#topological data analysis

[dirichletttt]

Hey, sort of a very niche question, if anyone reading this knows about topological data analysis and particularly persistent homology, are there any resources out there on the PH of the n-torus? I've been able to find that of the 1-sphere from this stackexchange post and the linked articles within but nothing (as far as I'm aware) on higher-dimensional tori.

Edit: I should specify, in case it helps, I'm looking at the Clifford embedding where you embed T^n into R^(2n). In an adjacent vein, perhaps there are some results about PH on product spaces, where we could break T^n into S^1 x ... x S^1 (n times).

[bth3cowboi]

love conjeture, lh44 x reader

masterlist

pairing: lewis hamilton x mathematician!reader

summary: sometimes algorithms win championships, other times they help find love. (social media au)

mercedesamgf1

liked by yninmath, georgerussell63 and 879.301 others

mercedesamgf1 This year we want to give a special thank-you to Dr. Yn Ln! With the creation of her new algorithm focused on data analysis and her extensive collaboration this season our view in analytics evolved to unimaginable levels. We are forever grateful for her contributions and what they mean for the future of Formula 1. Thanks again Dr. Ln, and good luck with the thesis! 😎💻

tagged yninmath;

see all comments

yninmath thank you for the opportunity🫡💙 it was an honor to work alongside this great team

mercedesamgf1 👏💙

user1 omg work girlll!!

user2 just googled her and im going crazy like how do you have 3 phds at 27😭?

user3 graduated super early too shes kind of a genius lol

lewishamilton thank you miss yn💙

yninmath your welcome sir champion🥹

user4 ok this is cuteee

user5 you should be thanking him bffr

georgerussell63 Outstanding!🙌 Make sure to come back Dr. Yn

yninmath oh but the travelling😮‍💨

lewishamilton nah you’ll make it back

yninmath if you say so haha

yninmath

liked by lewishamilton and others

yninmath currently picking up trash couches, writing thesis and remembering the friends ive made along the way 🤓💘

on a serious note, if anyone is interested in reading about topology feel free to read my new paper abt it (link in bio #influencer)

tagged bestfriend, roscoelovescoco;

see all comments

roscoelovescoco working’s hard🐾😵‍💫

yninmath or hardly working🤔

bestfriend surprised the couch didnt bring rats or something

yninmath no rats or fleas!!! its been a great couch #trashcouch #luckygirls

bestfriend please never use # again

user1 great paper dr yn😍 is there any way I could get your paper on the hodge conjeture for academical porpouses? magazines are too expensive, help a girl out🙏

yninmath dm me girl that should be free so make sure your class gets it too

user2 dr yn youre saving the nyu maths class of 25’🫡

lewishamilton no rest on break miss yn?

yninmath you know me already haha💞

user3 suspicious…

user4 what? they cant be just friends?

user5 I thought she worked for merecedes, what is this?

user6 she was only there to develop part of her thesis tho still won them another championship

liked by lewishamilton

f1paddockgossip

liked by pierregasly and 903.443 others

f1paddockgossip BREAKING! Lewis Hamilton was caught while vacationing in France with mathematician and Mercedes’ collaborator Dr. Yn Ln. The pair are rumored to be in a months-long relationship already, starting in the middle of last season.

see all comments

user1 NOOOOO

user2 isnt she like way younger than him? weird

user3 shes literally a grown woman lol she can be with whoever she pleases

user4 no cause they actually look really cute🥹 so happy for them

user5 right! she seems super nice

user6 i just know that man is confused everytime she talks numbers lmao the curse of dating a stem girlie

lewishamilton

liked by yninmath, f1 and 3.478.139 others

lewishamilton congrats on the finished thesis miss yn😉💙 love you

comments have been limited

yninmath love u and ty for the championship😘 would have failed otherwise

lewishamilton 😂😂

lewishamilton anything for my girl

yninmath 🥹

yninmath

liked by mercedesamgf1, lewishamilton and others

yninmath you best believe he sat on the #trashcouch #dearlordwhenigettoheaven

comments have been limited

bestfriend did it have fleas lewishamilton?

lewishamilton no but I was worried

yninmath booo tomatoes

bestfriend just buy a new one please

yninmath i believe in sustentability🫡🍃

lewishamilton there has to be a limit

lewishamilton ❤️❤️

yninmath love you sm

liked by lewishamilton

——

a/n: ty for reading and i hope you enjoyed🩷 maybe ill be writing more for different drivers soon, so if anyone is interesed keep that in mind!

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

[mentalknot]

What I thought my trajectory as a math major would look like during the fall of my freshman year:

Semester 1

Take linear algebra + multivariable calculus… maybe intro combinatorics if I’m feeling “wild,” but taking it easy to learn the ropes

Semester 2

Take number theory, maybe some CS classes to work on the double-major side plot… pretty chill semester again, to adjust to college ofc

Semester 3

Take abstract algebra and a few more CS classes, maybe an extra little elective? Time to be adventurous!

Semester 4

Take real analysis + finally start finishing my distribution requirements… lol

Semester 5+

Topology and purely unknown vibes, maybe research at some point? Who knows!

Reality, three semesters later lmao

Semester 1

Took linear algebra and combinatorics + a last-minute remote internship + intro CS, and discovered research seminars for the first time

Semester 2

Took abstract algebra, number theory, and multivariable calc + data structures + started my first math research project, …and had an eight-day medical emergency side plot (oops)

Summer

Finished first math research paper, attended six conferences + more seminars than I can count, worked part-time at a pizza place, and my friend, imposter syndrome, said hello

Semester 3

Taking advanced linear algebra and real analysis, working two interdisciplinary research jobs because I was ready to “take a break from retail,” experienced my first “philosophical bender” after severe anxiety that spawned a “potentially novel” family of graphs, attempted to prove some goofy old conjectures and convinced myself that I was going crazy in the process… and enjoyed combinatorics seminars with my friends!

I’m never letting my autistic brain have free will to decide my schedule again… 😭

[kingme1002]

Quantum computers:

leverage the principles of **quantum mechanics** (superposition, entanglement, and interference) to solve certain problems exponentially faster than classical computers. While still in early stages, they have transformative potential in multiple fields:

### **1. Cryptography & Cybersecurity**

- **Breaking Encryption**: Shor’s algorithm can factor large numbers quickly, threatening RSA and ECC encryption (forcing a shift to **post-quantum cryptography**).

- **Quantum-Safe Encryption**: Quantum Key Distribution (QKD) enables theoretically unhackable communication (e.g., BB84 protocol).

### **2. Drug Discovery & Material Science**

- **Molecular Simulation**: Modeling quantum interactions in molecules to accelerate drug design (e.g., protein folding, catalyst development).

- **New Materials**: Discovering superconductors, better batteries, or ultra-strong materials.

### **3. Optimization Problems**

- **Logistics & Supply Chains**: Solving complex routing (e.g., traveling salesman problem) for airlines, shipping, or traffic management.

- **Financial Modeling**: Portfolio optimization, risk analysis, and fraud detection.

### **4. Artificial Intelligence & Machine Learning**

- **Quantum Machine Learning (QML)**: Speeding up training for neural networks or solving complex pattern recognition tasks.

- **Faster Data Search**: Grover’s algorithm can search unsorted databases quadratically faster.

### **5. Quantum Chemistry**

- **Precision Chemistry**: Simulating chemical reactions at the quantum level for cleaner energy solutions (e.g., nitrogen fixation, carbon capture).

### **6. Climate & Weather Forecasting**

- **Climate Modeling**: Simulating atmospheric and oceanic systems with higher accuracy.

- **Energy Optimization**: Improving renewable energy grids or fusion reactor designs.

### **7. Quantum Simulations**

- **Fundamental Physics**: Testing theories in high-energy physics (e.g., quark-gluon plasma) or condensed matter systems.

### **8. Financial Services**

- **Option Pricing**: Monte Carlo simulations for derivatives pricing (quantum speedup).

- **Arbitrage Opportunities**: Detecting market inefficiencies faster.

### **9. Aerospace & Engineering**

- **Aerodynamic Design**: Optimizing aircraft shapes or rocket propulsion systems.

- **Quantum Sensors**: Ultra-precise navigation (e.g., GPS-free positioning).

### **10. Breakthroughs in Mathematics**

- **Solving Unsolved Problems**: Faster algorithms for algebraic geometry, topology, or number theory.

[coming-up-with-usernames-is-hard]

PhD Blog Week 8

Courses

CFT: More messing around with correlators, radial quantisation, lots of things that are almost vertex operator algebras without ever saying that

Diff Top: Main complaint this week is that he keeps mentioning bundles without defining them, but I finished the assignment so that's good

Lie Algebras: Root systems, mostly just linear algebra, should finish the classification this week

Talks

Integrable Systems Seminar: Spherical double affine Hecke algebra, still don't really know what it is but despite that the talk was actually one of the most understandable seminars I've been to

Algebra Seminar: More Yangians, still don't know what a Yangian is, followed for about ten minutes before getting lost. The preseminar was good, but didn't help follow the main seminar

Example Showcases: Mostly pretty good this week. The first was on geometric applications to number theory, simple start showing that some equation has no solutions over the integers, then the schemes appeared and I was lost. This seems to be a common occurrence. I should learn what a scheme is. Second talk was on Feynman diagrams and how they arise in QFT, it was a good explanation of a lot of physics in just half an hour, and it was nice to be back on familiar ground after the étale fundamental group. Third one was on the Witt and Weyl algebras, a good explanation but I felt that the talk lacked a conclusion. The final talk was on topological data analysis, very interesting application of things that I don't know that well, and a little bit of rep theory.

Reading Groups

Complex Geometry: The Weyl group part 2, I missed part 1 but it still mostly made sense

Infinity Categories: Really interesting this week. We looked at how to define monoidal categories, the approach taken was to move away from the notion of a biniary product and phrase symmetric monoidal categories as co-cartesian fibrations, then the monoidal structure is naturally induced from maps in FinSet_*, and replacing finite sets with ordered sets gives a non-symmetric structure. Then this (much more complicated) definition generalises to infinity categories.

Categories: The 2-category of categories, after infinity-categories 2 feels like a very small number! I've also agreed to give a talk in a couple of weeks so I need to brush up on universal properties

Supervisor Meeting

Finally heard from my second supervisor as we discussed Wronskian solutions to differential equations, not my favourite area of maths but hopefully once it's related to the algebra I won't have to deal with the differential equations much

Teaching

Two tutorials this week, the work sheet was harder this week as they've just started graph theory, the final question was to prove that the utilities problem has no solution which was a pretty big ask

[edupunkn00b]

Decoherence, Ch. 8: Night Falls

Creative Commons 1.0 Public Domain

Prev - Night Falls - Next - Masterpost - [ AO3 ] - Playlist

“So the universe is not quite as you thought it was. You’d better rearrange your beliefs, then. Because you certainly can’t rearrange the universe.” -Nightfall by Isaac Asimov

WC: 1975 - Rated: T - CW: swearing, alcohol -

2129, September 19 - Geneva, Switzerland

Remus leaned back in his chair, eyes squeezed shut. He’d been staring at the monitors in front of him since… He opened one eye and groaned at the clock. For the past ten hours. Shit. The commissary would be closed now and he’d worked through lunch. Again.

Shaking his head, he pushed himself up out of his chair with another groan as his back cracked and creaked with the movement. Stretching his arms overhead, then twisting, careful to avoid his trick shoulder, he cracked the last of his vertebrae and sighed. There was always the breakroom. Maybe the vending machine might actually work tonight.

He jogged down the two flights to the staff floor and navigated the maze of hallways to the breakroom.

“Dammit,” a low voice swore from inside. Remus turned the corner and peeked in. A tall man in a white lab coat stabbed at the—unresponsive—vending machine control panel, another quiet swear slipping out when every light on the panel flickered out and the machine powered down. He banged his head against the glass with a little shake.

“Working as well as it always does, I see,” Remus said. The man spun around, eyes wide.

Brilliant, familiar blue eyes framed beautifully by thick black glasses, topped with silky soft dark hair hanging over his forehead and a crooked little smile. “Apologies, I thought I was alone in the building tonight.”

“Y—yeah,” Remus cleared his throat. “So did I.” His ears buzzed and he stared at the man from his dreams, the man’s name just on the outer edges of his mind. He’d woken up with the name on his lips, but the detritus of the day had pushed it aside. 

The raven-haired man stepped forward, hand outstretched. “I don’t believe we’ve met,” he said, still smiling. “I’m Dr.—”

“Lo,” Remus whispered, taking his hand.

“Yes, Dr. Logan Sanders.” Lo’s brow furrowed. “Have we met?”

“Ah—” Remus’ mouth went dry. The other man held no recognition in his eyes. “Perhaps only in passing,” he finally managed. “I’m Remus… Remus Prince.”

“Dr. Prince?” His smile returned and Remus shook off his strange deja vous. He must’ve seen an attractive man in the building, heard his name and then his dreaming mind had simply run with it. “You’re heading up the wave field experiments upstairs,” Logan continued.

Remus chuckled, “I will be once I get the sensors to stop redlining. How about you? What’s your specialty?”

“Chaos detection through topological data analysis,” he grinned when Remus whistled.

“I’d better get my sensors to behave, then, so you can use my outputs.”

Logan laughed, bright musical bubbles filling the room. “Indeed.” Smiling back, Remus’s bones finally lost their lingering chill from his hours in the computer room. “I presume we’re both here hunting for something to fuel a second wind?”

“That was the idea,” Remus nodded, eyes narrowed at the dead vending machine. “Want to see if we can get this thing working? Or at least open?”

“Excellent plan,” Logan chuckled.

Fifteen minutes later, they’d managed to use a butter knife to pry off the control panel and revealed the corroded contacts beneath. “Fuck, no wonder this thing’s always on the fritz,” Remus laughed. Tracing the wires, he wiggled each one and looked back at Logan over his shoulder. “The rest of it’s fine. Which do you want?” he asked. “I can hotwire it.”

Laughing, Logan shook his head. “I suppose I’ve been mischarged often enough for a free item or two to balance the scales a bit.”

They looked over the treats behind the glass and Remus nearly picked the trail mix, then pointed to a small packet of cinnamon cookies. He could almost see them in Logan’s hand. “Petit Lu’s?” 

“Good guess,” he nodded, cheeks just a little pink. “Those are my guilty pleasure.” Logan watched him trace the cables connecting the controller to the delivery mechanism. “Careful, though,” he whispered. “Any gun could be loaded, Dr. Prince, any wire could be hot.”

“These aren’t even five amps,” Remus grinned over his shoulder. “And not enough voltage to really hurt.”

Logan didn’t look convinced but he didn’t stop him, either.

It took only a few more minutes and one tiny shock for Remus to retrieve their snacks and two insta-teas from the machine. Eyeing the single small table, he shrugged. “No food in the control room, so I was going to have this here and head back with a fresher head. Hopefully,” he chuckled. “Would you like to join me? Or do you need to…”

Logan grinned. “That would be more than acceptable,” he nodded and sat down with his cookies and pre-made tea. He cracked open the can with a little laugh at its relative loudness in the quiet room and waited for the autoheater to steam it before he took a slow sip. “Better,” he hummed. Peeling back the compo-film from his Petit Lu’s, he moved the tray to the middle of the table and munched. “You mentioned the sensors are redlining?”

“They are,” Remus sighed, leaning back in his seat. “We made some progress after altering the J-25 protocols—”

“You what?” Lo's laugh held more surprise than mirth. “It’s a wonder you didn’t blow up the collider!”

“Nah,” he waved his hand. “They were redlining way below their actual max. You do have to watch them, can’t just set it and take walk like you can with the override controls in place.”

“So what’s the difference now?” He shook the last dregs of his tea before finishing the can.

Remus tugged at his mustache. “Half the sensors report the wave collapse just as predicted. The other half are showing the opposite results.”

“Calibration issue, maybe?”

“That’s what I thought!” he leaned over the table, nodding. “But I’ve run every diagnostic, recalibrated by hand…” He sank back into his chair. “Same anomalous results. It’s like the test itself is breaking it.”

“You think it could be as simple as the Observer Effect?”

His words echoed in Remus’ mind, layering over each other and he stared at the man sitting across from him. “Are you sure we haven’t met?”

Blinking at the non sequitur, Logan chuckled. “I am quite certain I would remember meeting someone willing to hotwire the snack machine.”

“I suppose you’re right,” he laughed half-heartedly then finished off his own tea and pushed the can into the recycler. “I just… I get the strangest sense…” He sighed and dragged his hand through his hair, ruffling the curls on top of his head. “If my mind is playing tricks on me like this, maybe it’s a sign I should call it a night. The collider’ll be here in the morning.”

“Perhaps that’s wise,” Logan chuckled again as he gathered the remains of his snack. He rose and offered his hand. “It was a pleasure meeting you, Dr. Prince.”

Remus’ throat went dry, staring back into his clear blue eyes, but he nodded and shook his hand. “And you, Dr. Sanders.”

~

It was fortunate the streets were empty because Remus’ mind was everywhere but the road as he biked home. His second-hand motorbike’s engine purred, a steady drone that served too powerful of a soundtrack for his racing thoughts.

Why had he felt like he’d known this other scientist? Remus had never worked in the data analysis group. He wasn’t even sure he knew what floor they were on, and they certainly never came up to the control room, just… they were just on the stupidly long list of cc’d staffers on his team’s reports.

But those eyes. Those were the eyes he imagined he’d see each morning when he woke. The eyes he saw hiding beneath the brim of a dusty old cowboy hat, or a clean room bonnet and goggles. Behind those giant American-style mirrored sunglasses, the kind you had to be inches from to see through.

Remus eased into his basement parking spot and cut the engine. It was late and he’d been staring at screens all day long. His mind had just latched on to the first set of warm eyes he’d seen all day. He pulled off his helmet and reached back and, without thinking, patted the empty seat behind him for… for what? The helmet he already held?

A good night’s sleep. That’s what he needed. Everything would make more sense in the morning.

~

Our train’s big iron wheels make a steady chunka chunka sound as we pass over the bridge, and Lo sits next to me, head resting on my shoulder. Together, we watch the sun set just past the sparse trees and brush. The train moves fast enough that when we focus on the lake off in the distance, we can see right through the trees, like they weren’t even there.

The warm glow reflects off Lo’s glasses, flashing from time to time when he turns his head just right. I can’t tell if it’s the fancy seats or just the soft smile on Lo’s face, but I feel more comfortable, more… peaceful than I’d felt in a long, long time. 

He reaches for my hand just as the last sliver of sunlight slips down past the horizon, the light bursting up and bouncing against the sky before it’s swallowed up by a dark, deep indigo black. Lo turns to me and smiles. “It’s time to move to the next car,” he murmurs. A shadow passes over his eyes but then the lights above our seats click on and he looks up at me, eyes gleaming in the low light.

“How do your eyes always seem to match the sky?” I whisper.

He laughs. “It’s what you see.” He stands, fingers locked together with mine. His skin is warm and soft, and grips my hand like he’s afraid I might let go. I’ll never let go.

Once we’re both standing, he opens the compartment overhead and, still holding my hand, fishes around between our bags. After searching for a while, he pulls out a small, bright green bottle of wine.

“Just what we need,” he smiles and I nod. He points to the door that separated the train cars and squeezes my hand. “Follow me, Meus.”

I nod and follow him down the narrow aisle between the rows of seats. The rest of this car is empty now. It’s not due to arrive at the station until dawn, and the few people we’d been riding with were already settled into the sleeping cars. “Do you think they’ll have kept our bunk?” I ask, a little trill in the back of my head telling me something might have gone wrong.

“It’ll be there.” Lo nods, confident. Steady. I smile back and continue with him down the aisle.

When we reach the door, it slides open easily and the rhythmic clacking of metal wheels on the tracks fills our ears. A blast of grass-scented wind whips our hair in our faces.

“Hold on tight,” I grin and step through between the cars. I reach for the door on the other side and turn back when Lo doesn’t follow. “You okay? Did we leave something behind?”

Lo nods and lets go of my hand. “We did.” He uncorks the wine and pours it over the railcar coupler. 

“Lo? What—what are you doing?”

He just looks up at me with big, sad eyes and pours out the rest of the wine. Steam billows up from the coupler and the heavy steel begins to warp and stretch. My car keeps speeding along and his begins to slow. 

“Lo, come on!” I reach across the growing gap between us before his car slips too far away. “C’mon, you can still make it!”

Lo shakes his head and lowered his hand, slowly backing away into the darkened train car. “Find me, Meus,” he cries over the roar of the tracks. “Find me!”

[landoffreaksandfrogs]

Aranea: I think I'm in love with you.

Porrim:

Aranea:

Porrim: Shit, so+rry, did yo+u say so+mething? I was zo+ning o+ut.

Aranea: I said in topological data analysis, a su8division 8ifiltration is a collection of filtered simplicial complexes, typically 8uilt upon a set of data points in a metric space, that captures shape and density information about the underlying data set. The su8division 8ifiltration relies on a natural filtration of th

[architecturalthesis]

From FEA analysis to Data Informed Voxel

FEA load analysis

Topology optimized form

Point sorting based on load value

Voxelized geometry ready assign spatial printing toolpath density

[nimuetheseawitch]

#️⃣ What's the most oddly specific AO3 tag you could use for this story? for the professor au and ❓Share some dialogue with a question in it. for the hangster hate sex

️#️⃣ What's the most oddly specific AO3 tag you could use for this story?

#inaccurate portrayal of topological data analysis

❓Share some dialogue with a question in it.

I think I've shared this before but it's still the only dialogue with a question so far:

"What do I know, man? I don't actually like you, how am I supposed to know if Coyote does?" 

Although, I'm planning on there being something along these lines at some point:

"Fuck you!" "Would you?"

[akihatohnoofficial]

akiha: "oughhhh ouuuuuugh... my bwain... gone..."

akiha's boobs (where all the brains went): "Well, we had a light morning reading Gödel, Escher, Bach before spending the afternoon on theoretical biology research, but what should we do now that we've discovered the cure for cancer? Perhaps we can take a rest day to self-study topological data analysis while we ruminate on this... If only that idiotic wreck we call a host would go to bed at a reasonable hour so that we can truly rest."

oh my GOD

[cazort]

I see both sides of this, but I think there is.a best-of-both-worlds solution, which is to teach different aspects of abstract math that would be both more useful for direct applications, and for abstract reasoning.

I think what is now taught as college-level discrete math could be taught before high school calculus and would be more useful. It could even be introduced around 8th grade and used as an introduction to logic and mathematical proof, in place of geometry where it often feels artificial. Then, geometry could be taught later where it could be intertwined with algebra and calculus and maybe even a little data analysis. Discrete math could teach some intro combinatorics (counting) which could flow into probability and then statistics. You could even sneak some abstract algebra, group theory in there, teaching about rotational symmetry and also permutation groups of objects. Maybe even mention some topology and non-euclidean geometry.

All of this stuff can be taught without calculus.

Heck I've even seen someone teach category theory to 5th graders.

The crazy thing is, kids think this stuff is cool. It feels less like work and more fun. People have told me their first discrete math course didn't feel like math to them. The fun of it can help kids get to a much higher level more quickly.

It’s sad how much of what is taught in school is useless to over 99% of the population.

There are literally math concepts taught in high school and middle school that are only used in extremely specialized fields or that are even so outdated they aren’t used anymore!

[renatoferreiradasilva]

HydraSphere: A Fluidic Analog Platform for Experimental Simulation of Gravitational Equivalents, Climatic Systems, and Ballistic Phenomena

Abstract

HydraSphere introduces a novel spherical fluidic environment enabling laboratory-scale investigation of astrophysical, climatic, and hydrodynamic phenomena through analogical modeling. This modular platform (Ø=1.8m) employs magnetohydrodynamic principles, thermoconvective gradients, and particle tracking to simulate:

Gravitational lensing via refractive fluid vortices

Thermohaline circulation analogs for exoplanetary climate modeling

Microballistic interactions in viscous media High-resolution 360° optical capture generates empirical datasets for machine learning validation of nonlinear systems. Demonstrated cost efficiency (<$20k prototype) and educational adaptability position HydraSphere at the Pasteur’s Quadrant intersection of fundamental physics and applied engineering.

1. Introduction: Bridging the Analog Gap

While numerical simulations dominate complex system modeling (Navier-Stokes, N-body), their disconnect from empirical validation remains problematic. Astrophysical observations suffer from non-replicability, and microgravity experiments incur prohibitive costs. HydraSphere addresses this via controlled fluidic analogies:

Magnetic fields → Gravitational potentials

Thermal plumes → Stellar energy injection

Tracer particles → Mass streams in curved spacetime This work extends beyond prior fluid analogs (e.g., silicone oil vortices) through multiparameter coupling (magnetic/thermal/kinetic) and quantitative optical metrology.

2. System Architecture & Innovation

Core innovation: Configurable spacetime metric in a confined fluid continuum ds^2 = \alpha(r)dt^2 - \beta(r)dr^2 - r^2d\Omega^2 \approx \frac{\mu_0}{4\pi}\frac{\vec{m}\cdot\vec{r}}{r^3} + k\Delta T \hat{z}

2.1 Structural Implementation Component Specification Function Pressure vessel Borosilicate-PC hybrid (σ_y=85MPa) Turbulence damping at Re~10⁴ Field generators 6-axis Halbach array (0.5T gradients) Multipole gravitational analogs Tracer system PMMA microspheres (Ø50μm, λ_ex=365nm) Geodesic path visualization Thermal actuators Peltier tiles (ΔT_max=80K) Convective instability triggering

2.2 Metrology Suite

Tomographic PIV: 4× 5MP cameras @ 240fps

Distributed fiber-optic thermometry (0.1K resolution)

Lorentz force velocimetry (EMF sensing)

Control System: ROS2-based architecture enabling closed-loop perturbation experiments (e.g., simulated supernova → shockwave propagation).

3. Experimental Capabilities & Validation

3.1 Gravitational Analog Verification Experiment: Neutrally buoyant dipole in Couette flow → Frame-dragging simulation Result: Quantified Lense-Thirring analog with 92% match to GR prediction at v=0.2c (Fig 3a)

3.2 Climate Regime Exploration

Hadley Cell Simulation: Salinity gradients + radiative heating → Meridional flow patterns

Tipping Point Detection: Critical transition thresholds in double-diffusive convection

3.3 Ballistic Analogies Hypervelocity impacts (v=100m/s) → Crater morphology matching Chelyabinsk meteorite data

3.4 ML Dataset Generation

10TB multimodal dataset: Optical/thermal/EMF time-series

Benchmark for Physics-Informed Neural Networks (PINNs)

4. Comparative Analysis

Parameter Numerical Sims Astrophysical Obs HydraSphere Temporal res Δt~10⁻⁶s Δt~days Δt~10⁻³s Parametric control High None Programmable Energy cost 10 MWh/run N/A 2 kWh/run Error propagation Truncation Cosmic variance Turbulence noise

5. Epistemological Framework

HydraSphere enables tangible abductive reasoning for counterintuitive phenomena:

Visual heuristics: Topological defects as Kerr metric analogs

Tactile scaling: Reynolds number ↔ Hubble parameter correlation

Pedagogical inversion: Student-designed experiments → theoretical refinement

Aligns with van Fraassen's constructive empiricism by privileging empirical adequacy over metaphysical commitment.

6. Future Trajectory

Near-term (0-2 yrs):

ISS microgravity compatibility study (ESA collaboration)

Quantum dot tracers for Lagrangian turbulence analysis

Museum network deployment (NSF Informal STEM)

Long-term:

Exascale simulation cross-validation (DOE INCITE)

Biohybrid variants for synthetic astrobiology

[codingprolab]

ECE 478/578 Project # 2. The Internet Topology

You are to study the Internet topology at the Autonomous System (AS) level using real topological data. We will use the data sources available at the Center for Applied Internet Data Analysis (CAIDA) at http://www.caida.org/. 2.1 AS Classification – 20 points Explore the classification of ASes to (a) transit/access ASes, (b) content ASes, and (c) enterprise ASes, using the dataset available at…

[spacetimewithstuartgary]

Small-scale solar explosion reveals big clues about magnetic reconnection

Using the world's largest solar telescope, a team of scientists has captured one of the most detailed views ever of a microflare—a small yet powerful solar explosion. The images are helping scientists understand the complexity of magnetic fields powering the sun's smallest outbursts.

The new research, led by Dr. João da Silva Santos, a postdoctoral researcher at the U.S. National Science Foundation (NSF) National Solar Observatory (NSO), uses unparalleled data from the NSF Daniel K. Inouye Solar Telescope, built and operated by the NSO on Maui, to reveal how magnetic fields deep in the sun's lower atmosphere can suddenly reconnect and unleash bursts of energy, heat, and plasma—an explosive process known as magnetic reconnection.

The research was published last month in the The Astrophysical Journal by a team of scientists at two organizations: the NSF National Solar Observatory and the NSF National Center for Atmospheric Research (NSF NCAR).

"This study investigates a small yet powerful event on the sun where magnetic fields reconnected in the solar atmosphere," says da Silva Santos. "We captured a microflare in extraordinary detail, observing sudden heating, fast-moving plasma, and turbulent motions in a region just over 700 kilometers wide, yet showing substructures 10 times smaller than that."

Although the event was tiny when compared to massive solar flares—i.e., "average" flares are about 100–1,000 times stronger—its energy release was far from insignificant, and estimated to be on the order of 10 billion lightning bolts.

This event, which initially displays characteristics typical of Ellerman bombs before evolving into a more complex microflare, was observed in high resolution using two of the Inouye's instruments: the Visible Broadband Imager (VBI) and the Visible Spectro-Polarimeter (ViSP). The impressive telescope capabilities revealed remarkable details such as sudden bursts of light, fast plasma flows, and fine-scale magnetic field interactions unfolding just hundreds of kilometers above the solar surface.

The data show the brightening occurred in a tightly packed zone where opposite magnetic fields met and canceled out, releasing energy in the process. Spectropolarimetric analysis using complex modeling allowed the team to extract precise temperature, velocity, and turbulence profiles, and reconstruct the 3D magnetic topology of the region.

"We found that the reconnection occurred along a dome-shaped magnetic structure known as a fan-spine configuration, complete with a magnetic null point and enhanced squashing factors," said Robert Jarolim, NSF NCAR scientist and co-author of the study. "This had been predicted in simulations and hinted at in coarser observations, but now we could see it clearly."

The structure acted like a trap and trigger, guiding the release of energy through the cancellation of magnetic fields and the sudden acceleration of plasma—akin to snapping rubber bands in a "magnetic" net.

Eric Dunnington, an undergraduate student from the Rensselaer Polytechnic Institute, played a key role in the study and is also a co-author. In the summer of 2024, he participated in the NSF Research Experiences for Undergraduates program run by the Boulder Solar Alliance, and had Dr. da Silva Santos as a mentor.

"João offered me the invaluable opportunity to significantly contribute to the data calibration and early analysis, and even to present a poster with preliminary results at the American Geophysical Union 2024 annual meeting in Washington, D.C.," Dunnington says. "It's a fantastic example of how undergraduate research can directly advance cutting-edge science."

The findings address longstanding questions about how small-scale reconnection works in the upper photosphere and low chromosphere, regions of the solar atmosphere that are notoriously difficult to observe. While larger solar flares have been widely studied, these microflares are more elusive—yet potentially just as important for understanding how the sun's energy ultimately affects the space environment around Earth.

"This research provides some of the clearest observational evidence to date that magnetic reconnection can occur in compact, low-lying magnetic structures," says da Silva Santos. "And without the Inouye's resolution, the key small-scale features would have remained invisible."

This study not only opens a new window into the sun's hidden activity, but also strengthens the case that even small-scale solar events could play a role in understanding stronger ones driving space weather. And thanks to the NSF Inouye Solar Telescope, the smallest sparks on the sun are no longer out of reach.

TOP IMAGE: This multi-instrument figure showcases high-resolution observations of the same active region. Panels a–b show data from the Helioseismic and Magnetic Imager at the NASA Solar Dynamics Observatory. Panels c–e show spectra from the ViSP instrument at the Inouye. Panels f–h show images from the VBI instrument at the Inouye using three different light filters known as G-band, Hβ, and Ca II K. The panels reveal a small-scale, transient brightening (indicated by the black arrow) occurring at the boundary between opposite magnetic polarities (inside the blue box). Credit: NSF/NSO/AURA

LOWER IMAGE: This figure zooms in on the microflare event, marked by enhanced emission at specific wavelengths (i.e., green contour for the wavelength of Ca II K; and magenta contour for that of Hβ). Credit: NSF/NSO/AURA

[aimarketresearch]

Quantum Computing Market Size, Share, Trends, Growth Opportunities and Competitive Outlook

New comprehensive research on the Quantum Computing Market highlights promising growth prospects fueled by evolving consumer preferences and technological advancements. The latest market analysis projects a robust CAGR over the next five years, driven by increasing adoption across key sectors and expanding geographic reach. Market players are focusing on innovation and strategic partnerships to capitalize on emerging opportunities, positioning the Quantum Computing Market as a critical component in the broader industry landscape.

The study further identifies key trends shaping the market dynamics, including the rise of sustainable solutions and digital transformation initiatives. Regional insights reveal strong growth potential in North America and Asia-Pacific, supported by favorable regulatory environments and infrastructure development. This in-depth report offers valuable data and actionable insights for stakeholders, enabling informed decision-making and strategic planning to navigate the competitive terrain of the Quantum Computing Market.

Discover the latest trends, growth opportunities, and strategic insights in our comprehensive Quantum Computing Market report.

Download Full Report: https://www.databridgemarketresearch.com/reports/global-quantum-computing-market

Quantum Computing Market Overview

**Segments:**

- **By Component:** - Hardware - Software - Services

- **By Deployment:** - Cloud-Based - On-Premises

- **By Technology:** - Quantum Annealing - Superconducting Qubits - Trapped Ion - Topological Qubits - Photonic

- **By End-User:** - Defense - Healthcare & Pharmaceuticals - Chemicals - Banking & Finance - Others

**Market Players:**

- IBM Corporation - D-Wave Systems Inc. - Microsoft Corporation - Rigetti & Co, Inc. - Google - IonQ - Zapata Computing - Intel Corporation - Anyon Systems Inc. - QC Ware Corp.

The global quantum computing market is experiencing rapid growth and is expected to witness significant expansion in the coming years. The market is segmented based on components, deployment, technology, and end-users. The components segment includes hardware, software, and services. Hardware components are essential for the operation of quantum computers, while software plays a crucial role in programming and controlling these systems. Services encompass support, maintenance, and consulting related to quantum computing solutions. The deployment segment consists of cloud-based and on-premises solutions, catering to different organizational needs and preferences. Quantum computing technologies such as quantum annealing, superconducting qubits, trapped ion, topological qubits, and photonic systems are driving innovation in the market, offering diverse capabilities and applications across various industries.

The end-user segment of the global quantum computing market encompasses industries like defense, healthcare, pharmaceuticals, chemicals, banking, finance, and others. Each industry vertical has unique requirements and can benefit from quantum computing in different ways. Market players in the quantum computing sector include key companies like IBM Corporation, D-Wave Systems Inc., Microsoft Corporation, Rigetti & Co, Inc., Google, IonQ, Zapata Computing, Intel Corporation, Anyon Systems Inc., and QC Ware Corp. These players are actively involved in research, development, and commercialization of quantum computing technologies, driving competition and innovation in the market. Collaborations, partnerships, and strategic alliances are common in this sector to leverage expertise and resources for accelerated growth and market penetration.

https://www.databridgemarketresearch.com/reports/global-quantum-computing-market The global quantum computing market is poised to revolutionize the way businesses and industries approach complex computational problems. One of the key drivers of this market is the increasing demand for high-performance computing solutions that can tackle challenges beyond the capabilities of traditional computers. Industries such as defense, healthcare, pharmaceuticals, chemicals, banking, finance, and others are exploring the potential of quantum computing to enhance efficiency, accelerate research and development processes, optimize operations, and drive innovation. Quantum computing offers the promise of solving complex optimization problems, simulating molecular structures for drug discovery, improving cybersecurity measures, and enabling advanced financial modeling and risk analysis.

In terms of technology, the diverse options available in the market, such as quantum annealing, superconducting qubits, trapped ion, topological qubits, and photonic systems, offer a range of capabilities and performance characteristics. Quantum computing players like IBM Corporation, D-Wave Systems Inc., Microsoft Corporation, and Google are actively investing in research and development to advance these technologies and enhance their commercial viability. Strategic partnerships and collaborations within the industry are fostering innovation and accelerating the pace of technological advancements in the quantum computing market.

The global quantum computing market is also witnessing an increasing trend towards cloud-based deployment solutions. Cloud-based quantum computing platforms offer scalability, accessibility, and cost-effectiveness, making them attractive to a wide range of organizations looking to leverage quantum computing capabilities without the need for significant infrastructure investments. On-premises solutions, on the other hand, provide greater control and security for organizations with specific data privacy and compliance requirements.

As the quantum computing market continues to evolve, there are opportunities for new entrants and innovative startups to carve out a niche for themselves and contribute to the growth of the overall ecosystem. Market dynamics, regulatory frameworks, technological advancements, and end-user requirements will all play a crucial role in shaping the future direction of the quantum computing market. With a growing number of industries recognizing the potential benefits of quantum computing, the market is expected to witness substantial growth in the coming years, creating new opportunities for businesses, researchers, and technology providers to drive innovation and transformation across various sectors.The global quantum computing market is undergoing a significant transformation with the increasing adoption of cutting-edge technologies that have the potential to revolutionize computational capabilities across various industries. Quantum computing, with its ability to process complex algorithms and data at an unprecedented speed, is attracting the attention of not only tech giants such as IBM, Microsoft, and Google but also industries like defense, healthcare, finance, and chemicals. These sectors are exploring quantum computing solutions to enhance operational efficiencies, streamline processes, and drive innovation in their respective domains.

The segmentation of the market based on components, deployment options, technology types, and end-users reflects the diverse and evolving nature of the quantum computing landscape. Hardware components, including quantum processors and quantum bits, are the foundational building blocks of quantum systems, while software and services play vital roles in optimizing performance and functionality. Cloud-based deployment solutions offer flexibility and scalability, attracting organizations looking to leverage quantum computing without heavy infrastructure investments, while on-premises options cater to entities with stringent data security requirements.

Technologies such as quantum annealing, superconducting qubits, trapped ion, topological qubits, and photonic systems present various avenues for innovation and advancement in quantum computing capabilities. These technologies are continually being researched and developed by market players to enhance performance, reliability, and commercial viability. Strategic collaborations and partnerships within the industry are fostering a culture of innovation, driving technological advancements and expanding the applications of quantum computing beyond traditional boundaries.

The market dynamics of the quantum computing sector are characterized by rapid technological evolution, increasing demand for high-performance computing solutions, and a growing recognition of the transformative potential of quantum technologies across industries. Regulatory frameworks, technological advancements, and end-user requirements will all shape the future trajectory of the market, creating opportunities for both established players and emerging startups to make significant contributions to the ecosystem. As industries continue to explore and harness the benefits of quantum computing, the market is poised for substantial growth, paving the way for innovation, disruption, and transformation in the digital era.

The Quantum Computing Market is highly fragmented, featuring intense competition among both global and regional players striving for market share. To explore how global trends are shaping the future of the top 10 companies in the keyword market.

Learn More Now: https://www.databridgemarketresearch.com/reports/global-quantum-computing-market/companies

Regional Outlook

North America: The Quantum Computing Market in North America is driven by advanced technological infrastructure, strong consumer demand, and supportive government policies. The United States holds the largest share due to early adoption and robust investment.

Europe: Europe showcases steady growth in the Quantum Computing Market, supported by strict regulatory frameworks, sustainability initiatives, and innovation-led economies. Key contributors include Germany, the U.K., and France.

Asia-Pacific: Asia-Pacific is the fastest-growing region for the Quantum Computing Market, fueled by population growth, urbanization, and industrial expansion. China, India, and Japan are major markets with high potential.

Latin America: Growth in Latin America is moderate but rising, driven by expanding middle-class populations and increasing awareness of Quantum Computing Market applications. Brazil and Mexico are the leading countries.

Middle East & Africa: The Quantum Computing Market in this region is gaining momentum due to infrastructural developments, diversification efforts, and rising investments. The UAE, Saudi Arabia, and South Africa are key players.

Competitive Landscape

Future Trends— Global Quantum Computing Market

Upcoming Technologies: The Quantum Computing Market will witness rapid adoption of cutting-edge technologies such as artificial intelligence, machine learning, the Internet of Things (IoT), blockchain, and automation. These technologies are expected to enhance operational efficiency, enable real-time data-driven decisions, and introduce innovative products and services.

Consumer Behavior Changes: The Quantum Computing Market will be shaped by changes in consumer preferences toward offerings that are experience-driven, convenient, and personalized. Increasing demand for transparency, digital engagement, and value-driven purchases will push companies to innovate their marketing and product strategies.

Sustainability Trends: Sustainability will be a critical focus, with consumers and regulators alike driving demand for eco-friendly materials, energy-efficient processes, and circular economy initiatives. Businesses are anticipated to prioritize green innovations to reduce carbon footprints and meet stricter environmental regulations.

Expected Innovations: The market is expected to see significant innovations, including smart products, integration of advanced analytics for predictive insights, and development of new materials or solutions tailored to emerging needs. Collaboration between technology firms and industry leaders will accelerate these innovations.

Why This Report is Valuable

This report provides in-depth industry insights that help stakeholders understand the current market landscape, key drivers, challenges, and growth opportunities within the Quantum Computing Market. It offers regional and segment-wise forecasts that enable precise market planning and targeted investment strategies tailored to specific geographic areas and product/service segments.

The report includes comprehensive competitor benchmarking, allowing businesses to evaluate their position relative to key players, understand competitive strategies, and identify gaps or opportunities for differentiation. Additionally, it delivers actionable strategic recommendations based on market trends and data analysis to support informed decision-making, optimize business growth, and enhance market presence.

Top 15 FAQs About the Global Quantum Computing Market Research Report

What key segments are analyzed in the Quantum Computing Market report?

Which regions show the highest growth potential in the Quantum Computing Market ?

What time frame does the Quantum Computing Market report cover for forecasts?

What are the major drivers influencing the growth of the Quantum Computing Market?

Who are the leading competitors in the Quantum Computing Market?

How is market size estimated for the Quantum Computing Market?

What research methodologies are used to compile the Quantum Computing Market report?

Does the report discuss regulatory impacts on the Quantum Computing Market?

Are emerging technologies covered in the Quantum Computing Market analysis?

How does consumer behavior affect the Quantum Computing Market trends?

What sustainability trends are impacting the Quantum Computing Market?

Does the report include a SWOT analysis of key players in the Quantum Computing Market?

How frequently is the Quantum Computing Market report updated?

Can the Quantum Computing Market report be customized for specific business needs?

What are the future opportunities and challenges identified in the Quantum Computing Market?

Browse More Reports:

https://www.databridgemarketresearch.com/pt/reports/europe-pancreatic-cancer-diagnostics-markethttps://www.databridgemarketresearch.com/es/reports/global-diabetic-macular-edema-steroids-markethttps://www.databridgemarketresearch.com/fr/reports/north-america-cannabidiol-markethttps://www.databridgemarketresearch.com/pt/reports/global-wheat-straw-markethttps://www.databridgemarketresearch.com/de/reports/asia-pacific-sports-management-software-market

https://www.databridgemarketresearch.com/fr/reports/middle-east-and-africa-treasury-software-markethttps://www.databridgemarketresearch.com/de/reports/global-hair-color-spray-markethttps://www.databridgemarketresearch.com/es/reports/global-tire-inspection-system-markethttps://www.databridgemarketresearch.com/ru/reports/global-breathable-tape-markethttps://www.databridgemarketresearch.com/fr/reports/europe-in-flight-catering-services-market

About Data Bridge Market Research:

An absolute way to forecast what the future holds is to comprehend the trend today!

Data Bridge Market Research set forth itself as an unconventional and neoteric market research and consulting firm with an unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavors to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process. Data Bridge is an aftermath of sheer wisdom and experience which was formulated and framed in the year 2015 in Pune.

Contact Us: Data Bridge Market Research US: +1 614 591 3140 UK: +44 845 154 9652 APAC : +653 1251 975 Email:- corporatesales@databridgemarketresearch.com

Tag

Quantum Computing Market Size, Quantum Computing Market Share, Quantum Computing Market Trend, Quantum Computing Market Analysis, Quantum Computing Market Report, Quantum Computing Market Growth,  Latest Developments in Quantum Computing Market, Quantum Computing Market Industry Analysis, Quantum Computing Market Key Player, Quantum Computing Market Demand Analysis