Hello:3
posted on my personal blog about hannibal so much that i decided to create a separate one just so i can rant about it cuz i think im gonna get very deep into this gay cannibal shit for a very long time <3
my primary blog is @aggressiveguitarnoises so if u get a notification from that url, then yeah, that's me :) (personal blog, music especially nin based and other interests)
-------------------------------------------------------
rumai/canni/any variation of my url lol ¦ ukrainian ¦ 17 ¦ she/her
ofc expect hannibal on here (nbc for now but who knows!!!)
probably mostly reblogs than original posts? although i do make art but anyway expect:
hannibal quotes out of context (although most of it is on my other blog but...)
hannibal song of the day, music overall (got like 4 playlists just for hannibal,,,, concerning ik but here)
art!!! mostly digital and will be hannibal related (gonna be under rumaiq art hashtag)
hannigram. a lot of it. like cmon that's what the show is about. but other characters too obv
memes
shit posts
prob giving my opinions and thoughts in the hashtags, theyre very elaborate,,
rants about specific scenes or moments cuz i had a mind blowing realisation
asks open for anything(tho preferably hannibal related), including doodles
dms always open too:)
also got myself into a lovely mess of a hannibal rp and I am somehow running jack crawford's blog, @jack-loves-bella !
(there's also a discord server in the post which i highly encourage to join, it is very fun and very active, very friendly I love yall already)
i think thats it for now
enjoy:3
60 notes
·
View notes
barry sloane +au. +characters rec list!
masterlist. socials. recs.
head canons & imagines |
dbf!price boys your age by @captainfern
dbf!price shotgunning his cigar by @inkbybambi
dbf!price sugardaddy; part.2 by @faith369
bf!price headcanons by @empresskylo
landlord!price moving out by @gatorlovebot
husband!price darling wife by @ghosts-cyphera
honesty by @gatorlovebot - John doesn't like liars.
fixing your bad self-image by @sweetiecutie - You’ve been feeling a bit self-conscious lately, so John decides to fuck some sense into your head.
tummy love by @stoutpancakes
truth or dare? by @soapyghost
don't disobey by @jawabear - A risky move on the field leaves the captain less than happy with you.
steady girl by @jawabear - John loves when you help him trim his facial hair. And he loves what comes after as well.
genesis by @moondirti - It’s the first time you truly see him – this much of him, anyway, and he’s startlingly younger than you would’ve thought. The progression of a spite-fuelled relationship.
eye contact by @kungfubarbie101
two is hardly a crowd by @grippingbeskar
how to disappear by @fawnpires - After a failed attempt at a date, you unexpectedly find yourself in the hands of comfort of your dorm-mate, also known as your captain.
bartender by @sky-is-the-limit
rings by @glossysoap
what’ve you done this time by @captainfern inspo; @bleuu-moon
just the tip, love by @floralpascal
home is the feeling of you by @maryangelex - You’re Price’s fiancé back home and it’s been months since you’ve seen him. He’s been on deployment and days have been getting lonelier the more days pass. Until you get home one night from work to a more than pleasant surprise.
taking his time by @empresskylo
neighborly advice by @sky-is-the-limit - Your neighbor price takes matters into his own hands to finish what your incompetent ex could never. all in the name of good neighborly solidarity, of course.
cigar smoke and good sex by @lxvvie
helping hands by @deathsimage
break the rules by @bonitanightmxres - Months after breaking up, you and price agree to a “no strings attached” relationship to fill the void in your lives—but it proves to be harder than anticipated when you both start to catch feelings again.
how you deserve by @manmuncher777 Inspo; @sky-is-the-limit
fics |
never let me go 5/5 by @maryangelex - You worked at a coffeehouse, your life is filled with mundanity and you wouldn't change it for anything else. That is, until one crisp autumn morning, you meet the handsome Captain John Price and there’s an immediate, undoubted connection between the two of you.
neighborly 5/5 by @391780 inspo; @hereforthepedrofanfic - You and your neighbor, john price, slowly getting to know each other over the holidays.
the rear window 5/5 by @391780 - spinoff! neighborly!pricepov stalker!price.
soft 9/9 by @391780 - Soap says dumb shit in a bar, Captain Price falls in love with a fat girl.
Songs That Sound Like Sea-Foam 2/2 by @halcyone-of-the-sea - fisherman!price x mermaid!reader.
take me home, country road 5/5 by @ceilidho - 1800s!price. reader flees to his town where Price is the sheriff after a murder in her previous town. only to be mistaken for the mail order bride that Price just sent for ….and he’s not interested in hearing any of her excuses when she tells him that he’s got the wrong girl
callsign: zero 12/12 by @cass-the-mess - 2 years ago you saved John Price from an untimely death, only to disapear without a trace before he could thank you properly for getting him back home safe. You show up again 2 years later to help the task force defeat a new enemy. Tensions rise as you show your true colors and navigate through unresolved issues that puts you and your new team at risk. Are you willing to finally open up or do you keep pushing everyone away to keep yourself "safe".
marigold 7/7 by @captainfern - dadsbestfriend!price (pretty much anything and all things from this masterlist.)
disclamer! none of these are my works all credit to the authors. I just loved them so much figured I'd give them a shoutout!
1K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
making Hamlet fanart in 2024, slapping Juicy (main hero of Fat Ham, a modern play, Hamlet version, played by black fat queer person) on char design i saw in old b&w film while listening MCR playlist was an experience
highly recommend. also pls watch/read Fat Ham
upd: image description added! (in alt text, but also under the cut)
(Image Description:
List of sketches with 3 drawings. The textures used here are elegant looks-like photo silk (for clothes), soft shades and gradients. Shapes are sinking in each other depth. No color, black and white
It's fanart depicting Hamlet character being combination of different versions of him from different media: fat black queer masculine person being elegant, wearing mascara and lipstick (took from modern play Fat Ham) wearing vintage royal clothes (took from old classic film). The narrative of sketches also mixed of modern play (Fat Ham) and classic one
There are 3 sketches:
First one. It's the character described above (TC in text further) sitting in side view. His eyes is closed and face has melancholic emotion. TC is holding a scull. There is a simple-shaped silhouette of crown above his head. This image represent classic play melancholic vibes of character fused with modern play appearance
Second sketch. It's TC singing, while holding white pigeon in hands. It had previous classic-modern fusion vibes + a little vibe of disney princess song (because of bird and emotion expression similar to disney musicals). By left side of this sketch is stylized speech babble with music notes symbols and deformed text, visualization of singing. The text saying: "I want a perfect body", quoting singing of TC from modern play. By the right side of sketch there is arrow pointing at character with text "has most perfect body ever".
Sketch Three. It's dynamic sketch of TC in a duel (opponent is out of the frame), waving a thin sword (idk how it in eng, in my first it's шпага, a sword but specific type of it). From the chest of TC it's going steam, like character is heated mechanism pushed to limits. The face of TC is strong and determined, with mouth wide open trying to catch breath. Near this sketch is text: (text starts here) "He is fat and scant of breath" - original play quote. i know Fat Ham message. this one [the sketch with duel] here for slay jpeg reason (text ends here).
End of Image description)
566 notes
·
View notes
Fractalize (part 1)
Title: Fractalize
Fandom: Hunter x Hunter
Summary: Lack of hope creates a strange kind of numbness.
Word count: 3700+
Characters: Chrollo x Reader (female)
Notes: yandere Chrollo, kidnapped, depressed and miserable Reader, Reader is dissociating a lot, morbid pondering, suicidal thoughts, explicit/triggering language/words, Reader's thoughts on possible sexual assault in future.
Part 2
Fractalize - making things into smaller copies of themselves over and over again.
Sometimes you stand in front of a mirror and try to picture yourself in another timeline. One where your life didn’t take this specific turn. You try to imagine a different setting, a different apartment - perhaps the one you had before Chrollo started moving you around like a luggage bag. Maybe living in a cottage by the sea or an old farmhouse. Someplace rural, peaceful. With a garden and fresh air, far away from the city noises.
It's difficult at first, your reflection keeps slipping through your mental fingers every time you think the image is set in place. But with practice it becomes easier, sort of, so you can now see yourself clearly as you brush your hair - not here.
A blue dress on, made for nights at parties with friends. Laughing until your stomach hurts and eyes become sore. Making silly faces over alcoholic beverages. Or you can wear your favourite jeans with a high waist and head out to the pub, the same one with crooked stools and a broken sign. Drink cheep bear, eat greasy peanuts from a little bowl, listen to some small band play unknown and unheard songs.
Leave intoxicated, and everything is too fast and vibrant and wonderful until you're back home.
It's your favourite pastime now: imagine, remake and slip.
Imagine. Remake. Slip.
You don't quite remember the last time you laughed, a month ago maybe. Maybe more. Lack of hope creates a strange kind of numbness, dull, cold, you would compare it to a winter plastered all over your insides, but it's almost colder than that. It freezes everything and turns it into icicles hanging off the roof.
Remake, slip.
You have new vocabulary now.
"Mm" - is for when he asks you if you like a dress or a top and it doesn't matter how you actually feel about it, because it's going to end up being worn anyway.
"Okay" - is for when Chrollo sets another fancy meal for you on a dinner table and "Eat, don't be shy".
"I'm not hungry" - doesn't work with him, even if it's the truth. You always eat what's put in front of you, that's the rule, because he's not above shoving the spoon into your mouth, so you spare yourself the tears and sobs that will probably come with that. It's so bizarre: how much effort he puts into keeping you alive when you're anything but.
"Whatever you want" - is for when he asks you something that requires a choice, between two or three options usually. He's not one for an extensive list.
"If you say so" - for everything else.
You used to delude yourself with the idea that if you managed to appear pleasant enough, pleasant-talking, pleasant-listening, smiling a bit here and there, it would gain you some privileges and perhaps a bit more freedom. It did. But never where it really mattered. Those little things were absolutely inconsequential in the grand scheme. Yes, you can have that sweater, dear. No, you can't have your own bed. Yes, you can come shopping with me, if you give me a kiss. No, you can't take walks without me holding your hand.
Yes this and no that.
Those moments were fragile and so very takeable that they didn't give you any sense of accomplishment, just a short respite and bitter aftertaste that made you feel pathetic.
Wasn't worth it.
***
"Do you like animals, dear?" Chrollo asks out of the blue one day. He's reading something on his tablet while you're curled up on the couch, watching TV.
It's a new series that's been on the major channels for a few weeks, a mystery drama about a girl who moves into a house she inherited from her grandfather. The picture provides a distraction enough to have you forgetting where you are for a brief period three times a week.
You pull the blanket higher. "I do."
He knows it.
The girl on the screen finds a mysterious box hidden in the attic. Perhaps there's something valuable inside. Or information about her grandpa; your fingers tug on a loose blanket thread without much thought.
"What kind?"
Or maybe it's just a time capsule with photos and postcards and random objects collected over the years.
Or-
You had a cat before he took you. A foster grey ragdoll with blue eyes who liked to rest on your belly and bump her head against your chin. You called her Miss Whiskerton and kissed her little nose, because she did act like a proper lady - poised, dignified and entirely too proud to eat food mixed with medicine. The worst enemy Miss Whiskerton has ever had in her cat life was the corner of your couch. When you weren't paying attention, she would dig her claws into the fabric and leave thin lines. You hope that someone took her in.
She probably thought you abandoned her.
"Cats."
Chrollo hums in acknowledgment and continues scrolling through whatever he's looking at - maybe news or auction listings, you don't know nor do you really care. You shift under the blanket, pulling your legs closer to your body.
"We can get one, if you'd like."
"No."
Your answer is immediate and short, without thinking. You know it, you know him by now - there's nothing Chrollo does out of spontaneous generosity, it always benefits him in some way. And you've studied him enough to figure that any pet would only be a tool to keep you tamed and compliant. Puppies make life better. Happier, lighter, with goofy smiling faces and wiggling tails. Cats make life better with soft purrs and paws stomping on your chest. They're too easy to love.
"Why not?" There's a sound of tablet set on a wooden surface.
The girl on the screen is trying to solve a combination lock on the box when the TV switches off and your little world of carefully shot scenes and scripted lines vanishes. You don't need to turn around to guess where's the remote.
She almost had it, but now you won't know what's inside until Thursday evening.
Your reflection stares back from the dead screen, blank-faced and with a blanket pulled up your nose. It tickles a bit. "Because I don't want one."
A chair creaks. "Why?"
You close your eyes shut for a moment before opening them again. This is tiring. Always probing, digging, pushing. Trying to find chinks in your armor, but all you're wearing is just a flimsy dress with thin straps and a blanket you wish could swallow you whole.
"Don't need it."
"You said you like animals," Chrollo sits next to you and places a hand on top of your covered legs. He squeezes your thigh and you stare ahead, wishing he would just leave you alone tonight.
"I do." Your fingers twitch under the blanket, nails scratching at the fabric.
Strange. Sometimes it feels like he understands perfectly that you want to be alone, have time for yourself and don't want his constant physical presence. At the same time Chrollo brushes this all aside like old tin foil wrappers - insignificant. He pulls the blanket down and you cling on it stubbornly for a few seconds before letting go. His thumb and index finger grasp your chin and turn your face towards him so you have no choice but to meet his eyes.
There's such still intensity within him that made your skin crawl whenever he looked at you with this much focus and attention. You don't know what he saw there most times, it used to be fear or anger or sadness - right now it's none of these things. Everything inside you feels jammed and stiff.
"We should get a fish then," he continues, brushing hair out of your forehead. "You can watch it swim around, wouldn't that be nice?"
Chrollo talks to you like this sometimes, as if you're a child who needs to be convinced to eat veggies or take medicine. Like you're simple-minded and he's reasoning with you out of good will. It's sickening. You hate it.
"I don't want a pet," you repeat the words slowly. "If you're going to give me something only to take it away, then I don't want it."
His finger leisurely stroking your chin pauses at the edge of your bottom lip. Something flickers behind his eyes, it's barely noticeable but you've become good at catching those minuscule shifts. He smiles, yet there's nothing joyful about it. "Take it away? Why would I do that, dear?"
"Because that's what you do. Because that's how you are." You don't try to pull free from his hold, he'll only tighten it; not enough to hurt, no, he is too suave and polished for that - or wants to appear so - but enough for you to feel trapped under his palm.
There's something off about you, you can tell, but are not quite able to discern what or where. It sits in the very structure of your bones and eats away with ravenous appetite. An imbalance in the gut. Fever-warm body, cold fingers. Thoughts like potholes.
"And how am I exactly, according to you?" His voice is light, playful, a stark contrast to his eyes that study you with unnerving precision. Chrollo rarely loses his temper and never gets violent with you (yet, you correct yourself), but he has other ways of expressing displeasure, and they're petty, ugly and cold.
"Cruel," the word rolls off your tongue so effortlessly that almost frightens you; it's easy to tell the truth when you're this numb.
He looks taken aback for a split second, and the smile freezes. His hand stops midway to your hair. Then everything's gone.
Chrollo releases you and leans back into the cushions, almost thoughtful, like your observation is something that requires careful consideration.
"I suppose, it depends," he says finally.
"On what?"
"On how you choose to see things. Your perspective is bound to be biased, dear."
You don't respond.
To continue this conversation would be pointless and circular, like running on a treadmill, like everything else between you and Chrollo, really. He simply has too many answers to any possible argument, and no matter how convincing you manage to make them sound, he'll poke holes into each one. You don't want a fish. Or a cat. Or a dog, a bird, anything that moves and breathes and looks at you with big, trusting eyes.
Chrollo is cruel. Not in a way that's straightforward and brutal. Not in a way of someone who'd tear your limbs apart or rip off a fly's wing to see it wiggle. You have no doubt that he is capable of such a thing, but that would be uncouth. Cruelty in his case is a quieter, more delicate affair - in a way of a sculptor who'd chisel off everything unnecessary and unneeded, no matter the size or significance, to produce something entirely his.
His hands are soft, his voice is always composed, and he wears well tailored clothes. But the rest is sharp, clean and merciless.
"I think I'll go to bed," you say and push away the blanket.
"It's early."
"Mm."
He takes your hand just as you're about to slide off the sofa. Chrollo's always faster than you, always ahead and always observing, and that little realization while bitter is not so shocking anymore, more like another fact that you file away from your interactions.
You watch him. Wait.
"You're distraught," he says. "But you should know by now that there's no need for that."
Your hand remains in his grasp, limp and heavy.
"I don't enjoy seeing you upset, dear. Even more if you make false conclusions."
You turn to see the expression on his face - and there isn't one, at least not the type that most people would make. There are no frowning eyebrows, no clenched jaw that would indicate irritation, nothing like that.
"You're giving me too little credit," his tone is quiet as he runs his fingers up and down your wrist. "My intentions are not to hurt you. They are much, much sweeter than that."
"But you would," you say quietly and lean closer, ignoring the obvious implication behind his words. There is a hollow sensation inside of your head that prompts you to speak, everything is hollow - body and mind, heart, the space in your guts, your throat. "You would hurt me, if that's what you thought was necessary. Rip me apart and leave me deformed beyond repair, to fit into whatever framework you've laid, you would do that."
You're not being deliberately cryptic or fatalistic. These are your observations, based on a period of months spent together. They take root in no one being there for you anymore, in your phone which is long gone, in your closed accounts, your missing laptop and old clothes, the entire previous life in the city that has been discarded for something new. Chrollo was very methodical, you can give him that.
He doesn't listen, he studies your responses. Every single word. He has a talent for that, for absorbing everything about you while hardly ever letting you glimpse his interior - all that you know about him are tiny slivers which you picked up through living together, observation, accidental bits.
You expect him to contradict your statement, to offer a logical explanation why you're wrong, but instead Chrollo brings your hand to his lips and presses a kiss against your knuckles. The touch is light and dry.
"You're not entirely wrong, dear," he says and moves closer until you can smell his aftershave, something fresh.
His proximity is uncomfortable, it always is and probably always will be.
"I'm right then," you say.
"No," he keeps your hand in his grasp. "But you're not entirely wrong either. That's what makes you interesting."
There's a strange kind of fondness in his voice, it's subtle, yet undeniably present. You've never felt less interesting in your life, in a dress with thin straps that's too fancy for a lazy day at home and your bare feet and tangled hair.
"If you say so," you respond and slowly tug your hand free. "I really want to sleep now."
You get up, and he lets you go without another proposition. The blanket falls off onto the sofa, and before you slip into the semi-darkness of the bedroom, he says,
"Not beyond repair. But I like to believe we can both agree it doesn't have to come to that."
***
The drive feels endless. Houses and streets blur in a mix of colors, shapes and people, which soon change to an empty highway with greenery on both sides. Trees and fields, tall grass swaying gently in the wind and rare cars passing you by. Chrollo's hand is resting on your leg; he hasn't moved it since the car started, but you choose to ignore it in favor of your regular pastime, the one that's made of imaginary worlds and places where the timeline stretches differently.
Mostly it's just you and the layout of your fake apartment.
Imagine, remake, slip. Repeat the steps until it becomes muscle memory.
You have this daydream on loop now. Wooden floor and wide windows, lots of sunlight. Books everywhere, comfy clothes and not a single skirt in your closet. A cup of tea with honey in the morning, and Miss Whiskerton curled into a soft grey ball on your lap. You feed her salmon in a shiny bowl, occasionally she catches a lizard outside and drops the tail on your doorstep as an offering, looking immensely proud of herself.
A smile slips on your face without meaning to, a wobbly thing; you promptly wipe it off.
It would be a crime to show such blatant joy. This fantasy has become so sweetly personal that every fiber of your being resists even acknowledging it in front of Chrollo. He can sense a stray happy thought from miles away, like a hound, and will never stop prodding until everything is raw and tender. You've learned to say less in his presence, especially if it's something that has you invested. Chrollo knows how to pick things apart.
You lean your cheek against the glass. This world would never happen, never in a million years, but dreaming doesn't hurt anyone, does it?
Your grandma, wearing an apron, sets a tray filled with fresh pastries on a table, because she's amazing like that. She fusses and worries and pretends to scold you. For not calling enough, for not coming sooner, for not eating well. For leaving.
"Dear."
You almost jump.
Chrollo's voice brings you back where his hand is heavy on your leg, you're wearing a dress above the knee and aren't allowed to use scissors or knives.
"Mm?"
"That frown of yours," he says, turning into a small road. The surroundings change again, it's quiet here, not a soul in sight. "It's been there for fifteen minutes now."
You sit up straight and move your hair out of your eyes. Chrollo's a perceptive one, so this is a reminder not to sink too deep around him, unless you absolutely need it.
"Was just thinking."
"You do it a lot lately," he states and looks at you from the corner of his eye.
True, but you have no intention to confirm it. First, he won't like the reason behind these thoughts. Second, he will dig and try to worm his way in. No. Most of what you've been fixating on, staring out of the window like a mindless drone, or reading and rereading pages that you barely grasped, would fail to create anything more complex in his heart than desire to pull it out.
For whatever twisted reason, Chrollo cares for your well-being, or, more precisely, your acceptance of his advances. Yet his way of caring isn't nurturing in any sense.
Chrollo's interest (you don't dare call it love) is crushing, too heavy to carry - he'll find what troubles you and "fix it" in way that will twist it into something pathetic. Something that shows how you have nothing else to cling on but him. You're not stupid enough to keep falling into this trap. Being a slow learner doesn't mean you don't learn at all.
He's done it before. He'll do it again. So you reply, "I haven't noticed."
His thumb rubs circles on your thigh; you press your shoulder against the car door as if hoping it might open. It doesn't, much to your disappointment.
"What was on your mind then?"
Something you shouldn't tell him, that's for sure. Chrollo's watching you, even if his eyes are trained on the road.
"Random stuff," you say. Half-truths, half-truths are safe. "A weird dream I had this morning."
If you bothered to look, you'd see a raised eyebrow and the faintest hint of amusement at the corners of his mouth. You don't.
"Tell me."
You hate when he does that.
"It was boring."
"I'm interested in anything that made you so pensive."
Chrollo likes conversations with you, even if they're short. You can tell that he does, or he wouldn't be trying to make you talk and getting subtly frustrated when you choose not to. It never shows outright, Chrollo is very gifted at keeping his calm exterior, but there are certain giveaways like the slight tightening of his hand, an emphasized "dear", a pause here, or a quiet exhale through the nose. You could make a list out of these.
If you ignore him, he gets quiet and handsy or petty enough to throw away the only dress you feel comfortable in. Stop bringing you new books. Take you to places you hate.
It's always the small things that kill you, not the big, dramatic ones. The devils in the details.
"There was a lizard," you begin, and he hums in response, prompting you to continue. "It was cute with brown spots and a tiny tail."
Lies weave themselves easily, intertwine with truths and turn it into something that resembles a story.
"It was sitting on my windowsill and I wanted to pet it. A cat came out of nowhere and almost ate it, then I woke up. It's a silly dream."
There. Nothing to dissect here, not that you can see. Just a nonsensical dream, filled with random happenings and strange emotions.
"And that's why you frowned for fifteen minutes?"
"Yes, I got sad."
Yes, you think. Yes, Chrollo. I frowned, because I care for the damn lizard that doesn't exist, an animal from a dream. A stupid musing, nothing special, a very mundane and simple thing, because people do have silly dreams sometimes, and it's not a crime. It's not a crime and has nothing to do with that fact that I have a whole dream world where I'm not with you in my head.
"How peculiar. You never struck me as the type to get upset over something like this."
"You never asked," you respond flatly and Chrollo's hand on your thigh moves an inch.
It brushes up, closer to where you really, really don't want it to be, so you squeeze his fingers hard and redirect them to the curve of your knee.
"True," he says after a pause, not sounding too bothered. A month ago you would've brushed his hand off completely, probably that's why. Chrollo is convinced that with enough patience and effort he'll be able to close that final barrier between you both. Time, coaxing, a dose or two of endearment, some carefully calculated touch - but you'd rather stick a knife through your ribs than have sex with him. Or his patience will simply run out and he'll rape you. You're not delusional. Not a fool. "Well, that can be fixed. I'll make sure to ask about your dreams more often, dear."
You lean back into the seat and stare ahead, this time without anything pleasant on your mind. Of course he will. Of course he'll take this as a sign to dig deeper and invade that small bit of solace, Chrollo can't simply co-exist. He wants it all.
"Mm," you say.
Your new vocabulary is such a handy thing.
668 notes
·
View notes
where is the most likely place for a bunch of iterators, slugcats, and ancients to all hang out and take a selfie together?
a wallmart parking lot, of course.
and yes i misspelled that on purpose
tumblr has absolutely killed my image quality hgvcvghjjhb so clicking on it will hopefully make it look less terrible
this was supposed to be finished a while ago but IM JUST GLAD I ACTUALLY GOT IT DONE. IT'S DONE. FINALLY.
a few weeks ago i decided that i wanted to give back to my favorite people on this site. my friends, mutuals, the people who inspire me. everyone who has made my venturing onto this website and into this fandom the absolute highlight of my year. i wanted to have a way to say thank you to the people who motivate me to keep creating.
so.
thank you, everyone. whether i included a character of yours in this drawing or not, thank you. thank you all for creating what you create, for the chaos that you cause, for being so kind. i love you all so much.
CHARACTER LIST (32 in total)
Ashes from Above -- me!
The Fidget & Spectrum of Colors -- @pookapufferfish
Four Shiny Reeses Wrappers & Butternut -- @kakyogay
Looks to the Moon design -- @ssagesaurus
Anthro Monk design -- @draagu
Lingering Fog -- @mothsakura
Eight Crashing Tides -- @dustyfandomtrashbin
Paths Left Untaken -- @fauxbia
Sliver of Straw design -- @skybristle
Ancient No Significant Harassment design -- @tanzytechgem
Reluctant Abstinence -- @copepods
Saturn's Foley -- @csavii
Adamant Dune -- @druidshollow
Three Star Songs -- @skyistheground
Curtains Drawn Over Bone -- @bitsbug
Unparalleled Innocence design -- @shkika
Three Sparrows -- @spotsupstuff
Anthro Artificer design -- @pansear-doodles
Flickering Nightfall -- @flickering-nightfall
Somnium of the Deep -- @stratusstormcloud
Five Pebbles design -- @lyss-butterscotch
Distant Frontier -- @daszombes
Original Seven Red Suns & Spearmaster designs -- @faelingdraws
Eleven Rivers -- @druidshollow
Chasing Wind design -- me again!
Smoke Upon Droplets of Rain -- @mothsakura
Rot x Enot x Lizard Polycule -- @excessive-moisture
563 notes
·
View notes
Treasure Planet X Wings of Fire
Here’s some smaller screenshots with movie screenshots in them as well. Keep in mind I drew all of this after the watching movie I wasn’t really using references so it’s not like they’re a bajillion percent accurate
I drew all of this while listening to Epic the musical, and it was on the last song for Mr Arrow and bones, which is why they aren’t the same detail
[ID: (in order of the singular images) 6 wings of Fire dragon references and two headshots, all digitally sketched in a red pencil-like brush. Each dragon is heavily referenced off some characters from the show Treasure Planet. Bedside each dragon is written the character they’re based on and the Wof tribe the dragon design is also based on. Each singular image has the dragon, it’s info, and an image of the character it’s based on.
The first dragon is a heavy set MudWing based on John Silver. His right legs and wing are mechanical, heavily based on the cyborg parts of the movie character. His wings are semi spread, held above him but curved so that they aren’t fully spread. He wears a captains hat that looks small on his head and has a large tail that has a scarred end, as if it were cut off at the very end. A small hoop earring is on his short ear, and his horns seem to have been sawed off halfway, given a flat cap over the end of them.
The second is a much thinner and lankier dragon based on Captain Amelia. She is listed as a hybrid of an icewing and a sandwing. Her wings are folded at her sides, showing off the frill had follows along her spine. It breaks apart in some areas, becoming small quills behind her head and neck and on the end of her tail. Her head is thinner, with sharp ears perked upward. A larger captains hat stands on her head.
The third dragon is another Mudwing based on Dr. Delbert Doppler. He is dwarfed by Silver, despite being the same tribe. His stance is less wide than Silver, though he also has a blockier head and shape. his wings are semi folded in the same way, though tilted a little upward. He has small glasses on his face and darker spikes and horns along his face and the back of his neck. Ears are rounded and folded over halfway.
The fourth image has two dragons which seem to be arguing. Furthest from the screen is a huge but lanky Sandwing. Based on the antagonist Mr. Scroop. His wings are outspread and the membranes are shown to be in tatters. A talon is outstretched toward the screen, curled like he were preparing to hit the smaller dragon in front of him. His face is thin but showing a wicked snarl, long horns jutting outwards opposite of his snout. A spiky frill lines the back of his head and down his spine. His ribcage is a pronounced shape, not in the way that he’s starving but to show how thin and lanky he is. His tail curls behind his feet and points its scorpion like barb directly at the chin of the other dragon. The other dragon is nearly half his height, facing toward Scroop and away from the screen, face in an open snarl with his ears pinned backwards. He is a Nightwing Skying hybrid based on the protagonist, Jim Hawkins. His wings are touching the grounds at his sides and the ends folded upwards. Spikes line his spine from neck to tail, which curls around him like it was mid-flick.
The fifth image is a side profile headshot of an old and thin looking Seawing based on the old and dying character, Bones. He has an underbite, large webbed frills along his head and spine, and catfish-like whiskers on his chin. small sharp teeth are visible on his closed mouth, and his horns look to be broken off.
The sixth image is a 3/4ths headshot of a thicker Nightwing with a wide nose and chin based on Mr. Arrow. His face his scrunched in what looks like a grimace. He has short but big horns, and spikes that stick out from his spine along his neck. A thick captains hat sits on his head.
The final image is a full body reference of a robot made to look like a rainwing. He is based on B.E.N. He is 3/4ths facing the screen in a sitting position, with a wide mouth open in a grin. Mechanical frills on either side of his head are open wide. His winds are semi open and pointed outward on either side, showing that they have minimal ‘membrane’ as if he wasn’t built for flying. His chest has a circle in it, which resembles the broken compass the character has in his own chest.
End ID]
Woaaah that was a lot of writing 😂
149 notes
·
View notes
"something floral": literature student blabbering about the usage of flower symbolism in "nevermore", how it ties to the theme of insanity and a little bit (a lot) about shakespeare.
from lenore's perspective, flowers are closely associated with isolation caused by her trauma and supposed "hysteria". floral pattern wallpaper accompanied her loneliness for days, months, even years. image of the flowers signaled that lenore's position would remain unchanged, that she was stuck, that she would continue to slowly loosing the clarity of her mind.
having torn the wallpaper off the walls, lenore believes that she will never see this image again, but flowers continue to accompanying her. lenore sees them again during her first meeting with annabel lee. and during the last one, too. she may have managed to get out of her lonely room, gain more strength in her legs, find a new friend, but lenore is still trapped. she's the daughter disowned by her parents, a stain on the family reputation that must be hidden forever. the image of flowers doesn't let her forget about it.
similar symbolism is also not alien to annabel lee. episode 66 is interesting in particular, because it directly quotes ophelia's monologue. I'm a big fan of shakespeare, it was he who instilled in me an interest in floral symbolism. a year ago, for a conference on foreign literature, I wrote an article about flower language of "hamlet". it's not available in english, but I'll list down some points that I considered relevant regarding "nevermore".
• rosemary can serve as a keepsake between lovers and also between the dead and the living. it could be seen at both weddings and funerals. in the old days it was also believed to be helpful in mental illnesses treatment.
• pansies, just like violets, symbolize innocence and devotion. ophelia doesn't consider the people around her worthy of violets, since she blames them for the death of her father.
• rue is a symbol of eternal suffering; grieving over her murdered father and the loss of her beloved hamlet, ophelia leaves some of the flowers for herself.
• the image of daisies has a close connection with the concepts of innocence, fidelity and eternal love. in shakespeare's tragedy, this symbol is overshadowed by the fact that in the world around ophelia there's no place for these beautiful things. for "nevermore" the symbol is also not so positive, since the readers are already familiar with daisies. they were on that wallpaper in lenore's room.
it's impossible not to note that annabel lee recites the monologue while in the bath, in the water. ophelia decides not to resist the river flow. her life turned into a tragedy: she was left without a father, her lover has seemingly lost his mind. her own sanity is also called into question. ophelia sings cryptic songs, goes into the field to weave a wreath, gives flowers to other characters. in the eyes of those around them, hamlet and ophelia seem crazy, while being the only sane and honest people among them. there's no place for tender, innocent ophelia in a cruel, deceitful world, so she drowns.
annabel lee also reflects on how both she and lenore are considered madwomen. her meeting with "leo" is accompanied by floral pattern on the annabel's dress. their madness is contextual, they both are perfectly sane, but don't fit into the system that could be leading to real madness with time. "all madwomen die twice. at least twice".
now about the arboretum. it obviously has a lot of flowers, but in my opinion this place is interesting in a different context. lenore and annabel visited the arboretum twice to discuss upcoming plans and such, and there are many parallels, both visual and narrative. not much time has passed since last time, but their situation has changed. they seem to look on their past selves from the upper level, having their conflict more acute now. I'll make a more detailed post about it later.
and now I'll just focus on how the characters in this arboretum full of roses behave as lost and confused as in the phobia-inducing flower labyrinth from earlier episodes. “the closer you get to beautiful flowers, the closer you get to their thorns,” says duke in episode 38. the flower imagery haunting the main characters doesn't let them forget that their sanity is always on a verge of slipping. and once a flower falls from its stem, it cannot be fixed.
p.s. guess which writer’s works I chose for a new article this year?
335 notes
·
View notes
ok fine, wyllstarion rec list
the demons bade me write this. i have a lot of Thoughts and Feelings and a fabulous bookmarks list. come with me....and you'll be.......in a world of pure wyllstarion nation
note that this is like. an intermediate/advanced, 201-level list. i am trusting you, and assume you've already read asidian's body of work. you've read nothing is safe. you're reading Nothing Like the Sun &etc. Really anything that appears on the first two pages when sorting by bookmarks/kudos is disqualified due to pre-recognized excellence. (you could, however, go read them again)
are you back? good. now read:
"We Happy Few" - @geometea. listen to me. listen. i am looking deeply into your eyes. read this fucking fic. it's hard to shill without spoiling anything, BUT: wyll is a still-pacted grand duke. he used to have a bunch of unresolved romantic tension with astarion and now hasn't spoken to him for 15 years. now take that premise and add body horror, beautiful ominous surreal images, and SURPRISE BIG EMOTIONS. just trust me on this one, guys
"Crossed Blades" - @rebelontherocks. this is a...i think i have to call this a cozy sex romp. wyll and astarion are married, wyll is a busy duke, astarion needs more enrichment, astarion invents a very silly sex game by roleplaying teenage-wyll's smut books. wyll is So Deeply Into It. i love this fic for its characterization, its banter, and its commitment to paralleling character psychology to what sounds like an absolutely wild in-universe smut series (that is sketched with an impressive amount of detail and care tbh??).
"Comfort" - @acephalouscreature. short and sweet. wyll is injured and everyone expects astarion to take care of him. luckily, astarion has a dastardly plan to fake feelings for wyll by thinking about his feelings for wyll. you sure fooled them, astarion!! also featuring: astarion trying to figure out how to comfort someone by thinking about horses
"False Compare" - @jellyfishline. i'd recommend checking out their work generally, but i fell in love with this one first. wyll writes a sonnet! astarion is mean about it until he isn't! deeply in-character with an emphasis on how each of them communicates affection. gorgeous prose
"how to escape the torment nexus" - @ushauz. this series is incredibly unique, set in a fucked-up bad end where wyll is a lemure, astarion is still on the run from cazador, and almost everyone else is dead. where this really shines imo is wyll's POV: he's been through literal hell, doesn't remember his life, and is wading through his unconscious attachment to astarion like a foreign language. (side note also read Heart of Stone for a great lae'zel character piece)
"An Acorn in the Moonlight" - @anonyhex. this is one of the first wyllstarion fics i ever read and it has a special place in my heart!! it's particularly cathartic to read for Wyll reasons, including him actually getting to Have Emotions about what Ulder put him through. and they are so sweet with each other!!
"temporal displacement" - @purplecatghostposts. ok this came out like. yesterday but listen, i LOVE outsider pov of an astarion who's learned to show affection somewhat, seen from the eyes of someone who doesn't know his history and has no reason to suspect All Of That. and when that "outsider" is a dying 20-year-old wyll who just saw astarion step out of a time portal. well.
"nothing to make a song about" - themortal. for when you want something meaty and casefic-adjacent, set in a post-canon where wyll is the blade and not the duke (for once). contains bonding on the road, getting romantically snowed in together, and Symbolic Fetch-Quests.
i am also watching closely: "One of Those Prince-Types" by @lesbianralzarek and "sigh no more" by @tomorrowsrain. both are one chapter in and promise to be meaty, with execution that already feels very very promising
SPECIAL MENTION TO "Like Death (or Birth)" by The_Dancing_Walrus, which has some fraught implied background wyllstarion and is just generally completely baller. astarion kind-of sort-of accidentally adopts yenna, who got fucked up by her time as a potential sacrifice to bhaal. it works! i promise it works
182 notes
·
View notes
Hesokuri Wars Archive Masterpost:
Hi, guys! Hope you've had a good, or at least somewhat decent, 2023. I can't believe it's been well over a year since Hesokuri Wars officially shut down. Time really flies, doesn't it?
Despite how long it's been, I've been feeling a little nostalgic for this franchise lately. As much as this blog ended up neglecting its duties during the year leading up to the game's shutdown, I kind of want to make up for that by helping with its preservation. Others have already committed to doing so, but I think it'll help a few people if there was a single post consolidating everyone's efforts, so here we go:
Basic / General:
The Osomatsu-san AU Fandom Wiki has a page dedicated to listing the various Hesokuri Wars AUs, all of which have their own wiki pages with images
Tumblr user @/denkimystery has a pretty extensive catalog of information related to the Denki Mystery AU in Hesokuri Wars, including but not limited to a basic run-down of the characters, translations of the character descriptions / event stories / attraction buildings, and a timeline of the overarching story
Added 12/3/2023: Another good wiki to use is the Hesokuri Wars Wiki on Gamerch, though it's (possibly?) incomplete and in Japanese (credit to @/snowimatsu for providing!)
Sprites / Assets:
A comprehensive, albeit incomplete, catalog of assets (character sprites, backgrounds, resumes, etc.) courtesy of Tumblr user @/osmt-hkw (original post)
Added 12/3/2023: Another rather comprehensive (unsure if complete) catalog of character sprite assets uploaded to The Spriters Resource by user Biggest_Chungus (credit to @/snowimatsu for providing!)
Event Stories:
A playlist featuring a variety of stories from the game (untranslated) courtesy of Tumblr user @/mallowkey (original post)
Added 12/4/2023: Tumblr user @/ngmatsu has translations of some of the older events (2016 - 2019), as well as some miscellaneous information on other sets provided via asks
BGM / Music:
A playlist of most(?) of the songs on the Hesokuri Wars Original Soundtrack courtesy of Tumblr user @/snowimatsu (original post)
Another playlist of most(?) of the songs courtesy of Tumblr user @/doctorjoshua64 (original post)
Added 12/3/2023: The downloadable soundtrack to the 2019 Hesokuri Wars CD soundtrack uploaded to KHInsider by user @/Stanky_Cat (credit to @/snowimatsu for providing!)
If anyone else knows of any other links that serve as a catalog and/or archive of anything Heso-related, please let me know!
🐾 Mod Ichi
212 notes
·
View notes
Please could you do Will Graham x fem reader where she's kidnapped by him but he treats her so well? Like he is madly in love w her and even tho she doesn't like being kidnapped, she accepts her reality and starts to get along well with Will? And he's happy because maybe she can start feeling the same that him.
Smut and fluffy/angsty please! I love your work
►PAIRING: Will Graham X F!Reader
►UNIVERSE: Hannibal
►WORDS: 1.1k
►SUMMARY/PROMPT: See Above.
►SONG INSPIRATION: Obsessed by Elle Lexxa
►TRIGGER WARNINGS: Angsty Reader | Fluffy Will | Unprotected Vaginal Penetration | Acceptance of situation - Stockholm Syndrome | I may be missing some, but you get a general idea, so please proceed with caution if there is anything in there that is overly triggering please let me know politely and I will make sure it is added to the list.
►NOTE: Hello Anon Requester and Reader. So in a previous post I had stated I will no longer be taking on Hannibal and Hannibal character requests until further notice. However, this request would finish up my series of Obsession. So for you and for the sake of finishing my series, I will fill this request and make it my third and final part of Obsession. You can read part one and part two in the links next to the masterlist. Sorry if this isn't what you expected, or had envisioned yourself, I apologize. But I hope you enjoyed my vision.
►IMAGE & DIVIDER CREDIT: @nyxvuxoa
►My Master Masterlist | Hannibal Masterlist | Obsession Pt. 1 Obsession Pt. 2
You were just as lost then as you are now. You had no idea what was happening, but you were feeling it. You were feeling it deep, this sense of acceptance over everything. Maybe Will wasn't so bad, maybe there was good to him, after all, you never wanted for anything, you never needed anything, and anything you ever desired besides escaping you've gotten. The way you take your toast with a little extra jam on the bottom corner for your first bite, or how you take your coffee with a little pinch of cinnamon in the grinds before brewing. He took note of all of this, and you never felt unsafe with him. He never hurt you. All he's ever wanted was to love you, and for you to love him and here you are questioning the very same thing.
Knocking at your door he peeks in and looks at you with such a kind loving smile. "Good morning. How did you sleep?" He asks you.
Nodding you give a small smile tucking some hair away from your face. "I slept alright, thank you. Coffee? Maybe I can, I don't know, join you for breakfast this time instead of eating in here? The room is starting to smell like breakfast lunch and dinner." You give a small smile and a soft chuckle.
Will's eyes light up and he looks over you and with an eager nod he looked over you and gave you a genuine loving smile. Swallowing your pride, you give him a smile back and search his face. He seemed kind, caring even. You didn't want to judge but it was like you couldn't help it. He kidnapped you after all, but there was just something so soft and somber behind his eyes. You could feel that he could really do damage if he chose to, but he didn't. He didn't hurt you; he didn't want to. He's been nothing short of sweet with you.
You reach for him and look over him and give him a sweet smile and he takes your hand and kisses your hand gently before he unlocks your ankle from the chain and leads you to the kitchen. Sitting you down he smiles.
"Coffee? What would you like for breakfast?" He asked.
"Coffee sounds perfect. Breakfast... blueberry pancakes? With sausage on the side and an egg?" You ask with a small smile. "I can help if you'd like." You offer.
Looking at you he tilts his head and smiles nodding. "I'd like that."
Making your way over to the counter, it felt good to stretch your legs and do something other than reading, or sketching, even pacing your room was growing exhausting. You would attempt to see if he can take you out back to his beautiful garden later. But right now. Right now, you just wanted to enjoy doing something different after what seemed like days.
Taking a moment to watch him, you feel this urge to reach out and touch him. Looking up at him you smile. He looks over you, but it was this urge to reach out a little more. Pushing past, you start to realize a little more about him that was deeper, it was a deeper acceptance of things, you realize you're really not going anywhere.
"I want you to make love to me Will..." You state, almost hesitant, but genuine. "In your bed..." you add.
He stops and looks at you, tilting his head, a little concerned, but there was something in your eyes that spoke truth. He knew what this was, but he was also blinded by his own wants, needs, and desires. His utter infatuation with you.
He pulls you close and kisses you deeply. In a fever you wrap your arms around him and pull him even closer, your hands in his hair. Bending slightly, he picks you up, wrapping your legs around him as he takes you to his room.
Laying you upon his bed he looks over you as you toss your night shirt to the side and you sit up, reaching forward and pull at his pajama pants as he strips his shirt off and tosses it to the side. Dropping his pants, he scoots you further up on the bed, so your head rests on the pillows.
"Are you sure?" He asks. The first time he's asked for consent, but you know what, you were willing this time.
You look at him and nod. "I'm sure." you whisper as you press your lips to his and pull him closer.
Pressing your hips up toward him, you feel his member against your flesh, and you let out a soft whimper and a heavy breath. The kiss deepens. Feeling him stiffen against your warm, damp, needing core you whimper again and roll your hips against the stiffing flesh and with a small adjustment he slips his member between your heavenly folds, and he lets out a groan.
Feeling the way he stretches you, you let out a soft moaning whimper as you arch into him, your nails rake across his back up to his shoulders. His lips press against yours in a small fit of fever. With each thrust the grunts and groans matched.
He made your body feel hot, tingly, wanted even. Why did you not see this before? Maybe it was because it wasn't under your terms, but now, now this was your terms and it felt different. You could get more used to this than what you are now.
The roll of your hips matched the press of his in perfect unison, the moans from your lips bounced off the walls and it only fueled him even more. The way he filled you caused you to want more. You were absolutely lost in this moment, craving more you widen your hips and lose yourself completely to him.
While the act itself was intoxicating, what fueled you more was feeling that pining for a finish, feeling it swell within your core you clench your legs around him pulling him deeper into you. Letting out a seductive lustful scream in raw pleasure you feel this orgasm consume you. But it was when you felt him press deeper into you releasing his hot ribbons of seed, feeling them coat your walls you let out another trembling fluttering moan that fills the room.
After a few moments you both look at each other and you smile a somber calm loving smile. "Breakfast?" you ask.
With a chuckle he nods and carries you to the kitchen, setting you on the counter, his seed oozing from you as he smirks. It was this moment you realize that this man, you were going to enjoy the company of a little more than before. This moment right here that he knew you were going to be with him forever.
408 notes
·
View notes
justice of toren collecting songs and one esk/breq constantly humming/singing them is such a good detail and ann leckie does so much with it. an incomplete list:
justice of toren's eager collection of songs is part and parcel of its violent destruction of cultures: these songs are cultural artifacts that it only learns because of its presence on those worlds during their conquest, and in many cases breq is the only one to remember them because their people have died out due to that violence. JoT preserves cultural artifacts for its own use at the same time it directly contributes to the need for that preservation in the first place.
the matter-of-fact way in which this is narrated to us gives us information about JoT's stance on respect and imperialism - that is, contrasted with other characters who look down on the conquered cultures, JoT does actually seem to appreciate their value. and yet it communicates to us no sense of remorse over its role in their genocide.
singing can be a communal activity. this allows us to feel the difference between one esk's multiple bodies singing together in harmony/in a round vs. breq singing alone. this has emotional weight, is an evocative image, and illustrates quite nicely some of the logistic considerations of having one vs. multiple bodies.
the constant humming/singing is extremely notable and idiosyncratic according to other characters, which is a dangerous combination for someone who's supposed to be undercover, so it adds a lil bit of fun suspense for us.
the fact that no one ever figures out breq's identity despite this giveaway tells us something about the other characters' attitudes towards artificial intelligences (though see below about seivarden).
the fact that it's so idiosyncratic also tells us something about the ability of individual AIs to have personalities that distinguish them from other AIs, and the fact that one esk sings constantly but two esk doesn't tells us something about the ability of different ancillary decades that are all part of the same AI to have distinguishing characteristics. this is very relevant to, and illustrative of, the series' thematic throughlines around identity, personality, continuity, etc.
the fact that breq personally has a bad voice also serves multiple purposes. because breq and seivarden both believe that the medic could have chosen a body with a good voice if she had wanted to, we can infer something about how ancillary bodies work, how much the AI (and, by extension, its medics) knows about the individual capabilities of those bodies while they're in suspension, and what kinds of things the AI can and can't control once it has unfrozen and taken over a body.
we can also draw conclusions about the medic that chose that body and about intracrew relations on that ship.
breq's bad voice creates moments of humor and irony in the narrative, such as when breq's constant singing - aka the most obvious clue that she is one esk - is precisely what makes seivarden so sure that breq can't be one esk, because no esk medic would use a body with a bad voice for an ancillary.
constant singing/humming imposes itself on the shared soundscape, meaning other people can't easily avoid it and it has the potential to annoy them, especially if the voice itself has annoying qualities. the reactions of other characters to the frequency and/or quality of this verbal tic tells us something about the level of affection those characters have for one esk or breq.
because singing involves words, the meaning of the lyrics being sung can be used to advance the plot, communicate things about specific characters, create irony in juxtaposition with what's happening on the page, etc.
i especially like what's done with the lyric "it all goes around". it's woven throughout the story in such a way as to manifest its own meaning (the repetition of "it all goes around" is, itself, an example of something going around). by repeating the lyric, breq is the one making it true, and i would argue that her repetition of this particular lyric about things orbiting other things contributes to, and/or is a sign of, her growing understanding of the necessity/reality of interdependence and her place in that framework/her role in constructing it, or in other words, the extent of her own agency and the rights and obligations it confers upon her.
because the singing/humming is a constant, background, automatic action, it only ceases when breq is experiencing a strong emotion. from this we are able to infer things about the emotional state of our famously-omits-details-about-her-emotional-state narrator based on other characters' comments about whether or not she is currently doing this thing.
we also aren't even aware that breq is doing it constantly until another character says so. on a narrative level, this serves the dual purpose of making sure we know about how much she hums AND of reminding us that she's not telling us everything.
the humming is not mentioned constantly even though it is happening constantly - this helps us forget in between mentions that it's going on while also simultaneously reinforcing just how constant it must be, so constant that to mention it every time it happens would be like narrating every time she breathes in or out. whenever someone brings it up, we are reminded anew that something has been happening all along that we forgot about. this means that ann leckie is able, by leaving information out, to hammer home to us how much we are not being told.
through this one character trait, ann leckie efficiently and elegantly communicates not just aspects of character but also of setting, plot, tone, theme, and narrative. there's no extraneous exposition just to tell us about the song collection or singing; everything that tells us about it is serving other functions in the narrative as well. the ways in which she manifests this one character trait in the universe and in the narrative contribute to and exemplify both the story itself and the method of its telling.
516 notes
·
View notes
Misery {Annie Wilkes! Aemond Targaryen x Author! Reader}
*All images found on Pinterest*
Warnings: Dark! Aemond, stalking, language, mentions of murder
Smut- oral (fem receiving), fingering (fem receiving), female orgasm
*Divider from Firefly Graphics*
Synopsis: You find yourself near death after being the victim of a car accident in a snow storm while working on the latest instalment in your bestselling Misery series. The man who found you, your self declared number one fan, seems innocent enough, but his dark past, and even darker intentions, soon become clear
With a sigh of slight relief, you placed the final page on top of the pile beside you, tying a rubber band around it and placing it in a blue leather case.
Another book finished to hopefully join the others on the bestsellers list.
You had written twelve other books, to be exact, and had now finished your first completed draft for the thirteenth.
The cursed number.
The unlucky number.
The number of misfortune.
But for you it was a blessing.
For years you had dedicated your life to the running series of books centred around a character called Misery. You'd published your first book at eighteen, becoming the new face of the romance genre. And as you had grown up, your books had matured as well, becoming darker, bordering on the thriller genre as well as still centering on the romantic aspect. It was a bold move, but seemed to pay off, as it had made you even more popular than before.
Yet, after dedicating your life to one character for an entire decade now, you knew you had to move on, take another path in a new series you were going to write. You knew some of your fans would be disappointed that this would be the last entry in the Misery series, but it had to be done.
It felt like a relief to you, that you could finally move on with your life. And you felt as though it were almost a weight being lifted off your shoulders as finished your usual celebration of a single cigarette and champagne. You rose to your feet to take the manuscript to your car with the rest of your belongings, departing from a small log cabin called Winterfell Lodge you always rented out when working on your latest novel. It was always calming to get some time away from the chaos of the city.
You pulled your coat around you tighter, the snow flurry thickening around you as you loaded your bags into the trunk of your car. Usually, you wouldn't drive in weather like this, especially as it seemed as though a snow storm was fast approaching, but you needed to get back to the city as fast as possible.
Quickly shooting your agent a message to let you know you had finished the initial draft and were on your way to get back to the city, you started the car and drove away from Winterfell Lodge.
You squinted slightly as the snowfall grew thicker still, trying to see the curve in the road as the wipers speed couldn't keep up with the snow that was now covering the road. You slowed your speed, maintaining control of your car, humming along to the song playing on the radio.
Maybe you should have waited for tomorrow.
It was already late in the afternoon, and the clouds darkened the sky.
You turned on your car's headlights, a small sign reading 'Curved road, next thirteen miles'.
You hit the curve no problem, turning the wheel with perfect control, keeping a steady speed as you continued turning the wheel, but suddenly one of the wheels skidded, followed by another as the car span erratically out of control.
And all you remembered was the car spinning of the road, followed by it slamming into a tree, doing a one hundred and eighty degree flip, landing on it's hood.
And then as you fell into the darkness, you heard the harsh sound of the radio static and the howling winds, and felt the blood trickling down the side of your face.
Followed by nothing. Only darkness.
When you awoke, you felt numb.
You skin was paler, and clammy with a feverish sweat that sent a slight tremble through you. You couldn't lift any of your limbs. They felt weighted down. You didn't even want to try and lift your head.
"You're awake."
The voice was male. It sounded calm, well spoken. Soothing, almost.
Approaching footsteps to your bedside soon brought the owner of the voice into your vision.
He looked around your age, maybe two or three years younger, around twenty five or six, perhaps. He had long silver hair tied half up, a strong jaw and a tall, well defined figure. One of his eyes was a vivid blue, like a sapphire, the other a cloudy white, a long scar running from his brow down to his cheek. Resting on the bridge of his nose was a pair of black rimmed glasses. He was dressed in a dark blue sweater, the white collar of his shirt peaking up above its neckline, and a pair of black trousers.
Your saviour was very handsome, indeed.
"W-where... where a-am-"
"Shush," He interrupted you, placing the back of his cool hand against your forehead, frowning slightly at the heat radiating on your skin from the fever. "We're just between Storm's End and Winterfell. You've been here two days. I was concerned that you were not going to pull through. I'm thankful to say that I think you will recover. You'll be okay. Thank the gods you'll be okay." He shot you a slightly relieved smile. "Oh, how foolish of me. My name is Aemond Targaryen, and I'm your-"
"Number one fan?" You murmured, your eyes fluttering closed from a split second before opening again to see him shooting you a rather bashful smile, his cheeks dusted with pink.
"That- that's right," He murmured. "I-I am also a doctor, fortunately enough." He added, gesturing to where you were connected to a drip before outstretching his hand and opening his palm to reveal two pills. "You need to take these for the pain," He said softly, lifting your head slightly to bring the pills to your lips and swallow them, his fingertips lingering slightly against your lips.
Aemond propped up the pillows slightly, resting your head back down. Giving you a better view of your room, you noted you appeared to be in a rather old cottage or farmhouse. Your room was rather charming; wood panelled walls, a large fireplace opposite the bed. From the window, you saw a view of the mountains.
"Shouldn't I be in hospital?" You mumbled.
"The blizzard was too strong. I didn't want to risk trying to get you there. I couldn't even call, the phone lines are down and I don't own a mobile, I'm afraid. I doubt you could even get signal out here with the weather like this."
"Thank you for saving me," You murmured, you eyes aching with fatigue.
"You are more than welcome. Now, you should get some rest. You nearly lost your life." He replied, stepping back. "I'll be back to check on your when your meds run out," Was the last thing he said before leaving the room, shutting the door behind him.
Your fever past after a few days in Aemond's care, but you were still incredibly weak. But Aemond promised you that things would get better.
"It's not going to hurt forever, I promise you."
"Will I be able to walk?" You asked.
"Of course. And your arm will be fine, too. Your shoulder was rather badly dislocated, but I managed to pop it back in there. But I must say, I am rather proud of what I managed to do with your legs, especially considering what I had around the house. In fact I don't think there's a doctor in the whole of Westeros that could do a better job."
And with a flourish of blankets, he made your legs visible to you for the first time.
From the knees down, you believed you resembled a mummy. Steel rods that seemed to be remains of aluminium crutches were used as splints with taping circled around them. From the knees up, your thighs were swollen and horribly bruised.
Upon seeing your slightly horrified expression, Aemond hastily added. "It is not nearly as bad as it looks considering the severity of your injuries. You have a compound fracture of the tibia in both legs, and the fibula in the left leg is fractured too. I could hear the bones moving, so it's best for your legs to remain immobile. And as soon as the roads open, I'll take you to a hospital. In the meantime, you've got a lot of recovering to do, and I consider it an honour that you'll do it in my home." He gave you a kind smile, once again leaving you to get some more rest until he had to administer your next round of painkillers.
And soon enough Aemond's visits to your room became more frequent and for longer periods of time. He didn't just stay to gave you your meds, but also to reassure you that the sweeling to your cheek would go down, and how you were still beautiful, and how much he adored your books.
"It was quite a miracle that you found me," You said one evening after Aemond had fed you your dinner. He let out a small, slightly nervous chuckle in response, pushing his glasses up the bridge of his nose.
"Actually, it wasn't a miracle at all. I... as I... in a way... I was following you."
"Fo-following me?" You stammered out.
"Well it isn't exactly a secret that you were staying at Winterfell Lodge, you know, considering that I am your number one fan, but some nights I found myself driving there, sitting outside and just looking at the light in your cabin, knowing you were most likely creating another Misery masterpiece. I'd try to imagine what the world's greatest writer was creating." He replied, his voice light and airy, as though it was the most simple explanation.
"Can you say that last part again? I didn't quite hear..." You murmured, trying to brush off the fact he practically stalked you. Aemond just shot you a small smile in response.
"The world's greatest writer." He repeated before continuing. "Anyway, the other afternoon, when I was on my way home, there you were leaving the lodge. I must say I was curious as to why an intelligent woman such as yourself would go for a drive with a storm such as that approaching."
"I... didn't know there was going to be a storm like that..."
"Well, luckily I did," He replied. "And, it was lucky for me too. Because you're alive, and now you can write more incredible books. I've read absolutely everything you've written. I enjoyed your three standalone novels at the start of your career immensely, but the Misery series... I must say that they are my absolute favourite. I-I know them all by heart, all twelve of them. I love them, they helped me through my darkest times... through any obstacle I've faced in my life, I've managed to find solace with Misery.
You couldn't helped but feel touched by the way he spoke so fondly of your work, how he constantly sang your praises whenever he got the chance. The man was socially awkward it seemed, and perhaps rather shy at times, but he was still surprisingly charming.
"You're too kind..."
"And you're too brilliant," He replied. "You must be to create such a wonderful character like Misery." As he spoke, he traced a finger down your cheek. The swelling was gone, and the bruise was fading. He cleared his throat, hastily pulling his hand away and rising to your feet. "I'll um... just wash these dishes up." He said, seeming rather embarrassed all of a sudden. "I'm sure the road will be open soon, which means the phone lines will be back up in no time. But until they are, I'll kept trying so you can phone your agent."
He stopped when he reached the doorway, turning away from you, his hand hovering over the door knob.
"Is there something wrong?"
"Oh goodness no. I-I was just wondering if I could ask you a favour."
"I'm sure it's the least I could do after you've shown me such kindness." You replied, mustering a small smile that made his expression brighten.
"It's just that I noticed in your case there was a new manuscript..." He trailed off, hesitating slightly.
"You want to read it?"
"If it's not too much trouble. I do not mean to intrude."
"I usually only let three people read my new work this early," You replied, making his smile drop slightly. "And that's my editor, my agent... and the person who was kind enough to save me from dying in a car wreck."
"I... thank you," Aemond smiled. "You have no clue as to the gift you've given me and the gratitude I feel to you."
You shot him a smile, but that soon changed into a grimace as you winced from the pain.
Aemond glanced at his watch, hastily placing your empty plate on the bedside table before reaching into his pocket for the painkillers.
"It's like clockwork, the way your pain returns," He murmured, pressing a glass of water to your lips to help you swallow the pills. "The pain will subside soon. It will be okay," He sighed, placing his hand over yours as your expression twisted in discomfort.
"What's the title of your newly finished book?" He asked, trying to take your mind away from the pain.
"I'm not sure yet," You murmured. "I usually come up with the title after the final draft is finished. Perhaps after you read it, you'll have an idea or two."
Aemond's expression brightened again. "I will do my best not to let you down."
Days past, and soon enough Aemond could move you from the bed to a wheelchair. Your arm was healing nicely, as were your legs, despite there still being some time until the latter were properly healed. Aemond never failed to update your over his progress of the manuscript.
"I read chapter one, it was one of your best introductions to a Misery novel I have ever read..."
"Page twenty, I've reached. It's incredible how you can engage with the reader so quickly in the novel..."
"Page thirty, I had to force myself to put it down..."
It wasn't until one day when he came in with your lunch that something seemed a little... off, about Aemond.
"I know I'm only forty pages into the book..." He began in his usual tone. "But... oh I cannot criticise someone like you-"
"It's fine," You replied. "I can take it. Believe me, if I can deal with the critics, I'm sure I can handle whatever my number one fan has to say."
Aemond softly exhaled, keeping his gaze fixed on where he was cutting up your lunch. "It's just..."
"Just what?"
"It is brilliantly written," Aemond admitted. "Although everything you write is brilliant. But... the swearing..."
You raised an eyebrow.
"The... swearing...?"
"Yes, the swearing. There, I said it!"
"It bothers you?"
"It is inappropriate. It has no nobility," He protested, sawing through the food on your plate.
"It is appropriate for the setting and background of the character speaking-"
Aemond stilled, his hands stopping from cutting your food for you. His head lifted to meet your gaze, his expression uncharacteristically cold.
"No. It isn't," He replied firmly, resuming to cutting your food, his gaze still focused on you. "What do you think people say when they go into the grocery shop in town. Give me a carton of those effing eggs and five slices of that bitchly roast chicken?"
You couldn't help but smile at his refrain from using the profanities, but it faltered as the cutting becoming more and more erratic.
"...And in the bank, do I tell Mr Lannister, here's one big bastard of a cheque, give me some of your darn money?"
You let out a nervous chuckle at his rants, but soon enough your ears were greeted by the grating sound of metal against china. He looked down, slamming the plate down on bedside table.
"There! See? Now see what you have made me do! These were my mother's plates! What she left me when she passed! And now, it's all scratched!"
His chest heaved as he closed his eyes, trying to calm himself down. When they reopened, his good eye was full of shame and embarrassment.
"Oh... I'm so sorry... sometimes I can get so worked up I... oh, can you ever forgive me? Here..." He pressed your pills to your lips before picking up the plate, shooting you a rather overly sweet smile.
"I hope you can forgive me. Oh, Y/N... how I adore you. I mean... your mind. Your creativity... that is all I meant."
Several days passed, and Aemond's previous disposition had returned. He didn't lecture you over the choice of language used in the book, but still seemed disapproving nonetheless. He still cooked and fed you your meals, brushed your teeth, gave you your pills, praised you every waking moment he was with you. The phones were still apparently out, but he had assured you it was only a matter of time before they were up and running again. He had even managed to convince you to autograph his limited edition copy of your first Misery novel, promising to cherish it for the rest of his days.
He still gave you regular updates on reading your manuscript. At page 185, he expressed his sadness at being over halfway through. At page 300, he branded it better than perfect, that it was divine. He said it was more beautiful than any tapestry adorning the Red Keep. He had then introduced you to his pet snake, Vhagar, and his cat called... Misery.
And you had found out more about him.
How he had graduated top of his class from medical school, and how his peers and his family were constantly consumed with jealousy from his success. How they would attempt to belittle and mock him for his eye, and how in his lowest moment, his fiancée, Alys, had left him, but you had saved him with releasing your newest Misery novel some weeks later.
He had told you about the neglect from his father, his older brother's alcoholism and his mother's untimely death. He stiffened when he mentioned his eye, but you quickly changed the conversation and didn't bring it up again, not wanting to upset him by bringing up possible past trauma. And you had listened to him, consoled him over the misfortunes of his past, and he had expressed his gratitude in return.
And then he had left you to rest while he returned to finish the manuscript, which he had entitled Misery's Child.
The slam of your bedroom door awoke you from your doze, your eyes fluttering open to reveal Aemond staring down at you, his face ashen and jaw clenched.
He must have finished the book, it seemed.
"You... she cannot be dead," He murmured. "Misery cannot be dead!" He then exclaimed, voice rising. "How... how could you do this to me?"
"Women in that age... it was tragically common for them to die in childbirth, Aemond. I'm sure you know that. But you know, she will still be alive in... in spirit..."
"I do not want her spirit! I WANT HER! AND YOU MURDERED HER!" He yelled.
"I... I didn't kill her..."
"THEN WHO DID?"
"Nobody she... she passed away and..."
"She passed awa- she passed away?! No, Y/N, you did it. You killed her. You murdered my Misery."
He picked up the chair by your beside where he usually sat with you with ease despite it's weight, rising it in the air as if to strike it down on you before turning and throwing it against the wall. It shattered immediately upon impact, breaking into pieces on the floor.
"I... I thought you were good," He murmured, tone suddenly soft. "But you're not good. You're just a dirty, untrustworthy woman. I don't... I don't think I should be near you for a while..."
He walked to the door, and stopped to turn back to you.
"And don't even think about anybody coming for you. Not the doctors, your agent, your editor... I won't call them. I haven't called them and I never will. Nobody knows you're even here. And you better hope nothing ever happens to me... because if it does... you'll die."
After the click in the lock of your door, followed by the slamming of the front door and the revving of Aemond's car as it pulls away from the house, you let out the breath you didn't know you had been holding.
You were slightly shaken from Aemond's outburst, but tried to focus on what needed to be done, shifting to the other side of your bed and reaching out with your arm. It had come out of it's sling several days ago, and was now bandaged in a cast. You managed to grasp ahold of the armrest and pull it towards the best, shifting your body closer to the edge of the bed. Your legs screamed in agony as you manoeuvred yourself onto the wheelchair, but you persisted nonetheless, managing to sit down in the chair and wheel yourself towards the door. Reaching into your hair, you pulled out a hairpin Aemond had leant you, pushing it into the keyhole and soon enough hearing a click. Turning the knob, you pulled open the door and wheeled yourself out of the room, looking down the flight of stairs that blocked your way.
Letting out a deep sigh, you gripped the banister with one hand as you slowly steered yourself to the edge of the staircase.
"What have I got to lose?" You murmured, before wheeling the chair down the stairs.
The chair turned on its side as it crashed down the last step, but you managed to hoist yourself up again. You immediately tried grabbing a phone, but it turned out to be fake. You then discovered the windows bolted shut and both of the front and back doors having a second lock at the top, which you couldn't reach due to not being strong enough to stand just yet.
You wheeled yourself back into the living room, looking at the photographs placed on the drawers against the wall. There was Aemond as a young boy standing with his siblings and mother, his eye unharmed. Another showed him graduating medical school, a proud smile on his face. The third was him with his mother. And the fourth... was you.
He truly wasn't lying when he said he was your biggest fan.
Between the two photographs was a crystal dragon ornament, and beneath that was an emerald scrap book. You lifted the ornament carefully and grabbed the book, opened it.
The beginning seemed fairly normal. More photographs of his childhood and teen years. The was a photograph of him at what seemed to be a formal event with a women you only assumed was Alys. She was dressed in dark green, matching Aemond's tie, and you were sure she was very pretty, but you couldn't see her face due to the black ink scribbled over it, almost cutting through the photo. The next page was work related. More photographs and newspaper clippings of his medical success.
But turning the page was a different story entirely.
The first page contained a page of the newspaper, what seemed to be it's headline emblazoned in large capital letters.
'Doctor Aemond Targaryen arrested for the murder of nephew Lucerys Velaryon'
'Doctor Aemond Targaryen was arrested this morning, accused of the murder of his nephew, Lucerys Velaryon. Targaryen, 20, pleaded not guilty to the death of Velaryon, 16, under the accusation he had simply acted in self defence after his nephew attacked him with a knife and caused the disfigurement of his left eye'
And it only got worse as you read the following pages.
'Targaryen trial postponed until December 10.'
Accompanying the headlines were photographs of him standing in front of the courthouse with his lawyer, Larys Strong, a stony expression on his face.
'Targaryen declared innocent by jury, claims he was a victim of a malicious attack.'
'Shamed doctor Aemond Targaryen resigns from King's Landing hospice.'
You slammed the book shut, a sick feeling brewing in your stomach as you hastily placed the book in it's position with the ornament on top.
Wheeling yourself to the stairs, you gripped the banister and you pulled yourself up the stairs. Your arms ached, the muscle burning and sweat beading on your forehead as you persisted, refusing to let go and crash back down to the bottom again.
In time, you reached the top of the stairs, moving the wheelchair as quickly as you could, taking the pin out and moving towards the bed, when a slam of a car door stopped you in your tracks.
Aemond was back.
You knew he would enquire about the now unlocked door, but you could just pass it off by saying you urgently needed to use the bathroom. You also knew that you didn't have enough time to haul yourself back into bed, and so you did what you could, and threw yourself out of the chair and onto the floor, pushing the wheelchair away from you slightly as the front door opened, the rustling of paper bags being put on the table before the creaking of the stairs. There was a slight falter before he twisted the knob and pushed the door open.
He knew it was unlocked.
"What happened?" He asked, voice laced with concern as he hurried over to you, lifting you into his arms and shushing your cry of pain as he placed you down in bed atop the covers. His glasses had been taken off, the brilliant blue of his good eye burning into you.
"I needed the bathroom, but I couldn't get back into bed I... I lost my balance and fell on the floor..." You lied, hoping that you managed to convince him that your story was true.
"You needed to use the bathroom?" He asked, receiving a nod from you in response.
"And you managed to get yourself on and off the toilet alright?"
Another nod.
He slowly nodded in response, and you let out a small sigh of relief, visibly relaxing at him seemingly believing your story.
"And... you managed to get down the stairs and into the living room without hurting yourself after picking your bedroom door lock?" He added, his tone still soft.
A little too soft.
"Aemond... I never..."
"And you managed to somehow drag yourself back upstairs into your room?"
"I... I don't..."
"The dragon ornament on top of my photograph album," He replied. "It was pointing the wrong way."
You opened your mouth to speak, but found yourself at a loss for words, you mouth dry and your blood running cold.
"It's okay," He murmured, running his thumb over your lower lip. "I shouldn't have scared you. I know I did. I frightened you, hm? Well for that I apologise. I will refrain from repeating that behaviour in the future." He added, leaning forward slightly. "You are so incredibly important to me, Y/N. I'm sure you know that. You saw the photograph downstairs..."
You tried to speak again but he quickly shushed you, the finger resting on your lip tracing down your jaw, your neck, across your collarbone. His pupil had dilated, his breath quickening slightly as his hand moved down to your chest, covered by one of his shirts he had given you, framing your body in a pale blue.
"You do not need to speak Y/N," He whispered, leaning closer still, one hand placed the other side of you, caging you against him. "You will only waste your energy..."
As he pressed his lips to yours, you knew you couldn't fight back. You were weaker with him even without your injuries, and with his erratic behaviour, and what you had discovered downstairs...
And so you let him deepen the kiss. You let him part your lips with his tongue. You let his hand wander down from fondling your breast to your waist, pulling the shorts you had on down to your knees.
You let him ever so gently part your legs, pressing a line of kisses along your upper thigh, and then pay the same attention to the other, his lips tracing your flesh that had been swollen with bruises the week before.
Did you even know how long you had been here?
Staring up at the same ceiling, being enclosed in those same four walls day after day had merged the days together.
And if you asked Aemond, would he tell you the truth?
You couldn't trust him, but you needed to stay alive. And if you had any hope of getting out of here alive, you needed to stay on his good side.
And so there you were, legs spread as Aemond lowered himself between them, his moans vibrating against you at your taste, his tongue circling your clit and sending a jolt of pleasure through you that was both pain and pleasure as your legs twitched slightly, a hand tangling in his silver locks.
You resented the way your legs squeezed around his head as he thrust two fingers into you, murmuring against you about how wet with want you were for him. Your body was betraying you, but you couldn't stop the way he was making you feel such pleasure. The mere curling of his fingers against your sweet spot, or the flick of his tongue against your swollen clit caused a string of breathy moans to leave you, and soon you found yourself coming undone. He drew his fingers out of you, replacing them with his tongue as he eagerly lapped at your release.
He sat back, lips glinting with your release. He reached forward, fingers parting your lips so you could taste yourself on him. He let out a satisfactory groan as you sucked on his fingers, allowing them to linger on your lips as he pulled away.
Pressing his lips to yours, he pulled your underwear and shorts back up to rest on your hips.
"I would love to go further with you, but I'll have to wait until you're back to your full strength. It may take some time... but I think I can manage with having your addictive taste on my tongue until I can truly claim you as mine. You'd like that, hm?"
"I..." You let out a deep breath. This man was unhinged. He'd break your ankles with a sledgehammer before letting you leave. You knew that your best chance to survive this, was to play along. Allow Aemond to believe that you were beginning to reciprocate his affections for long enough so he could let down his walls and nurse you back to health so you could escape.
"I would like that..." You murmured, looking away to feign embarrassment.
"It is nothing to be ashamed of, my darling Y/N." Aemond replied, looking at you with such fondness, you wouldn't have believed he was a murderer. He paused for a moment. "This may not be the best time, but I have a surprise for you. In the other guest room."
"Oh... okay..."
"If you want to wait another day, as disappointing as that would be-"
"No, I can see it now," You hastily replied as to not flair that nasty temper up again. He smiled warmly in response, stepping towards you as you reached for the wheelchair, but he instead lifted you into your arms bridal style, walking you away from the chair and towards the bedroom door. Instinctively, you wrapped an arm around the back of his neck, your head resting against his shoulder.
He pushed open the door with his foot, giving you another overly sweet smile as he proudly declared "It's your new studio. I set it up last night. I just needed to get the typewriter and paper, which are downstairs."
"But... w-why..."
"You need a place to work, after all," He interrupted you, placing you down on the desk chair. "All writers need a place to work."
"B-but... what would I write?" You asked.
Aemond smirked at you, walking over to where a trashcan sat in the far corner of the room. The clang as it landed on the floor echoed around the room as he dropped it at your feet, your manuscript discarded in it.
"You want me... to burn my book?" You looked up at him in disbelief.
"I know this may be difficult to you," Aemond nodded, reaching into his back pocket and bringing out a box of matches.
"I... I can't..."
"Yes. You can," Aemond's voice was firm. "You can do this. Do it. Now."
Your hands began to tremble as he pressed the matchbox into them, pouring lighter fluid into the trashcan.
"I know this is the only copy," He continued. "You always only write one copy at first. When you were eighteen, you wrote your first book and you didn't make a single copy. Because you didn't think anybody would take it seriously. But they did. And you kept that tradition because it's a superstition to you, and you don't want to make a copy in fear of it being rejected. I'm trying to help you can't you see that?" His voice was steadily rising as his agitation grew, making the tremble in your hands worsen.
"I just want to help you. Why won't you let me help-"
As he spoke, you hastily lit one of the matches and threw it in the trashcan, the manuscript exploding into flame.
And as Aemond lovingly kissed your forehead, murmuring how proud he was of you for being so strong, all you could do was stare at the flames consuming your work, your own masterpiece.
"Now you can go back to doing what you're great at," Aemond murmured, a hand resting on your shoulder. "You can write a new novel, your greatest achievement ever... Misery's return."
He knelt down by you, a finger hooking beneath your chin, turning your head to meet his gaze. "I know you didn't mean it when you killed her. And now you can make it right. You can even write it in my honour, as a thanks for saving your life and nursing you back to health." He leaned forward so his breath was tickling your ear, his hand now resting on your thigh. "Although there are also other ways you can repay that debt to me."
"And you... you expect me to write something up just like that?" You asked.
"I expect nothing less than a masterpiece from you," He replied reassuringly, pressing another kiss to you, this time on the cheek. "I have the upmost faith in you my darling... I know you won't let me down... and if you do... we'll just have to start again. And again. And again... you won't try to escape, will you?"
"O-of course not. I... wouldn't dream of it."
Aemond hummed in approval. "I know you won't," He whispered, kissing you on the lips before standing up. "No one will come for you. If they do... I won't let them take you. If they try to take you from you, or if you do try to leave..." He said, opening a storage closet and reached inside, brandishing a sledgehammer. "There are other ways of keeping you here... with me... forever..."
Masterlist
293 notes
·
View notes
At the Cabaret Pt. 1 | Tommy Shelby x fem!character
Summary: Lenore is a dancer at the Birmingham Cabaret when she's approached by an estranged neighbor and notorious gangster, Tommy Shelby, with a business prospect. Seeing him again brings up old feelings and new conflicts that they must navigate in the topsy turvy world of Cabaret.
Warnings: Heavy misogyny (1920s Cabaret... I mean), mentions of sexual assault, and objectification. Please don't read if these topics are upsetting to you- I'm writing from a historical perspective and some of the elements I write about are disturbing. Take care while reading. This story only gets worse from here lol. I use a few modern songs in the story but imagine them in a 1920s style (aka Post Modern Jukebox). I really recommend listening to the songs I have listed below because I reference them in the story.
word count: 4125k
Come with me- Preservation Hall Jazz Band 🎶
Ain't That a Grand and Glorious Feeling? - Annette Hanshaw 🎵
Last Nite- The Strokes 🎶
PDA- Interpol 🎵
Not proofed- my b folks!
She felt powerful when she stepped on stage. She felt untouchable. She performed five days a week at Birmingham’s Cabaret Club during the late night slot when the wealthiest clientele slipped in through the backdoor to huddle around the stage. She was lucky that her life had ended up like this and not working the streets like so many girls she knew had to after the war years. She tried to get them jobs in the Cabaret but their addictions to uppers and downers and strong cocktails made it hard for them to follow the routine of Cabaret. It required discipline to arrive at the club everyday at three in the afternoon and work new routines until the doors opened at eight, and they worked hard. She wasn’t an especially good dancer but her energy and confidence on stage won her the best slot of the night and the notoriety that nicknamed her “Lady Lenore.”
Her shows were sensual, sure, but mainly they were performances. She sang and sparkled onstage with her elaborate costumes. And sure, men often followed her backstage, seeking an encore in not so polite terms but she was the master of her own image. She was allowed to say no when she wanted to because she was “Lady Lenore.” She wasn’t a stranger to male guests coming by to visit her at night and many times, she allowed them to join her in her dressing room shared with the other performers, offering him whisky and resting her feathered head against his chest. But these were the boys she recognized from the factories her father had worked in, that her brothers had worked in before the war. She flirted with the rich cats who came by to seduce her but only the boys with coal grease still stuck in the curves of their muscles made it farther into the reaches of her corseted costume. She had a preference and she didn’t care who knew it.
What won her fame, besides her voice, were her costumes. The early twenties offered an exciting new spread of style that she latched onto like Vicodin. She loved red, so she dyed most of her costumes a deep scarlet with millions of beads sewn onto the surface. She pulled on the red bodysuit, fixing the ropes of red beads draped around her shoulders and bare thighs. She didn’t have large breasts so the front stuck tightly to her chest but elegant bodice distracted disappointed eyes. Her blonde hair was bobbed around her heart-shaped face. Lucy, one of her friends, secured the devil cap on her head, the strap going beneath her chin. The horns were stuffed with couch stuffing to stand up straight. She under-drew her lips, creating a heart with red lipstick. The rest of her makeup was minimal, making the lipstick stand out. She buckled her nude-colored dancing heels across the top of her foot and shook out her arms nervously.
She could hear the announcer out on stage with his squeaky voice. She pulled on her red satin gloves and made her way slowly to the curtains offstage waiting for her cue. Johnny the club manager squealed, “and now, the girl you’ve been waiting for, the queen of our hearts and the sweetheart of Birmingham, Lady Lenore!” He ran off stage and a spot opened against the curtain.
She lifted her lips into an innocent smile and stuck her arm out through the slit in the red velvet curtain. She trailed her finger down the fabric, teasing the slit beneath the hot spotlight. The audience cheered loudly, feet stomping on the bar floor.
“Aw come on out, darlin!” A man hollered from the audience and she laughed quietly behind the heavy fabric. Whistles followed his brave shout and she shook her finger naughtily at them, still obscured by the curtain.
“Now, now boys. That’s no way to ask a lady. I was gonna be real nice to you tonight, and I mean real nice.” The men whistled again and slammed their hands on the drinking tables.
“Please, honey!”
“Come on, love!”
She slipped her arms back behind the curtain and giggled.
“Oh, boys! You really do know how to make a girl feel so good!” She squealed, “open the curtain, Johnny!”
The curtain swung open on its tracks and she placed her hands on her accented hips. Her bare thighs warmed under the hot spot. She switched into her Lady Lenore facade, apologizing raspily, “sorry about that boys, I was a bit nervous.”
Men howled in the audience and stood to whistle. She put a dramatic finger to her lips, biting it gently.
“Gee, thanks. Now let me show you what I can really do.” She chuckled darkly and nodded to the band beside the stage. “Hit it, honey.” She called with a smile. A ragtime track began and she twirled, pulling the hair from her shoulders to show off the back of the costume, her butt just peeking out beneath the underwear-like bodice. She strutted across the stage with a flick of her leg, turning into a jumpy great-vine, tap dancing without the loud clacks. She reached out her gloved hand to the audience and gasped when the music jumped, smirking as she took quick steps backwards. She did the same to the otherside, each action dominated by the sexual squeal of the trumpet. She took slow steps downstage to the drum beat and lowered herself slowly to her knees, playing with her long strand of pearls.
“I just feel so good tonight,” she bit her lip and shook her shoulders and lay back, still on her knees, her sparkly crotch exposed to the roar of the crowd. When a man wolf-whistled she sat back up quickly, an innocent smile pulling at her painted lips. “Oops!” She giggled and crawled forward on her hands and knees. She reached the end of the stage and swung her legs over gracefully. She went over to the fat cat at the first table and stroked his long white beard.
“Say, you look like a good boy,” She purred and sat abruptly on his lap, “now what do you want for Christmas? Or more importantly what do I want?” She pouted out her lip, thinking. The men in the audience laughed.
“Anything you’d like sweetheart.” The man chuckled and she smiled.
“Ohh, Daddy! That’s exactly what I wanted to hear! But say, aren’t you gonna ask me if I’ve been a good girl?”
“Well, have you?”
“Hmm, one second, Daddy,” She stood up from his lap and cleared her throat loudly. “Do you boys think I've been a good girl?” She asked the room and smiled when she received stomps and applause. “And do you think I should get anything I want?” She added, biting her lip.
“You’re all I want, love!” One man yelled from the bar and she clutched her heart.
“That’s the right answer, boy!” She called back and laughed, returning to the lit stage. A microphone had been set up centerstage while she was in the audience. She shimmied up to the microphone.
“Y’all ever been to New Orleans?” She quipped in her best southern accent and winked at the band who burst into, “Come with Me.”
A line of feathered dancers came out onto stage, flirting with the audience with their scandalous dance fan dance.
Come with me to New Orleans
I'll show you a great time
All your dreams will come true
A' With me by your side
Her raspy voice echoed out into the small club. She scanned the crowd, her fingers cupping the wide microphone. The men in the crowd smoked cigarettes and cigars, separating them by class and income. The day-laborers sat with crushed cigarettes in ashtrays while the fat cats still smoked the same cigar they had light when the night began.
So
Come with me to the' New Orleans
I'll show you a great time
All your dreams will come true
A' With me by your side
She smiled as she sang, looking down at the audience through her eyelashes. She adjusted her red velvet garter, her fingers trailing up the fabric on her crotch to her stomach. The dancers behind her dipped their fans to show their cleavage.
Come with me to New Orleans
I'll show you a great time
All your dreams will come true
A' With me by your side
She finished the song with a low voice and the audience roared once again. She took an extra fan from one of the dancers and held it in front of her body. With the large fan, she did look naked, tricking those who were drunk in the audience to believe she was nude like a game of peek-a-boo. “Ain't that Grand and Glorious” marked the beginning of a new musical number and she started singing, traveling to either end of the stage. She moved her fan to her back like a peacock, pushing what cleavage she did have forward with her arms.
Now is there any one present
Who was ever in love
If it’s so you know how
I’m feeling right now
Everything is so pleasant
She broke out into a brief timestep combination and moved the fan to her chest, just showing her legs and face.
You’re so full of bliss
You just feel like knocking wood
She planted and shook her hips to the knocking noise.
And when you naturally say yes
Ain’t that a grand and glorious feeling!
She spun around and planted the fan on the top of her butt, bending over to show off her ass to the audience who cheered. She spun again and did a quick Cincinnati step during the instrumental break.
I’ve got something to say
When that band starts to play
She raised the fan above her head, showing off her costume once again, as everyone in the room sang the last line with her:
I get a grand and glorious feeling
“That’s all!” She smiled and the spot went out. She hurried off-stage with the others and ducked into her dressing room, returning hugs and hollow laughs with the other girls.
“You were wonderful, Nore!” A dancer hugged her around her stiff waist and she let out a repressed breath.
“Thank you, thank you. Gee, I’m happy it's over with. Father Christmas in the front row got a little too excited if you know what I mean.” She rolled her eyes and the girls laughed. Clara patted her on the back and slipped through the dressing room door to go on with the following act.
“Break a leg, Clara babes!” She teased warmly and she tittered her thanks. They could hear the crowd grow impatient as they waited for the next round of entertainment. She sat down at her place at the makeup counter and removed the horned cap from her head. Lucy slipped into the dressing room, closing it quietly behind her so the sound wouldn’t carry onstage.
“Nore, great job as always.” She sat beside her and intertwined her fingers with Nore’s. The dancers switched their tops and bottoms, each barely covering anything of their anatomy.
“Thanks, Luce.” She wiggled in her seat and slid the large rings off her fingers and put them in her pink jewelry box.
“Johnny wanted me to tell you that there’s a fella in the audience that wants to see you.” Lucy grimaced.
“I have another show tonight, I can’t.” She sighed and fixed her lipstick.
“He said it’s important.”
“He always says that.” She laughed curtly.
“Sure but I think he means it this time, Nore. I would do it.”
“Why? Is it a cat?” She raised her eyebrow at Lucy and frowned, “He is isn’t he?”
“It's Thomas Shelby, Nore.” She whispered close to Nore’s ear and sat back again, biting her lip anxiously.
Her heart fell into her stomach and she looked at Lucy through the mirror for a moment. She cleared her throat and looked down at her red gloves.
“So? He doesn’t own me,” She tried to sound brave.
“No, but he owns half of Birmingham.” Lucy retorted and started again, “and besides, he used to be a factory boy, you remember don’t you? He used to live on our street!”
“That was before the war, Lucy. He’s changed since then. We all have.”
“Wasn’t your brother friends with Thommy?” She asked carefully, not wanting open old wounds.
“Like I said, Luce, we’ve all changed. I haven’t spoken to her in ages. The war was hard on everyone, even the Shelbys.” She sighed. Lucy looked down at her naked thighs pressed against the chair and took in a deep breath.
“You’ll do it though, won’t you?”
“If I don’t have a choice…” She shrugged and stared at herself in the mirror, “then I guess I will. Help me out of this corset, won’t you please?” She stood and Lucy undid the tough clasps on the back that insured the piece wouldn’t fly open during the act, no matter how many hands probed it. She shrugged the top off, her breasts sitting back against her chest. She put on the white satin bra and short set laid out for her second performance. She rolled on her stockings and clipped them into her garters to keep them from falling down. Lucy fastened a tulle train onto the back of her shorts and fixed the edges. She buckled her heels and fit the glitzy headband around her forehead. Someone switched her pearls for a necklace with small gold stars, and her red gloves for blush pink. She brushed a little kohl behind her eyes and sprayed herself with perfume, sticky and sweet.
Her second number was more choreographed and started like this:
She and the dancers entered with chairs. The chairs were arranged with her on center stage. The audience applauded and whooped and the girls smiled as brightly as they could beneath the white hot spot. “Last Nite” strikes up with the jumpy stutter of piano. It was a straight-forward dance. The hardest part was singing as she moved, bicycle-kicking her legs above her head in the chair. She abandoned the chair half-way through the song and scat at the microphone, accompanied by the instrumental riff.
They don’t understand
No, girlfriends, they won’t understand
A cheer went up from the crowd, beer spilling from raised glasses.
Last night he said
“Oh, baby, I feel so down”
“And it’s turnin’ me off when I feel left out”
So I, turned around
She turned slowly, kicking the tulle train back out as she did with her heel. Her arms were raised above her head, smiling wide.
“Oh darling no care no more
I know this for sure, I’m walking out, I’m walking out that door
And ain’t gonna understand
She winked and blew kisses to the growing crowd in the audience. She scanned the faces at the tables for Peaky Blinders. Then she saw the tell-tale peaky cap pulled down over his face. She couldn’t see his face in the darkened house but the way his table was separated from the rest in the club, and completely empty save the man sitting there with Irish Whisky told her enough. The crowd’s applause came to an end and she snapped back into character, curseying and raising her hand to the band.
“Thank you!” She twirled once more to show off her ensemble and curled her finger at Johnny who was still standing off stage.
“Oh, Johnny!” She called him out on stage and when he waddled over she put her chin on his shoulder, “Get these wonderful men a drink huh?” She smiled innocently. The crowd exploded with hoots and hollers. “That’s for making me meet with Shelby without asking me first, Johnny.” She growled beneath her breath and smiled at the crowd, “sweet dreams, boys!” The men waved from the audience and the girls scurried off stage.
She was too distracted to speak to anyone right after the show. She went straight to the dressing room and removed the tulle train from her shorts, grimacing as she did though it caused her no pain. Tommy was too smart to fall for her Lady Lenore act and she silently cursed herself for making the character such a staple of her success. He would be able to see through her confidence to her fear wallowing in her eyes. Some of the girls helped her quickly slip into a blush pink dress, the drop waist brushing against her hips. She changed into her normal heels, shiny black mary janes, and pulled off her headband. She left the star necklace around her neck but removed the gloves and extra jewelry. Lucy wiped off her bright red lipstick, changing it for a more casual color. One of the younger girls, Lily, ran in and called for her.
“Nore, Johnny said to take the spare dressing room.”
“Got it, thanks.” She nodded and exhaled loudly, pushing air through her nose. “He has everything fucking planned out,” she cursed below her breath. “Is he going to undress me for him too?” She grumbled and wiped kohl fallout from beneath her eyes.
“He may not want that.” Lucy offered.
“That’s what men always want, Luce.” She responded and sighed. With one last smile, she opened the door into an adjoining room called the spare dressing room. It was called that but it had never been one. There was a bed against the back wall with wood bed-frame and carved posts. The bed was dressed with clean sheets everyday and draped with a heavy red quilt to keep out the December cold. This was the nicest room out of the lot and it was reserved for our best clientele. A table and chairs separated the bed from the main door to the hallway. A bar cart sat idly against the side wall, stocked with cheap liqueur and towels. On the opposite side was a lounge in dark red fabric to hide stains. The wood floors were cold without the heaters and she could feel the chill even through her heels. She perched herself on the arm of the lounge and settled, waiting for Tommy Shelby to arrive.
He didn’t know when he came in, he wasn’t worried if he happened to walk in on anyone, and he just didn’t care. He avoided her eyes as he stepped into the room and closed the door, loud voices carried down the hallway like the smell of cigarette smoke. When the door was firmly closed behind him, he finally caught her eyes.
“Hello Mr. Shelby.” She didn’t move to stand.
“Miss Panning,” he gave her a curt nod, “or shall I call you Lady Lenore?”
She smiled and rolled her eyes. “Miss Panning unless you’d prefer to call me Lady Lenore.”
“Well Miss Panning,” he walked to the table and lit a cigarette, dropping the lighter and cigarette case on the table, “I’m sorry for disturbing your evening.” He gestured loosely to the direction of the stage, talking around the cigarette.
She sighed and stood, taking a cigarette that Tommy offered out to her. She held the cigarette between her lips as he flicked open the lighter and the cigarette caught. “Did you like my performance, Mr. Shelby.” She smiled, blowing out the smoke. He looked down at his shoes and exhaled a cloud of heavy gray smoke, his hands in his pockets. When he looked up his smile was pained, his brows furrowed.
“Eh, not really my thing.”
“Mmm of course. From what I’ve heard you like it quick and dirty. You’re not one for a performance, are you?” She teased darkly and moved to the bed, sitting at the end. He watched her, his eyes calm and unfazed. She flicked the ash of her cigarette to the floor and crossed her legs, the slit in her dress showing her thigh. He stared at her thigh, puffing on his cigarette.
“What do you want, Mr. Shelby?” She asked him bravely. He tore his eyes from her exposed leg and looked into her eyes. Exhaling and pulling the cigarette from his lips he rubbed his thumb across his thick lips.
“I want us to be friends, Nore.” He said finally, his voice restrained, holding back a layer of information he wouldn’t easily give up.
“I’m Nore now?” She almost sneered.
“We were neighbors once if you remember.”
“Those days are far behind us now, Mr. Shelby.” She tucked her hair behind her ear and looked down at the ground.
“Tommy.” He inclined his head slightly and stubbed out his cigarette. “And maybe they are but that doesn’t mean we can’t become friends again now, does it?
He’d said something like that years before when she was fifteen, he was seventeen, and best friends with her brother. Her brother told him that she had a huge crush on him and he’d treated her kindly, offering to be her friend, though nothing more. Hearing him now brought her back to that moment in the alley between their houses, ducking beneath the laundry lines. He’d told her that maybe when she was older… but he went to war and never came back the same. He hadn’t spoken more than a few sentences to her since, plagued by guilt. She’d lost her brother in the war.
“Why do you want to be friends, Tommy?” She asked slowly, fighting the images of her brother that entered her mind when she looked at him.
He lit another cigarette and pulled it from his lips.
“I think we can help each other.”
“Oh?” She switched legs, letting the fabric slide slowly over her skin. He watched, his jaw clenched, in what she read as distaste.
“I need someone who’s willing to be my eyes and ears inside this club. I know Billy Kimber and his men meet here.”
“Does this job require more than ‘eyes’ and ‘ears,’ Tommy?” She looked down at her cigarette.
“It would require anything that gets them comfortable to talk to you, you can fill in the rest.” He looked over at the whiskey. “Whisky?” He asked and she nodded.
“Yes, please.”
He took two thick crystal glasses from the cart and poured. He rounded the table to hand her a glass and she took it, looking up into his blue eyes. He took a deep drink from the whiskey and sighed. She drank and swirled the caramel liquor around in the glass.
“You know, Tommy, I don’t sleep with all of my clientele. Believe it or not but I prefer working boys over men like Kimber. I’m still a Small Heath girl, Tommy. That’ll never change, no matter how many rich men come in here promising me globs money in return for a quick fuck.”
He looked down at his shoes and nodded, thinking. He downed the rest of the whisky and cleared his throat.
“Will you do it?” He asked.
“What do I get in return?” She sighed.
“Money and protection, of course.” He put his glass on the table and leaned against it, sucking on his cigarette.
“Anything else?” She smiled softly.
He looked at her, expressionless, trying to determine what she wanted from him.
“What else would you like, Lenore?” He asked softly.
She swallowed the rest of her whiskey and smiled sweetly at him, taking from her character.
“Well, if we’re really to be friends, I want you to come to my shows.” She stood and reached around his waist to the ashtray and stubbed out her cigarette, looking directly in his eyes.
“And besides,” she continued softly, “men like nothing more than competition. If Kimber learns that you fancy me, he’ll do whatever he can to get with me.”
She took a step back and took a second cigarette from Tommy’s breast pocket. He lit it for her without a word.
“Alright,” he nodded, his face unchanging, “anything else?”
Her eyes softened and she fought back weak tears.
“Look after my father, Tommy. Make sure he’s safe too. If not for this, for James.” The mention of her brother stilled something in him. He nodded and cleared his throat. He turned and walked to the door to the hallway.
“Tommy,” she called from the bed. He paused with his hand resting on the door handle, “you know he’s going to kill me before they tell me anything you want to hear.” She said softly, almost sadly.
He said nothing for a moment and inhaled, looking over his shoulder though his eyes didn’t meet hers.
“I won’t let that happen.” He said evenly and left, the door closing loudly behind him. She tried to still her shaky hands, dragging on the shrinking cigarette.
_______
end part 1 here :)
148 notes
·
View notes
Okay, FINE, the shows you should watch for BL's QUEER AF roots
You ready to go hunting?
Many of these are difficult to find. Also many of the images of them and their posters have been block/banned by tumblr, so, no screen grabs for you! (Good times.)
I don't necessarily *like* any of these, but if you are queer and in this fandom and need to dialogue around BL's queerness - these are going to provide a foundation for you. They are important for various industry, reputation, directorial, and cultural reasons. As seeds often are.
Trigger warnings throughout.
The true beginnings:
Boys Love, Japan's 2006 movie is a REALLY rough start featuring a journalist + hot model = murder gay, mild necrophilia, cheating, abuse, rape, and suicide for love. Start as you mean to go on, why don't you, Japan? Is it queer... maybe? Is it BL... honey, I am very sorry to inform you, this started BL.
Note: Yoshikazu Kotani is famous in og BL circles since he acted in 3 early BLs, both Boys Loves and then Same Difference. Also he v tall and hawt.
Eternal Summer, Taiwan 2006 - unlike Japan, Taiwan did NOT start how it would, eventually, go on. But what a messy way to start. A high school story of 3 besties in a love triangle, self discovery, and sexual awakening that fucks it all up.
No Regret, Korea 2006, is a very unhinged queer catastrophe piece about a lost gay man who ends up a host and then almost a murderer because of both his job and his identity.
Note: This is the directorial feature film debut of Lee-Song Hee-il Korea's (so far as I know) first openly gay director who specialized (to this day) in queer content.
The Love of Siam, Thailand 2007, this was Thailand's queer awakening, sure they would backpedal for YEARS after, but in 2022 they began to remember what this movie was (and did) and overtly referenced this quiet little masterpiece. This movie is sad but stunning in that way that the best queer works from Thailand can be (like Present Perfect or ITSAY.) It has Thailand's quintessential softness around theme and character, which you'll understand perfectly when highlighted against the backdrop of the early 2000s works from Japan, Korea, and Taiwan. Thailand will never lose this soft style and it's one of the most attractive qualities of Thai BL: it's never very harsh with us or its characters. This movie very easily COULD have been quite harsh indeed.
I thought long and hard about including Rice Rhapsody AKA Hainan Chicken Rice (Hainan ji fan) on this list and finally decided it doesn't really qualify. Still let me mention Hong Kong's 2005 movie. It is amazing, fascinating, and very rough going for an ostensible comedy. It wasn't the actual beginning because few saw it and Hong Kong never really picked up or ran with BL let alone QL, but it was hella queer. It's also hella homophobic.
Just Friends? (2009 Korea) - this is Korea's first (kinda) upbeat version of a BL featuring already established boyfriends, one of whom is on military leave, trying to decide on coming out, family life, and the future. All of these are themes Korea will pretty much never tackle again, retreating as they would to their bubble. But what a fun little offering this little show was and is to this day. You should watch it.
Like Love 1 AKA I Love You As A Man: Part 1 - China's 2014 offering is actually pretty classic early form live action yaoi with things like whipping boy, a university setting, rich/poor jock/nerd pairing, hard grumpy/sunshine and a very odd title. It's pre-censorship with an HEA, also explicit, yeah China once did that. This is a lot less queer that it is classic BL and classic Chinese romance, neither of which have any kind of connection to reality. But hey, that's what I'm here for. But it's important to note the drifting away from queerness beginning to occur.
Love Sick - Thailand's 2014 "boys in blues shorts" high school set soapy (in all ways) offering is widely considered the true beginning of Thai BL and by default, eventually, BL as we know it today. (As the biggest producer they somewhat dictate taste and trends in the genre.) This is one of those BLs that owes almost nothing to yaoi, although it started a number of tropes that are now endemic to Thai BL. What it is, instead, is a well scripted story of bisexual self-discovery and the inherent chaos of loving someone of the same gender for the first time, all wrapped up in hormones, existing relationships, and communication issues. It is high school queer angst at its messiest. Nothing is going to be easy for these boys because queer isn’t easy but also because life isn’t easy… welcome to adulthood sweethearts. Is is overtly queer? For 2014 Thailand? Sure is.
Love Next Door 2 a movie from 2014 and one of Thailand’s early very high heat pieces, it’s odd, but sexy I guess? Some unexpectedly decent queer rep including femme characters getting screen time + HEAs. (Part one from 2013 has the same high heat content and features the same lead character (and actor) discovering he is gay with the sex worker next door, but isn't as good nor is it relevant to this installment.)
A few other unknowns, for the queer babies
Wait For Me at Udagawachou AKA Udagawachou de Matteteyo - from Japan in 2015, this is a story about two boys in high school one of whom is a repressed outsider and the other who has a terrible secret (body dysmorphia & cross dressing). When the first boy discovers what's up with the second one, his reaction is very much fetishization. "Oh Japan must you?" kinda started for me with this show. But in this case, Japan, weirdly MUST. This is the ONLY show laboring under (and testing) a pointedly straight lens (or is it?) and identity examination (yes but which boys' identity? that's the question) that I've EVER seen even edge into the BL genre. It is crazy queer, even as it mostly focuses on the fetishization of identity from an outsider's perspective. I WISH more people in fandom would watch it so I could at least talk to someone about it.
The Lover (BL Cut) Korea's 2015 series had multiple couples in an apartment complex, one pair of whom is a BL romance between a Korean man and a visiting Japanese tourist (played by a Kpop idol). It's comedic, slapstick sexy only (no kissing), but basically starts up Korea's bubble and use of idols in BL. It's kinda fascinating to watch them dodge around and still represent gayness in what (is sadly destined to become) a very Chinese way, but which Korea in pursuit of Hallyu and market share would morph into the bubble.
Mr. X and I from China in 2015 is a compilation piece and, I think, the first of this kind of multiple narrative shorter grab bags AKA "Sampler Pack BL." Two of the stories are very queerly sad, but the third is CLASSIC BL of the kind that would become China's best (and last) true BL, Addicted.
Sweet Boy, (Thai 2016) Chimon's first gay role and it is quite sad, oddly sexy, and similar to Dew the movie or My Bromance (just so you know what you are in for) but the acting is on point. When Thailand goes dark, this is how they do it, but this is rough going for baby queers because that's the darkness it is exploring. Our old thematic friends: the pain of self discovery and coming out into a homophobic environment and unfriendly reality, and the cost of being the one able (and willing) to stay in the closet.
Method (Korea 2017) this movie is a May/December actor/idol pairing, that should have been everything I wanted in life but is more about the older character cheating on his wife and their weird “artsy” relationship and frankly, I hated it. And I don’t say that lightly. Is it queer? Who tf knows, but is sure has some interesting things to say about the nature of PERFORMATIVE queerness.
Red Balloon is Taiwan's 2017 precursor BL to their biggest and most famous prestige piece Your Name Engraved Herein. If you're making a choice, choose that instead, but this series certainly paved the way for it to come into existence. Both shows tackle the pressures of culture and social structures on self acceptance and identity and the loneliness inevitably caused by conflict between the two.
(As indeed does Life Love On The Line, Present Perfect, Grey Rainbow, Tropical Night, My Sky, and many other queer meets early BL pieces that revolved around coming out and family acceptance.)
China's 3 2017 "they tried to censor the gay... and it went HORRIBLY wrong":
Beloved Enemy,
The Fairy Fox,
Mr. CEO is Falling in Love with Him.
Honestly these 3 are basically the uncanny valley of BLs.
The Novelist AKA The Pornographer series (2018-2020). Messy psychological machinations, gaslighting, fetishization, sexual corruption, and more good times from "well, what did you expect?" Japan, but also no holds barred queer, just well and truly fucked in the head (and arse) about it.
The Cornered Mouse Dreams of Cheese AKA Kyuso wa Chizu no Yume wo Miru (Japan 2020) - Drama llama queers so queer and so dramatic it's like Japan is trying to PROVE something: obsession, cheating, break-up, reunion, then break up again, all of it explicit. This show is just SO JAPANESE. I can't even, but you should watch it and you'll know exactly what I mean. Something like My Personal Weatherman owes it's lineage to this kind of BL. If you like Japan naked, boney, emo, and smoking (hot & ciggy) you will love this, and should watch it. It's objectively amazing, I can't stand it, but I NEED people to talk about it more.
More Queer Stuff about BL from moi
BL Linguistics & Queer Identity - I Am Gay versus I Like Men
Will BL Get More Honestly Queer?
Actually gay, not BL gay - the idea of “by queers, for queers, about queers,” the BL bubble, sanitized gay, and a queer lens
Queer lens (from the director) and chemistry (from the actors) in BL (A Tale of Thousand Stars)
Touch & Daisy in Secret Crush On You - Queer Coded Language and 3rd Gender Identity
BL in Taiwan & Gay Marriage
Debating Queerbaiting in BL ( + Devil Judge… is it queerbaiting?)
BL Actors and the Assumption of Queerness - outing actors, coming out, being out, more: Is that BL actor actually queer?
So is it really fetishization? straight women loving bl
Some BL fans are sasaengs, and it’s a problem in this fandom
BLs That Highlight How Society Treats Queers
10 BLs That Are Honest to a Queer Experience
If you like these kinds of shows try the "Moody Arthouse Smackdoodle" section of this post too.
Happy watching!
(source)
250 notes
·
View notes
roosterforme's '80s Rocktober Playlist fic challenge
For those about to rock, we salute you!
Let's rock 'n' roll the Top Gun way! Choose an '80s rock song (or pop or country or rap...), and write a fic about one or more of our favorite Top Gun characters! Just make sure the songs are from Rooster's favorite decade, the 1980s!
Or create a banner or mood board! Go with an '80s vibe or a specific song to inspire you and run wild.
Banner credit to @mak-32. Rock on, Mak.
Rules for fics:
Please use the #top gun rocktober hashtag!!!
Once you have your song selected (first come, first served, no duplicates), please send me an ask letting me know which song and character(s) you want to write about. If your song is not listed below, just let me know what you want with your ask and I’ll add it (as long as it fits the decade). If your song has been claimed already, I'll let you know so you can choose another one.
You can use the song in the fic however you would like. Use it as the title, use some lyrics, have the song playing in the background, use it as inspiration, anything you want!
There is no real time limit, but please try to post in September or October.
Please make sure you tag me (or send me a message) when you post your story so I don’t miss it. I can’t wait to read and reblog!
Please reblog and share this with anyone who may want to participate. And reblogging fics is always a treat for writers!
If you’re under 18, do not submit or read smut.
Rules for banners and mood boards:
Please use the #top gun rocktober hashtag!!!
If you want to use a specific song, please send me an ask letting me know which song. If you want to participate with the '80s vibe and no specific song, just send me an ask and let me know you'll be submitting an image or images.
Please make sure you tag me (or send me a message) when you post so I don’t miss it. I can’t wait to reblog!
Please reblog and share this with anyone who may want to participate.
Songs and fics we are rocking out to:
1 @roosterforme What's Your Name by New Order (Bradley)
2 @beyondthesefourwalls Time After Time by Cyndi Lauper (Bradley)
3 @sylviebell Faithfully by Journey (Natasha)
4 @wkndwlff Love Walks In by Van Halen (Bob)
5 @desert-fern Jump by Van Halen (Bradley)
6 @yanna-banana Like a Prayer by Madonna (Jake)
7 @fanboyswhore9 Addicted to Love by Robert Palmer (Mickey)
8 @cherrycola27 Born to Be My Baby by Bon Jovi (Bradley)
9 @trickphotography2 Start Me Up by The Rolling Stones (Bradley)
10 @blue-aconite Every Little Thing She Does is Magic by The Police (Jake)
11 @roosterforme Do You Wanna Touch Me? by Joan Jett (Bradley)
12 @startrekfangirl2233 Wake Me Up Before You Go-Go by Wham! (Mickey)
13 @bradshawsbitch Hungry Eyes by Eric Carmen (Bradley)
14 @bellaireland1981 Can't Fight This Feeling by REO Speedwagon (Bradley)
15 @wkndwlff Lay Your Hands On Me by Bon Jovi (Bob)
16 @beyondthesefourwalls Jessie's Girl by Rick Springfield (Javy)
17 @thedroneranger Boys of Summer by Don Henley (Bradley)
18 @cottagecori Dancing With Myself by Generation X (Bob)
19 @sweetwhispersofchaos I Hate Myself For Loving You by Joan Jett (Natasha and Jake)
20 @sometimesanalice Straight Up by Paula Abdul (Bradley)
21 @lovinglyeternal Call Me by Blondie (Jake)
22 @roosterforme Adult Education by Hall & Oates (Jake)
23 @beyondthesefourwalls Your Love by Outfield (Bradley)
24 @mayhemmanaged You Shook Me All Night Long by AC/DC (Jake)
25 @topherwrites Love Shack by The B-52's (Bradley)
26 @ficsilike-reblogged Take On Me by A-ha (Bob)
27 @cottagecori Rock You Like a Hurricane by Scorpions (Bradley)
28 @jupitercomet Kissing a Fool by George Michael (Bradley)
29 @startrekfangirl2233 Don't You (Forget About Me) by Simple Minds (Jake and Bradley)
30 @topherwrites Just Like Heaven by The Cure (Jake)
31 @sweetwhispersofchaos As the World Falls Down by David Bowie (Natasha and Bob)
32 @inmyloveworld Open Arms by Journey (Bradley)
33 @thedroneranger Centerfold by J. Geils Band (Jake)
34 @gretagerwigsmuse Can't Hardly Wait by The Replacements (Bradley)
35 @bellaireland1981 Love is a Battlefield by Pat Benatar (Jake)
36 @blurredcolour Push It by Salt-N-Pepa (Jake and Bradley)
37 @blackwidownat2814 White Wedding by Billy Idol (Jake)
38 @keep-on-burnin The Look by Roxette (Bradley)
39 @cherrycola27 Secret Lovers by Atlantic Starr (Natasha and Javy)
40 @topherwrites Uptown Girl by Billy Joel (Bradley)
41 @jynxmirage If I Could Turn Back Time by Cher (Jake)
42 @notroosterbradshaw Edge of Seventeen by Stevie Nicks (Bradley)
43 @ficsilike-reblogged Hungry for Heaven by Dio (Beau)
44 @callsign-magnolia Who's Crying Now by Journey (Bradley)
45 @trickphotography2 Every Breath You Take by The Police (Bob)
46 @sarahsmi13s Pour Some Sugar on Me by Def Leppard (Jake)
47 @roosterforme Cover Girl by New Kids on the Block (Natasha)
48 @bobfloydsbabe Alone by Heart (Jake)
49 @ughthisisntright The Stroke by Billy Squier (Bradley)
50 @wkndwlff Special Secret Song Inside by The Red Hot Chili Peppers (Jake)
51 @sylviebell Thriller by Michael Jackson (Natasha and Javy)
52 @xoxabs88xox Why’d You Come in Here Lookin' Like That by Dolly Parton (Jake)
53 @paigewinchester67 I'm On Fire by Bruce Springsteen (Bradley and Jake)
54 @sarahsmi13s Fishin' In the Dark by Nitty Gritty Dirt Band (Bob)
55 @callsign-joyride Need You Tonight by INXS (Bradley)
56 @foreverrandomwritings Paradise City by Guns N' Roses (Beau)
57 @cherrycola27 Whoever's In New England by Reba McEntire (Bob)
58 @1234-angelika The Bluest Eyes in Texas by Restless Heart (Jake)
59 @decantedenchanted Right Here Waiting by Richard Marx (Mav)
60 @the-authoress-writes Black Velvet by Alannah Myles (Jake)
61 @withahappyrefrain Somebody to Love by Queen (Bradley)
62 @valhallaas Hold on Loosely by 38 Special (Javy)
63 @talktomegooseman The Chair by George Strait (Jake)
64 @foreverrandomwritings Master of Puppets by Metallica (Mickey and Bob)
65 @poetrieshouse Hungry Like the Wolf by Duran Duran (Mav)
66 @tongue-like-a-razor Poison by Alice Cooper (Jake)
67 @1234-angelika Real Love by Dolly Parton and Kenny Rogers (Bradley)
68 @the-authoress-writes The Flame by Cheap Trick (Ice)
69 @hangmanstigerlily Can't Fight This Feeling by REO Speedwagon (Jake)
70 @samsgoddess Hysteria by Def Leppard (Bradley)
71 @eternalsams Cherry Pie by Warrant (Jake)
72 @love-in-light Livin' on a Prayer by Bon Jovi (Bradley)
73 @thatdammchickennugget Summer of '69 by Bryan Adams (Bradley)
74 @whatislovevavy Everybody Wants to Rule the World by Tears for Fears (Jake)
Totally rad cover art:
@ryebecca She Drives Me Crazy by Fine Young Cannibals
@bettycooper Running Up That Hill (A Deal With God) by Kate Bush (Bradley)
@ryebecca The Power of Love by Huey Lewis and the News (Bob)
@mak-32 Get Outta My Dreams, Get Into My Car by Billy Ocean (Bradley)
@laracrofted I Love Rock 'n' Roll by Joan Jett (Bob)
@sebsxphia Come On Eileen by Dexys Midnight Runners (Bob)
Need some song inspiration? Check out these bangers:
Every Little Thing She Does Is Magic - The Police
Start Me Up - The Rolling Stones
Livin’ On A Prayer - Bon Jovi
Eye of the Tiger - Survivor
Shout - Tears for Fears
You Give Love A Bad Name - Bon Jovi
Every Breath You Take - The Police
The Final Countdown - Europe
Angel - Aerosmith
Edge of Seventeen - Stevie Nicks
Uptown Girl - Billy Joel
Call Me - Blondie
Take Me Home Tonight - Eddie Money
Free Fallin’ - Tom Petty
Hysteria - Def Leppard
I Hate Myself for Loving You - Joan Jett & the Blackhearts
Just like Heaven - The Cure
I Won’t Back Down - Tom Petty
Magic - The Cars
Love Is A Battlefield - Pat Benatar
Addicted To Love - Robert Palmer
Love Shack - The B-52’s
Without You - Motley Crue
Material Girl - Madonna
Legs - ZZ Top
Paradise City - Guns N’ Roses
Can’t Fight This Feeling - REO Speedwagon
Cum on Feel the Noize - Quiet Riot
351 notes
·
View notes