of Kuroo again like you did this morning when he found you cuddled up in your bed, not packed at all. “It’s just… what if I can’t do it? What if I fail? I don’t want to be the reason we have to go home early.”
Kuroo pulls you closer, enveloping you in a hug, one that feels like he’s shielding you away from the world. His arms wrap around you tightly, inhaling deeply, like he’s committing the feel and scent of you to memory. “Listen to me,” he murmurs into your hair. “You’ve already accomplished so much to get here. This is just a small step, one that you’re more than prepared for. You aren’t going to be the reason the team gets sent home. And no matter what happens, you have people here that believe in you.”
The words settle into your soul, soothing the frayed edges of your nerves. You return the hug, squeezing him close like he might disappear if you don’t hold him hard enough, you want to remember this feeling and keep him close forever. The fear is still there, but it feels less like your impending doom and more simply like nerves.
“You’re going to be here when I come back right?” you ask him, pulling back slightly, looking up at him with glossy eyes. The sight makes Kuroo melt, he takes a hand that was wrapped around your waist to run a hair through your hair in another soothing manner. 
“I would hope so,” you pinch his side and he yelps. “Ow!”
“Don’t tease me right now,” a scowl reaches your face and Kuroo lets out a throaty laugh. A warm smile spreads across his face, “I’ll be right here, waiting for you. Next time I’ll drag Kenma out of bed so he can come join. Oh, and I’ll even invite Bokuto and Akaashi too.”
“Please don’t. Bokuto said he was going to bring a cardboard cut out of my face if I invited him.”
“I know. I saw it.”
A chuckle escapes Kuroo’s lips as you pull back, there's a buzz in your pocket and you dig out your phone only to be met with a bunch of notifications from the team’s group chat. Almost everybody was there, only four players not including you hadn’t made it yet, tucking it back in you look at Kuroo, who’s smiling contently at you. 
It was probably time for you to leave now, in case some huge rush comes in and you get stuck in a long line, but you have one more question for him, one that you’ve been itching to ask for no reason other than to test something.
“Hey, Kuroo?” you call, gathering his attention. “Yes?”
“What is it like to fall in love?” you ask, voice barely above a whisper. Heart beating with both anticipation and fear, with hope that he might just tell you what you’re hoping to hear.
The question pierces through him like an arrow, he freezes, confused about why you're asking him that. The question hangs in the air, so thick, that the two of you feel like you are suffocating. Kuroo takes a deep breath and looks away searching for an answer that will suffice. You notice a flicker in his eyes– something unreadable.“I don’t know.”
“Never experienced it.”
A wave of disappointment crashes over you. His answer is polite, almost feels like it’s been rehearsed, but you can sense something is off. His entire tone was off, it shifted to one you know he uses when he’s lying you think. Why does it feel like he's holding something back?
Does Kuroo like somebody? That you don’t know about yet?
The idea hurts, more than the idea of him not liking you back.
You force a smile, trying to mask your disappointment. “Never mind then,” you wave it off with a laugh that sounds hollow to your own ears. “I was just wondering. I wanted some advice that’s all.”
Now it’s his turn to furrow his brows, Kuroo wants to know what you meant? Seeking advice, for what? Is there someone he doesn’t know about?
You watch as something flickers in his eyes but it’s gone before you can truly grasp it. He opens his mouth as if to say something, but then closes it, the words seemingly lost. 
The moment feels heavy, pregnant with unspoken emotions and missed connections. It’s as if you're both standing on the edge of an abyss, teetering but afraid of falling. “You should probably go catch your flight.”
He tells you and you realize that a silly amount of time has passed and that he was right, you do need to leave. A part of you wishes that he’d give you something more, more of who it was he’s thinking about, or even a tiny spark that he might like you, but that idea feels more distant now than ever and hope is a fragile thing, and right now, it feels too breakable to cradle. 
“Take care, okay. Promise me,” you say, voice as steady as anybody’s who feels like her heart is hurting. 
“I promise,” he replies, his eyes never leaving yours. “You take care as well okay? Text me when you land and if you need anything. And come back with stories to tell, for me– Bokuto.”
“I will,” you force a smile, grabbing onto the handles of your luggage, and gathering everything together. You turn to leave, and the path ahead is clear, more clear than ever now, except there's a tinge in your heart. Kuroo doesn’t like you, and that’s clear enough. 
He watches you go, you turn around one last time to smile and wave and this time he can tell it’s not forced. He wishes the words didn’t get jumbled in his head, that he actually knew what he felt and Kuroo lets out a shaky breath watching you go. He wonders if things would be different if he knew, and maybe then you wouldn’t be asking him for advice for another guy. 
Instead, he tells himself that love is patient, that he will wait for you, even if you never return to him. 
As you enter the airport, all you can think is what a lucky girl she is. 
And all he can think is how he’s going to murder this guy. 
Tumblr media
Today had to be perfect. 
It was his first time being somewhat in charge of helping to host an event of this size, and god, is Kuroo thankful for his department. He doesn’t know if he could have pulled all this off by himself. 
He moves through the expensive hall, eye-catching every detail he can. The venue was a hive of activity, the final touches had been put in place for what was shaping up to be an unforgettable night. This wasn't just any party; this was the prelude to the 2024 Olympics, and Kuroo was there to help, orchestrate an event that would celebrate Japan's proudest athletic traditions and its most promising future stars.
And also, several of the higher board members of the JVA would be making an appearance, so everything had to be proper and to exact perfection. The thought of it alone was making him jittery. 
Guests were already pilling inside after taking photos with the paparazzi and posing at the venue's entrance, and Kuroo thought it would be a great idea to make one last round check of everything. It started with the tables, ensuring each one was adorned with elegant centerpieces and meticulously arranged name cards. 
He recognized a few names from the other sports, and even vividly remembered that he had collaborated with this one specific lady from another sports department for that one. Each section was divided up randomly, and people from all different sports sat together, but the seating was also strategic, designed to foster conversations and networking among the sponsors, athletes, and other prominent guests. He paused at one table, adjusting a slightly crooked name card, and smiled at the sight of names he recognized. 
His old classmates, old teammates, current friends, and the people he currently works with today– the monster generation. The volleyball prodigies, who have encaptured the nation since their high school days, were now the cornerstone of Japan’s Olympic volleyball team. 
Kuroo thinks that they were the main selling point of the Olympics, with how popular they all were. He hadn’t even realized how increasingly popular volleyball was becoming, not only in Japan but worldwide until now and the feeling had him buzzing from the inside– it meant that his tactics of getting people interested and hooked on the sport were working. 
Moving on, Kuroo hurriedly checked on the musicians who were starting to play up near the stage. Since the event was one of a more sophisticated background, some other member of the hosting community decided on a string quartet, hoping that their serene music would provide a calm atmosphere for the night. Kuroo exchanged a few words with the conductor, confirming the playlist and timing, but he was ushered off by the same lady who was his partner for the planning. Kobayashi Himari told him to go check on the other stuff, as she had told him she got the rest of this covered. 
Kuroo laughed but agreed and headed to the bar. He inspected an array of drinks and cocktails that they were offering and specifically designed for tonight, a refreshing mix of sake and citrus, ensuring that they were up to standards. He chatted briefly with the head bartender, emphasizing the importance of swift service without compromising the quality of the drinks. The bar would be one of the evening's focal points, he knew how athletes liked to get when they were celebrated, and Kuroo needed it to be flawless. 
The guest list was next on his agenda, He conferred with the team at the entrance as they were helping people, going over the names one last time. They checked and rechecked, but Kuroo’s attention to detail meant he wanted to be absolutely certain that no one was left out or improperly acknowledged. While he was out there, he greeted a few sponsors and celebrities who were heading inside. 
His phone buzzed in his pocket, and he checked it to see a confirmation of everything else inside being ready for the night. Only then did he feel his heart rate go down a little. Finally, Kuroo mingled with the rest of the sponsors, thanking them personally for their support. Their contributions were the lifeblood of the event, and Kuroo ensured that they felt appreciated with some usual ego-boosting. 
As the evening drew near, Kuroo took a moment to stand back and survey the scene. Everything was in place, every detail meticulously planned. The lights dimmed slightly, casting a warm, inviting glow over the room. The camera crews were set up, capturing every moment for the eager public. Now it was time to let the night unfold in front of him.
Tumblr media
Kuroo has never noticed you like this before. 
No, who is he kidding? His eyes were on you the moment he saw you step into the venue with your team, after the paparazzi photos. You looked drop-dead gorgeous, makeup done, extenuating your pretty features, your hair shinned and flowed effortlessly down your back, and don’t even get him started on your outfit. 
The white champagne dress clings to your body nicely, the creamish color emits a slight glow due to the dim lights of the venue, and it hugs your curves in all the right areas, practically exposing you to all the guests in the room, he doesn’t like that but it’s not his place to say. After all, he’s just a friend. 
His eyes move with your figure, and Kuroo watches how you interact with a few sponsors, all smiles, showing off your perfect teeth, and laughing at their jokes. He wonders if they’re as funny as you make them look, or if you’re just laughing to be courteous. He watches as you talk with your teammates, listening to one of them complain about whatever, you offer them a gleeful smile and pat her back reassuringly before heading off into the crowd once more. 
His eyes follow just like before, you have this aura about you, one that’s been dragging him in since he met you in high school, one that causes him to notice all the little things about you. Just like how he notices how the dress might be a tad too long for you, the fabric getting caught in your sharp heels, how the bag that came with your outfit is bothering you, he sees how you look around for your nametag on one of the tables to put it down, and most importantly, he can see the way you limp. 
He wonders how they even got you into those heels, you’d always complain about how they gave you blisters but maybe it was the nature of the event that had your manager forcing you into them. You would never wear them willingly, he bet you put up a fight. Kuroo can imagine the pout on your face, your bottom lip jutting out a little further as your manager lectures you on why the heels are an important part of your image this evening. 
Kuroo wonders if you are limping because of the pain, was it the wrong size? Or was it because of the blisters? Maybe you weren’t used to how tall or how small the heel was. He should have brought extra shoes just in case, for you to wear—
“Kuro..” a voice calls out and the sports promoter remembers where he was and who he was currently talking to. He shifts back to the bar, staring at the drink that now looks slightly watered down, a sign that it’s been sitting there for a minute. Then he turns his head to face his friend, the reason he was at the bar, “Don’t ever invite me to events like this again.”
The dark brunette with fading blonde highlights slouched over the bar, a side of his face smushed into the cold expensive counter as he hosts a brooding look on his face. One Kuroo has seen a lifetime's worth of. “Hey, you need to keep up appearances as a sponsor and the CEO of Bouncing Ball Corp. Besides you were the one who asked to come. What was your excuse? Because you wanted to see a certain someone?”
Kuroo smiles, propping his chin up on his hand and nudging Kenma with the other one. The dark brunette frowns, pink tinting his cheeks–he knows he’s been caught, that he did come out tonight to see a certain someone, but that’s beside the point. “Shut up. I already went around greeting people and it was annoying and a pain in my ass. Besides she’s literally swarmed–can’t you see that?”
Kenma lifted his head up just a smidge, to check if what he was saying was true, and low and behold it was. You stood surrounded by a bunch of other volleyball players, mainly people he recognized like the msby players, Hinata, Kageyama, Komori, and Suna. The rest of them were spread out all around the room socializing with other athletes.
“Hm, haven’t noticed,” Kuroo lies through his teeth. He refuses to look over, trying to get you out of his mind seems impossible tonight. Not like it’s possible any other night. How strange, he thinks, to dream of you even when he is wide awake.
Ever since you moved back to Japan to play in one of the Division 1 teams, you’ve constantly been on his mind. Kuroo hates to say it, but he missed you— and now that he gets to see you almost every day as a member of the JVA, his feelings just keep growing.
Every living moment with you makes his heart beat faster than usual. It reminds him of how he would act in high school, where he would wait for you after school to hang out, go visit your work to bother you, have you come to his school to practice with his team, and the small moments where he’d watch you play games with Kenma and beat him. 
He loves reliving those memories because they’re all filled with you. 
Quite possibly his favorite thing in the world. 
If he had known you coming back would have excited this weird feeling in him again he would’ve stayed as far away from you as possible. Which ultimately wouldn’t be too far, since his job required him to work with your team and because how was he supposed to stay away?
“Seriously?” Kenma scoffs, looking at Kuroo with a knowing look. It’s not like the tall dark down haired man was any bit subtle, and besides, Kenma knows his best friend and he knows you (his other best friend but that’s beside the point). Unfortunately, you both are stupid and idiots. 
Every time Kenma has to watch the two of you interact, it’s like he’s watching two people drowning and trying to save each other. It’s unfortunate that his two friends are oblivious and can’t see what’s directly in front of them. 
Kuroo frowns at Kenma, taking a drink of whatever was in the cup in front of him. He doesn’t even remember what he ordered but it’s strong and leaves a taste in his mouth, “What do you mean seriously?”
Kenma shrugs, puffing air out of his lips and avoiding Kuroo’s eyes. He can’t help but feel sorry for how dense his friend is. 
“Why don’t you go over there and talk to her? Talk to the people you represent, I don’t know,” Kenma suggests, holding his hand out in your path. Kuroo’s eyes follow it until they land on you, this time you're grimacing at something everybody else is laughing at besides Sakusa. 
He thinks about it for a moment. Kuroo hasn’t talked to you all night, too busy talking to sponsers, organizing and discussing future collaborations and deals. The only time he engaged with you was a brief text beforehand when you asked him if you should bring a jacket. 
“And leave you here all by yourself?” Kuroo turns his head to face his friend who is glaring. “I’m worried if I turn around for a moment you’ll pull out your stupid nintendo and stay stuck in a corner.”
“Sounds like my ideal kind of night. It sucks that I can’t even stream,” Kenma mutters to himself, ignoring the unamused look Kuroo was currently giving him. They both turn to stare at you, admiring how you look, some more than others. Soon enough, you must feel the two sets of eyes on you, because you turn their way, gaze briefing meeting Kuroo’s before switching over to Kenma.
You offer a sweet smile, holding up your hand to wave. Kenma’s nonchalant look changes into a slight smile, while Kuroo sends a sloppy smile your way and blows a kiss. His heart patters in his chest when your smile widens at his silly gesture. He waves you over to them, turns around, and chugs the rest of his drink, hoping to steady his nerves.
As you approached, Kuroo felt a surge of confidence. Maybe it was the success of the evening, maybe it was a couple of drinks he'd already had, but he somehow decided tonight might be the night to make a move on you. Just to test the waters. 
But when he turned back, it wasn’t you who stood in front of him, it was Kobayashi Himari. His partner in hosting the event and the brilliant mind who helped him plan everything. She stood there with a light smile, her eyes sparking with mischief. “Hi Kuroo! Long time no see?” she says putting the drink in her hand onto the bar countertop. 
“I saw you thirty minutes ago...” He raises an eyebrow, confused. Himari just shrugs, she leans in closer, purring into his ears. “Feels like forever ago. That suit looks amazing on you by the way. The color is… nice. It’s not quite what I had in mind for you though…”
Kuroo smiles, playing along. “Really? What color did you have in mind?” he asks, his tone a bit teasing. Off to the side, Kenma grimaces at the conversation. 
Himari pouts playfully, “Something a bit more daring, perhaps? But you do still look good, I have to admit.” She twirls a lock of her hair around her finger, her eyes never leaving him. “And this dress? What do you think?”
“You look great,” Kuroo offers. He can’t lie, Himari has always been a bit of a looker. The dress is different compared to the normal business suits she wears, the ones with the glasses that she’s forfeited for tonight. She easily eases a strong sex appeal, the way she carries herself with extreme confidence. She knows she’s good-looking and uses it to her benefit. Kuroo thinks she is more of a mature and sexy type. 
It’s not the answer Himari wants though, Kuroo is oblivious to this, but Kenma catches the slight drop of Himari’s smile. He doesn’t think it’s a pleasant smile, either. Too sharp for his liking. Himari instead of faltering, tries to redeem herself by leaning closer, bending down a bit,  giving Kuroo an ‘unintentional’ view of her cleavage. She whispers in his ear, her breath warm against his skin. “You know, we should ditch this party. Go somewhere else maybe..?”
Kenma gags. 
Kuroo blinks, taken aback. Why would they do that? He glances around the room, the very room they had both worked so hard to perfect. “Why?” he asks, genuinely confused. He did not stress several weeks of planning and stressing on the small details for it to go to waste. “We’ve put so much work into tonight..” he frowns. 
Himari straightens up, her smile never faltering. "Sometimes, Kuroo, it's nice to enjoy the fruits of our labor in a different setting. Just think about it." She winked, then turned as someone called her name from across the room. "I'll be back," she promises, sauntering off to attend to the other guest.
“Please never flirt with her in front of me ever again,” Kenma says, causing Kuroo to look over at him. “That woman is terrifying and not in a good way.”
“Really? That’s just how Himari always is.”
“Yeah maybe if you're a tall, hot, sports promoter named Kuroo Tetsurou…”
“Did you just call me hot?” Kuroo laughs at Kenma rolling his eyes and leans back on the counter. He starts mumbling something incoherent and Kuroo was just about to ask what he was saying until something else entered his view.
Something worth his time. 
Kuroo thinks his heart does several flips now that you're here, in front of him. Blessing his eyesight. Your hands are at your side, fidgeting with the silky smooth fabric of your dress, “Wow. Who was that?”
“Who?” Kuroo snaps out of his gaze to ask, following the tilt of your head when it lands on Himari, who is gleefully chatting it up with some sports athletes. “Oh her. That’s Kobayashi Himari– she's the sports promoter of the swim team. Also my partner for helping to host the event. She’s incredible–really helped pull this entire thing together. Don’t know what I would’ve done without her honestly,” he could go on about the woman's accomplishments, despite only working with her recently, she’s a big hot topic within the sports division due to her ability to bring in support to the swim team. 
Kuroo hopes to have that type of effect on people one day. You listen carefully, not missing the way he talks about her, his voice full of admiration and your heart unreasonably aches with every word. Himari is beautiful, she excludes a level of maturity and elegance that you worry you’ll never possess. Even the way she walked away was sexy– you couldn’t help but wonder if that was Kuroo’s type. Tall, sexy, and not built like a linebacker. 
You feel small in comparison, a stark contrast to Himari’s confident aura. There is even a sense of jealousy that runs through your veins, it’s not justified, Kuroo is not your man no matter how much you want him to be. 
Kuroo’s about to add on when Kenma elbows him, signaling to stop. He honestly to God loves his best friend, but damn is Kuroo so stupid sometimes for the guy who graduated top of his entire class. 
He takes the hint and switches the subject, focusing entirely on you. “Ah, anyways. I didn’t know you were going to wear white. I thought you said you were going to wear black?”
You shake your head, and your hands find your waist over the dress, smoothing it over, attempting to fix your already perfect appearance. “I originally was going too, but the team stylist said I would look better in brighter colors, so we settled on this dress.”
“I also sent you a message about it a few hours ago... but I think you were too busy setting up to respond,” you grin at him, throwing your hands up in a ridiculous pose, and Kuroo is able to take you in fully. He gives you a warm smile as he admires everything about you, “It looks gorgeous on you. Spin for me?”
Your face lights up at his little request and you do a little twirl, the fabric of your dress flaring out gracefully as you giggle. Kuroo swears his breath catches in his throat while watching you move, it's really tempting to hit Kenma and cover his eyes– so that Kuroo is the only one seeing you like this. 
“You are breathtaking, as always of course,” Kuroo hums, reaching a hand out to pull you a bit closer. The hand settles on the lower side of your back, and the warmth it provides excites you, making you rub your thighs together underneath the flow of the dress.
Too busy geeking at how nice Kuroo’s hand feels on you, you almost forget that your other friend is also at the bar, staring at the two of you with a small smile, “Oh! Hi Kenma, almost didn’t recognize you with the suit you had on.”
“Hey pretty,” he greets, straightening up in the bar stool and turning his body towards where you stood in between the two men.
“Pretty?” Kuroo raises an eyebrow at his friend, who shrugs with a sly smirk–one that Kuroo decides he doesn’t like, especially not when it has you smiling like that. 
“Didn’t know you owned anything like that in your closet.”
“Haha, very funny Kenma. That’s rich coming from the man who lives, eats, and breathes, in hoodies and sweats. Did you steal that suit?”
“Yes.”
“No, he did not,” Kuroo glares at Kenma, and he just shrugs in return. “I went out and bought that for him. I swear, believe he would’ve walked in here with a hoodie on if I didn’t”
“I probably would have. Dressing up is exhausting.” You nod in agreement, your stylist took around two hours just for the simple attire you were wearing. It was nothing like some of the other female athletes who went all out, you kind of wished you were dressed like them. 
Kuroo catches your gaze slipping off him, he watches as you stare at the other women in the room and notices immediately what you’re thinking, you don’t need to express it for him. He knows you. “Stop that,” he says softly, pinching the skin on your back through the silk. “You look gorgeous.”
You stop and stare at him. How does he always know when you're up to something?
He gives you a certain look and you roll your eyes playfully. “So, do you like my new suit?” Kuroo asks, leaning back and showing off the black fitted suit.
“Yes! I see you took my advice!” you squeal, happy that he chose the color you said would look best on him. “It’s so much better than that gray suit you practically wear, every day.” 
“My gray suit looks nice, excuse you.”
“I never said it didn’t!”
Your gaze travels all over him, enjoying the view he is giving you. Kuroo had taken off the suit jacket, it was draped over the back of the barstool, leaving him in just the white long-sleeved dress shirt, a black vest, and a red tie. The sleeves of his shirt were rolled up to his elbows, revealing a set of strong forearms, muscles, and several veins. 
The sight of him like this sends a flutter down to your stomach.
Out of the corner of your eye, you notice the black ink that decorates his tan skin. It’s a date, in Roman numerals on the inside of his right arm. Something you’ve never seen before, you swear that Kuroo had once said he didn’t like tattoos because of the pain. So why did he have one that was dated so far back?
Was it a lover? It’s from 2012 when he was a senior in high school. Maybe a high school sweetheart? But you knew Kuroo from then and never saw him with any girls. Unless you count Kenma with long hair. Maybe it was that one girl he half mentioned when you left, You want to ask, but figured that if he hasn’t mentioned it– it’s not your place to ask.
Your hands move unconsciously, reaching out to touch the fabric of his vest while thinking about what that tattoo might mean. The action was casual, like a stylist who was making finishing touches to their work, but the way your fingers traced the material and brushed against his body sent a rush of heat through Kuroo. Though your hands weren’t directly on his skin, it still feels that way to him. 
His pulse quickens as your touch lingers, your proximity making Kuroo oddly nervous. But of course, you seem to have no idea the actual effect you have on him by standing so close, lost in your own world, in between his legs that are spread on the barstool, lost in the gorgeous details of the vest. It has a slight design going on that nobody would notice unless they were sitting close. 
He can smell your perfume, it’s a soft scent that hints on the border of floral but he can for sure confirm it’s strawberry– your signature scent. It envelops him, taking over his senses, the stupid perfume is mixed with something he thinks, it has to be infused, because every time you wear it he swears it overrides everything, everything is just you, you, you. 
“So..?” he purrs.
Kuroo’s breath hitches when he looks up at you. Your makeup is flawless, and the colors match perfectly with your skin tone, accentuating your already pretty features. Your eyes sparkle with excitement and it makes his heart churn, you’re so beautiful to him. Your lips, perfectly painted, curve into a small smile.
“I think… You look sexy,” you tell him softly, a little bit too in your feels to care about how you sound. “Yeah? You think so, princess?” The question–or if he even asked a question gets lost on you, the need to just tell him how you feel honestly for once takes over. The adjective doesn’t get lost on him, you’ve never called him sexy and Kuroo isn’t going to lie, your compliment goes straight to his cock and he can feel himself straining in his pants. 
He has to readjust himself in the seat to try and relieve the feeling. 
God, Kuroo just wants to take you right here. Pick you up and set you firmly on his lap, maybe grind your hips into his until he can feel your pussy throbbing against his cock, make you beg for him to put it inside, he’d tease you, possibly take it slow until you can’t handle it anymore. Make up for lost time and then he’d pound that sweet cunt until all you can think about is his cock sliding in and out of you. Till he successfully fucks you dumb and your whining and begging with tears in your eyes, telling him how much you love the way he feels, and how you want more. 
If the venue was empty, he would bend you over the bar, take you from behind with his hand wrapped firmly around your throat, he’d—
“Hey yn, we have to go. Speeches are about to start soon,” a voice snaps him out of his disgusting thoughts, ones he shouldn’t be having about his best friend. “Hm? Oh! Okay, coming,” you grin his way and then back out between Kuroo’s leg, you pat his hair, ruffling it a bit saying goodbye, and then you wave to Kenma who messes up your hair. “I’ll be back!” you whisper as if it’s some secret you're not allowed to share. 
Kuroo hates Sakusa Kiyoomi– spoiler alert, no he doesn’t. Not when the guy brings in views due to his good looks and talents he doesn’t, but at this moment, watching how Sakusa pulls you away with a hand on your waist, he just might. He watches as the fucker pulls you closer to his body and how his grip on your waistline tightens. 
Sakusa even has the audacity to lean down and whisper something into your ear. Something that has you tensing, your back muscles tightening up as you move uncomfortably and smack Sakusa’s back. The action makes Kuroo smile, but then you lean in to whisper something into the 6’4 Greek god’s ear his smile drops. 
He can sense when Kenma is about to say something he’s not going to like, “Don’t,” his friend only snickers and shuts up. 
“You both are stupid.”
“No idea what you’re talking about.”
Instead of fussing over the fact that no matter how hard Kuroo tries, he will never be enough for you, he turns to the bar and orders another drink. He sends quick curses to Sakusa until the fruity cocktail gets placed neatly in front of him. He's staring at it about to taste it when a hand settles on his shoulder. 
It’s Hinata in his orange glorious self– No Kuroo is not kidding. His suit is literally orange, may somebody fire Hinata’s stylist, “Hey Bossman! Looking great! I just wanted to that that Atsumu and Bokuto broke the chocolate fountain and I had absolutely nothing to do with it.”
Kuroo’s face drops, and he blinks several times, hoping the next words out of Hinata’s mouth are ‘it’s a prank’ but they aren’t. The guy is dead serious, “Are you serious?? How does that happen??”
“No idea, like I said, wasn’t at all involved. Nothing to do with me. Suna is over there filming it–”
“This is why we can’t have nice things,” Kuroo mutters, taking the cocktail down the throat and getting up from his seat, he tells Kenma to watch his stuff. “Hey Kuroo?” Kenma’s voice rings out and he turns around to his friend, “You might want to take care of that before you go...”
Kenma gestures down below and Kuroo’s face falls. He doesn’t even have to look down to know what his friend was mentioning. His lips fall into a thin line and he sighs in defeat, his mood is ruined, his head is hurting at the thought of Atsumu and Bokuto breaking the fountain, and the worst of them all is that he’s still hard. “Right. Thanks.” 
Tumblr media
The event dreads on after that, one by one, sponsors, professional sports alumni, and various dignitaries took to the stage, their words teetering on the edge of boring and inspirational. Kuroo sat beside Himari, she attempted to talk to him the entire time but for some reason, her words weren’t registering in his ears. They sit near the back, as requested by Kuroo so that he can watch everything from afar to make sure nobody is acting up, it’s also a great opportunity to keep an eye on you. 
The table you sit at isn’t too far from his and he thought that would help to relieve his worries but now all he can do is worry about how all these specific volleyball players ended up at the same table–because he doesn’t remember putting them all together like that. In fact, he distinctively remembers separating Bokuto and Hinata. 
A realization dawns on him that somebody over there, (Atsumu probably) has changed the place cards around and it has Kuroo wondering when the hell did he find the time to do that? Probably when he was hitting one off in the bathroom thinking of you. 
Himari leaned over to Kuroo’s side, peering down at his arms, trying to make some small talk, “Hey, I’ve noticed the tattoo before... What’s the meaning of it?”
Kuroo’s fingers instinctively brushed over the tattoo, a small line of Roman numerals that read VII • XXII • MMXII. It was the same day he had met you at the Shinzen High School training camp and Kuroo remembers that day vividly. 
If only you knew how much you’d change the rest of his high school experience and quite frankly his life. You took everything about him, his flaws, his terrible moments, his dramatic moments, his stupid moments, and you welcomed him home with open arms. Invading his heart without making a sound.
You had been so different back then— aloof, detached, seemingly over everything and everyone (it was high school so he couldn’t blame you). You stepped onto the court with an air of indifference, your sharp eyes scanning the room looking for the coach of Karasuno’s team, there was boredom in your eyes that for some reason he couldn’t stand. There was just something about you that drew him in, something beyond how pretty you were and the extreme talent you displayed for the sport. 
A spark? Some sport of potential he couldn’t quite define at the time.
As a child, Kuroo had known what he wanted to do. He wanted to bridge the gap between the world and volleyball, making the sport accessible for everyone to enjoy and have fun playing–just as he did. He already knew this was what he wanted, but when you came along, you challenged him in ways no one else had, pushing him to improve his skills on the court and his outlook on life. 
Then there had been that one day when you confessed to him that you played volleyball because you were good at it, that there was no enjoyment left in the sport for you, no passion remaining, and that you would probably quit after winning nationals. It was that day when he vowed to make volleyball fun for you, to help you find the joy in the sport that he loved so much, to help you discover yourself as he did.
From that day forward, he tried a bunch of different tactics and set up some really stupid stuff to help. Stuff that you had gotten annoyed at, that you yelled at him for, like that one time he had you–freshman you play with a bunch of college kids who were all men (yea he really regrets that one). But his favorite was when he tricked you into letting him teach you the basics, teaching you techniques that you already knew, and probably knew better than him, but in a way, he felt like he made them feel new and exciting to you. Like it was your first time ever touching a volleyball.
The two of you spent hours inside the gym of your school, on that court with the fading paint, going over drills and exercises that emphasized fun and creativity. Sometimes he would invite Kenma, other times he would invite Bokuto and Akaashi and you all would just play your hearts out until night came and the janitors kicked everybody out. 
Kuroo still remembers,  when you showed up to his house over the break, with such a beautiful smile he wishes he stared at it more, asking if he could set up those stupid drills and games for you, or if the two of you could just play together. When you asked him that, Kuroo thought his heart would have stopped in his chest. He realized that the way your eyes lit up in enjoyment, he was so deep in his feelings for you. 
How he always wanted to see you happy and smiling like that. 
Helping you find fun in the sport that you once saw as a requirement was a turning point for Kuroo. He saw how your attitude shifted, how you began to approach volleyball with a newfound enthusiasm. You started to play not because you were good at it but because you loved it. 
Watching that transformation was one of the most rewarding experiences of his life, and that sealed the deal for him. Kuroo knew that he wanted to support you while you went pro and wanted to help others find that same joy in volleyball that you and he have discovered, to “lower the net” and make the sport accessible and enjoyable for everyone.
He will forever cherish those moments.
In many ways, your presence in his life was a blessing he never saw coming. You kept him grounded, where he belonged and supported him. His heart knew where he stood, welcoming you in, letting you get comfortable, letting you embrace him, steal his every thought, and make it yours. 
Kuroo beams softly as he looks at the tattoo, feeling the weight of years and unspoken truths that it represented. Meeting you had been the beginning of everything for him. This is exactly why he is afraid to make a move, he refuses to let his feelings for you get in the way of your friendship. 
With the way he’s looking down at it, Himari can’t help but find herself jealous of the person who’s caught his attention like this. She’s been trying to get with Kuroo for ages, with no advice. 
“It’s a secret,” he replies, trying to keep his tone light. Himari raises a brow but laughs, her eyes sparkling with amusement. He gives her a soft smile before looking in your direction, where you sit next to Sakusa, arm on his shoulder, leaning slightly against him at the table. 
 And then it all bubbles down to moments like these where Kuroo questions his feelings. Not the fact that he likes you–loves you, but where he wonders if he should give up on you. The thought had crossed his mind more times than he cared to admit. 
After all, you didn't seem to see him as anything more than a friend, and he wasn't getting any younger. With him being thirty the dating pool twinges as he goes and well— Himari was right here, interested and ready to move forward. She was beautiful, intelligent, and kind—everything he could ask for in a partner. But his heart wasn't in it. 
Not only with Himari but with any woman he has tried to date. None of them can replicate the feelings you give him; none of them can and will ever come close to you. 
“Ah, I love secrets,” Himari winks at him, and Kuroo thinks the gesture repulses him for a moment. They both wave goodbye when a member of the hosting community excuses himself for a moment, and then her face changes as if she just remembered something. 
She leans closer and whispers, "There's an after-party happening later tonight. You should come. I'll send you the address."
Kuroo looks at her, surprised. "An after-party?"
"Yes," she says with a playful look. "It's going to be fun. A more relaxed vibe, just a few of us from the planning team and some of the athletes. You should come. It’ll be a good way to unwind after all of this."
Kuroo purses his lips, hesitating, glancing back over at you. Now you were pointing fingers at Atsumu from where you sat, most likely accusing him of something, and from the looks of it, the platinum blonde was guilty. 
The thought of spending more time with Himari, away from the pressures of the event, was tempting. Maybe he really did just needed to give someone else a chance. Kuroo looked back at Himari, who was watching him with hopeful eyes.
"Alright," he agrees. "I'll come."
Himari’s smile widens,  in shock. "Great! I'll text you the details."
She moved to mingle with other guests. Maybe tonight was the night to start letting go. If he could give Himari a chance, perhaps he could finally move on from the feelings that had held him captive for so long. 
The speeches soon concluded, and the room erupted into applause. Kuroo clapped along, the speeches weren’t as bad as he originally thought. But the event still had a few more hours to go, filled with press talks, socializing, and dancing. After that Kuroo decided to make his rounds, checking in on everybody, the musicians, servers, the bar, and some sponsors. 
He currently stands at a table, fixing an off-center centerpiece after talking to the JVA board members, who were very pleased with his performance tonight. He was observing the crowd with a relaxed expression when suddenly he felt a light pressure against his right shoulder. 
Kuroo knew exactly who it was. “Hey you,” he says, turning his neck to look down at you and your pouty self. “You okay princess?”
You smile back at him, though your eyes show the fatigue you are trying desperately to hide. “I’m okay. Just tired from all the speeches. They were pretty boring. I think the guy in the blue suit had the best one,” you admitted, still resting your head on his shoulder. You take the opportunity to nuzzle him with your cheeks, accidentally smearing the makeup you had forgotten you were wearing. 
The gesture is endearing and despite his white shirt getting messed up in the process, Kuroo finds it adorably cute. “Ah him.. What was that guy’s name? Gojo.. Satoru? I think he’s a big sponsor of your team actually.”
Kuroo remembers the man with the white hair and scary blue eyes, he had greeted him while speeches were starting because that was when he showed up… notoriously late. But when the guy looks like that Kuroo assumes a person can get away with anything. Not to mention but he’s also filthy rich. 
“Hmm, he’s nice. Albeit too friendly, but very sweet,” you blinked in agreement. “I don’t know if I’ve mentioned it but Kuroo you did a really good job with tonight.”
“You think so, gorgeous?”
“Yes! I mean have you seen the place?” you point your hand out, gesturing to the big venue all around you.
“I don’t know if I can take credit for eeeeeeverything–”
“Shut up,” Wow. Kuroo thinks that one went straight down his pants. “I know you did most of the work, remember? You kept texting me about it? Either way, you did such an amazing job, everyone looks happy and again, the place is beautiful.”
“Hopefully the JVA people will stop underestimating you now.”
“They’d stop doing that if you’d let me–”
“Not a chance.”
“The idea–”
“Is terrible. Leave it alone,” Kuroo laughs, watching you wave your finger wave side to side in his face in a gesture that tells him no in all capital letters. He will get you to do it one day. 
“At least think about it?” he asks. 
“The idea was thought about and then thrown in the trash,” you tell him moving off his shoulder and leaning against the big round table. You were playing around with the flowers near the plates when Kuroo noticed that you were leaning on one foot. The right ankle is rested on the other one. 
“Do you need to sit down? Your foot looks like it’s in pain,” he questions, stuffing his hands in his pants pockets and shifting in front of you just to look down on you with a tilted head. You shake your head and for once Kuroo has a hard time deciphering if you're lying to him or not. This is typical, you often hide your feelings from him–he doesn’t know why or how to get you to stop yet. 
You shake your head. “I’m fine, really. But actually, I came over here for a reason. I was thinking maybe we could... leave? Just for a bit?”
Kuroo’s eyes light up at the suggestion. “We won’t be missed for a couple of hours. We could take advantage of that.” He offered her his arm, and they began to walk towards a back entrance where the staff entered from. It was the least monitored area, not that he or you would have to worry about getting into some sort of scandal. Everybody already knew you two were friends from the many interviews and appearances on Kenma’s stream. To the public, you two were just childhood best friends, nothing weird about it.
When Kuroo leaves the venue with you, entering the parking lot it takes a bit to find his car since the area is so full. The valay? workers aren’t there, either of you question it because it allows the two of you to get out unseen. Finding his car was easy, the black sleek exterior just appeared to stick out among all of the other fancy cars, it also helps that the sticker you stuck on the bumper once is still there. 
“Nice ride, who did you rob?” you ask him when he opens the door for you to step in the passenger side. Kuroo lifts up your dress so that it doesn’t drag along the possible dirty outside. Once you were settled in the seat, Kuroo reached out, his fingers gently brushing strands of hair away from your face. 
Your eyes flutter close at the touch, and he marvels at how serene you appear. With a tender smile, Kuroo closed the door and walked around to the driver’s side, his mind still lingering on the softness of your skin and the warmth in your eyes.
“Fuck off,” he snickers while climbing into the driver's seat. He noticed you watching him, your gaze steady a bit intense. 
Kuroo smirked as he let go of the seat belt, letting it hit against the melt in his car, he leaned over the console, moving in close, his face just inches away from yours.
His eyes watch how yours widen momentarily and then close, the way your lips part slightly in anticipation is cute. 
Instead of doing what you were expecting, Kuroo’s hand reached for the seatbelt next to your head, yanking on it till it crossed over your chest and buckling you in with a smooth click, and then he leaned back, chuckling at the look of surprise and slight annoyance on your face.
“What’s wrong?” he asks, his voice teasing. 
You pout, crossing your arms. “Nothing,” you muttered, tone petulant.
Kuroo couldn’t help but laugh again, the sound warm and genuine, causing you to pout even more and shuffle into a slouched position in the leather seat, “You are impossible, you know that?”
Kuroo grinned, starting the engine and feeling a lightness in his chest. “So I’ve been told,” he replies. He uses one hand to maneuver his way out of the parking plot, he steals another glance at you, your profile illuminated by the city lights as the car enters the main road. 
“How much to be my chauffeur?”
“You wouldn’t need to pay me to be your chauffeur, sweetheart. I would do it willingly. Unfortunately.”
“What do you mean by that?”
“Hm, come find out, sweetheart.” 
Tumblr media
You watch the surroundings of the area while Kuroo pulls into the parking lot. He’s brought you to Tokyo’s biggest fair which only happens around this time of year. Comedic timing huh? It stretches out before you like a vibrant assortment of colors, sounds, and scents. There are lights hooked up above, twinkling in the winding paths, with the window lowered you can hear the distant laughter and chatter from outside. 
The car comes to a stop and Kuroo gets out first to help you. He opens the doors, his eyes meeting yours with a playful twinkle, “Do you need to tie up your dress?” he asks, staring down at the fabric meeting the dark concrete. The ground was definitely going to ruin the white color, but you could care less about that, servers your stylist right and when you return it you’ll stick your tongue out at her. 
You smooth out the silk, shaking your head. “No I’ll be fine,” you tell him and Kuroo gives you a look, like he knows what you're planning. He probably does. 
The two of you step away from the car, the night air carries hints of caramelized sugar and popcorn, ticking your nose with a delightful scent. Kuroo offers you his arm and you take it, the rhythm of your steps falling into harmony as you enter the fair. 
“Do you remember this place? It was our first date,” Kuroo states, a little proud of himself for no reason in particular. 
You hesitate, a furrow forming between your brows. “First date?” you echo, a touch of confusion in your voice. Yes, you recall the outing, it was one of the very few times you’d ever hung out with a guy before that weren’t your siblings, filled with laughter and no particular expectations. 
“That was a date??” you gasp, asking again for clarification. 
“You didn’t think it was a date?” Kuroo asks, his face falls in astonishment and you shake your head, confirming that you did not think it was a date. “No?! I thought we were just two friends hanging out!”
“You thought it was just… friends?” he questions, his voice laced with disbelief at what he was hearing. Kuroo stops, turning to face you fully, his dark eyes searching yours for any sort of sign that you were joking. “It was only the two of us. I had everything planned out because I thought it was a date.”
Your heart skips a beat at his candidness. You do remember the effort he put in, but at the time you had chalked it up to his liking to plan down to the smallest detail. During the time, he was sure the two of you hit all the booths he thought you’d like but wasn’t that just because he cared?
“I just assumed you were being you,” you say, your voice feeling smaller now, unsure of what else to offer him. 
Kuroo gapes at you, the sudden vulnerability in his expression softening the air around you both. After a beat, he asks quietly, “Did you want it to be a date?”
The question hangs between you like a fragile thread, waiting to be snapped. You pause, the question making your head buzz. It was years ago, could acknowledging that yes, you wanted it to be a date change anything? “Does it even matter anymore?” you finally reply, evasively. 
You feel your heart racing, unsure of how to navigate this conversation with him.
The words build an awkward silence that thickens the air. You feel his eyes on you, probing gently but insistently for a truth you aren’t ready to reveal. Your chest tightens with a mixture of fear and unspoken longing and it feels like you’re drinking vinegar out of the bottle. 
To break the tension, you point towards a nearby stall, the vibrant colors familiar. “Hey, let’s go check that out,” you suggest, your voice light with forced enthusiasm. Anything to avoid this piercing moment. 
Kuroo’s gaze lingers on you for a moment more, filled with questions you aren’t ready to answer. With a slight shake of his head, he relents, his arm guiding you towards the stall. That’s how the two of you find yourselves standing at the jewelry stall, the vendor has a plethora of tiny gem bracelets, necklaces, and even rings with stunning designs, it takes your mind away from the conversation. 
Next to you, Kuroo picks up a delicate golden bracelet, its charm shaped like a heart, a perfect fit for you. Your heart flutters as he takes your wrist gently, his fingers brushing against your skin with a touch so soft it sends shivers down your spine. He carefully fastens the bracelet, the cool metal contrasting with the warmth of his touch. You can’t look away from his concentrated expression, and your pulse quickens at the intimacy of the moment.
With a wide grin, he places it around your wrist, his fingers brushing lightly against your skin, sending a cascade of warmth up your arm, leaving a trail of bumps. “It looks perfect on you,” Kuroo murmurs softly, making your heart flutter. 
“Are you insinuating that I’m a gold girl and not a silver one?” you say faking offense. The question confuses Kuroo, it’s evident in his face, “Does– Does it matter? I think you look pretty in both..?”
“I can’t believe you don’t know about jewelry theory! How do you gift your girlfriends jewelry?”
“You are the only woman I’m gifting jewelry.”
“oh.”
Despite your protests, he buys you the bracelet anyway. You assume it’s expensive, nothing in Tokyo is cheap– but just the feel of it is what makes you assume so, it’s definitely some sort of authentic, and even if it wasn't– the thought of it has your heart beating faster. Maybe it’s the way Kuroo pulled his card out like it was nothing, waving you off about the price, acting like it was nothing. Perhaps you are crazy. 
Thanking him, your voice catches slightly, and you hope he doesn’t hear the tremor of your accelerating heartbeat. After you thank him a hundred times and even offer him the opportunity to take it back and he declines, the two of you continue walking, the evening air turning crisper as the sky darkens. The breeze picks up, lifting strands of your hair and sending chills down your spine.
“Are you cold?” Kuroo asks, concern threading through his voice. It just now dawns on him that you’ve only been walking around with your dress and no cover— he doesn't even recall you having a jacket to begin with. He might have to have a word with your stylist when the night is over. 
“No, I’m fine,” you reply quickly, rubbing your arms in a futile attempt to generate warmth. The lie is evident, even to you, but you don’t want to admit your discomfort. It doesn’t bother you to much if you don’t think about it. 
Kuroo frowns, watching your movements carefully. “Are you sure?”
Smiling, you shake your head. “Really, Kuroo, I’m not cold.”
With a resigned sigh, he steps behind you. The warmth of his large hands meets your chilled shoulders, making you shiver involuntarily. Your arms are freezing.
 “Your shoulders say otherwise,” he murmurs, his voice closer now. The sound of something rustling fills your ears and you turn your head to find Kuroo removing his suit jacket.
Before you can protest, he drapes it over you with careful tenderness, ensuring it covers you fully. The weight and warmth of the coat are immediate, enveloping you like a shield against the night’s chill. Your body reacts on its own, melting into the fabric and letting it engulf your body. He steps in front, his eyes meeting yours with a focused intensity. You feel your cheeks heat up, the closeness of his presence making your heart race more fiercely.
He adjusts the coat, smoothing it over your shoulders and pulling it tight around you. Kuroo buttons up a few of the buttons, leaving the top part of your dress showing, to allow some cool air in. He doesn’t want you to overheat. His fingers brush your skin as he tucks stray strands of hair behind your ear, each touch lingering and deliberate. You realize how close you are, his breath mingling with yours in the cool night air. His eyes, so intently watching you, make it seem like you're the only two people in the bustling fair.
Kuroo smiles softly, his hand squeezing your shoulders, as he steps back reluctantly. “Can’t have you freezing before your big game,” he says, his eyes still holding yours.
“Wow, so you only like me so I can bring in views?” you ask, trying to tease him. 
“That and because you play well,” he plays along, making you grin and nudge his shoulder. 
The suit jacket settles on your shoulders, the warmth of it feels like an embrace. You knew the suit was going to be good when you picked it out for him and now you get to see it up close. The fabric has a nice smooth texture and not a single string is out of place. It falls past your hands, so much so that your fingers aren’t visible anymore.
The scent of it surrounds you, your favorite scent. A blend of something expensive, understated, and undeniably Kuroo. You take a deep breath, comforted and a little giddy at how it feels and smells.
“You know you’re going to freeze without this,” you tell him, half concerned, half happy he gave it to you.
For some reason, you want to read more into why he gave it to you, why he took the time to make sure you were comfortable and that it fit nicely, but you know Kuroo, and you know this is how he always acts. 
Always the gentleman, he’s always making sure everybody is okay, checking in all the time, ensuring that they are comfortable and cared for. He’s always giving his jacket away, so maybe that’s why a part of you doesn’t feel like the gesture can count as anything, whenever somebody wears something too short or forgets to bring something warm, he’s there, giving what he can away to help them.
You're not the exception, you doubt you’ll ever be. He just noticed because that’s who is he, Kuroo Tetsurou who pays attention to the smallest details. 
Kuroo Tetsurou who will drop what he’s doing to come to your aid whenever you need it. 
The genuine care in his voice sends a warm cascade of feelings through you, even warmer than the coat enveloping your frame.
the two of you continue walking through the thickening crowd.
Tumblr media
While Kuroo points out stuff that reminds him of your date, you can’t help but notice the occasional lingering glances people throw his way. It doesn’t surprise you–they’re likely drawn to his tall, striking figure (the words of a magazine, definitely not something to describe you), his suit that highlights his broad shoulders, and your impeccable taste that went along with choosing the suit. . 
Kuroo always manages to stand out effortlessly, among the sea of curious and admiring faces, you feel a pang of self-consciousness. Like everyone that looks at him has to look at you, their eyes tearing you apart, judging and inspecting every little thing about you as if you weren’t good enough to be next to him.
Your gaze lifts to him, searching for comfort, and in an instant, you feel like you belong. Kuroo probably feels the harsh grip you have on him because he takes your hand off his sleeve and entertwines it with his own and squeezes, giving you a quick smile before focusing back on the crowd. You feel secure, wrapped in a blanket of warmth yet it was only his hand holding you. 
You’ve known Kuroo since high school and thought of him as a pain with how insistent he was with everything. Back then you kept to yourself, played the damn sport because you promised you would, hating every moment of it– until he showed up at your school unexpectedly, demanding that you let him show you the fun in volleyball.
That day in an instant, your heart knew something your mind couldn’t comprehend. He had been nothing more than another face in the back of your mind that you would see at tournaments, on the bus, on the train,  at work but now he’s the only face that you seek to see. He’s your anchor whenever the world around you spins out of control.
You never expected to get so attached. He slipped into your life like sunlight streaming through a window, slow and warming, until one day, you realized you couldn’t imagine existing without him. Kuroo gave you something no one else ever had, the feeling of love, of pure, unconditional, affection that made your heart feel both lighter and fuller. He taught you what it was like to be cherished, to be seen for who you were, and loved even more for it. When he looked at you, he didn’t see the struggling girl, he saw you in ways that you hadn’t seen yourself in years— strong, capable, worthy. He gave you peace in a world that constantly demanded more. 
Kuroo was the first person to make you feel like you were enough, that you deserved to be loved and wanted. The self-doubt that had built up over the years always seemed to dissipate whenever he held your hand when he would whisper, yell, and shout words of encouragement when he simply stood by your side. The uninterrupted conversations, the silent understanding that needed no words. 
Growing up, friends were a fleeting concept, an abstract idea that never solidified into reality for you. Perhaps that’s why the line between liking and loving Kuroo blurred so effortlessly. Your heart, thirsty for genuine connection, latched onto him, mistaking friendship for something deeper, until it was too late. You were already hopelessly, irrevocably in love with him. Entrenched in a love so deep it scared you.
You don’t know if you could ever love someone else the way you love him, with a passion so pure and a devotion so absolute. Your feelings for him are woven into the very fabric of your being. The very thought of anyone else fills you with an emptiness no one could possibly fill. When you glance back at him, Kuroo is already staring back at you with inquisitive eyes as if he’s trying to read what you're thinking. 
“What? Is there something on my face?” Kuroo asks, raising an eyebrow. 
You shake your head, trying to come up with a response to explain the unwanted and unreasonable staring. “No you’re just ugly,” you tell him and pat his back, providing comfort. Kuroo gives you an invidious look and you have to fight back a smile. 
You continue to walk hand in hand with Kuroo past the bustling array of games, it catches you by surprise how each game is the same from all those years ago, and your eyes catch sight of a ballon game. The brightly colored balloons are blown up in a star formation set up in several rows so several people can play at once. Your attention is immediately drawn toward a pink giant stuffed teddy bear displayed among the smaller prizes. There is a pink one and a purple one and it looks like they are holding hands.
“Look at that bear,” you muse, pointing. “It’s so cute! Reminds me of the one you won me when we first came here.”
“You still have that one?” Kuroo chuckles, his eyes following your pointer finger to the bear.
“Duh, of course, I still have it.”
He nods, bringing you over to the vendor, who has already noticed your interest and is looking for an attempted cash grab. “Care for a go?” he asks, a knowing smile tugging it the corners of his lips, thinking he’s gotten another set of victims.
Without hesitating, Kuroo nods. He turns to you with a playful glint in his eyes, his hands tugging up the sleeves of his shirt that had started to fall. You admire his hands as he does it, they’re so big and the action is so casual that it has your mind wondering, “Do you think I’ve still got it?”
You fold your arms and raise an eyebrow, pretending to appraise his biceps. “Probably. With all those muscles you have, you better.”
The vendor hands him a few darts, and you watch from farther back as he effortlessly lines up his first throw. To win, he has to pop the entire thing and can only miss three times, you think it’s a rip-off but won’t say anything since Kuroo is so determined to win. 
You might console him if he fails rather than laughing in his face.
The first dart he throws slices through the air and pops a ballon with a precise, satisfying burst. People nearby who were walking started to take notice, almost as if they were cheering him on. One by one, each remaining dart finds it’s target, every ballon popping in quick succession. It was so perfect that even the vendor was taken a back, he couldn’t even rig the game with how impressed he was. 
“Don’t miss!” you shout, offering him some support and Kuroo flips you off.
The last ballon bursts before you know it, Kuroo turns to you with a smuggest grin on his face before turning back to tell the vendor which bear he wants. Of course, he gets you the pink one, and he holds it out for you to take. “For you sweetheart,” he says softly. 
You take the bear, the fur is soft against your skin and it’s huge, almost as tall as your waist and up.  “Thank you,” you whisper, clutching the plush toy to your chest, feeling a warmth spread to your cheeks and through your chest. It reminds you of the way you felt all those years ago when he had first won you a bear, a giddy excitement bubbles up as if you were a school girl all over again. 
Clutching the bear tightly, an idea pops into your head, and you find yourself turning to Kuroo with a mischievous grin. “Do you want one too?” you ask, your eyes sparkling. 
Surprised, he tilts his head, looking between you and the bear you’ve nestled securely in your arms. “Do you think you can do it?” he asks, amusement laced in his tone. “Last time I checked, you were terrible at darts.”
You gasp, taken aback by his accusation. “How dare you! Playing beer darts does not count. You hit all of them and just left me drunk! That’s why I miss,” you retort, frowning and pressing the bear he just won you against his chest. You step towards the vendor, determined to prove him wrong. 
“I wanna have a go,” you announce confidently, too confidently, making Kuroo laugh.
The vendor nods and starts to collect the darts that Kuroo has used. Mimicking Kuroo, you roll up your imaginary sleeves, your eyes have fire in them and you breath in and out. “Stand back,” you tell Kuroo, tossing a glance over your shoulder at him. “Watch me work my magic.”
Kuroo chuckles, the sound filled with affection and amusement, his gaze softening as he watches you. The vendor hands you the darts, their weight unfamiliar in your palm. Trying to recall any tips or techniques, you take a deep breath, aiming carefully at the colorful balloons. 
To your astonishment, the first dart flies through, popping a ballon. You blink momentarily stunned, but you quickly regain your composure. You hadn’t expected to hit it, you were actually thinking you were going to miss it.
You channel an inner confidence you didn’t know you had, lining up each dart with a sort of clumsy precision, tossing each of them with your thoughts and prayers and hoping for the best. When the last balloon bursts, you can hardly believe it and neither can Kuroo. He was secretly hoping you’d miss and he’d look cooler. 
Your mouth drops open, and you can barely contain your excitement. Suddenly, you're jumping up and down, your excitement bubbling over. “I did it! Look, Kuroo, I fucking did it!” you exclaim, turning towards him with an expression of pure joy and fist bumping the sky. He chuckles at your reaction, loving how wide your smile and the excitement in you. 
The vendor hands you the other large bear and you clap your hands happily. Beaming, you swap bears with Kuroo, checking which one is cuter before trading off of course. “I’m actually impressed,” he says, a singular brow raised and the corner of his lip curved upwards as he watches you giggle over the bears. “Have you been playing beer darts without me?”
You shake your head even though you know he’s just joking, “Beginners luck, what can I say? You just suck.” You tell him, lifting your arm up to flex your muscles in his face, “Oh my god. Get away from me,” he shudders, shoving you away with one hand to your face.
Tumblr media
Kuroo had led you to an ice cream vendor after you both had looked at almost everything the fair had to offer, just like you did the first time the two of you came together all those years ago. There’s still a family in front of you by the time you get in line, so you take the opportunity to look at the menu, trying to find a flavor you’d like. 
“Two cones please,” Kuroo asks, taking out his wallet. “I can pay!” you say eagerly, hoping to pay him back for the bracelet, the ticket, the darts, and everything else he bought you today. 
He shoots you a look, one that deflates your happiness and you tuck the wallet back from where it came from. “Forgive me for offering jeez. Can’t a girl pay you back?”
“No, you can’t. Stop trying,” he says while paying for the ice cream. The vendor nods along while you tell him your order and immediately starts scoping. 
While you wait Kuroo puts a hand on your shoulder, tugging you closer to him as some people walk by, “Are you excited for the Olympics?”
Your eyes light up. “Yes! I cannot wait to play in Paris. The city of looooove!” you say drawing out the last word as if it alone holds all the romance in the world. 
“Is that your only reason?” he asks with a chuckle, admiring the way your eyes widen and twinkle at the mention.
“Of course not! I get to compete and crush the other teams. I actually have high hopes for both the women's and the male teams this year,” you nudge him. 
You don’t get to say anything else as the vendor hands you and Kuroo your ice cream cones. He had gotten Chocolate Fudge, a classic. Kuroo likes anything if it has some sort of chocolate in it, he refuses to try any other flavor. On the other hand, you had gotten cookie dough.
“Thank you,” the two of you tell the man before leaving to find a seat. 
You make your way through the crowd, following along behind Kuroo’s tall imposing figure. There’s a group of tables nearby that have a beautiful view of the whole fair. The horizon is awash with the twinkling lights of the fair and all its displays. 
“Are you not excited to go to the Olympics?” you ask Kuroo, standing next to him as he cleans the seat for you not to ruin your dress. Only once it’s clean to what he thinks is perfection does he allow you to sit, but not before he fixes his suit jacket so that you aren’t at all touching the seat. 
He’d hate to see the dress ruined. 
Kuroo glances back up at you, “I am excited. I have the team's schedule lined up already. A few sponsor commercials, magazine shoots, video takes, and lots and lots of interviews–”
“Stop right there. I don’t want to hear it,” you groan. The least memorable part of being a celebrity athlete has to be the interviews. You hate them, your team hates them, and you don't know anybody who likes them besides maybe Bokuto, Hinata, and Atsumu, but that's self-explanatory. 
The last interview you did left a distasteful feeling in your stomach. The guy was a total jerk, interviewing women just to stroke his ego. He would only ask more personal questions, most of them were about your body and your looks, leaving you uncomfortable the entire time. You didn’t even get to finish it because Kuroo interrupted the interview to yell at the dude and tell him off for wasting everybody's time. You’d never seen him so angry before, he was more angry than you were. 
“You asked, princess,” he says, taking a bite out of his ice cream, a habit of his that you hate. 
“I’m unasking. Stop telling me.” Kuroo chuckles and you watch him fetch his phone from his pocket, your eyes glance over the name that appears on his screen and your heart hurts.
You’ve been itching to know about his relationship with that woman. If it meant something, Kuroo would have said so, or if he didn’t tell you, he would at least tell Kenma something who then would relay the information to you, but there has been nothing but silence.
The only way you knew about the two of them was from the stupid insider articles that had mentioned the chemistry between them too. Himari was popular in her division, a strong leader with a mature attitude and a gorgeous face.
Kuroo was in a similar predicament. His popularity started in high school and rose when he was featured in one of Kenna’s streams, the fans loved him and people loved him even more when he brought together all the players from your generation, the monster generation in a big group match-up. It was a pro that he was also extremely attractive and charming.
“Do you think we’ll have some off time? In Between games and interviews?” you ask, trying to get his attention again. Hoping you’ll be able to distract him from the fact that the two of you should be returning to the gala any time soon now. You don’t want to leave just yet, just a few more minutes with him alone will suffice. 
Kuroo hums, swiping left on the message from Himari and shutting his phone off “Pretty sure you would. Why?”
“Sakusa invited me to hang out with him, but we haven’t decided on a date yet–”
“Sakusa? Wants you to hang out with him?” Kuroo repeats, with a scowl. He fucking knew it. Knew that motherfucker would have made his move soon if he didn’t already, and this was his confirmation. Kenma had warned him about the two of you, but he didn’t believe it. 
“Why’d you say it like that?” you respond, raising an eyebrow in surprise that he cut you off. 
“Because it’s Sakusa Kiyoomi. He hates doing, I don’t know, everything,” he tried to downplay his concern with a half-heated smile that tugged at the corner of his lips. But jealousy, an unfamiliar yet persistent feeling, was creeping in. 
It’s weird for Kuroo. He’s never been jealous of you hanging out with other guys before. The feeling is more of a sad ache in his heart, rather than the raging feeling that is bubbling up inside of him. Maybe it’s the fact that you and Sakusa go way back like your relationship with his was. The two of you went to the same school, you probably spent hours upon hours with him back then. Kuroo took up a lot of your time outside of school, but he will never know what happened during school hours. Or at those training camps, where the two of you were always selected to go together. 
For no reason at all, Kuroo feels beyond frustrated. 
You laugh, your hair falling over your shoulder softly, it’s halfway accurate. “Those are just rumors. He’s actually really active, Sakusa just likes doing stuff at home. Like last week me, him, Atsumu, Suna, and Osamu had a party at his house. It was really fun.”
So that was why you brushed him and Kenma off that one time. He bites into the cone of his ice cream in frustration at the realization. 
“So are you going out with him?” Kuroo asks, his words are quick, almost impatient waiting for an answer. For the first time in Kuroo’s life, he’s felt at a loss for something. 
“Huh?” confusion was written all over your face. Where did he even get that idea from.“Going out?”
“Are you two together?”
“Uh no, We’re just friends. You would know if I was going out with anybody.” you narrow your eyes, scrutinizing him, trying to decipher the sudden shift in Kuroo’s demeanor. Confused on why he was asking you this and what he’d hope to get out of it. 
“Good, don’t go out with him,” Kuroo tells you, finishing the rest of his cone. It comes off more forcefully than he intended, but he wants you away from Sakusa, as fast as possible. Suddenly the idea of letting you go and move on is no longer an option in his mind. 
“What..? Why not?” 
“Do you need a reason?” He huffs, looking away from you. 
“No… I won’t go out with him if you tell me not to,” you nudge his shoulder with your free hand. “But I would like a reason,” you retort.
His throat tightened. “You’ve listened to me before with other guys. Why not now?”
“Because Sakusa is different,” your voice was steady. Almost defiant.
“If you keep hanging out with him, more articles are going to come out about the two of you,”  Kuroo says, trying to keep his tone calm, but the urgency seeped through. A pit was forming in his stomach, and Kuroo couldn’t believe he was actually jealous at the thought of you getting with Sakusa. A sense of dread lingered, one that he couldn’t shale. It felt like he was losing you, piece by piece, with each passing moment and he didn’t know what to do with himself. 
“I don’t understand why it’s such a big deal for Sakusa and me to hang out. The articles have always existed, I get shipped with almost everybody else like Hinata, Kenma,  and even you. So if the media says Kenma and I are together, would you believe that? See? Maybe—“
And Kuroo feels like if he doesn’t say something now, he might explode. He knows love is patient. He’s been waiting all his life, but if he doesn’t say something now, he feels like he might live the rest of his life in regret. 
Fuck what he said about moving on because he simply cannot do it. 
It needs to be you. 
Kuroo needs you in his life. 
He doesn’t want just to be your friend or bestfriend, not an old teammate nor classmate. Not a fleeting memory in the background but as the person she could always turn to without question. The thought of a future where you aren’t by his side, nitpicking at him, complaining, yelling at him for not knowing how to cut fruit, laughing by his side, clinging to him, is one he doesn’t want—a void he couldn’t comprehend. 
You're his constant, a lighthouse guiding him through the crashing waves of life. Kuroo can’t imagine navigating life without your light, your laugh, and your endless support. You aren’t just the women he loves; you are his soulmate, the missing piece that’s always been there, what he’s been searching for. 
He swallows hard, gathering his thoughts and pushing away any negative thoughts. 
“Because I like you. No, no, no, not even that. I’m in love with you.”
“What?” 
Your ice cream almost falls out of your hand, and all you can do is turn to Kuroo, looking at him with extreme confusion and utter shock. It feels as if someone has thrown cold water on you.
“I have loved you from the moment you walked into the school gym looking for Karasuno’s coach, from the moment you told me how you felt about volleyball, from the moment you let me into your heart and let me see the side of you that nobody else had seen before.
“It’s always been you. Whenever I see you, my heart speeds up. When we touch, I get this warmth that I can’t explain. My heart feels full whenever I’m in your presence, like it’s about to burst.”
You remain silent, the ice cream in your hand melting and forgotten. Your lips are slightly parted in shock. 
“I–”
He continued, not wanting to hear your response regardless of whether you reciprocated his feelings or not. The words just started spilling out like a dam that had finally burst. “I want to live the rest of my with you. I want to wake up next to you and share every tiny moment, every laugh, every tear, every failure with out. I’ve never been more certain about anything in my entire life. “You bring out the best in me, you make me want to be a better man.”
Frozen, you were frozen, body, mind, and everything else. Your heart pounded in your chest a you tried to formulate words, anything, something to tell Kuroo how you felt. The pulse in your body was so loud, drowning out almost everything at the fair. 
“Kuroo–”
“Do you remember that one day when you asked me what it feels like to fall in love?” Kuroo asks you, and your eyes drift from the ice cream to him, he meets your gaze instantly only because he is already looking. Looking as if you were the only thing in the world, the only thing worth looking at.
You nod, the day at the airport flooding back in, when you asked that ridiculous question, hoping and praying to make something more out of your friendship. Except you never thought that it would ever come to this. 
“I couldn’t answer you back then. I told you it was because I had never experienced love, but it was such a lie,” he huffs. Reaching a hand out to brush your hair from your face so he could see all of you, the person he loved so much that at times his heart felt like it was overflowing. 
“Back then, I thought it was normal to feel this way. I thought that friends would make you feel this warm inside, make your heart speed up, make you wish you were always in their presence, make my every living moment seem so significant.”
“But it wasn’t normal. It’s anything but normal actually— this isn’t normal, princess. Nobody jokes around with their friends like we do, the silent glances, secret touches, the compliments, princess.” Kuroo runs a hand through his already messed-up hair, biting his lip softly before continuing. 
“You had me going crazy, because nothing we’ve ever done was normal, and you know that, I know you do.”
“I told you I didn’t know what love feels like because all I’ve ever felt was it. I didn’t know what it felt like without it because I’ve always had you,” he confessed, his voice breaking slightly. Kuroo took hold of your hand, squeezing it softly for reassurance that he was doing the right thing. You squeezed back and allowed him to continue, still somewhat in shock that this was happening. “You were always there, and so was my love for you. I didn’t need anything else.”
“I’ve been so afraid of losing you,” he admitted, saying words that the both of you felt. “I thought that admitting how I felt would ruin everything. That I would never be enough for you, that I would hold you back, and the thought of not having you in my life was just too much to bear.”
His hand tightens around yours, “Every single day, I told myself I could live with being just your friend, that it was better to have you close than to risk everything. Every moment with you has been both a blessing and such fucking torment because all I could think about was how much—”
His words were cut off abruptly as you leaned towards him, your lips finding him in a tender kiss. At that moment the world seemed to fade away, and there was only the soft, intoxicating warmth of Kuroo against your skin. It was a soft, tentative kiss– an innocent gesture, like the delicate brush of a butterfly’s wings. Large hands settle themselves firmly on your waist, squeezing softly. 
When you finally pull back, your breaths mingled in the scant space between you. Kuroo searched your face for any sign of regret, but only found a reflection of the same emotions that had torn him open. “Thank you,” you smile tenderly, emotions bundling up that it’s hard to speak properly.
“I’m never going to doubt myself ever again,” Kuroo smiles, and it’s so beautiful. Your favorite thing in the world, causing you to giggle at his sentence, silently agreeing with it. “You deserve everything in the world, and I promise I’ll spend the rest of my life showing you that you meant everything to me.”
Tears welled up in your eyes, threatening to spill over. Your lips quivered as you tried to formulate the rush of worlds and feelings swirling inside of you. “I think,” you pause, swallowing hard, struggling to keep your voice steady, “I’ve been waiting to hear you say that since forever. I dreamt about it, thought about it, hoped for it, and now that it’s happened, it seems so unreal.”
You took in a shuddering breath, the reality of the moment hitting you in waves and before you knew it, the tears you were trying to hold but came like a flood. Each one is evidence of the feelings you had tried to keep hidden, to push back, to the unnamed hope you dared to harbor in your heart. 
He gently lifts your chin with his fingers, bringing your faces closer until your foreheads touch, the warmth of his skin melting the icy shook that had gripped her. His hands gently wipe away the tears, the touch so light and tender. “It’s very much real, sweetheart,” he murmurs. 
Kuroo places his hand behind your head, his fingers threading through your hair, pulling you closer with a soft but insistent pressure. Your lips met again, but this time it wasn’t timid. It was a reaffirmation, a promise sealed by the eagerness in the kiss. Your hands instinctively wrap around the back of his neck, pulling him closer still as if you feared the moment might have been a fleeting dream. He was so real, here, with you. The solidity of him reassured you, grounding you here in this moment. Your heart was pounding, so hard it almost hurt. The realization that your hearts have always gravitated towards each other, just waiting for the right moment. 
When you finally broke the kiss again, the two of you were breathing heavily, unable to let go of one another, uncaring of what the people around you were thinking or doing. “I love you, Kuroo Tetsurou,” you whispered. The words felt so right, so perfect coming out of your tongue. The words you’ve been waiting to say forever now but were so afraid to do it. 
“I love you too,” he replies, nudging your nose with his as he presses his lips to the corner of your eyes, kissing your tears away. “So much.” 
Tumblr media
You're practically buzzing. Walking hand in hand with Kuroo, except it feels different now. Your head is resting on his arm, while you're wrapped snugly in his suit coat, feeling like you're on cloud nine as the two of you head out of the fair and towards his car. 
Despite having to head back to the gala, you were happier than ever. So overwhelmingly happy that any minor inconvenience paled in comparison to your joy. That’s maybe why you didn’t feel the ache in your foot until now, it was bearable before, but it was starting to get too much to the point where you had to stop and stare down at your feet. 
“I think I actually did something to my ankle with those heels,” you whine, staring down at your poor feet in the funky shoes. Your ankle feels like it’s been rubbed raw, and every sudden moment hurts like a bitch.
Kuroo halts immediately, concern etching itself on his face as he rubs at his eyebrows. “Gosh, I knew I should have brought an extra pair for you,” he sighs, frustration in his voice, not at you, but at himself for being so careless. Without wasting another second, he bent down to inspect your foot. One hand lifts the helm of the white dress a little so that the other one can wrap around your foot to inspect it. 
You rest one hand on his shoulder to steady yourself, slightly wincing as he feels around the tender skin and when he presses on a certain spot you let out a sharp hiss of pain. “Did that hurt?” he asked but already knew the answer. 
“What do you think numbskull?!” you shot back with a pinch to his shoulder. Your retort made him chuckle, the soft laughter vibrating through her fingers and easing some of the tension from the pain. 
“Alright, come here,” he says, an affectionate smile lighting up his face. In one smooth motion, he stood up and swept you off your feet carrying you bridal style in his arms. The action was effortless, Kuroo didn’t struggle at all to pick you up. Your heart swelled even more at the gesture. 
You looped your arms around his neck, your head resting against the curve of his throat. The closeness was maddening, the gentle sway as he walked, the beating of his heart– the overwhelming feeling was coming back again. 
By the time you reached his car, the throbbing had lessened, only due to the lack of usage on your legs. Kuroo eased you into the passenger seat, making sure that your foot was elevated on his dashboard and making sure you were comfortable. Before closing the door, he leaned in, pressing a kiss to your forehead and then to your lips. 
Kuroo opens the back door to stuff your matching teddy bears inside, buckling the two of them in together. Once he’s fixed himself in the driver's seat, Kuroo glances over to you with a half smile, “We need to get you home so you can ice it.” He insists, turning the key in the ignition, allowing the car to hum to life. 
“But what about the event?” you hop up to ask, face scrunching up when your ankle shifts slightly. Kuroo places a hand on your chest, settling you back down. 
You already felt bad for making him ditch earlier to come to the fair, and now you weren’t going back at all? You feel guilty like you're ruining his moment for him to take care of you. 
“Could care less. Your injury is more important to me,” he states, like a matter of fact. His eyes meet you briefly before he turns his head back to reverse the car out of the parking spot with one hand. 
“But you spent so much time planning–”
“Sweetheart,” he interrupted, his hand gently cupping her cheek. The touch was soothing, a warm wave washing over your troubled heart, making your nerves calm down while also causing your heart to beat faster. You practically melted into his touch, pressing your cheek more firmly against his palm.“You are more important to me than any event or gala. I’d rather spend my time, here, taking care of you, than anywhere else.”
There's no room for any argument after that, he shuts it down with a quick kiss on your lips before he focuses up back on the road. You settle down in the seat eyes watching both Kuroo and the street lights outside as he drives. One hand is settled on your thigh, his fingers subconsciously 
“Kuroo I don’t know if you know this. But this is not the way to my place." “I know sweetheart. We are going to mine.”
Tumblr media
Arriving at the building, Kuroo parks in his private section, getting out quickly so that he can help you out. He carries you in his arms despite your meek protests, you burry your face in his chest to hide from the people at the desk that Kuroo passes by and greets— even chats with for a second and she greets you in recognition before heading to the elevator and telling the worker his floor number. 
It was so embarrassing to be carried up like this, but Kuroo seemed to care less, not finding it troublesome at all.
Once off the elevator Kuroo takes you to his massive door, he puts you down for a moment to pull out his keycard for the door. You're already shoving past him and entering the place, “Home sweet home!”
One step inside and you’ve already forgotten about your injured ankle which is why you almost trip and fall. Luckily Kuroo reaches out, catching you with a firm arm around your waist. “Careful,” he mutters softly into your ear, his voice is a little breathy, probably from having you pressed up against him. Kuroo places a quick kiss on the shell of your ear, causing you to giggle before steadying yourself while he lets you go to lock the door behind him. 
You enter the open space more carefully now, as per Kuroo’s request. The open living room space is dark due to the lights being off, but the lights from the city lighten it up and paint a beautiful view through his windows. His place was so sophisticated though currently a little messy, which you bet is due to his consistent planning recently. 
Without missing another beat, you made your way to his bedroom and flipped down on Kuroo’s bed with a squeal. You’ve spent countless nights here, when your bed didn’t feel comfy enough or whenever you had gotten lonely in your own home. His was like an escape, probably more of a home than your own.
Kuroo watches you from the doorway, his bigger frame leaning up against the trim watching you sprawl out, his eyes soften at how comfortable you look in his home. It makes his heart swell.
“Your bed is so much more comfier than mine,” you sigh dreamily into his sheet.
“So you’ve said.”
He strides inside his room, heading straight to you, making you sit up with curiosity. Bending down in front of you, his fingers find the straps of your heels, unbuckling them in a gentle manner and sliding them off of your feet. 
His warm hands, gently examine your foot now that he has a better view and has you situated in a comfy position.
“That hurts! Are you trying to reinjure me?” you whine and squirm when Kuroo continues to press down on a certain spot, checking to see if your injury is bruised or inflamed or if you hurt it worse by wearing those ridiculous hills today. The complaints leave your lips one by one and Kuroo pays no mind to them, semi-lost in the sight of your lips forming into a pout. 
He thinks you're so so adorable.
You look perfect, bathed in the soft light of his penthouse. He’s too distracted, that’s probably why the words leave his mouth before he can register it. “You’re being all cute and sweet, it makes me really want to kiss you.”
The words hang in the air between you two, you seem frozen by them but Kuroo is less fazed and you realize how awestruck he really looks. Your cheeks flush, the heat is evident and your eyes widen in surprise. 
That’s why your lips meet again, it’s a soft kiss at first, with an innocent intent behind it. One that becomes ravishing fast, Kuroo tilts his head to get a better angle, his hand sliding up your thigh, your dress, all the way up until it reaches your chest. 
You pull back first, out of breath, foreheads touching one another, his cheeks are flushed and you imagine yours are too. “I—” his lips find yours again, tongue sliding against your lower lip then he bites down on the bottom lip, forcing a squeal out of you, that he swallows right up. 
He takes the chance and slips his tongue inside your mouth, exploring every crevice he can. The kiss is intense, and passionate, lacking urgency but the fire between you two is there and apparent.The kiss was dizzying and so were the following ones after.  
Breaking apart, he places a chaste kiss on your nose and then on your lips. “Tetsurou—” you start but are cut off by Kuroo kissing you, a slow lingering touch. It’s like he is insensible, drunk on the taste of you. 
It keeps going like that, the kisses become sloppy and more hungry, Kuroo is grabbing at you and your arm is wrapped around his neck while the other one is tangled into his hair. 
He leans into you, slowly pushing you down onto the mattress but when you whimper into a kiss, he recollects himself, trying to tug away but your wrapped arm brings him back every time. “We,” kiss. “Should,” kiss. “Fuck sweetheart—,” kiss. “Stop,” kiss. 
“No,” you whisper to him, lips ghosting his. You can practically feel the smirk on his mouth as he urges yours open again. He licks the inside, tongue sliding against yours as he words. “You’re injured.”
“Make me feel better than,” you mumble, allowing your mouths to connect again. Your lips move fluidly on each other, and Kuroo’s fingers trace your jaw. Kuroo chuckles against your lips, a sound you messily suck up, he pulls off to press kisses onto your face, allowing your heart to flutter within your chest. 
You look gorgeous like this, swollen lips from all the kissing, hazy doe eyes, waiting for his next move, and your chest heaving so heavily. Such a sight. You’re his sight. A messy one too Kuroo thinks to himself as he wipes a bit of spit from your lips. 
He moves to kiss along your jawline, grabbing your chin to keep you in place despite your whines and whimpers. He gets lower and lower until he’s able to lick a stripe up your neck that has you trembling in his gasp. “Tetsurou—”
“Nu uh, sweetheart. You wanted me to make you feel better, yeah?” he responds, continuing to kiss and nibble at your chest. 
With Kuroo on top of you like this, you took the opportunity to let your hand wander over his body, touching and squeezing what you could as he proceeded to leave open mouth kisses everywhere on you. 
You fiddle with the buttons of his suit jacket, unbuttoning them as you reach down further and further, yanking the vest off and then helping him toss his dress shirt over his head. 
From underneath Kuroo, you admire the view. Hands sliding up his stomach, tracing the outlines of his abs, perfect and surprisingly intact, his gorgeous tan skin— his stomach tenses under your touch. Kuroo pants heavily from on top of you, from all the kisses, his hair a mess due to your hands finding their way there, and his face is decorated with red lipstick. 
Bringing your lips closer to his face, you press a quick kiss to the cheek, his mouth finding yours, as one of your hands lowers until it comes into contact with his belt. You trace a finger down from his happy trail all the way down to his crotch, cupping the bulge that had formed there. 
“Aaah, fuck.” Kuroo hisses when your palm presses up on him. "Feel that? It's just for you, sweetheart.”
Without a second thought, Kuroo gets up and off of you, standing by the edge of the bed before gently dragging you over to him. You giggle in response, liking the view you have of him like this. 
“Can I?” you purr, already unbuckling his belt, not waiting for another word. Kuroo chuckles at your eagerness, “Ah— slow down princess.” But you don’t listen to him, already tugging his slacks down after tossing the belt out of your sight. 
When you get Kuroo’s boxers down (not very far) you’re too busy marveling at him to do anything. Now, you knew Kuroo was huge, he was already massive in general, and you’ve heard rumors from other girls in his department (he also had a scandal about it) but seeing it in person is so different. 
His cock hangs heavy, long and wide, twitching and throbbing, with pearly white precum seeping out of his flush pink tip. There are several veins run up his cock, stopping when they reach the end, Kuroo is leaking so much that you’re afraid it might start dripping onto the floor. 
To be frank, his size is intimidating. You haven’t taken anyone near his size, and you haven’t slept with anybody in a while. He was going to rip you apart. 
“You gonna stare at it all night sweetheart?” Kuroo asks, a hand finding its way to your head, patting you yet guiding you closer to his cock at the same time. 
You swallow the lump in your throat and take a grab at his cock, wrapping your hand around his base, not even covering most of it, and for sure your fingers can’t close around it. Kuroo lets out a low hiss when you squeeze him attentively. 
It twitches, more precum leaking out when you start to stroke your fingers in a teasing motion. A laugh escapes your throat at his expression, eyes slant glaring down at you, you can tell he’s about to say something but you shut him up with a kiss to his tip. 
You start to pepper tender kisses along his cock, enjoying how it twitches in your smaller grasp, how Kuroo wants to say something so badly, but he knows, he knows he’s huge, so he allows you to take your time to do whatever you want with him. Whatever makes you satisfied he’s happy with, even if he has to put his own pleasure aside.
“Fuuuuck princess,” he groans when you lick a stripe up his length back to the tip, wrapping your mouth around the flushed pink, and slimming your cheeks down in a sucking motion. You take the opportunity to grasp both hands around him, starting up in a stroking motion, twisting and turning gently, causing Kuroo to let out a loud moan and throw his head back. 
This must be what heaven is like, Kuroo thinks when you start to take him even further down your throat, inch by inch, flattening your tongue and running it on the underside 0f his cock. He can tell you are struggling, tears are already pricking in your eyes. 
“You look so cute struggling on my cock like this sweetheart.”
You're able to get a few more inches of him in your mouth before he hits the back of your throat, forcing you to gag, but not enough for you to pull off. "Oh, you like that?"
A whine escaped from your stuffed mouth, the vibrations moving on Kuroo’s cock made him moan slightly. A bit flustered from his words, you hollow your cheeks and start to bob your head up and down. 
The movement is addicting, watching you suck so carefully, Kuroo can tell that you're trying your uttermost best to keep your teeth away from his cock. Though he wouldn’t mind a bit of pain— but that’s for next time. His cheeks are flushed, a dark red hue, that he’s sure looks terribly unflattering on him, but it’s hard to focus when your working magic on his cock like this.
Kuroo fills your mouth so deliciously, cock hogging up every bit of space inside, accidentally hitting the back of your throat every time, you try and push deeper on him. He’s so warm, hot, and heavy on your tongue, and each one of his moans only spurs you on further. “Gosh, princess.”
“F-fuck,” he mumbles softly as you continue to bob your head, the action allows you to feel every bit of him while you suck down on him as hard as possible that your cheeks start to hurt. There’s saliva starting to drip down from your lips, some of it meets with the tears that have started to fall, running your makeup in the process. 
Hips softly buck into your mouth, not trying to make you gag, but the pace you’ve set for yourself and him is spurring him on, making him reach his high sooner. The bedroom is filled with dirty, wet sounds, Kuroo’s soft, rough moans combined with the squelching of your mouth on him.  “haaahh, you’re doing so well for me, sweetheart.”
You grin up at Kuroo when his hand finds its way to the back of your head, slightly shoving you closer. You don’t allow him to, instead pulling off until your mouth is enclosed around his tip again and swirling it this time, teasing him just to drive him further to insanity and closer to his high. 
Kuroo lets out a deep moan when you lick along a specific vein of his before taking him all down your throat in one go, the action has him letting out a plethora of curses, some of which you’ve never heard before. The hand that was gently placed on the back of your head moved again, smoothing away the flyaway hair on your forehead. Through strained eyes and an agape mouth, Kuroo manages to catch sight of you struggling to fit the rest of his cock in your throat. 
Such a sight to see. He feels like he’s getting impossibly harder while watching you. 
“That’s it, fuck, that’s a good girl.”
You’re forced to settle on the several inches already in your mouth, continuing to bob your head on his length, you find out that Kuroo’s veins are more sensitive than you could have imagined. Every stroke of your tongue or fingers against them has him groaning and bucking his hips into your mouth— just how you want it.
You pick up the pace once you notice him getting closer, an obvious sign due to the high-pitched moans that are dropping from his lips and the way his abdomen clenches and unclenches, it’s a sight to behold to you, as you watch Kuroo’s body shudder and tense. “Fucking hell–” he shudders, throwing his head back and shoving you further down on him. 
He works your mouth like that for a little while longer, your throat constricting around him as his warm cum spills down your throat without warning. “Fuck–shit. Sorry about that, sweetheart,” Kuroo says, allowing you to pull your mouth off him. You swallow up every last drop that he gives you, a bit salty. You hum to yourself while wiping off any access and licking it off. 
“You’re way too good at that,” Kuroo comments, smiling when you reach up to kiss him. Your lips move rhymaticially and you bite him while pulling off. He helps you off of your knees just to press a few kisses over your messy face, grinning ear to ear at the damage he’s done. “Just for you,” you giggle, kissing him again and allowing him to tilt your head so that he can deepen the kiss that you moan into. 
“You want to keep going, princess?”
You nod eagerly, just wanting him to touch you already. So desperate for anything he’d give you. 
You allow Kuroo to help you out of your dress, he turns you around, a warm palm coming to gently massage the exposed skin of your back. He works his way up to the straps of your dress, lowering them off your shoulders, pressing sweet kisses to the area where they hindered on your skin, he follows a trail down your back making you shift and arch slightly at the feeling.
Kuroo’s fingers tease your skin softly as he unzips the back portion, allowing the dress to fall down your body, leaving you in your lingerie and exposing you to him. The feeling of being so exposed in front of him is nerve-racking and Kuroo doesn’t help when he’s just looking at you– not saying anything. 
Without realizing it, you pressed your thighs together almost instinctively.
“Huh, all pretty up and dolled underneath there,” He says, tracing a pattern up your exposed leg all the way to your underwear. The soft fabric feels nice against his fingertips–definitely something expensive, Kuroo hooks a finger underneath it and tugs a little just to let it slap against your skin, causing you to yelp. “Tetsu–”
He cuts you off, stepping closer to you. Your eyes follow as he towers over you, blocking the already dimmed light from his bedroom, “Who’s this for huh?” 
“Sakusa maybe?” His hands start roaming up and down your skin, each touch feels like fire, leaving a shimmering path against your skin. Your eyes shoot open at the mention of your friend, only so that you can glare at him.
“It might–” He continued to move his hand up your inner thigh until it was a few inches from your wet panties without taking his eyes off you. 
Kuroo smacks your ass and you let out a loud whimper. He gropes the tender skin with such fervor you start to wonder who is more affected here. 
“Who’s it for sweetheart? Who has you wearing such a cute fucking set underneath that sinful dress?”
“You–!” you choke out. “You, Tetsurou. I wore it for you...”
“Good girl,” He smirks at your response before picking you up to gently set you down on the bed, being mindful of your ankle. He positions you so that you are lying on your back, head laid out in between his pillows and your leg resting on his hip. 
Your breath hitches as you watch him. The want in your eyes is so abundantly clear to him, that he can practically see the anticipation building withith them every second. His hand moves down to your panties again, the warmth of his fingers ghosting over your sensitive area had your body twitching already. 
He sucks in his teeth when his fingers finally touch you– even if it’s only over the fabric. 
“You're wet. So fucking wet. I knew it…” His hands, ever so slowly, rub your covered slit, soaking through and you gush even more at the touch. It’s embarrassing how he hasn’t done anything yet, and you're already acting like this. The rough pads of his fingers press at your hole, almost swallowing him inside if not for the barrier of your panties. 
He doesn’t stop teasing your entrance, even as his thumb brushes against your fabric-covered clit, Kuroo watches with a predatory gleam in his eyes, closely as you whine and twitch again, your eyes flutter shut at the sweet sensation. 
Kuroo must be testing your patience because he refuses to actually touch you. All he does is tease you through your underwear, toying with your entrance as if he wanted to drive you mad off of a few touches. His eyes are completely focused on how you twitch each him he touches you, his teasing, slow touches might just be the death of you. He wants to wait, and savor the moment but you want nothing but for him to stuff you full right now.
“Kuroo fucking Tetsurou if you don’t shove your fingers in my pussy right now I will shove mine up your a—” His smirk grows, and the way your brows furrow in frustration was cute. So cute. It almost made him want to continue to mess around, but for your sake and yours only he seems to oblige. 
"Hmm, you're not very patient, are you?" He chuckles, shifting down to press a kiss against your stomach, he keeps kissing your skin until he reaches the skin right before your underwear, and he bites, causing you to yelp and kick at the unexpected touch. His teeth hook on your underwear, lifting up your legs so that he can pull them off of you in one swift go.
You watch him intensely as he goes, the sight is so erotic you can feel yourself tingling. 
Kuroo tosses your panties to the side, they get lost in the darkness of the room and he concentrates his attention back to you. You clench around nothing when he whistles at the sight of your exposed glistening area, “Prettiest pussy I’ve ever seen sweetheart.”
“Tetsurou–” you start but are unable to finish when Kuroo spreads you, getting a look at your swollen clit and sopping folds. Kuroo runs a finger up your leaking slit, gathering the wetness and smearing at all over, a soft sigh of relief leaves your throat when he finally starts to touch you. 
His thumb catches your clit, he draws small circles around your pulsing nub. The feeling sends a surge of heat up your body, he adds a slight pressure on your hood, dragging it up and down in small but deep movements. “Don’t tease me like that,” you tell him, your bottom lip jutting out.
“Like what?” He purrs, leaning down to press a quick kiss to your lips as if that would satisfy any of your needs. Kuroo starts to pull back when you grip onto his chin, yanking him back down for a sloppy kiss, one that leaves the two of you breathless. 
“What do you want sweetheart?” He asks, tilting his head while he looks down on you. When you don’t respond he pinches your clit, exciting a moan out of you. 
“Tell me or I can’t do anything.”
“Teturou please please please just touch me. I want your fingers inside, pretty please!” you whine, eyes starting to get glassy while you beg, waiting impatiently for him to do something, “That’s it, princess.”
You grip onto the sheets when he prods at your entrance with his middle finger, he applies a bit of pressure then pulls back, it feels so different when he’s touching you without your panties in the way. That and the fact that you haven’t been fucked in several years, so every touch ignites something in you. 
Slowly, his finger sunk into you and a quiet moan escaped your lips. “Fuck, your tight.”
“How are you going to take me like this? Hmm?” Your right thigh closes in, trying to close tha gap in between your legs but you're unable to when Kuroo stops the action with his other hand. “Keep them open,” he warns.
Kuroo sets a slow steady rhythm, watching your face for any discomfort at the stretch. His bottom lip gets caught up in his teeth as he watches your squirm, hips bucking up against his hand, he takes that as a sign to add another finger, the thick digit sinks into you easily. 
“Fuck—” you hiss, back arching off the bed in pleasure. His fingers pull out slowly only to push back in with the same speed as before. 
The sounds of your moans fill the room easily, they sound pathetic, a bunch of whimpers and barely understandable babbles of  “more” and “please”, it has Kuroo chuckling against your heated skin. Every thrust of his fingers has something clenching in the pits of your stomach. 
“I’m going to add another one, okay sweetheart?” Kuroo asks for confirmation and you nod eagerly, a string a breathy moans leaving your lips. “Mmmmppffhf—” is all you can get out for him, head thrown back into the pillows he presses another finger inside you and curls them immediately in a way that has you seeing stars. 
You don’t even register when his hand slips underneath your back to unclasp your bra, the material quickly gets flung somewhere, probably in the same corner of the room where your panties went. You could care less about it when Kuroo latches his mouth onto your boob, tongue swirling and sucking on your nipple.
It adds to your heightened senses, you gasp when his teeth find their way to your bud, capturing it between them and biting down softly. You let out a loud moan at the feeling. Kuroo’s looking at you from his spot at your boob, enjoying the heavenly view you’ve decided to bless him with. Scrunched up face with your mouth slightly agape as your moans spill out. The sight makes the blood rush to his dick.
There's a euphoric burn in your stomach as Kuroo picks up the pace, continuing until he finds that spot that had you kicking, trying to escape from his grip and the intense feeling overcoming you. It was all so overwhelming — you were right there ... !
Kuroo lets go of your nipple with a final tug, the way you clench around his fingers is a telling sign that you're about to let go all over him. “Wanna cum sweet thing? Yeeahh? Fuck, cum for me, then. Cum all over my fingers like a good fucking girl,” and you do, with a loud moan that Kuro enjoys very much, every part of you lets go and you cum hard. The body-shaking orgasm hits you and leaves you breathless, chest heaving up and down as you twitch and come down from the high. 
He brings his fingers out of your cunt and the loss makes you clench around nothing and whimper. A grin makes its way onto his face as he admires the clear sticky material that’s draped on his fingers and he slides two digits into his mouth, sucking your fluid straight off. 
“Think you can give me another one?” He asks, bending down and pressing a kiss to your lips. It’s a sweet and gentle one, that doesn’t last long before he’s pulling back, awaiting your answer. “Another one?” you repeat back to him a little breathlessly, allowing your head to move to the side on his pillow. 
This man just gave you a groundbreaking orgasm, and he wants to go again? Fuck, he might just be the death of you. “C’mon, I’ll treat you real nice. I just want a taste,” he reasons and you give in, nodding to him.
“Is this ok?” He asks, staring up at you from between your legs. He’s face to face with your pussy and you subconsciously clench at the the fact. “Yes, Tetsu,” you tell him, clenching over nothing but the way he’s staring up at you like you’re his first meal in a while. 
Once you give him the green light, Kuroo dives right in. He starts with soft kisses and nibbles up your thigh, tantalizingly close to where you want him that has you squirming. He places a quick kiss on your swollen clit before sucking on it gently. You shudder and let out a breathy moan, heaven to Kuroo’s ears, he lets out a grumble of satisfaction at the sound.
The vibration on your cunt makes you gasp. “You taste like heaven,” Kuroo tells you with his lips wrapped around your sensitive bud.  His tongue flattens out, licking several stripes up your slit and then starting to prod at your hole just as his fingers once did, tasting your wetness, humming against you with an eagerness. The vibrations have you squirming around already.
He’s just as much of a messy eater as you expected, tonguing and biting at you like a man in heat, one that’s been starved and deprived of his favorite meal. “Ffff–uck. Mmpffh,” you stuttered as Kuroo sucked and twirled around your pearl before tugging at it gently, leaving sweet kisses all around, lapping up at your arousal, anything he can quite frankly get his hands on.
His arms wrap around your thighs to keep your hips steady and legs open as he works. His tongue flattens against you before the muscle flicks up, tasting you each time. He has your body jerking, hands trying to grab onto his sheets when he swirls his tongue. “T–Tetsurou!”
“Be good, and I'll fuck you.” Kuroo’s tongue dances between your folds, and your hips buck up onto his mouth even as you try to ground yourself to his bed. Hips grinding faster when you feel his tongue nudge at your opening again. You moan loudly, back arching off the bed again, Kuroo hums at the sound, his upper lip fluttering by your clit while the tension inside you starts to build up again. 
His movements urge small vocals out of you, tongue delving deeper inside, shoving his nose right up into your folds, the tip of it nudging at your sensitive skin, has you blanking out as you let out an airy moan. He’s upping his efforts now, sucking your clit as his tongue torments it, flicking over the sensitive bud. The sensations from his tongue are proving almost too much for you, and you can feel the tension worsening from your stomach to your toes as your orgasm grows closer.
“You're fucking gorgeous like this,” his voice is muffled, busy by his antics, but you make out the words clearly. “spread out like such a good girl. All for me.”
Hooked on your pleasure, he starts to fuck his tongue into your hole, pressing his face into your pussy. Kuroo’s lost in the taste of you, practically drowning in the feeling and sensation. He wants to bury himself so deep inside of you that Kuroo forgets where he ends and you begin. 
It’s obvious with the lewd sounds from his tongue on your cunt and the shudders, gasps, and moans that drop from your mouth. You clunch around his tongue as he continues to fuck inside of you. The feeling so exotic and pleasurable, that you doubt you're going to last long like this. “Wanna cum for me again?”
“Yes yes yes yes yes– please, please. Tetsurou, please,” you shudder and gasp while Kuroo shamelessly eats you out. Dragging his tongue out for a mere second to lick another stripe up your cunt, teasing your nub again, then going straight back into fucking his tongue into you, he curls it up skillfully. The feeling was enough to send you over the edge.
You were a squirming, sticky mess. Your ankles were crossed behind his back, and your only moans grew louder, your body bucking against his mouth, your movements becoming more erratic. Kuroo’s grip on your thighs tightened, making sure to keep you near him as his tongue worked in and out of your dripping hole. 
“That’s it sweet thing. Gonna cum for me? All over my tongue? C’mon then.”
And that's all it took for you. Head thrown back, withering and moaning in pleasure as your orgasm hits you like a lightning bolt. Toes curled as your whole body shook, arching off the bed impossibly high, your body tensing and un-tensing under Kuroo’s harsh grip. Your body was contorting before it relaxed, and your breathing returned slowly to normal. 
Kuroo watched as you rode out your orgasms, the second one taking more out of you than the first one did. He could tell you were sensitive. “Hmmm, how was that sweetheart?” 
“Still feel up to it?” Kuroo asks you while licking the remains of your orgasm off his face. You nod weakly, your body tired from both orgasms he just gave you. A chuckle falls from his lips and then he’s getting up from in between your legs, large hands lifting the bottom half of your body so that your legs are around his waist and you can feel his hard cock up against your thigh. You gasp, hips twitching involuntarily. 
A shiver ran through you, and you looked up at him, wide-eyed. Flushed and panting when he asks, “Are you sure about this?” You nod trembling in both nervousness and anticipation. “I’ve never been more sure about anything in my life.”
Kuroo laughs at your sentence, finding it cute and he couldn’t agree more. He bends down to place a smooth kiss on your lips, tilting your head to give him more access. “Just let me know if it’s too much for your ankle or you.”
Even as you sprayed on his bed naked, he’s still worrying about your injury. So sweet, but that’s not what you care about right now. Kuroo takes hold of his cock, lining himself up with your entrance, he taps the tip against your pretty slit a few times before rubbing the head up along your folds, collecting your wetness. “Fuuckk,” he groans watching how it glistens along his dick. 
“Stop teasing,” you pout, smacking his arm. “Hurry up and put it in.”
“Jeez, a man can’t enjoy a bit before?”
“No. Put it in.” you hiss at him.
Rolling his eyes Kuroo places the tip of his cock at your weeping hole, he would just have to teach you manners at a later time. You shiver at the sensation of him nudging inside and pulling back, and you felt it immediately when he started to feed you his cock, the stretch extremely overbearing, causing you to girth your teeth and grab onto his buff arms.
He let out a deep groan at how warm and tight you were, gaze flickering back to yours–watching you he felt like he would cum on the spot with that pretty look on your face. Mouth formed into an “o” as your eyes flickered shut and your eyebrows were scrunched. 
He should’ve felt bad knowing that he was causing you pain, but you were just so beautiful like this and it seriously felt like you were going to cut off the circulation around his dick with how tight you were. “God– sweetheart you have to relax. Fuck.”
“I’m trying jackass. You wouldn’t like it if I shoved a cock your same size up your ass would you–?” you choke out as he pushes in another inch or two, a soft moan fell from your lips, a mix of pain and a bit of pleasure. Kuroo chuckled, his deep laugh vibrating and causing your pussy to flutter around him, “I wouldn’t but lucky that’s not happening.”
“Don’t fucking temp me Kuroo Tetsurou,” Inch by inch he eased his way inside, pulling back and then pushing a little further. The sensation had your nail digging into his skin as you whimpered at the stretch. You were more than prepared, yet the stretch was still a lot. The sting was nice yet antagonizing. He was truly stretching you out in ways you’ve never experienced before in your life, and you loved it. 
“I think you might just clamp my dick off…” Kuroo mumbles off, folding his bottom lip under his teeth. His face fully concentrated on you and your sweet reactions and making sure he didn’t hurt you. Your feet flex and point as you squirm at the feeling of Kuroo sinking in. It almost feels like it’s never-ending, inch by inch he continues to sink inside of your warm cunt  and you continue to clench down on him like your life depends on it.“So fucking tight princess.”
“Sucking me in like a vice. You wanted this badly huh?” he hisses when you clench around him again. Kuroo was just so big, too big, but you’d be lying if you said you didn’t like it. 
He kept going until he was up to the tilt, your hips meeting together, pausing at being inside you entirely. You huffed, the feeling of being so full unusual for you, you felt like you had just gotten impaled on his cock, stuffed to the brim of no return– and it felt so fucking good. The two of you stayed like that, waiting for you to adjust properly while he peppered tender kisses across your skin. 
His cock was throbbing inside of you, hips threatening to pull back and slam into you as hard as possible, but Kuroo knew he had to hold back for his own sake and yours. Not wanting to cum too early and because he wanted to savor the moment as long as possible.
When you grant him the okay, Kuroo pulls out only a bit before pushing back inside with a tentative thrust. “Testu! Fuck–” you whimper, legs shivering again at the pleasure that just shot through your body. 
“Want me to keep going?” He asks, only to laugh at how quickly you nod. Your grip on his arms has loosened now– not entirely but not enough to leave a mark on him. Kuroo’s hips move inside you again, his thrusts are slow but harsh as he works you up, his patience holding on by a fine thread. 
You let out an airy gasp every time his hips meet yours, the skin slapping against one another filling up the room effortlessly. His groans and low-pitched moans are just as audible as yours. Every stroke of his cock sends both of you over the edge nearing blissfulness. “Too big–” you shudder, trying to hide your face in the crook of his neck when he leans down to be closer to you. 
“Wasn’t too big when you–Ah fuck– were trying to stuff my cock–shit,  down your throat huh?” he argues, hands running up your sides as he picks up the pace of his thrusts, hitting every single point in your body, causing you to clench tightly around him, forcing a couple of curses out. 
Your face quickly morphed into one of pleasure, a look he did not want to miss, not even in a million years. His grip on your waist tightened, he uses his hands to lift the bottom half up so your hips meet his thrusts as he begins to speed up again, finding a steady rhythm this time. “Nngh– Tetsuoru–” your moans only grow louder and louder and that familiar tension starts to build up rapidly. 
Kuroo pulls you in, hand gripping your chin lightly and connecting his lips to yours, kissing you with a feverly touch. The head of his cock kisses up against your cervix each time he pushes back in, starting a new pace where he pulls almost all the way out before hitting the tilt again, the contact has your toes curling, coaxing more pretty moans out of your mouth, moans that you don’t even recognize yourself for making. “Mmmmh, so good for me sweetheart. Fuck–”
The edges of his cock rub against your fluttering walls, gushing inside of you, the wet sounds of your hips slapping fills your ears and there’s no hiding anymore, not that you have the energy to do that anyways, all you can do is moan and whine around him. Crumbling to his touch and thrusts. 
The pace he’s set is perfect, allowing you to feel and enjoy every single drag of his cock as it goes in and out. The pleasure is almost oppressive, everything feels so good that your having a hard time focusing on anything else but his cock. Kuroo’s grip on your waist is so tight that you’re sure it will leave bruises, not that you mind at all.  
“You fit so nicely around my cock, huh? So sweet for letting me take care of you like this," He purrs, enjoying the way your body responds to each stroke he makes, effortlessly hitting all your spots, exploring your body as if it were a reward. 
It’s unexpected when Kuroo reaches down, his lips finding your sensitive neck and starting to leave kisses all over it, adding to your heightened senses. Sweet innocent kisses turn into small nibbles being left everywhere, and those small nibbles turn into full-on love bites. Sharp teeth digging into your skin as he sucks harshly, you don’t know if his intent is to leave marks on your body but at the rate Kuroo is going at he surely will leave more than just a few marks. 
The tension in your stomach is on the brink of snapping, and you can tell that Kuroo knows, not as if it’s a secret with how you try to hide your face from him, whimpering and chanting his name like it’s a prayer of some sort. “It’s too much–” you cry out, wrapping your arms around his neck and yanking him closer to you. His lips on your neck and the delicious drag of his cock inside your gummy walls– all too overwhelming that it’s hard to even form sentences. 
“You can take it—” and the tension that had built up again in your lower stomach snapped, simple, just like that. You clench around him tightly, a high-pitched wail leaving your lips as pleasure overtakes your body for the third time tonight. You are oversensitive, trembling, and gasping as Kuroo continues to thrust inside of you, with absolutely no intention of stopping. 
“Haaah– did you just cum? Fuck, that’s so– shit– cute, sweetheart,” a low chuckle leaves his lips. 
Without warning, he bends your legs, pressing them to your collarbone and hooking them over his broad shoulders, practically folding you like a pretzel, and Kuroo just loses it. His grip on your thighs gets tighter than you thought was possible as he starts to piston his hips against yours. 
“Tetsuoru–!” you yelp at the sudden fast pace. Whines and moans spilling out of your lips like a waterfall. You attempt to slow him down by placing your hands on his pecs, but Kuroo growls at you to take them off and yanks them your hands off himself. “Try that again, and I'll tie them up.” 
His gaze drifts to where your cute pussy engulfs his cock every time, and he’s mesmerized at how you can take so much of him. It’s ruthless, the way you swallow his entire cock, Kuroo feels his resolve cracking and his own orgasm approaching, steady and fast. He fucks you thoroughly, giving the both of you pleasure in places neither of you knew existed. 
Being pressed directly against him while he thrusts into you feels like a dream. He spreads your legs and little wider, shoving them impossibly closer to your body, and somehow, it feels like it’s going impossibly deeper at this angle, and that’s when he hits it. 
“You feel so fucking good. So tight— you’re going to milk me dry like this,” Kuroo murmurs, he squeezes your thighs in reassurance. Giving you a mocking smile while he rolled his hips into you again, the head of his cock brushing against that one spot that had you seeing stars. 
He starts to pick up his pace, thrusting harder, eager for you to come again.
Eyes rolled over your body, taking in the obscene image of you. Mascara messed up from your tears, the dark color hindering underneath your eyes, your lipstick was practically gone, Kuroo having kissed it off you and smudging it around your face– He doesn’t think you can get any more beautiful. 
He rolls his hips upward, drawing out another whiney moan from a pleasure point that you didn’t even know was there. He begins to pound into it with every thrust he makes, Kuroo bends down, capturing your lips in his mouth. With the sweet moan you make he tugs at your bottom lip, before letting his tongue back into your mouth, swirling your tongues together, gently sucking as he explores the inside of your mouth again. 
You shudder and yelp, coil in your stomach nearing its peak again, eyes finding Kuroo’s sly gaze. The eye contact is unwavering, he smirks down at you, sticking his tongue out to wet his bottom lip before tucking it back in.
Sweat drips down his body, giving him a shiny look, his hair is wild, strands stuck to his forehead and you watch as his muscles flex while he hits you with deep, languid strokes. “Doing so good for me baby. You take my cock so well. Almost as if you were fucking made for me,” he coos when you clench and clamp down around his cock, it leaves him groaning lowly, your tight and warm cunt sending him into a damn near frenzy. “Shit, I’m close,” 
“Please come in me. I want you to fill me up,” you cry, prying your eyes open to admire the sculpted man above you, taking you as his. Everything felt so good, your eyes started to water, body trembled underneath him. Little did you know how much those words spurred him on, Kuroo was fully ready to pull out of you and cum on your stomach, yet with the permission you just granted him— he was going to make use of it. 
He didn’t waste any time, continuing to slam into your cunt, hard and fast. “Yeah? Want me to fill you up? Fuck– you're gonna take my cum like a good girl? Hmm, that’s it, sweetheart,” your body judders with each thrust. Tight walls spasm around his cock, and you cry out at the delicious feeling of him rummaging through you. “Answer me.”
“Hmmmpffhh–” The answer never leaves your mouth when Kuroo grinds his hips against yours, pulling back to slam into you again. 
“I’m going to cum,” you whine when Kuroo’s cock brushes up against your sweet spot, every stroke sending electrifying waves through your body. Your insides clench, the coil threatening to snap at any given moment, and your abdomen starts to twitch, tremors leaving your body in the form of sweet cute tears that start to roll down your cheek.  
"Almost, pretty girl," His grip tightened on your suspended leg to hold you in place.
Your cries only grew louder as your orgasm approached, body so sensitive, you hiccup as you try to form coherent sentences, trying to tell Kuroo that you really can’t hold on any longer, but all that comes out are clumpy tears, airey moans and silly babbles. Nothing makes sense anymore besides your overbearing need to cum on his cock. 
Your thighs twitch, your body trying to pull away from Kuroo as your toes curl at the pleasure, “Testuoruoooooo– please please please— plea–” he thrusts into your sweet spot again, leaving you to blank out on his cock, seeing stars in your vision. 
He pulled out nearly all the way before sliding back inside of you, over and over again. There's a white ring of arousal at the base of his hips, he continues his relentless thrusts, the pleasure, the want, the need to cum inside you taking over. Waves of ecstasy crash over the both of you. You can hardly hold yourself back especially when he looks at you like that, talks to you like that, and soon, you’re falling off the edge, crying into his neck, nails raking down his chest, breathlessly chanting Kuroo’s name like a prayer. 
“Nnngh– please please! Tetsurou– Ah! Too much–” 
His thrusts become more frantic, the sound of your bodies slapping together filling the room once more. One of Kuroo’s hands lets go of your thigh, allowing it to fall back onto his shoulder, only for the hand to find yours and intertwine them together against the soft sheets of his mattress. Leaning down, Kuroo kept up his relentless pace and pressed his soft lips against yours. His lips brush against your ear, his hot breath fanning over the skin. “Just like that. Fuck, you're so perfect. Such a good fucking girl for me.”
You only whimper at his words, you can barely see from the tears in your eyes, you try to turn away from him, but he doesn’t allow it.“Nu-uh, don’t hide from me, princess. I wanna see your cute little face as you cum all over my cock again.”
A strangled cry leaves your throat as your final orgasm rips through you. You pant, tongue lolling out of your mouth, toes curled from the oversensitivity that was taking over. Your mind goes blank as you revel in the pure bliss of cumming around his cock, and with a low groan, Kuroo buries himself deep inside of you before letting go himself. 
You milk Kuroo dry. Taking all the cum from his body, there's so much of it and not enough space inside of you that when you clench around him, you can feel it oozing out making your body shiver. “Fuck,” you mumbled, allowing your body to finally rest against the bed. Limbs almost numb, from being held down most of the time and your jaw was a bit sore, not to mention the intense throbbing from between your legs. You didn’t feel like moving at all. You just wanted to lay in his arms. 
Kuroo pulls out of you, allowing his own body to relax from above you. “You did so good for me. look how much you came,” he coos, removing your legs from his shoulders and settling them down at his waist. He admires you like him, all fucked out and exhausted. You only grumble out something incoherent when Kuroo’s fingers slip down to your hole, playing with his cum that’s seeped out already. 
The two of you sit like that for a second longer before you speak up, breaking the silence. “Are we still friends?” you ask, staring up at him. 
Kuroo chuckles, a deep rumbly sound that fills your chest with warmth. “I dunno, I don’t necessarily fuck the shit out of my friends,” he brushes a few strands of hair out of your face, staring at the dried tear streaks and ruined mascara.  
You thin your lips, a splash of nervousness overcoming you at his vague answer. “Does this mean we are girlfriend and boyfriend then?”
“No,” he responds flatly, and you almost headbutt him with how fast you attempt to sit up. “What???” you ask him, slapping his arm, a mix of confusion and frustration building up in you quickly. There is no way, Kuroo must be pranking you. He was the one who confessed first, not you. 
He grins, his eyes twinkling with mischief as he presses a gentle kiss to your cheek, “I have to take you out. On a proper date.” he explains, a cheeky smile playing on his lips as he watches your reaction.
You roll your eyes, smacking his arm and fighting the urge to pinch his nipple. “You're so cheesy.”
Kuroo’s laughter fills the room again, a deep comforting sound that makes your heart flutter. “Can’t have you settling or less kay? Now come here” he says, kissing you and pulling you close to him, lifting you up and turning the two of you over so that he’s laying against the bed with you on his chest. You can already feel his cock getting hard again and you knew one thing for sure, that you were in for a night of your own.
Tumblr media
Bzzt! Bzzt! Bzzt!
Bzzt! Bzzt!
Bzzt!
The loud, incessant noise is what bothers you out of your sleep. You reach your arm out, trying to locate where your phone is on the nightstand while fighting the urge to flip the entire thing over. There’s a soft golden glow that filters through Kuroo’s apartment, that only light in the room which your eyes struggle to adjust to. Before you could grasp at your phone, a hand gently intercepted yours.
“I’ll check it,” Kuroo murmurs, his voice a deep, gravelly rumble, still thick with sleep. He brings your intertwined hand to his mouth, leaving a few kisses then letting go to place a tender kiss on your forehead. You let out a small hum of agreement, obviously, you weren’t going to argue against a few extra moments of sleep, your body relaxed back into his embrace while your eyes fluttered shut once more. 
Propping himself up on one elbow, careful not to disturb you again, Kuroo reaches over to the nightstand grabbing his phone. His other hand rakes through your hair, in a soft soothing rhyme, trying to lull you back into your slumber while he tries to figure out why both of your phones are going off. Kuroo’s brows furrow at the myriad of notifications lighting up his screen, a cursory glance at your phone showed the same thing. Messages from his co-workers, news apps, the JVA Outlook email, from Kenma, and even…. Atsumu?
Kenma: www.kyodonews.com
Tumblr media Tumblr media
He clicked on the text from Kenma that came with a link and a photo. With a single tap, the link opened to a bustling news website. Headlines blazed across the top of the page, displaying an array of articles centered around them. Images from the previous night were plastered everywhere, capturing them leaving together in a flurry of camera flashes.
Snatches of headlines like “Gala Afterparty Surprise”, “We Knew it” , “Nobody was Fooled”  and “New Couple Alert?” filled the feed, accompanied by countless comments and speculation. Kuroo’s lips curled into a bemused smile as he skimmed through the content. 
Kuroo chuckled softly, careful not to wake you up, and continued to scroll until he found the comment section. He continued to read through some of them, laughing a bit at the usernames and the contents of the comments. Each comment ranged from the supportive to the wildly speculative and even some heartbroken ones, adding a surreal layer to his reality.
Tumblr media Tumblr media
Kuroo: thanks for the articles  Kenma: rude that I wasn’t invited. Hope u know that Kuroo: uh huh, next time buddy Kenma: bet. 
Taking a deep breath, Kuroo put the phone back onto the nightstand and tightened his embrace around you, savoring the peaceful and calm morning before the rush of the outside world intruded once more. 
Back then, you wouldn’t have been able to get Kuroo to say why he had become so fond of you, why you mattered so much to him, your success, and everything else about you. But now, as you lay, laughing in his arms, in his bed— he could tell you that it was a feeling that was so foreign to him but so close and unforgettable.
Kuroo Tetsurou has loved you since the day he saw you.
Getting to know you was never enough.
And he’d choose you in a hundred lifetimes, in a hundred words, in any version of reality, he would find you and choose you. Over and over again. Without a pause, without a doubt, and in a heartbeat. He would choose you.
And in every other universe, he will search for you because one lifetime with you is just not enough for him. 
Tumblr media
an: omg I'm so happy that i was finally able to publish this. i hope this was up to everyones standards and i didn't like anybody down with my writing , ignore the comments from the websites lol its just a bunch of inside jokes from me and my friends about this fic hehe :))
471 notes · View notes
daisynik7 · 1 year
Text
Tumblr media
Teach Me, Senpai!
Pairing: Ino x f!reader x Nanami
Rating: Explicit - MINORS DO NOT INTERACT
Word Count: ~2.6k
cw: smut - threesome, spit-roast, PIV sex (doggy style), blow job, cunnilingus, vaginal fingering, Nanami is sorta a perv oops, Ino calls Nanami senpai, a hint of a breeding kink, use of pet names, everyone is an adult here in case that doesn’t come across clearly
Summary: Takuma Ino is your silly, golden retriever boyfriend who brings you along to meet his mentor, Nanami Kento. You’ve heard a lot about him, mostly because your boyfriend constantly praises him for being so amazing. You underestimate how close their relationship is until Ino starts asking his "senpai" for pointers on how to spice things up in the bedroom. What better way to learn than to demonstrate, right?
Author’s Note: I'm currently in heat, can you blame me? I tried my best to edit and proofread, sorry if there are any glaring grammar mistakes or typos, please ignore! Tagging @todorosie @crazychaoticizzy @gojoloves @brightnessemma @batafuraikisu (I know you didn't ask, but I'm tagging you anyways bc ily and I think you'd like this lol). I'm sorry if I missed any tags, Tumblr wouldn't let me tag you! Likes, reblogs, and/or comments are always appreciate, thank you for reading! MDNI divider by @/cafekitsune.
Tumblr media
“You’re going to love him, I swear!” Ino insists, dragging you down the hallway of the office building, past empty cubicles. It’s past five and all the employees are out for the remainder of the day. 
“I just don’t see why I have to meet him,” you argue, following him reluctantly.
“Because he’s important to me! He’s my mentor, my senpai! I have the highest respect for him, and I think it’s cool for you to finally put a face to a name. Aren’t you curious about the guy I’m always talking about?”
“Not really,” you answer, rolling your eyes. Honestly, you’ve grown sick of hearing your boyfriend gush so much about this Nanami fellow. You’re starting to feel jealous about how highly he thinks of this other man. “Why are we even here? This seems like a very random meeting spot.”
“We debrief here sometimes after our missions. He used to be a salary man, so I guess they still let him use the office.” They arrive at a closed door at the end of the hall. Ino knocks twice, a bright smile on his face, a little too excited for this.
A well-built blonde man answers, donning a blue dress shirt and spotted tie. You immediately notice how large his hands are, clenched to the door frame, staring at you from behind steampunk glasses. “Hello.”
“Nanami! Hey! This is my girlfriend, the one I’ve been telling you about.” You introduce yourself to him with a handshake, confirming that they are indeed very big compared to yours. You feel guilty noticing something that can be misconstrued as inappropriate, even lewd in most cases, so you quickly let the thought fade, stepping inside the room. 
It’s a normal looking office, quite barren, except for the few papers stacked on the desk and a map posted on one of the walls. There’s a single chair facing the table, so you take that as Ino stands beside you, arm around your shoulders. “Thanks for letting us stop by. I really wanted to introduce you two to each other.”
Nanami nods curtly, leaning on the edge of the desk in front of you. Your eyes almost drift toward his crotch, curious about his size, but you resist the temptation, ashamed of yourself for even imagining something so completely wrong, especially with your boyfriend right next to you. “You said you wanted to speak to me about something,” he says, focusing on Ino. He removes his glasses, tucking them in his breast pocket.
“Ah, right! Well, I’m a little shy to ask, especially since I haven’t mentioned it to her yet…” Ino scratches his nape nervously, tugging his beanie to cover his reddening ears.
You look at him, confused. “What are you talking about?”
He bites his lip, choosing his words carefully before speaking. “Well, you know how you and I have been…you know, having some trouble in the bedroom?”
At that, you immediately freeze, gaping at him, shocked. A strangled noise comes out of Nanami’s throat, equally jarred.
Ino continues. “I want to get some advice from someone I really trust, like Nanami.” He glances between you, waiting for a response, an uneasy grin on his face. 
You’re stunned, heat surrounding your entire body now, mortified that your boyfriend would casually bring this up without any warning whatsoever. It’s no secret to either of you that your sex life has gotten a bit lackluster recently. Besides missionary and the occasional blowjob, there isn’t much else that you’ve tried in the bedroom. Neither of you are that experienced to begin with, and you both lack the confidence to initiate something different, something new. It’s a matter that you’ve been meaning to resolve privately. Or so you thought. 
No one speaks for what feels like an eternity. You’re tempted to grab your boyfriend and haul ass out of there, hoping this entire conversation can be forgotten or played up to be some kind of cruel, sick joke. However, you remain seated, curiously anticipating Nanami’s response. After all, you haven’t flat-out refused yet, and neither has he. 
Nanami clears his throat. “What kind of advice do you need?” You’re surprised that he’s even entertaining the idea. 
“I just want a few tips on how to spice things up,” Ino answers. “Make it more enjoyable for her.” He puts his arm around you again, squeezing your shoulder. You don’t know whether to punch him or kiss him; the arousal growing between your legs says the latter. The thought of another man who’s practically a stranger instructing your eager boyfriend on how to pleasure you is titillating and definitely something different, something new. You won’t deny it: you’re intrigued. 
Nanami crosses his arms over his chest, avoiding either of your gazes, focused on the floor instead. “I will help, if you both consent to it.”
Ino turns to you with puppy dog eyes. “Babe, you cool with this?”
Too invested now to refuse, you reply, “Sure.”
Your boyfriend lets out a sigh of relief, the tension relaxing in the air surrounding you. “Sweet. Me too.” He looks at Nanami, a bright smile on his face now, clearly thrilled about this. “What’s first, senpai?”
Nanami clears his throat again, standing up straight, taking a step towards you. “Well, foreplay is always a good place to start.”
Ino sticks his finger up. “Right! Foreplay. Uh, do you have a pen and paper so I can take notes…?”
“You don’t seriously need to take notes on foreplay, do you?” he snaps. “It’s as simple as kissing and touching on all the right spots.”
“What spots are those?” 
“It’s probably better if you ask her.” Nanami points to you, making direct eye contact. “Where do you like to be touched?”
You swallow hard, timid from being put on the spot like this. “Just the normal places.”
“The two of you have to communicate better if this is ever going to work out,” he says, a hint of impatience in his tone. “Show him.”
Committing to this fully now, you stand up, grab Ino’s hand and brush it against your lips. “I like it when you kiss me. And when you touch my lips.” 
He smiles at you. “That’s good.”
“You can also put your fingers in my mouth every once in a while. If you want,” you suggest, licking the tip of his middle finger. 
He smirks. “Yeah. I definitely want that, too.”
“Sometimes, it’s better to learn by doing it,” Nanami interjects, watching the two of you carefully. 
You gaze at Ino’s lips, then into his eyes, nodding. He leans in, kissing you slowly. He’s always been a good kisser, a great one, actually. The problem is that he’s too gentle with you. 
“Kiss her neck,” Nanami orders, arms at his sides now, hands clenched into tight fists. 
Ino follows, trailing down your chin until he’s at your neck, sucking on your skin. 
“Put your fingers in her mouth. She said she likes that, right?”
Ino hums, tracing the outline of your lips with his thumb before pushing it in. You surround him, using your grip to pump him in and out of you. His other hand drifts to your waist, teasing the elastic of your pants.
“Are you getting wet, sweetheart?” Nanami’s voice is low and sultry; the use of the pet name has you unraveling much quicker than you expect. Without thinking, you breathe out, “Yes,” pushing his fingers deeper down your throat. 
“Fuck, baby,” Ino moans, hot on your ear. “Where else do you want to be touched?”
You pull him out, swallowing your thick saliva, placing his hand between your legs. “Touch me here.”
Ino, eyes glossy with lust, slowly shimmies your pants down your legs, revealing your soaked panties. “Oh shit, you really are wet, fuck.”
“Eat her out,” Nanami demands. There’s a desperate gruffness in his voice that’s undeniable now, and one glance is all it takes for you to realize that he’s hard, an impressive bulge strained in his slacks. He shoves all his belongings off the desk, making room for you. “Here. Do it here.”
Ino curses under his breath, cock stiff in his sweats, leading you to the table, where you sit at the edge, spreading your thighs open for him. He slips your panties off, licking his lips before diving into your arousal, tongue pressed firmly on your clit. “Fuck,” you moan, squirming from the sensation. 
Nanami walks to the other side, near your head, staring at Ino’s face buried in your pussy. Instinctually, you reach for him, pulling him by the belt, tongue hanging out. His eyes flit to yours, surprised when you say, “Touch me, senpai.”
Ino moans into you, clearly turned on by it. Obliging, Nanami hoists your shirt off, leaving you in just your bra, which he hastily unhooks to bare your chest. Bending towards you, he wraps his lips around one breast, suckling at your teat, his hand working the other nipple, pinched between his fingers. You’re close to your climax; you just need a little bit more. As if he can read your mind, Nanami releases you with a pop, saying, “Suck on her clit until she comes. Fuck her with your fingers at the same time.” His sudden vulgarity spurs you on, grinding your hips against your boyfriend’s face, pulling Nanami back to your tits.
Ino muffles, puckering his lips around you, sliding his middle finger inside you. You throw your head back on the desk, ecstasy rippling through your entire being, knees shaking with sensitivity. 
“Yeah, she likes that,” Nanami purrs, flicking his tongue on your peaked nipples. “Put another in. One at a time, until she’s full.”
Ino manages to fit three of his digits inside you before you orgasm with him latched to your swelling bud, coating him in your slick. He doesn’t stop licking until you’ve come down from your high, pushing his head away, overstimulated. Nanami removes himself from you, unbuckling his belt, watching intently as your boyfriend slips his wet fingers inside your mouth. “Taste yourself babe. You’re so fucking good.” You slurp your own juices off him, pussy throbbing, aching to be fucked. 
“You like that, don’t you, sweetheart?” Nanami murmurs, shimmying out of his pants, erection protruding from his briefs. He palms it, rubbing his thumb over the wet spot oozing from the tip. “Ino, tease her a little bit.”
“Yes sir,” he salutes, pulling down his bottoms, cock sprung against the hem of his sweater. He taps the tip of his dick on your puffy bud, smiling wide as you writhe for him. “Damn, baby. I’ve never seen you this wet before.”
“It’s a good thing you came to me then, isn’t it?” Nanami mentions, wiping the sweat off his brow with the back of his hand. “Now turn around for us, princess. It’s going to feel so much better for you like this.”
You obey, readjusting your body to bend over the desk, ass pushed towards Ino, desperate to be used by them both. Your boyfriend positions his cock at your entrance, huffing, “You ready, baby?”
“Yeah. Fuck me, Ino,” you moan. “Fuck me hard.”
He glides in slowly, stretching you out little by little, easing into you. Once he’s all the way in, groin pressed to your ass, he starts thrusting at a steady pace. It increases gradually until he’s pounding away at you, hitting that sweet spot over and over until your eyes glaze over, in a total state of bliss. 
Nanami studies you, enjoying the show until he notices you staring at the bulge in his briefs, tongue lolling, practically begging for him. He smirks at you. “You want all your holes stuffed, don’t you, sweetheart?”
You nod, drool leaking from the sides of your mouth, eyes weepy, peering up at him. How could he resist such a cock hungry slut like you? Especially when you look at him like this? 
“I’m going to give you my cock then. Think you can take it?” he asks, shoving his underwear off, cock flopping against his abdomen. 
“Oh yeah, she can fucking take it,” Ino grunts, hands gripped to your hips, still fucking you with fervor. “Right babe?” He delivers a fresh slap to your ass, which echoes off the walls of the office. 
“Yeah, I can take it,” you mumble, gulping down the spit collecting on your tongue. 
Nanami hums, satisfied with your answer, inching his dick closer to your mouth. “Open up for me, sweetheart.”
You do, swallowing him until he bottoms out to the back of your throat, testing your gag reflex. He stays still, staring at you, relishing this lewd sight. “Ino, your girlfriend looks so pretty with my cock in her mouth. Don’t you agree?”
“Fuck, yeah. So fucking hot how she just takes it. She’s a good girl, always has been,” he says from behind you, spreading your cheeks open to watch himself disappear into your pussy with each thrust. 
“You’re a lucky man,” Nanami mutters, tipping your chin up, gazing into your eyes. “And you’re a lucky girl, aren’t you? Getting fucked by your boyfriend and his senpai.” Nanami begins to move, pumping himself in and out of your hungry mouth, your tongue running along the underside of his dick. 
Ino shrugs his beanie off, running his fingers through his hair, damp with perspiration. “Oh fuck, baby, you’re taking us so fucking good.”
“Like a proper slut,” Nanami adds, tracing the outline of your lips, glossy with spit, stretched around his shaft. “Do you suck his cock as good as you suck mine?” 
You nod, swallowing your gag reflex as the tip of his dick hits the back of your throat with each solid thrust of his hips. Your second orgasm approaches quickly, your pussy clenching Ino’s cock, though you can’t say anything while gobbling up Nanami’s cock, so you let it be, continuing to be spit-roasted over the desk, thirsty for their cum.  
“Fuck, I’m going to come soon,” Ino says, slowing his pace. “I’ve never…I’ve never come inside her before.”
Nanami, still relishing his blow job, asks, “Why not?”
“Too scared to get her pregnant,” he admits. It’s true; Ino always pulls out, even when you beg him to finish inside you. You appreciate that about him, but in this moment, you want nothing more than his cream pie filling you up. 
“Is she on birth control?”
“Y-Yeah.”
Once again, as if psychic, Nanami responds, “Then I’m sure she wouldn’t mind getting your load just this once. Right, sweetheart?”
Your words are muffled. Nanami pulls out, cock wet with your spit, stroking it in his fist. “What was that, princess?”
“I said yes! Give it to me, Ino!” you whine, shaking around him. 
“Fuck, are you sure, baby? You sure you want it?”
“Give it to me. Want you to breed me,” you blurt out. 
“That’s it, that’s a good girl,” Nanami coos, slapping the head of his cock on your tongue. “How about here? You want it here too?”
You glance at Ino, who’s watching. He nods, licking his lips. “Yes. Want your cum inside me, senpai,” you reply. 
He smirks, pushing himself back inside you, his length sliding on every inch of your tongue. “Good girl.”
It doesn’t take long for both men to come, Ino shooting his seed deep into your womb, stuffing you full, Nanami spurting ribbons into your mouth, guzzling down each drop. They pull out slowly, cocks sensitive now from the stimulation. You roll over onto your back, catching your breath, looking up at them with a satisfied smile on your face. 
Nanami cups your cheek in his hand, thumb brushing delicately against your skin. “Such a messy girl. I think she needs a few more lessons. What do you think, Ino?”
Your boyfriend’s eyes are blown wide, staring at the lewd sight before him, your pussy leaking with his cum, your mouth drooling with Nanami’s. “Yeah. Definitely needs more, senpai.”
2K notes · View notes
noctlas332 · 2 years
Text
despite posting on tumblr since 595 days ago i still genuinely have no idea how to use it
1 note · View note