˖ ࣪ ، ◞ せ⌇ SWEET TALK. featuring choso.
↻ choso lives for one thing ; to make sure his precious girlfriend is never unsatisfied.
tags : cunniligus, dirty talk, body worship, male masturbation, overstimulation, squirting, fingering, mentions of face sitting, feral choso // wc. 0.7k
author's note : i lowkey wanna thank @toadtoru for sending in an ask about this before i even posted it, because i used some of those ideas to improve on this :3 in true homage to my username choso is a complete slut in this lolsies ;) one more to go and this event is finished, thanks for sticking around for THIS long i love everyone here >o<
this work is NSFW. minors and ageless blogs DO NOT INTERACT.
if there’s one thing CHOSO firmly believes in, it’s that you aren’t just his girlfriend, but some supreme deity from heaven above. it sounds completely ridiculous, but he believes it more than anything, especially in moments like this.
you just look so beautiful above him on the couch, thighs parted slightly and fingers caressing the sensitive mound in between your legs, head tipped back and lips parted in a silent ‘o’ as your toes curl into the carpet. angelic, he thinks, and he can’t wait to receive permission to touch you.
“choso…” your voice is smooth like butter yet sweet like caramel, and choso can feel his cock begin to press up against his slacks. “c’mere.”
yes. that’s all he needs before he’s eagerly crawling in between your legs to lap at your cunt, fingers digging into the fat of your thighs as he pulls them apart in earnest. “shit… missed me, did she?” his rambles are fueled by pure lust and delusion, and as he eats you out, choso begins to talk into your cunt. “missed her too… poor baby can’t go too long without her sweet boyfriend, huh…”
fingers tangle in his dark locks as you pull him closer, effectively muffling his ramblings by grinding your lower half on his tongue. the way he eats you out is feverish, his wet muscle alternating between your inflamed clit and pulsing hole interchangeably. and choso can’t help himself from getting fired up by your lewd display too, his own hips grinding down onto the couch as he finds solace in between your legs.
you, on the other hand, are positively reeling, legs twitching uncontrollably as choso continues to make a mess of your poor cunt. you wish you could return to him the same pleasure tenfold, but all you can do is sit and take it, helpless to his ministrations. “cho, cho, ‘s too much, baby, s-slow down…”
begging is futile. choso is hypnotised, his own eyes rolling into the back of his head in an immediate reflection of your own reaction. “sorry baby, can’t, you taste s’good, don’t wanna…”
neither of you are in your right mind, but choso especially. when you cry out from orgasm for the first time, he barely takes note, his tongue on your clit never letting up as he brings two fingers to the entrance of your weeping cunt. the other hand previously on your thigh is now shoved into his boxers, and he’s fisting himself just as quickly as his fingers begin to plow your pussy.
he’s killing you, but you love it. his brown eyes peek up in between your legs, and you just catch his expression, pupils dilated with lust as he watches you twitch above him. he mumbles something onto your clit before he’s licking and kissing it again, and you begin to think you might actually die.
“c’mon, baby,” he groans, hips thrusting forward into his palm as he continues to eat. “c’mon baby, gimme another one– fuck, please, please…”
“choso, i can’t…” you truly believe that, given the way he’s already on his way to giving you another orgasm in the short span of five minutes. but he needs it so bad, needs you to cum for him so bad that he speeds up, thumb now joining his tongue to stimulate your clit in unison. “choso!”
“that’s it, baby, that’s it, oh, she’s close, isn’t she?” you can barely believe that he’s treating your pussy like its own person, but fuck is it turning you on. you hiccup pitiful whimpers as your thighs begin to tremble again, knees closing inwards and trapping choso’s head in between your legs.
if he were to die in this position, he wouldn’t mind. your release sprays his lips in repeated spurts, juices dribbling down his chin and some even dripping onto the flared head of his cock. it’s that which tips choso over the edge, and he’s spurting ropes onto the carpet, his own eyes finding the back of his head rapidly as his nose jerks against your clit.
“baby…” he stares down at the mess he’s made on the floor and then back at you, who’s laying spread eagle on the couch, chest rapidly rising and falling. “you gotta sit on my face next time.”
PREVIOUS : SURVIVAL ft. sniper mask NEXT : INKED ft. suguru geto
liked that? check out the WE’RE SO BACK main masterlist.
© choslut 2024 — do not copy, repost or translate my works without permission.
248 notes
·
View notes
Summary; After her difficult breakup, Tiana wanted to start anew with her life. That's when she realized her life would be better when she met him.
This fanfic is 18+! NO MINORS ALLOWED
word count: 3783
Smut warning; it’ll come in the story randomly so PLEASE PLEASE look out for it I’m not really good at writing ✍🏽 smuts but I’m improving at the moment.
Jey Uso X Tiana
AWFUL GRAMMAR IM GETTING BETTER I SWEAR LOL.
comments, likes, repost are appreciated I would love the constructive feedback in what area I need to approve in. 🤍
ALSO! I don’t not want nobody stealing my fanfics or take it as theirs that will be an issue fasho so keep it cute respectfully.
I only own my OC along with the make up scenarios
But I’ll be writing along the way since this story is in my drafts on Wattpad right now so yuh 💁🏽♀️
TAGS⬇️ lmk if you wanna be tagged 🏷️
@paigereeder @pinkwithhearts @jstarr86
I.
Have you ever thought about running away? And starting somewhere new? Having a fresh start with things, especially having a promising career?
Tiana was doing that, starting somewhere fresh, living with her best friend Bianca in Cali after her messy breakup with Malakai when she saw him cheat on her with someone she knew.
But she wasn't worried about that man. She stood her ground while focusing on her career as a Nail Tech, getting her money's worth so she could have a place of her own.
She did the dumbest thing ever: She got this man tatted on the side of her right ear. Bianca convinced her to cover it with something pretty.
But she didn't know any tattoos around here; only Bianca did. She contacted a tattoo shop near them and scheduled an appointment.
OMNISCIENT
Tiana was finishing up with her last client of the day before shutting down the shop. She had a tattoo appointment afterward, so she wanted to get this done before she was late.
She focused on her clients' nails as she applied the last few bits of gems to their nails while turning on the curing light and placing their hands under the light.
Her phone beeped as she saw Bianca texting her, probably about her appointment at the tattoo shop.
Breezy💁🏽♀️: Tianaaaaa wyd girrrl?
Tiana: I'm finishing up my last client before heading to my appointment today.
Tiana: are you sure they're like legit? Bc if I get a fucked up cover-up, I'm going to kill you. 😀
Breezy: yesssss lele they're legit like this man owns the business chile. 😐
Tiana: oh fr?
Breezy: yes T
Tiana: do they have an Instagram page showing their artwork?
Breezy: yeah, I'll send it to you on Instagram.
Tiana: okay, girly, I'll text you later.
Breezy: bye, girl.
She turned off the curing light as her client looked at her nails with a smile on her face; she was satisfied with her results. Her client knew that Tiana was the shit when It came to doing nails.
Tiana instructed her to take a pose with her hands to show off her nails so she could post it on her IG story. She started doing nails when she was sixteen years old. Her mom and stepdad helped her with everything, and she was very grateful for that because look at her now.
biancabelairwwe replied to your story: ouuuuu girl them are honestly cute asf.
sheloveemma replied to your story: BOOK ME NEXT NOW!
ughitsstacy replied to your story: girl, I LOVE THEM! PERIOD!
shelovekai replied to your story: damn, mama, you snapped.
She looked at Malakai's reply to her story as she just rolled her eyes; she could've sworn she had blocked that man she didn't want nun' to do with his toxic ass; her client paid her with an extra tip due to how much she loved the nails as she told her goodbye.
Tiana smiled at the woman as she went to lock the door, getting ready to sanitize everything before her appointment. She was wiping down her equipment and the table with a warm rag, making sure that everything was cleaned and that she wasn't missing any spots.
She checked the time on her Apple Watch, seeing that she had to leave for her appointment to get this nigga name covered up due to the simple fact that she got tired of seeing it every single time she took pictures.
Tiana did one last check around the place, making sure that everything was back to where it was, before grabbing her purse and turning off the lights as she headed back towards her 2017 BMW.
She entered her car by shutting the door behind her, grabbing her keys as she put them in the ignition, and pressing the button to start it up.
She applied lip gloss on her lips and began pulling out the driveway towards the tattoo shop.
✧.*
Tiana pulled up towards the tattoo shop, turning off her car while grabbing her purse. As she entered the place, she looked around the area. She saw the shop's very cultured aesthetic, and the smell of the place seemed so refreshing to her.
She noticed that two other people were sitting at the reception table on their phones. Since it wasn't that busy today, she walked up to them, and they both looked at her.
"Hello, ma'am. I'm Kiara. What can I help you with?" Kiara asked.
"Hi, I'm here for an appointment at 3:50," Tiana said as she pulled out her phone to show them her appointment.
"Ah, you're Miss Tiana?"
She nodded her head yes as she patiently waited while clinging onto her purse.
"And you're here for a cover-up?" She asked.
"Yes, I am." She saw the woman nod her head as she looked up at her.
"Okay, you're set, ma'am. Please have a seat. He will be right with you."
"Thank you," Tiana said as she sat down in the chair.
She was scrolling through her IG, seeing people had liked her story that she had posted an hour ago. Replying to people who responded to her story, she saw a text pop up, so she scrolled down to see who it was. It was Malakai from an unknown number since Tiana blocked him.
Weirdo: mamas, can you unblock me, please? I promise I've changed.
Tiana: Kai you finna get blocked again leave me aloneeee
Weirdo: you know that you're mines forever.
Tiana: tuh in your dreams nigga bye.
Tiana rolled her eyes while proceeding to block his new number. She was thinking, 'nigga probably using WhatsApp or TextNow to get new numbers.' While she was doing that, her eye caught something as she saw a man getting his equipment out.
She tried to make out his features but couldn't due to the door being closed. She would have to wait until she got in that chair, but she went back to scrolling through her Instagram.
Breezy: bestieee are you at your appointment?
Tiana: yeah, I'm here.
Breezy: good cuz Ik your ass would've forgot I'm so glad you're getting that shit covered.
Tiana: yeah, me too tired of seeing that shit.
Breezy: do you like the shop?
Tiana: yeah, I love the aesthetic of it, and it smells good.
Breezy: seee I told you I got'chu girl.
As she was texting away, she pulled her head up and saw the same man standing at the door, waiting patiently for her until Kiara said something to her.
"Excuse me, miss, but you can come in now," Kiara said.
Tiana nodded her head yes, grabbed her purse, and walked past the specimen while sitting on the chair. She placed her bag on the table next to her.
She looked up at the fine specimen, finally making out his features, and boy, was he fine as hell. He was wearing some sweats with a black graphic shirt, and his shoe game was on point. Of course, he had a mullet and ear piercings on both sides of his ears.
His toned muscular body, along with his Tanned skin and salt/pepper beard, it wouldn't be rude to her if she kept eye fucking him while he was getting ready.
"You getting a cover-up?" Josh spoke, breaking the silence.
'Damn, his voice was deep as hell.'
"U-um, yeah, I am around my ear, " she said, noticing that she was stumbling on her words.
It caused him to chuckled a little bit while looking at her face, "You ain't gotta be nervous around me, Princess Ion' bite." She was taken aback for a second. 'Princess?' Well, she hadn't heard that nickname before. Is he always like this with his clients?
Tiana shook off the feeling as he pulled out some designs to show her, to see which one she liked better. She looked at his designs and was amazed at his artwork; it was perfect.
But one design caught her eye. It just looked so beautiful: two butterflies with a cross between them.
"I like this one; it caught my eye," Tiana said as she smiled.
He nodded his head as he took the design that she wanted behind her cover-up.
He pulled the chair towards her and reclined it back a bit so that she could be comfortable. He put on some black gloves while grabbing the tattoo pen.
"Can you turn your head for me, mama? " he asked. She nodded yes and turned her head to the side.
He started working on the cover-up behind her ear. He noticed that a male's name was tatted behind her ear. He had a smug expression on his face.
"So you got a name tattooed on you?"
Not trying to be in her business, but was trying to be in her business.
"Yeah, I got this lame ass nigga tatted on me that I was with for a while until he did some messed up shit, so my bestie decided to hook me up." She said while being still.
"Hm, how long was yall together?" He asked while focusing on the tattoo.
"We were together for like two, almost three years, maybe?"
He smacked his teeth and shook his head in disappointment. " That's a horrible mistake to get someone's name tatted on you. I heard it was bad luck." She wanted to smack him upside the head but couldn't.
"Don't put that on me, sir. I want no back luck," Tiana said as Josh snickered at her.
"It's not funny, you bozo." He rolled his eyes at her while continuing to do his work behind her ear.
They were back into complete silence again, and she kept hearing the needle buzzing in her ear like some type of fly buzzing around her.
She kept thinking about her relationship with Malakai. It became so toxic for her that she couldn't even deal with his ass anymore after she found out he cheated on her.
Tiana felt like she wasn't going to find love again because she was afraid of the outcome, so she kept her guard up around men, especially the ones who tried to holla at her.
"Who's your best friend?" Josh asked her.
"Her name is Bianca. She told me she comes here often, " she replied while continuing to talk on her phone.
"Ohhhh yeah I know her, I did some designs on her not too long ago."
Tiana nodded her head, listening to him talk. His voice seemed to soothe her because it was so deep and raspy, almost making her sleepy, as she yawned a bit while rubbing her eyes.
He took notice of that, "Long day, I'm assuming?"
"Yeah, I'm just hella tired. I'm not going to lie to you." She said.
He just hummed in agreement as he was finishing up her tattoo while turning off his tattoo pen; Jey had sprayed some alcohol on wet paper towel as he wiped behind her ear, causing her to hiss in pain.
Jey snickered at her reaction as she glared at him, throwing his hands up in defense.
"Aye, you wanted this, not me." He said.
"Yeah, yeah, whatever. How much do I owe you?" Tiana responded as she pulled her wallet out of her purse.
"It's on me, ma; don't worry about it." She looked up at him with a confused expression, which had her thinking to herself, 'What does he mean about that?' Tiana put her wallet back inside her purse as Jey gave her a mirror to check out her new tattoo.
She turned her head a bit to see it, moving her ear to the side to see its design.
"Omg, this is really bomb as fuck." Tiana said.
"Thank you. I mean, they say I'm the best, better than my cousin, no shade or nun." She snickered at his comment as he reclined her chair upwards while she stood up to fix herself.
"Lemme get a quick pic so I can post it on my story." He said.
Tiana knew she was good with poses, so she turned her head to the side, showing off her cover-up tattoo. Jey took a quick picture of it before putting his phone down.
"Thank you; I appreciate it. I never got your name; my fault," Tiana said while monitoring his face.
"My name is Joshua, but people close to me call me Jey or Josh for short—whatever floats your boat, mama." Jey replied.
"I'm Tiana, by the way."
Jey thought to himself for a second while looking at her features deeply. she was a pretty girl that's fahso, and her personality seemed bubbly almost?'Whoever fumbled her cute ass is so unlucky now I'm finna be all up in that.'
"Tiana, huh? That's a cute name for a pretty girl like you; lemme me get your number, lil' mama," He said bluntly as she rolled her eyes at him while he gave her his phone.
He watched her type her phone number in while she gave him back his phone. They stood there in silence as they looked at each other until her gaze shifted towards her buzzing phone.
He watched her walk out his suite as he kept stealing glances at her ass; he knew that thang was thang in that one piece that she had on.
It was almost like he was fascinated with her in some way when they literally just met each other today; maybe it was her features that got him feeling like this with her.
But he had shaken them thoughts outta his head cleaning his equipment up.
✧.*
TIANA
I finally made it home. I parked my car in the driveway right next to Bianca's, turned off the ignition, grabbed my purse, and closed the car door behind me.
As I was walking in the house, I heard moaning and groaning upstairs, which made me realize that Montez was taking Bianca to Pound Town, which I personally did not want to hear.
I went upstairs towards my bedroom while shutting the door behind me as I took off my shoes throwing them on my shoe rack sighing in relief I really did hate being on my feet especially sitting on my ass too.
I fumbled onto my nice, comfortable bed and hugged the pillows until I felt my phone buzz. I thought it was Kai texting me again from a different number, so I went to see who was texting me.
'An unknown number ofc.'
Unknown number: did you make it home safe, princess?
Tiana: who dis?
Unknown number: Did you forget already? You were just here a couple of hours ago, girl.
I had to think about it for a minute since I tend to forget sometimes. The caller ID wanted to FaceTime me, of course. I hung up quickly because I didn't know who this person was until that person called again.
I rolled my eyes. While answering the FaceTime call, she saw a familiar face. That's when it clicked to her: It was Joshua from the tattoo shop.
FACETIME
Jey: now, do you remember?
Tiana: yeah, yeah boy now what'chu want?
Jey: I just wanted to make sure you drove home safe. That's all, princess.
Him and these damn puppy names was going to be the death of me; never had I experienced being called princess like I'm some princess from England or sum.
I placed my phone down on top of my dresser while unzipping my one-piece. This shit was killing me today felt like I couldn't breathe. As I was doing that, I proceeded to wobble my ass outta the one piece hearing Josh snickering.
Tiana: The fuck is funny nigga?
Jey: you, you is funny as hell wobbling like that shawty.
Tiana: Man fuck you, it was really tight.
Jey: mhm
I just rolled my eyes at him and gave him the middle finger. Finally, I got out of one piece and threw it in the dirt bin next to my bookshelf. 'Yes, I read, yes, I'm a nerd.' I was in my underwear while digging through my drawer for some comfortable clothing.
I felt his gaze through the phone, but I didn't speak on it, not understanding why I was getting comfortable with being half-naked on FaceTime with this man I barely knew.
Jey: damn, mama, you got a dump trunk back there.
Tiana: are you flirting with me right now sir?
Jey: maybe, maybe not. I'm just calling it what it is, princess.
Tiana: call me that again imma
Jey: or what?
I ignored him while getting fully naked in front of him and grabbing my towel that was nearby so that I could cover my body until I headed to the bathroom.
Tiana: I'm going to go shower, so I'm going to hang up now.
Jey: nooo, take me with'chu
Tiana: why so? Can you look at my ass or what?
Jey: nah I just wanted to stay on the phone with'chu.
Tiana: sigh ight then whatever you want dawg.
I took my phone with me to the bathroom. As I sat down on the counter table, making it look up at the ceiling, I heard him smack his teeth.
Jey: aye, yo ass betta get me up from looking at this ceiling.
Tiana: my fault, dawg. Lemme fix that for ya.
He seemed pretty annoyed when I did that, but I found it amusingly funny seeing him annoyed at my actions. Meanwhile, I unraveled my towel from my body as I headed inside the shower.
Jey: what do you do?
Tiana: I own my nail tech shop, so I do people's nails and get good tips.
Jey: Fr shawty? shi imma have to pull up to get a manicure from you.
Tiana: I can definitely send you the address to the place.
Jey: Bet that up fasho
✧.*
After taking a nice long shower, I was downstairs cooking me something to eat for dinner while still being on Facetime with Joshua. He was playing the game with his brothers, hollering and screaming at each other like some dogs. I noticed that Bianca came downstairs and came towards me to see what I was cooking.
"Ouuu girl what'chu cooking?" She asked.
"I'm cooking me some chicken in the air fryer along with some rice. I made extra for you and Montez, so y'all can eat after that session y'all had." I said while letting the rice sit.
"Omg, I love you so much, bestie, but who's that on the phone?"
"Oh, that's Joshua."
Her face looked perplexed for a minute, then it clicked, so she put a smirk on her face as I gave her a stern expression, thinking, 'I know this girl isn't going to try to hook me up with this man.'
"B, no, I'm not doing this with'chu tonight, chile." I said.
"C'monn, lele Joshua is a really cool ass person, bro, and then he'll be the first Samoan man you dated." She commented.
Jey: I know that's right, what's up Bianca!
Tiana: Shut the hell up sir
Jey: No need to be rude lil' mama
Bianca covered her mouth after he called me that. This girl is so dramatic. I swear. After finishing cooking the food, I sat down at the table while setting up my phone, and I began eating while watching Joshua play the game.
It looked like he was playing Call Of Duty. He seemed pretty good at the game, but his attention was now on me as his eyebrows furrowed a bit.
Jey: What'chu eating, pretty girl?
Tiana: I made some chicken and rice.
Jey: you ain't gon' share it?
'tf he mean was I going to share it?'
Tiana: Um, no, I wasn't planning on it. Also, how the hell am I supposed to share this with' chu, sir?
Jey: never heard of pretending?
'ight he don't gotta be smart about it.'
Tiana: I guess I can share with'chu then you look like you've been starving sir so here boy.
He smiled like a cute puppy as I pretended to give him some of my food while he pretended to eat it. It was kind of cute and funny, and we both chuckled at each other while gazing into each other's eyes. For a second, I could read his facial expression well until Bianca said something.
"Aww, y'all two look cute, girl. Honestly, y'all would be the cutest couple." Bianca said as I rolled my eyes at her.
"Girl, please don't start" I said while continuing to eat.
"Don't be denying it now, lele; you two will end up fucking each other sooner or later and then be a happy couple." I almost choked on my food when she said that, especially while I was on the phone with this man.
I could sense him smirking through the phone as he continued to play the game, and I knew he had just heard what she had said. I'm not going to lie. He was fine as hell, but I don't know where his energy is at right now.
After eating dinner, I made sure I washed my plate and put it in the dishwasher before going upstairs to my bedroom, closing the door behind me and yawning.
Jey: you finna go to sleep?
Tiana: yeah, I'm tired
Jey: What'chu doing tomorrow?
Tiana: I have like four clients tomorrow, then after that, I should be free. Why?
Jey: You wanna go out for lunch or sum
'I don't know where he's getting at with this but I like it.'
Tiana: yeah, sure, that sounds good.
Jey: Ight bet I'll see you tomorrow then.
Tiana: Goodnight Josh.
Jey: Night, mamas.
Under Your Touch.
biancabelairwwe, shelovesemma, shelovekai and 58,999 people liked your post.
tianasworld: he fixed me up quick i love it so much. 😍
biancabelairwwe: that's so cuteee I didn't even notice it I'm so happy you got it covered.
shelovesemma: 🫢 you got his name covered?
tianasworld: @ shelovesemma yeah girl I did got tired of seeing it.
shelovekai: wtf tiana 😠
tianasworld: @ shelovekai don't wtf to me nigga you might as well do the same thing. 🙎🏽♀️
A/N: welcome to a new storyyyy I honestly wanted to try something different and I got some inspiration from a story I read on tumblr so I hope yall enjoy this one.
Lmk in the comments below ⬇️ love yall.
Stay Ucey.
29 notes
·
View notes
Hello friends! It's been way way way way WAY too long since we chatted, and to be honest I've been taking an embarrassingly long time to write this update post because godDAMN life just gets you sometimes and you go on an impromptu hiatus that gets super messy. So let's get into what's been going on and what to look forward to!
Pedro Tax for this long-ass post.
(We're gonna get into some personal stuff, but if you're just here for what's coming up skip down to WHAT'S NEXT for the tl;dr version)
So beyond work getting hectic from January to March, which was the catalyst for everything getting wacky, I experienced a weird emotional turn that I wasn't expecting. It made me get a little introspective, which I blame some of my productivity slump on.
As I was finishing up the Bangathon entries, I noticed a sharp decline in interaction. I'm a fairly young fic writer on Tumblr, but I was a little baffled as to why stories I'd posted only a week before got a nice bit of interaction yet the newer ones were only getting half to a quarter of what I expected. For a minute I thought I had been shadowbanned (I was not) or I hadn't tagged the posts (I had) or my taglists weren't working (they were). People were already talking about interaction being lower, so I sat back and tried to go with the flow and not let it bother me. I posted Decoherence, which has a more niche audience, but I was definitely missing and wishing for some of the comments and reblogs I thought I might get.
All this led up to one of the least favorite voices in my head saying something that stuck around:
"Well, you were right not to become a writer if your motivation is this closely tied to feedback."
If you're new here or I haven't talked about it much recently, I initially was planning to be a writer. Went to school for it and everything. While I was there I felt like I hadn't found the stories I wanted to tell yet. My colleagues were developing in their niches and writing "the great American novel" and I didn't feel like I fit in. My stories had a lukewarm reception, and I never felt like anyone was excited about anything I was trying to say. So I wrote myself into burnout by the time I graduated with not much to show for it. I ended up doing a career switch, which I love to this day, but I stopped writing for almost 10 years.
Coming to Tumblr, I felt that spark of excitement writing again, and some of that was definitely due to people commenting and being excited or interested in the stories I was sharing. That truly revived something in me I thought was long gone, and reflecting back on the last two years that I've been sharing stories with this community makes me wildly emotional. I didn't know how much I missed of the life I left behind, and how much joy it brought me to share stories again.
Which is why it was SUPREMELY FRUSTRATING to have that shitty little voice pulverize my productivity and excitement over something as silly as interaction. But I'm sure most of you know how hard it is to get that voice out of your head. I worked to write things I found fun and less stressful than the series I already felt bad for not updating. And while I still love those stories, it felt like I was pulling them from an inauthentic place and finishing them wasn't as satisfying as I'd hoped.
Thus the hiatus! I stopped writing and turned my attentions to consuming and creating in other ways. I watched some shows I'd been meaning to catch up on, started planning to buy a house, worked my butt off at the day job. And I was starting to feel like inspiration was coming back. I didn't want to spook it so I took my time and promised myself I was going to start small and not stress about getting stories out for a bit.
Top that off with some medical surprises, an upcoming surgery, and a little re-evaluation of life moving forward and things have been wild. But I've been missing the daily joy I get from being part of this fandom, and I'm getting back into being here more because I miss you guys! AND! I have stories I want to share and fun to be had. So let's shake off all the heavy shit and get to the fun stuff!
WHAT'S NEXT!
The big thing I'm getting ready to post (after teasing it for so long) is the 2024 Bangathon! This one is different from last year's because instead of requesting stories from me, the Bangathon is open to anyone who wants to participate! There will be a randomizer to play with, and some fun bonuses for those who participate. The announcement will be coming out soon, stay tuned!
As for fics, here are some updates on what's in my WIPs:
Series:
I Think of You: I spent some time rewatching Mando for the newest installment, and I've finally gotten the thread of where to go next thought out. It's been a long time coming so this one's gonna be BEEFY to make up for it.
SW!Frankie: I am crushed to realize it's been over a year since I posted any SW!Frankie! I've got a new story about him and Ms J moving in together I need to finish, then some more asks that are getting into new story arcs I'm excited to share!
Best Laid Plans: Dieter and Murch's first date is bouncing around in my head and I NEED to get it on paper. There's much fun to be had, and I've been binge listening to my playlist for them to get into the headspace.
Midnight Alley: I got all up in my own head about continuing the story with these two and lost a little steam, so I'm going to ease off my "big plans" and start smaller with some oneshots instead. I think it'll help me find out where I want this story to go.
One Shots in Progress:
Decoherence Follow-Up
Incubus!Dieter Ask
You know, laying it out like that makes it feel much more manageable than my brain was telling me! I'm also planning to prioritize more fic reading while I'm getting these updates in ship-shape. Reading your stories always helps get my creative juices flowing, and there are so many good ones lingering in my TBR list that I need to devour.
This has been a rollercoaster of emotions, so thank you for coming on the ride with me. I'm excited to bring more of myself back to Tumblr and have fun with all of you again! To many more stories!
78 notes
·
View notes
because i’ve made some new mutuals recently i’ll post about it again: i track #userarklay and you are more than welcome to tag me in your gifs and creations!! i’d love to see them all and reblog them for you ♡
15 notes
·
View notes
treat you better | carlos sainz
face claim: none ♡
request: here !
requested: Could I request a Carlos smau where another driver breaks your heart and he’s there to pick up the pieces and make you whole again? Please and thank you ❤️
cw: cheating, bad guy charles, mentions of unwell family members, cursing
a/n: charles and alex i love u guys i promise this is just for the au <3
───────── ౨ৎ ─────────
November
👤 charles_leclerc
liked by fan, fan, and 78,283 others
f1gossip Trouble in paradise for Charles and Y/N? Charles Leclerc was spotted on a long walk on one of Monaco's more secluded islands with a mysterious brunette and his and Y/N's dog, Leo, this weekend. Sources say the pair were often looking to see if there were cameras around, the two of them giggling as they held hands and played with the puppy. Y/N L/N, Charles girlfriend of 2 years, is currently said to be on a trip home to see family, we wonder if the two have broken up or if Charles is back to his old ways?
fan f1gossip tagging charles is so shady i love it
fan when i catch you charles
fan no bc remember when a fan said they met y/n in her hometown and she was visiting her gran bc she's not doing too good? charles u fuckin suck bro
↳ fan wtf really???? oh i hope his tyres stick to the road next race
↳ fan kmag you know what you need to do
↳ fan we put our hopes and prayers in the paddock terror 🙏🙏
fan ok but the girls gorgeous
↳ fan THAT'S YOUR TAKEAWAY FROM THIS?
↳ fan im just saying damn
fan this is not what i meant when i said i wanted silly season to get more interesting
fan *looks around* wow i'm so surprised... not like charles has a bad rep with women or anything
fan i hope y/ns ok... my heart is hurting for her
↳ fan the paddock adore her, charles has got a big storm coming next week
───────── ౨ৎ ─────────
liked by kellypiquet, carmenmmundt and 25 others
y/npriv my gran is doing so much better (nothing can keep the old girl down), my hometown is still as gorgeous as always and my sister got me a cake :)
kellypiquet my girl :((( i'm so happy your grans ok 🤍
↳ y/npriv thank u kelly bear 🤍
↳ kellypiquet did i have to physically hold max back from going after he who shall not be named?? yes... did i consider letting go?? very much so
↳ y/npriv 😭😭 hes not voldemort babe 😭 you should have just let him go
↳ kellypiquet now is that really how you feel?
↳ y/npriv ... no but i wish i did
↳ maxverstappen1 she has to go to sleep at some point, then i shall be free
↳ y/npriv thats so ominous you strange creature (i appreciate you)
carmenmmundt me and george have been keeping your gran in our prayers angel 🩷
↳ y/npriv i love you carm 🩷
↳ georgerussell63 and me?
↳ y/npriv i tolerate you :)
flavy.barla esteban nearly joined max
↳ y/npriv love him dearly but este's about as intimidating as a teddy bear
↳ estebanocon ?? hey???
↳ y/npriv sorry king xo there's a reason your nicknames estie bestie
↳ estebanocon let it DIEEEEE
↳ y/npriv never 🫶
schecoperez I am glad your gran is ok, y/n. Let me or Carola know if you need anything x
↳ y/npriv thank you checo :( give the little ones and carola a big hug from me x
♥️ schecoperez
lilyzneimer he shall d word at my hands
↳ y/npriv i fuckin love you lily
lewishamilton he will never know peace next year.
↳ lewishamilton i am however happy to hear your gran is well x
↳ y/npriv lewis 😭 thank you x
francisca.c.gomes pierre has been shouting at Him on the phone for like an hour...
↳ y/npriv 😭 ... what are they saying
↳ francisca.c.gomes a lot of french and things i don't want delicate eyes (yuki) to read...
↳ y/npriv pierre i appreciate you
↳ pierregasly i'm gonna kill him
↳ y/npriv ok maybe tone it down frenchie
lilymhe alex is setting his zoo on him
↳ y/npriv that's how you know it's serious wow
↳ alex_albon tinky's gonna boot him in the head
sebastianvettel i am very glad to hear your gran is ok, y/n, sending her and you all my love x
↳ y/npriv thank you seb :( miss you x
↳ sebastianvettel come and see us soon! the kids miss you x
↳ y/npriv you got it! x
danielricciardo he's a cunt
↳ danielricciardo and i don't mean that in a nice aussie way
↳ y/npriv DANIEL
↳ oscarpiastri no he's right, in the nasty aussie way, he's a cunt
↳ y/npriv oscar i did not raise you to talk like this
↳ oscarpiastri we are literally like 4 years apart in age...
↳ y/npriv kicking a girl when she's down WOW oscar
↳ oscarpiastri ... i am sorry mother dearest
↳ y/npriv that's better
carlossainz55 hermosa, he may be il predestinato but to me he is carne morta (dead meat)
↳ y/npriv carlos 😭
↳ carlossainz55 also i'm glad to know your gran is well, send her my love
↳ y/npriv she already fancies you enough as it is
↳ carlossainz55 my plan is working :)
↳ y/npriv what plan? are you seducing my family members??? hiding my mum as we speak
↳ carlossainz55 something like that ;)
yukitsunoda0511 happy to see your gran is ok! and i am sorry about the other thing :(((((
↳ y/npriv yuki my angel you have nothing to be sorry about
kevinmagnussen i know what i have to do
↳ y/npriv kevin NO you're like 2 points away from a race ban!!
↳ kevinmagnussen worth it :)
↳ y/npriv nicohulkenburg pls talk some sense into your teammate
↳ nicohulkenburg unfortunately y/n i too will be joining kevin in his "defense"
↳ y/npriv haas i am so sorry
landonorris i may have done a thing...
↳ y/npriv i am terrified...
↳ landonorris i'll text you :)
───────── ౨ৎ ─────────
───────── ౨ৎ ─────────
📍Monaco
👤 landonorris, carlossainz55, francisca.c.gomes, kellypiquet, lilymhe, lilynzeimer, flavy.barla, carmenmmundt
liked by carlossainz55, landonorris and 87,902 others
y/nstagram angel baby, dumb and dumber and my girls 🩷
Comments on this post have been limited
carlossainz55 ... am i dumb or dumber
↳ y/nstagram do you really want to know? 🤨
↳ carlossainz55 for my own sanity im saying i'm dumb
↳ landonorris why am i dumber?????
↳ carlossainz55 do you really want to know? 🤨
carmenmmundt don't forget about lunch today xx
↳ y/nstagram been looking forward to it since i boarded the plane 🫶
landonorris you're welcome for the lift and the room btw 🙄
↳ y/nstagram my saviour xx
↳ landonorris and for stealing leo for you
↳ y/nstagram I NEVER ASKED YOU TO STEAL HIM???? 😭
↳ landonorris well i did because i'm an amazing friend and am willing to sacrifice all my bloody furniture
↳ y/nstagram you leave the baby alone, he was probably stressed :(
───────── ౨ৎ ─────────
FEBRUARY
(estrellita - little star) (uy, quécarechimba - ugh, that dickhead)
───────── ౨ৎ ─────────
📍Shanghai
👤 carlossainz55, landonorris
liked by carlossainz55, landonorris and 89,028 others
y/nstagram did y'all think i would miss the first race week?? ft dumber and roomie x
fan mother has returned!!!!!
♥️ y/nstagram
fan if looks could kill, carlos would be six feet under ... charles was FUMING
↳ fan given the way his girly hid when y/n appeared i would say he has no right to be mad at all
↳ fan if the girl i cheated on rocked up to my teammates garage whilst i was with my side piece i quite frankly would walk onto the track midrace
↳ fan how do we know charles cheated? they've not said anything
↳ fan exactly. if they had been broken up surely they would have put out some sort of announcement to clear things up ????
scuderiaferrari always good to see you in red, y/n ❤️
↳ y/nstagram FORZA FERRARI SEMPRE!!!!!! 🐎🐎🐎🐎🐎🐎
carlossainz55 i hate this new nickname
↳ y/nstagram what else should i call you?
↳ carlossainz55 yours
↳ fan CARLOS I SAW THAT????????
landonorris i have been demoted from bestie to roomie... this is the thanks i get...
↳ y/nstagram thanks roomie xx btw bins go out on tuesday :)
lewishamilton now you're free of your ferrari obligations, you should come across to mercedes next time ;)
↳ mercedesamgf1 we would love to see you over here y/n!
↳ mclaren um no us next??
↳ alpinef1team no us!!!
↳ redbullracing come to the winning team :)
↳ scuderiaferrari y/n will always be a ferrari girl, back OFF 🤺🤺🤺
♥️ carlossainz55
───────── ౨ৎ ─────────
charles_leclerc added y/nstagram added
to their story to their story
───────── ౨ৎ ─────────
liked by maxverstappen1, carlossainz55 and 20 others
y/npriv that bitchass man... idk how he thought he was gonna spin that story but not on my watch
oscarpiastri did you really have to use my meme though?
↳ y/npriv yes it was funny and otherwise i was gonna call him a cheating lying bastard on main so 🤷🏻♀️
↳ oscarpiastri understandable, please continue
danielricciardo lando was laughing so hard i think he bust a rib
↳ landonorris it still hurts to breathe but holy shit y/n i love u
↳ y/npriv love u too stink :) also don't forget to pick up leo's food from the shops
↳ landonorris you do know you can text me this stuff?
↳ y/npriv yeah but reminding everyone we're roomies is funny to me
maxverstappen1 walked past ferrari hospitality and fred was PISSED
↳ y/npriv 👀👀 carlossainz55 can you confirm?
↳ carlossainz55 oh, absolutely... i was worried he was going to have a heart attack or something
francisca.c.gomes ok but did he not even think to talk to you first before posting that? it's literally been months
↳ y/npriv apparently not 🙃 texted him about it and suddenly he was sorry
↳ francisca.c.gomes men 🙄
↳ pierregasly ????
↳ francisca.c.gomes i stand by what i said
↳ y/npriv yeah is there a problem gasly?
↳ pierregasly no problem at all ma'am, as you were
scuderiaferrari we had no knowledge charles was going to post that. we love you y/n
↳ danielricciardo FERRARI? why are you on y/ns priv?
↳ y/npriv me and the social media intern are besties xx
carlossainz55 estrellita, lets go for dinner, you deserve it
↳ y/npriv 👀 are you paying?
↳ carlossainz55 of course, i am a gentleman
↳ y/npriv pick me up in an hour :)
───────── ౨ৎ ─────────
liked by fan, fan and 40,718 others
f1gossip Carlos Sainz and Y/N L/N were spotted at dinner last night. The two enjoyed a meal before taking a stroll along the Monaco pier front where, as pictured, the pair were in high spirits. We're happy to see Y/N looking so happy following the revelation that her ex-boyfriend, and Carlos' current F1 teammate, had cheated on her. The two were then joined by Y/N's current roommate and F1 driver, Lando Norris, who then whisked them off to a local nightclub. We continue to send Y/N our support and hope to see more of her happy side.
fan i don't think i've ever seen y/n laugh like that, we love to see it
fan this coupled with the photos of charles and his girly arguing in the paddock 🤭🤭 we know who won the breakup
fan why do i kinda think carlos and y/n would be cute together
↳ fan woah, she's only been broken up with charles for a few months and under really shitty circumstances, she needs time to heal
↳ fan ofc ofc!!! i just mean when she's over ch*rles, the two would make a really good couple
fan happy y/n and happy carlos, my two favourite things ❤️
fan y/ncarlos fans we rise!!!
↳ fan he would treat her so right
↳ fan the entire time she dated That Man, carlos has always been so nice to her, i wonder if he secretly fancied her all along 👀
↳ fan or maybe he's just a good guy
↳ fan that too 🤷🏻♀️
───────── ౨ৎ ─────────
APRIL
───────── ౨ৎ ─────────
📍 Australia
liked by y/nstagram, landonorris and 890,274 others
carlossainz55 swipe across to see me and oomf
Another Carlando podium! We know what you guys wanna see and we love to deliver! The car drove like a dream today, shame we couldn't get more points but it's always nice to celebrate a great race with some champagne showers!
See 98,072 other comments
fan WHO TAUGHT CARLOS WHAT OOMF WAS???
↳ fan either lando or y/n 100% 😭
fan CARLANDO PODIUM!!!!!!!!! WE DREAM OF DAYS LIKE THIS
y/nstagram FORZA FERRARI SEMPRE !!! 🐎🐎🐎🐎 congrats winner 🥳
↳ carlossainz55 i think i was right when i said you would be my good luck charm 😉
♥️ y/nstagram
↳ fan oh they're so sick for this
↳ fan y/ncarlos'ers we're so winning
charles_leclerc congrats
↳ fan ik for a fact he was forced to comment
landonorris carlando are back baby!!
↳ landonorris also cant believe im either oomf or roomie...
↳ y/nstagram stop leaving your smelly socks in the bathroom and maybe i'll change the nickname
↳ landonorris oh that was mean
fan "shame we couldn't get more points" carlos you shady shady man
fan who else cheered when kmag pulled through and took * out of the race
───────── ౨ৎ ─────────
liked by carlossainz55, francisca.c.gomes and 21 others
y/npriv oh we eating good tonight
kellypiquet i'm sure we are 👀
↳ y/npriv KELLY???
landonorris carlos is so sexy
↳ y/npriv real
↳ landonorris back off my man???
↳ carlossainz55 i'm gonna hold your hand when i say this lando...
↳ landonorris WOOOOOOW.... i see how it is carlos
carlossainz55 gorgeous as always
↳ y/npriv you can't even see my face in that photo carlos 🤣
↳ carlossainz55 don't need to see you to know you're gorgeous
↳ maxverstappen1 i hate to say it but that was smooth
↳ danielricciardo they don't call him the smooth operator for no reason
scuderiaferrari power (soon to be (fingers crossed)) couple
↳ carlossainz55 😉
↳ y/npriv not from the main acc damn
francisca.c.gomes need you biblically
↳ y/npriv come here then babe xx
↳ flavy.barla lemme join
↳ y/npriv i got two hands babygirl
↳ oscarpiastri estebanocon pierregasly you gonna let her snatch both your girls?
↳ estebanocon unfortunately there was a clause when they agreed to date us and it was that y/n is wifey, we are simply the Others
↳ pierregasly ^^
───────── ౨ৎ ─────────
───────── ౨ৎ ─────────
liked by carlossainz55, lilymhe and 25 others
y/npriv decided to put him out of his misery :)
carlossainz55 and who is that sexy man?
↳ y/npriv idk but he keeps speaking spanish to me even though he knows i dont understand it 🙄
↳ carlossainz55 but do you like it? 👀
↳ y/npriv i think you know i do x
francisca.c.gomes AND YOU DIDNT UPDATE THE GROUPCHAT???????
↳ lilymhe FR!!!! I LITERALLY SAID TELL US AFTER YOU KISS HIM
↳ y/npriv SHUT UP RN
↳ carlossainz55 no do go on
↳ lilymhe what happens in the y/n gf's gc, stays in the y/n gf's gc
carlossainz55 estás muy guapa, vuelve a la cama cariño ❤️
(you look so pretty, come back to bed sweetheart)
↳ maxverstappen1 we have the translate function on ig you horndog
↳ y/npriv don't be mad i snatched ur man
↳ maxverstappen1 ... he'll never forget the redbull days
landonorris RUE WHEN WAS THIS??????
↳ y/npriv hiiiii lando... um so.... 🏃🏻♀️🏃🏻♀️🏃🏻♀️
↳ landonorris GET BACK HERE U RAT EXPLAIN YOURSELF
↳ landonorris carlossainz55 WHAT ARE U DOING WITH MY ROOMIE ????
↳ carlossainz55 i mean i could tell you but instagram does have guidelines
↳ landonorris ew ew ew that's so gross i dont even wanna know
↳ landonorris happy for you guys or whatever but ew never tell me anything remotely sexual about y/n or i will vom
↳ y/npriv lando wtf????
↳ landonorris you're like my annoying sister i'd have to remove my skinsuit if carlos opens his fat mouth
↳ carlossainz55 hey?
↳ y/npriv you're so fuckin weird ily
danielricciardo HE SHOOTS, HE SCORES!!!!
↳ carlossainz55 you were right, they don't call me the smooth operator for no reason
↳ y/npriv you were literally giggling and kicking your feet after i kissed you
↳ carlossainz55 y/n :(((( my reputation :((((((
lilyzneimer wait do was taking the photos?
↳ y/npriv ... self timer
↳ lilyzneimer down horrifically bad wow
scuderiaferrari OH Y/NCARLOS'ERS WE WON!!!!!
↳ y/npriv admin 😭 not u too
↳ scuderiaferrari not even sorry i've been WAITING for this one!!!
───────── ౨ৎ ─────────
───────── ౨ৎ ─────────
liked by francisca.c.gomes, fan and 30,892 others
f1gossip A surprise twist in the Charles and Y/N drama? Following Sainz's back to back victory in Australia and then Silverstone, Y/N and Carlos shared what looks like a loving kiss. Eagle eyed fans then spotted Charles on camera arguing with a Ferrari employee in the garages following the Y/NCarlos moment. Finally, Carlos was spotted outside where he was soon joined by Y/N, the two leaving the circuit hand in hand. It is noted Charles' new beau was nowhere to be seen.
fan Y/NCARLOS'ERS WE SO WON!!!!
♥️ 10,829 others
fan she upgraded wowow
fan charles throwing a hissy fit was so funny i was cackling watching it
fan kika in the likes... what do you know queen?
♥️ francisca.c.gomes
user not her being a homie hopper 🤢
↳ carlossainz55 can't be a homie hopper if we're not homies :)
↳ fan CARLOS?????
↳ fan oh he ate them up
↳ fan carlos has not been fucking with ch*rles for a WHILE, even before all the drama
fan y/n's face... she looked so happy my heart is so full ❤️
fan queen y/n we trust your judgement
fan ik the entire grid is cheering rn
───────── ౨ৎ ─────────
📍 England
liked by carlossainz55, landonorris and 105,018 others
y/nstagram carlando podium again!!! anything else interesting happen at Silverstone? :)
fan the carlando bears 😭 her boyfriend(?) and bestie 😭
↳ landonorris roomie*
↳ y/nstagram you love me shut up
fan she's so unbothered im giggling
francisca.c.gomes the last slide...
↳ y/nstagram don't worry baby, he was just dropping me off for our date x
↳ carlossainz55 all i am to you is a glorified taxi driver
landonorris couldn't even post a photo of me for my podium... see how it is
↳ y/nstagram don't want your ugly mug messing up my feed
↳ y/nstagram also grey bin needs to go out on tuesday
↳ landonorris you're on bin duty this week?
↳ y/nstagram actually i'm gonna be on a boat in spain soooo
↳ landonorris i hope y'all break up
↳ fan LANDO ?
↳ y/nstagram he's joking dw he did the whole "big brother" speech with carlos, was kinda funny knowing carlos would flatten him in 2 seconds flat
↳ landonorris oh now i really hope y'all break up
fan y/n please we know you have bf carlos pics... i only ask for one thing
↳ y/nstagram i'll post some soon x
↳ fan the most unserious soft/hard launch
───────── ౨ৎ ─────────
───────── ౨ৎ ─────────
👤 carlossainz55
liked by carlossainz55, lilyzneimer and 98,017 others
y/nstagram my boyfriends so hot, do you guys mind if i chew on him a lil?
carlossainz55 please don't chew me???
↳ y/nstagram it's internet sla- never mind, ok mr sainz
fan her captions are always so real i love her
fan unhinged y/n is back, we missed you best friend
♥️ y/nstagram
scuderiaferrari HARD LAUNCH HARD LAUNCH HARD LAUNCH LETS GO Y/NCARLOS'ERS!!!!
↳ y/nstagram i love u admin ❤️
↳ scuderiaferrari our ferrari girl, forever ❤️
landonorris i hate this
↳ fan your ex and your roomie 😔
↳ landonorris you get it 😔
↳ carlossainz55 stop calling me your ex 🙄
↳ landonorris you dare deny the love we shared?
francisca.c.gomes never mind him, can i chew on you a lil?
↳ kellypiquet ^
↳ lilymhe ^
↳ lilyzneimer ^
↳ flavy.barla ^
↳ carmenmmundt ^
↳ y/nstagram everyone grab a limb x
↳ carlossainz55 please don't chew my girlfriend
fan thank you for the pic y/n! sorry for interrupting your holiday 🥺
↳ y/nstagram don't be silly!! it was lovely to meet you <333 dont forget to send me the link to the dress!!
↳ fan on it!!
↳ fan omg how was it meeting them?
↳ fan they're honestly so sweet, they were just holding hands and walking around and carlos was yapping away and the way y/n was looking at him 🥺 they're endgame fr
↳ fan could actually cry??
↳ fan also when they were on the beach, carlos twirled her around and they started dancing to the music playing from a nearby bar... it was actually like a movie scene 😭😭
───────── ౨ৎ ─────────
👤 y/nstagram
liked by y/nstagram, scuderiaferrari and 505,287 others
carlossainz55 dicen que ver una estrella fugaz da buena suerte, y tenían razón, mi estrellita ❤️
(they say seeing a shooting star is good luck, and they were right, my little star)
See 198,017 other comments
francisca.c.gomes that first picture... i love my girlfriend
↳ carlossainz55 can't even have peace on my own hard launch
↳ francisca.c.gomes you snatched y/n from her girlfriends, you will never know peace.
fan he bagged a baddie wowow
fan the caption??? oh hes in LOVE
♥️ carlossainz55
y/nstagram 🥺 carlos..i'm so grateful to have you in my life ❤️
↳ carlossainz55 i am the one who's grateful ❤️
scuderiaferrari heyyy y/n *with rizz*
↳ carlossainz55 even my own teams admin wow...
↳ scuderiaferrari not my fault your girlfriends hot
user homie hopper
↳ carlossainz55 eat glass :)
↳ y/nstagram CARLOS
↳ scuderiaferrari we love that you're happy but please carlos this is still your official account
lilymhe y/n i could treat you so much better
↳ carlossainz55 back off i've waited years for this
↳ y/nstagram YEARS???
↳ carlossainz55... 🏃🏻♂️🏃🏻♂️🏃🏻♂️
↳ y/nstagram you're literally sat right next to me ...
↳ y/nstagram he just got up and ran away...
↳ fan this is so fucking funny sddjsdhdk
↳ landonorris danielricciardo what was that about him being a smooth operator?
↳ danielricciardo hes also fucking dumb
───────── ౨ৎ ─────────
a/n: hope everyone enjoys! i am working hard on part 2 of girlfriend of the enemy so we can have some happy charles <3 also 2-3 posts in one week who AM I? (i'm gonna be busy w work so i'm trying to give u guys some food in case i have to disappear)
5K notes
·
View notes
The Video (18+)
Pairing: Best friend!Hwang Hyunjin x afab!reader
Genre: Smut (MDNI), bit of feelings
Word count: just under 3k!
Warnings: Idol!au, subby!Hyunjin, slightly perv!reader, recording, (maybe a bit dub con because he doesn't mean to send it but reader watches it anyway), mommy kink, masturbation (both but separately), Hyunjin fantasizes about reader, reader fantasizes about Hyunjin, lmk if I missed anything!!
Summary: Hyunjin finally gets some alone time after weeks of hard work and decides to use his time to... relax. The next day he ends up sending you something on accident that sets off a big change in your lives, with or without either of you really realising.
Note: My first ever fic!! :3 Inspired by a video I saw on phub. (@cbini (Ems isn't on Tumblr rn she still wanted to be tagged so I hope it's ok), @comet-falls, @hyunsvngs, @mnwrld and @skz-hell lmao hello everyone, writing blog reveal!!😁 here's this fic I've mention to all of you as an anon<3 (depending on who you are I'm either ❄️anon, 🐾anon or sounding anon😳)). To anyone reading this please give me literally any feedback (comment, reblog, anything!), I want to know if this is good or not since it's my first fic🙏😣
Please do not under any circumstance copy, translate, or repost my works!
It's been exactly three weeks since Hyunjin's had any time for just himself, though it feels like months at this point.
Recently everyone's been running around like headless chickens and between vocal trainings, dance practices and the studio, there hasn't been much time to just relax and recharge. Preparing for a new album really is the busiest time of an idols life.
There hasn't even been time to see family or friends, which is common during busy spells like this, but always dissapointing to think about. Now even more so, with how much he's been wishing to spend time with you, one of his closest friends... who also happens to be his crush. Not that he'd ever let you know though, not in a very long time.
It feels almost like a blessing, getting back to the dorms from practice late in the evening and realising... he's got the place all for himself, at least until his roommates get back from the studio.
Changbin had messaged him earlier, telling him that they'd probably be there well past midnight, so there was no use waiting up for them. To him though, this was the very opposite of an issue. With that much free time, he'd definitely be able to... make himself comfortable, so to speak.
See, not having time to relax also means he'd basically had no time to get off. The best he'd been able to do had been quick little sessions barely once a week in the shower right before passing out on his bed from the exhaustion of working hard.
The realisation that he'd be able to do anything he wants during his time alone is enough to get his dick twitching in his jeans and he decides the shower can wait until later.
Hyunjin goes to his room and locks the door after himself even though he's alone, it's just become a habit after so many years living with his members. He sets his bag down next to his bed and thinks through his plan.
Hyunjin has a little secret, which is that he loves recording himself do dirty things that range from more vanilla to much less vanilla. Something about the thrill of being recorded even if no one will ever see it just... makes him so fucking horny.
He opens the camera of his phone, puts it to video mode and presses record. Moving his hand off the lense and setting it down where he normally sets it, on the carefully placed pile of books on his desk, he sits down on his bed.
"Hmm... I hope the angle's good... It's been so long since I've had time for this", Hyunjin sighs with a pout and brushes his hair out of his eyes. He knows the camera won't see it though because he's made sure the stand, his pile of books, is at a level that cuts off his head perfectly.
Hyunjins hands run down his body slowly and he exhales deeply, just loud enough to get picked up by his phone. Once they reach his jeans he unbuttons them, unzips the zipper, then pulls the jeans down just enough to expose his underwear. Hyunjin pulls his shirt up over his stomach to be held in place under his chin, rubs his hand over his bulge and hums.
It's been so long since the last time he's been able to take his time making himself feel good. It's almost embarrassing how quickly he's getting hard.
He takes his dick out his boxers and then spits on the palm of his right hand. It's dirty and wet but it just turns him on even more. He grabs his dick with the hand and slowly moves his fist up and down, to spread the saliva and precum all over his dick to make the slide easier and wetter but to also get himself to full hardness.
"A-ah, ohh... that's so good... Feels-fuck, feels so good", Hyunjin sighs. It really won't take him too long to cum, he just knows it. He's been pent up for far too long.
He tries to think of something to help his issue and immediately thinks of you, no matter how embarrassed or dirty it makes him feel.
When you first started showing up in the dirtiest corners of his mind he felt so ashamed. Now it doesn't matter to him anymore. You'll never find out so why feel bad?
He continues to move his hand on his dick while thinking of you. The last time the two of you had time to hang out together you'd worn the lowest cut shirt he'd ever seen on you. He had tried so hard to act normal around you but whenever you bent down he'd been able to see into your shirt.
"Haah, fuck..." , he squeezes himself a little harder at the memory. Everytime you moved he could see your bra poking out from the top, black and lacy. The entire time he'd been doing his best to not bust in his pants. Oh, what he'd give to be able to see your tits. They always looked so soft and they'd probably fit perfectly into his palms.
Whenever the both of you would hang out at yours, watching movies and just hanging out, you never bothered to wear a bra. Why would you? It is your house where you want to be as comfortable as possible.
The feeling of laying down on your couch watching a movie with you on top of him, in just a t-shirt, will end up driving him mad one day. Everytime he'd felt your nipples poking into him he'd almost moaned out loud.
"Hngh... Oh my god, please... m-mommy!", he lets out pathetically, moving his fist faster. God he just wants you to use him, to do anything you want to him. The thought makes him whine desperately.
One of the most common fantasies for him is you on top of him using him to get off, not caring about if he's close or not. You'd sit on his face and ride it until you cum. He could probably cum untouched like that. All he'd need was tasting you and seeing you cum, just for him.
All the sudden he remembers the phone recording him and he shudders. He imagines what your reaction would be to seeing him like this. Would you be disgusted or delighted? Would you tell him what to do and how to touch himself? Maybe you'd touch him... He hopes you would.
"Mommy... please touch me, aah- oh!", he runs his thumb over the head of his cock just right and his thighs twitch but he keeps them open, in perfect view to the camera.
Throwing his head back he imagines you riding him. You'd be so tight and wet around him. Maybe you'd tie his hands behind his back so he wouldn't be able to touch you... he'd really like that. You'd feel godly around him, Hyunjin thinks.
"Fuck, oh fuck! Mommy I'm-haah, I'm so close, please!", his dick twitches desperately. You're so gorgeous, to him you're the sexiest person he's ever seen. He feels himself getting so close that tears spring to his eyes.
"Ah- 'm gonna... mommy, gonna cum...!", he whines out long and loud. It takes Hyunjin two more strokes to let go and he cums the hardest he's cum in weeks. He doesn't even register whispering your name. Hyunjin leans back on his left hand and keeps stroking himself through it.
The feeling is overwhelming, so much so that his thighs start twitching pathetically and the tears in the corners of his eyes fall. He's getting incredibly overstimulated but he keeps going, wanting to keep enjoying the feeling, just a bit more.
He squeezes himself one last time and suddenly everything on him feels gross and dirty. He's just had the best orgasm in weeks so it's no surprise that he came a lot, everywhere. He even managed to get some on his chin.
"Fuuck... Did you-haah... did you enjoy that?", he chuckles to the phone. It takes a while for him to come down from the high, the twitchiness and the feeling of euphoria lingering in his body. Once he's capable of standing up again he stops the video.
With his body feeling like jelly, he takes off all his clothes, drops them into his hamper and prepares to shower, at last.
Hyunjin wakes up to his alarm the next day feeling more refreshed than he's felt in weeks. He shuts off the still ringing alarm and quickly gets up from his bed to get dressed and go eat breakfast.
Checking the calendar on his phone to make sure he knows his schedule for today, he makes a note of one thing; he'd have a lot of time alone at the dorms today too, since he's only got a dance practice and a recording session today, which obviously means 3racha will stay behind to stress about their songs while Hyunjin can return early. Maybe this time he should continue the latest piece of art he's been working on after he gets back?
Hyunjin gets through the day well enough.
After eating breakfast he messages you a "Good morning pretty <3 please remember to drink water!" like every morning when he has time for it. He gets to the practice room only five minutes late, which is a record this early in the morning, because usually he ends up sleeping in at least ten minutes (which makes Chan scold him for being such a heavy sleeper).
He does well at practice, even though he ends up a little exhausted. That's nothing new though, with how hard they always work to be the best they can be.
The rest of the members leave to take a break but Hyunjin decides to stay behind to film the solo choreography he's been working on for fun. Once he's happy with how it's turned out, it's time for him to go record his lines.
The recording session goes smoothly, without hundreds of retakes and everyone's satisfied with the result. Afterwards they decide to order some take-out, as a reward for a job well done... and also because they're all feeling too lazy to even think about going to the dorms to cook.
While eating Hyunjin finally realises to check his phone again. "Good morning, take care of yourself too!! :)" is your response to what he sent earlier. It's nothing more than a kind response but it makes him grin to himself like the fool in love he is.
"Yaaah!! Hyunjinnieee, what's making you smile so beautifully?", Changbin leans towards him with his signature flirting-with-Hyunjin grin, mouth half full of rice.
"It's nothing," Hyunjin responds back to him cheeks red, "and don't talk with your mouth full hyung... Do you not have any respect?"
Changbin decides to drop it in favor of eating more delicious food.
"Oh come on... we wanna know!!", Han pouts at him from his seat on the couch in the room. Hyunjin shoves another mouthful of food in his mouth to avoid the embarrassement of explaining how a single text messaged from you manages to make his heart beat out of his chest.
Once Hyunjin's done eating he's free to go back to the dorms and just like he suspected the rest of his dormmates stay behind to work some more, although they all whine at him to stay to explain the previous mystery. He declines and they all keep their sad puppydog eyes on him until he's out the door.
He keeps texting you during his ride, all the way to the dorms. Once he's in his room Hyunjin decides to just change into some clean clothes. He's too excited to talk to you and get to painting, he can wash up later.
He lays in his bed to keep texting you and at some point your conversation changes from how your day's been going to talking about dancing and he mentions how he just today filmed a new choreography bit he's made for fun.
❣️:
Can I see what you've been working on? :)
I'm sure it's really good, you always are!!
Jinnie:
Well... since you asked so nicely😉
[video sent]
Quickly sending the video Hyunjin exits out the messaging app, feeling so giddy he can't help but squirm around on his bed. He still can't believe someone like you could be interested in seeing him dance.
It might seem like a small thing for most but he feels himself turning red just thinking about the way you look at him while he talks about something so important to him. It makes the butterflies in his stomach every time you're near go crazy. It's so attentive, like you actually care and are interested in his interests... and maybe even...?
'No' , he thinks to himself. There's probably no way you could ever actually be interested in him, not in the same way he's interested in you at least.
He leaves his phone charging and finally gets out of bed to go to the kitchen for a cup of coffee. He'd need it if he wanted to stay up late to work on his newest art piece.
Hearing the familiar 'ping' notification of receiving a message makes you open your phone again and just like you thought, Hyunjin had sent you the video of his latest masterpiece of a choreography. Not waiting a second you press the video just to see.... Hyunjin take his hand off the camera and set the phone down on the desk in his room he draws on. He sits down on the edge of his bed and says something, you aren't really sure what, because the volume's too low. In confusion you turn it up more.
Hyunjin sighs and reaches up to move his hair out his face, probably. You can't see it though, because the camera cuts his face perfectly off frame. Suddenly his hands run down his body to the button on his jeans. He opens it and starts undoing the zipper next. You just look at the video in shock. 'He isn't about to... to take them off is he?', you think to yourself, just as he pulls the jeans down enough to expose his white boxers and then palms his bulge.
Should you stop watching? Keep watching? How long has it even been playing? How long does it keep playing? While you wonder this you almost miss Hyunjin pull his hard dick out of his underwear and spit on his palm and... Oh God...
You've now done something you can never take back. The downright sinful view of his cock is something you don't think you're ever going to be able to forget. How do you even face him after this? After watching him grasp his dick in his hand and pump it a couple of times to spread the spit and precum around.
You exit the video, panting and absolutely soaking through your underwear. Your other hand rushes to your face to feel your cheeks. They're burning and feel like you've been standing out in the sun for hours, when in reality all you've done is accidentally watch your best friend play with himself.
You struggle to decide what to do with the video and in the end save the video without much thinking, then delete the message of it and decide to notify him of his mistake. As long as he doesn't know you saved it, it should be fine, right?
It takes Hyunjin less than 10 minutes to make and get the coffee. He returns to his room humming the tune of a song he's had on repeat recently. Setting the coffee down on the desk and taking his phone off from the charger he notices new messages from you.
❣️:
Uhm...😕
Hyunjin, I don't think you meant to send that.
He looks at his screen confused. What did you mean by that? He...
Oh God.
Did he send the wrong video?
Frantically opening the video he sent earlier he sees himself, in video, move his hand off the phone camera and set it down the desk near his bed and sit down. Oh no...
"Hmm... I hope the angle's good... It's been so long since I've had time for this", video Hyunjin sighs and reaches up to move his hair from his eyes. His head may be out of frame but he clearly remembers pouting while saying this. He watches himself slowly unbutton and unzip his pants, adjusting them so that his boxers are clearly visible in frame. In the video his hand drifts towards his crotch slowly, teasingly.
He quickly exits the video and promptly shoves his head under his pillow and yells. He'd accidentally sent the wrong video while hurrying to get a cup of coffee. How could he have messed up this bad? In his panic, it takes him a moment to respond.
Jinnie:
Oh god
I'm so sorry!!
Please don't watch that!
❣️:
Don't worry!!!
I stopped watching the moment you started unzipping your pants😖
I saw nothing, promise!🙏 It's been deleted already!!
Little does he know though, you'd kept the video. You're not really sure why, but subconciously your brain keeps screaming' to finish it later, of course'.
...
Fuck it, you don't think you can wait until later.
Taking a deep breath, you open your gallery to find the video he sent you. You hesitate for a second but press play anyway. You can feel how you're already soaking through your underwear but pay no mind to it yet.
You watch him do the things you've seen already, all the way until he spits in his hand... and you pause the video. 'Is it right to watch this? I mean, he didn't mean to even send it...', you think to yourself.
But the thought of seeing him touch himself, to hear him make the sweetest noises you could ever in your wildest dreams imagine him making drives you on.
Pressing play again you dip your fingers into your pants. You rub yourself over your underwear and oh my god... you can't believe the wetness you feel after less than a minute of watching the video. You focus on the phone you're holding in your other hand and finally move your fingers into your underwear to directly touch your pussy.
On your screen you see Hyunjin start to stroke himself faster, the head of his dick a dark pink, you can feel his desperation through the screen. Without thinking you move your fingers to your clit and start rubbing it in circles, aided by the wetness of your leaking pussy.
He moans out loud and even though you can't hear it through the fog in your head, you know he's desperate. You move your fingers down to your hole and dip two of them in. You're so wet you barely need to even stretch yourself out and then he does it.
"Hngh... Oh my god, please... m-mommy!"
You push your fingers deeper and your pussy lets out he lewdest squelch which in turn makes you close your eyes desperately in pleasure. 'Mommy? When he masturbates he calls out for mommy??', the thought makes you lose your mind. You think about what it would be like if he called you mommy in the throes of pleasure.
You want to make him follow every command you give him. The way he'd look up at you on his knees with you standing above him. Maybe you could make him suck on a strap? He'd look so ridiculously delicious with his mouth full, drool dripping down his cheeks.
You add another finger and start rubbing at your clit with your thumb at the same time. The feeling makes you whimper and imagine his hands on you, teaching him how to touch you perfectly. You're getting so close and you remember to focus your screen again.
Hyunjin looks absolutely disheveled. His dick is red and throbbing, you can tell he's getting close. His voice is another thing that gives him away. He's whiny and his voice keeps cracking every time he opens his mouth. Hyunjin bucks into his hand and moans.
"... mommy, gonna cum...!", he strokes himself twice more and then finally cums. You're so close it's maddening. All the sudden you hear him... whisper your name?
It makes you go off the edge and your entire body clenches and seizes while you silently cry out from all the pleasure you're feeling. Your walls suck in your fingers with how you're clenching around them. On the screen Hyunjin twitches violently, working himself through the end of his orgasm.
You pull your fingers out of yourself and slump down on your bed exhausted, but the last 20 seconds of the video that's now over haunts you. Did you hear him right?
You gather strength to pick up your phone again and rewind the video to the part where he cums and turn the volume almost all the way up. Admittedly you end up fixating on the way his dick looks and face twists in pleasure when he cums and then he says, or more like whisper your name. Your brain blanks.
"Fuuck... Did you-haah... did you enjoy that?", he chuckles to the phone, sits in place for a bit to properly come down and then gets up to stop the video.
You're wet, confused and you can feel your heart beat out of your chest. What do you do now? How can you ever face him normally after that... Does he feel the same way you do? Is he sure he didn't mean to send it?
It's all too much to think about, so you decide that instead of thinking about it you'll clean yourself up and... crawl into a hole where no one will ever find you. Probably. The only thing you know for sure is you definitely won't be sleeping tonight.
© lollixp0p 2024 | please do not under any circumstance copy, translate, or repost my works
3K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24)
consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.)
for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
for additional phobias: i tag with the specific phobia (trypophobia, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
according to democracy, yes
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
2K notes
·
View notes
ʜᴛᴛᴘꜱꜱᴇʀᴇɴᴇ'ꜱ ꜰ1 ᴋɪɴᴋᴛᴏʙᴇʀ ꜱᴘᴇᴄɪᴀʟ
ᴜᴘʟᴏᴀᴅ 1 : ᴄʜᴀʀʟᴇꜱ ʟᴇᴄʟᴇʀᴄ / ᴍᴀx ᴠᴇʀꜱᴛᴀᴘᴘᴇɴ x ʀᴇᴀᴅᴇʀ |ᴄᴏʀʀᴜᴘᴛɪᴏɴ ᴋɪɴᴋ
📖ꜱᴜᴍᴍᴀʀʏ: innocent and virgin !reader has never touched herself before. she knows how to, in theory, but whenever she tries, she chickens out. her tried and true way of receiving pleasure is failing her. she thinks that maybe it's time to allow her relationship with her two respectful and experienced boyfriends, to reach the next step. and she'll find that they're very willing to teach her a few things.
📖ᴄᴏɴᴛᴇɴᴛ ᴡᴀʀɴɪɴɢ: 18+ only. smut. corruption kink. orgasm delay/denial. praise kink. dom/sub undertones. hair-pulling. possessiveness. slight choking (glimpse and you miss it?). brief reference to previous dub-con (very minuscule, not charles or max). no penetrative sex.
📖ᴡᴏʀᴅ ᴄᴏᴜɴᴛ: 8k words
📖ᴘᴀɪʀɪɴɢ: charles leclerc / max verstappen x fem!black!reader
📖ɢᴇɴʀᴇ: oneshot
📖ꜱᴏᴜɴᴅᴛʀᴀᴄᴋ: all mine • brent faiyaz
ᴘʀᴇꜰᴀᴄᴇ: the strength i had to summon to post this is something crazy. it's my first smut fic if you can believe it or not, but the way i feel exposed to the world is wild. i almost forgot to include the actual kink because i got carried away, but it's there i promise you, don't get disappointed too early in! can confirm that while i was writing this i had to take several breaks and stare at the ceiling. the black!reader is vague i think, it's not noticeable until the end, but i had written it with all shades of my poc girlies in mind < 3. n e ways: hope you guys like it!
want to be added to my f1 kinktober taglist? or my general tag list? send me an ask!
huge thanks to my beta readers @lorarri and @sweetpiccolo-blog ! i appreciate y'all so much :)
cross-posted on my ao3, htpsss
here's the link to the masterlist for my f1 kinktober special, and send me a private message if you would like to be added to the list to become a beta reader in the future!!!
it’s late. you’ve kicked jimmy and sassy out of the bedroom, and locked it shut. you’re standing with your back pressed against the door, staring with unfocused eyes. you moved your stuffed animals inside the closet and had them facing the wall even though you closed the closet door. the window curtains are drawn shut, and the only light in the room is the warmth of one nightstand lamp. one of the plushest towels max owns is spread across the bed. in the center lays a single pillow.
this is the last chance you have to get off before max and charles get home in a few hours. they’ve been gone for a triple-header, and you haven’t been able to orgasm once in the near month they’ve been gone. you’ve become depraved enough to consider buying a vibrator, but all packages delivered to this apartment have to be approved by max or charles to be sent up, and you’re definitely not bold enough to go out and buy one (and risk being seen by one of their fans or have to physically talk to someone to buy one).
the obvious thing to do would be to talk to your boyfriends, and tell them that you’re ready to start exploring the sexual side of your relationship. you’ve been dating them for two years now, and you’re afraid that they’re getting tired of waiting for you to be comfortable enough to have sex with them. but, you’re also afraid that once they learn how inexperienced you really are—they’ll make fun of you, leave you, and find some other woman who knows how to please them. you know that’s outrageous and never going to happen. they’re the sweetest boys you’ve ever dated (way better than that one dude you dated who tried to get you wasted enough to persuade you into having sex with him), and they’ve been very respectful concerning your boundaries. always pulling away when they feel themselves getting hard, and constantly reminding you to tell them to stop if you feel uncomfortable and that there’s nothing wrong with that, and that they’re willing to wait as long as you need, and will continue loving you regardless even if you decide to never have sex with them. so—of course you know that they won’t be assholes about your innocence—it’s just your own self-esteem, insecurity, and overthinking that prevents you from saying you’re ready.
you make a deal with yourself. if you can’t manage to get off grinding against your pillow one last time, you’ll force yourself to sit down with your boyfriends, stare them in the eyes and state that your ready to have sex. who are you kidding—you’re going to get off right now one way or another even if it kills you, because you definitely will wither away and die if you have to have that conversation with your boyfriends.
you walk over to the bed, heart beginning to race as you start playing one of those curated “songs i’d like to be railed to” playlists, before throwing your phone somewhere up the bed. you move to straddle the pillow, and begin to calm your heartbeat. you take a few deep breaths and let your mind wander. the first thought that comes to your head is the goodbye kiss you got from your boyfriends before they left.
they had gotten all their luggage together and were pulling on their shoes at the entryway. charles was pouting at you, wide green eyes and all, “you are sure that you don’t want to come with us? for at least one of the races? we’ll be gone for almost a—“
“yes, cha. i’m sure,” you cut him off with a firm nod, “lemme give you a kiss before you leave, okay?”
charles frowned at max who laughed—like he wasn’t the one begging you to come with them last night before you all went to bed. with a little upset ‘hmph’ charles leaned down and kissed you softly. you had pulled away, only trying to give him a peck, and charles grunted disapprovingly. one of his veiny hands rose and gripped at your waist over your t-shirt, strongly pulling you forward, causing you to tumble into his chest. “oh, i am going to need more than that, mon ange,” charles smirked down at you, “i am leaving for so long, and that’s the goodbye kiss you’re leaving me with? no, i do not think so.”
you glanced away from him, cheeks beginning to become warm as you make to hide your face is his broad chest. charles tutted at you, tightening his grip on your waist, and his other hand gently pushed your head up to look at him, “c’mere and give me a real kiss, pretty girl.”
you made a suppressed little squeal in the back of your throat, a noise max and charles became very familiar with, often present when they start teasing you. you surprisingly leaned up and initiated the kiss, causing charles to let out a shocked gasp into your mouth. his hand on your waist moved lower, falling to the small of your back and pushed your body completely against his. his other hand caressed your jaw, soothing you enough to allow him to control the kiss, as he flicked his tongue at the seam of your lips. you shakily sighed, allowing him entrance and the kiss deepened, a pleased humming noise in the back of your throat escaping.
you impatiently shift side to side on top of the pillow, not yet allowing yourself to get any friction. sliding both of your hands underneath your sweater—well, max’s sweater, and you start playing with your chest. flicking gently at your nipples, just the way you like.
you could feel charles chuckle into the kiss, but you dismiss it, and keep kissing at him eagerly. however, you failed to recognize that he wasn’t laughing at you, he was laughing at max. cockily making eye-contact with him, before he let his eyes flutter shut and devoted his attention to you.
max stared on, his mouth slightly open as he watched his two loves give him a show for free. charles’ hand slipped lower, gliding over your ass, across your criminally well-fitted jeans, and found its home on the back of your thigh. max is well acquainted with how skilled charles’ mouth is, so he knows he must have done something spectacular to cause a choked-off moan to escape you, your hand raised to grab at charles’ polo in a fist, wrinkling the pressed shirt. max huffed, deciding to no longer spectate, and took the few steps to reach you across the foyer.
you let out a shocked gasp, eyes fluttering open in surprise at the feeling of your other boyfriend pressed up against your back. you attempt to break the kiss, but charles doesn’t let you. hand slipping from your cheeks to the nape of your neck, tangling in the hairs there and keeping you exactly where he wants. one of max’s hands came to rest at your hip, while the other rested on your navel. your eyes fell shut again in pleasure at how charles gently nipped at your bottom lip, and max’s presence is pushed to the back of your mind.
you didn’t register max’s hand disappearing from your abdomen, but suddenly, the air was cut with a pained moan from charles and his lips were ripped away from yours.
your eyes flew open, and max’s hand was buried in charles’ hair, tugging his head backward and maneuvering it into what must be an almost uncomfortable angle, but with how pleased charles looked—you wanted to feel it too. his eyes rolled backwards, before he pressed them shut and re-opened them to reveal dilated pupils and half-lidded lashes; panting hard, lips covered with your shared spit, and a fucked-out look in his eyes.
you struggle to pull off your sleeping shorts, eventually managing to tug them off to reveal your white cotton panties. your hand leaves your breast to touch at your heat, and you’re shocked at how wet you’ve gotten already. you use that same hand to adjust your pillow, before you let your hips fall all the way and make contact with the pillow. you sigh in relief.
now, max is the one to laugh with his hand firmly keeping charles in place. “oh, you know better than to tease me charlie…” he started, and you barely heard him. fixated on the way charles’ tongue frequently slips out to lick at his lips, but you could hear the smirk max was wearing.
“and you’re also not the only one leaving our sweet girl for a month. you should be nice and let me have a taste too, hm? isn’t that right, schatje?” he directs at charles. max’s other hand made its way up your abdomen, copping a feel at your chest, before it rested across your throat. he wasn’t squeezing at all, but the weight of his hand, how it spans across your neck, and how you can feel the strength lying underneath his skin, caused you to lose your breath. he guided your head back and dropped his to get his own goodbye kiss.
the kiss felt like it lasted for a lifetime, but realistically it had to be less than a minute of max forcing charles to watch how he ravaged your mouth, before charles started whining loudly. max patted your neck gingerly before pulling away and laughing at charles’ teary eyes. your legs were trembling and you were pretty sure if max wasn’t behind you, you would’ve fallen long ago. in one smooth motion, his hand fell to the monegasque’s throat from his hair and pulled him closer, completely sandwiching you between them, as their lips met in a wild kiss.
your hips start to rock against the pillow, keeping it slow in the beginning, learning your lesson about friction burn the last time you got too erratic with your moves too quickly.
charles—completely desperate—whined deep in his throat and max kept pulling consistently depraved moans and grunts out of your boyfriend. max’s other hand moved off of your hip to smack at charles’, a nonverbal command for him to calm down and let max take care of him. you felt charles practically vibrating against you in need, but he slowly started to calm; his posture slackening and lips slowing, allowing the dutch full control.
the two of them were completely ignoring you. caught in their own world, putting all of their energy into their kisses, and in turn gave you a front row seat to something you're never going to forget about. you felt so small in between the two of them, like the only thing that kept you from floating away is the fact that you were stuck in between their bodies.
eventually, max released his grip on charles and separated from the kiss, giving charles air to breathe. the blonde stepped backwards away from your body, and you stumbled embarrassingly. max’s hands went up to hover around your waist (suddenly so shy to touch you) to make sure you actually didn't fall. charles shook his head, physically trying to clear the haze in his mind before he stumbled away from you as well, pressing his back against the wall.
his chest was heaving with exertion, cheeks flushed a pretty red color, while his hands went to tug at his uncomfortably tight pants, failing to adjust himself to make his erection less obvious. he suddenly turns shy as well—it probably doesn’t help that max was laughing at how easy he is to turn on—, and charles tries to try and tug his shirt down to cover up his problem as best as he can.
your hips start to pick up in speed, movements more sure and less shaky. the friction between the cotton pillowcase and panties is multiplied on your cunt, and when you rock down deep enough, the catch of the panties on your clit is nearly immobilizing.
thinking about the moment before your boys left leads you into fantasizing about their dynamic, and how they are in the bedroom. that morning alone proved who was actually in charge; charles will tease and take whatever he can, as long as max allows him to. you can recall many instances of max guiding a well-fucked charles out of the bedroom and depositing him on your lap, before he went on to clean up and run the monegasque a bath.
the multiple post-sex facetimes you’ve gotten from the two when they’re across the world always starts with max softly speaking, “i’ve worn him out pretty good, but he refuses to fall asleep unless he gets to call you.” and the phone is passed to charles, who’s voice and lips are ruined to hell and you have to decipher what he’s attempting to say.
you’re starting to acclimate to the current tempo, so you pick it up another notch. you lean forward, bracing your hands on the bed for support as you focus on doing deeper and slower grinds against the pillow, allowing your clit to get constant attention.
you find comfort in the fact that charles allows max to take him to such a vulnerable state, and sometimes—you even find yourself getting jealous. you started joining them to see their aftercare for yourself, and found out that you're aching to be taken apart and put back together like max and charles do to each other.
the sound of max’s constant praises of charles being “so good for him,” and charles’s constant stream of “thank you, thank you, maxy” has you losing all train of thought.
you abandon the slow-and-steady technique, you’ve tried it several times this month and it’s failed to get you to come. you bite your lip, letting out a frustrated groan. your hips slow, and you grab the front of the pillow with one hand and pull it upwards, hoping that a tighter space allows better friction. you start moving quicker, doing smaller more shallow motions and it’s tons better. you can’t stop thinking that it would be even better to ride charles’ face.
even though your eyelids are scrunched shut, the thousands of tiktok edits you’ve seen of your boyfriends post-race; balaclava lines, sweaty, messy hair, and all—are playing behind them. you moan out desperately, toes curling in your socks. you hear the phantom noises of monegasque moans along with the imagined whispers of dutch-accented praises.
the knot in your navel tightens, your thighs begin to tremble, and you can feel yourself clenching around nothing. this is it, the feeling that’s escaped you for a month, it’s returning, you can finally come.
you start to rut against the pillow, uncaring of how your wetness has seeped into the pillow cover and sticks against your thighs—if anything, it’s just another pleasant sensation. unfiltered squeals and gasps start slipping out, you’re too blissed out to regulate your volume at this point.
but then, a minute passes and you still haven’t fallen over the precipice. it’s right there; you can see it, you can even hear it, but you can’t fucking feel it.
your moans of pleasure turn into cries of frustration. your legs start to quiver with exhaustion, and the orgasm you almost had fades. tears spill from your eyes, as you frantically rut against the soaked pillow, not caring about rhythm or technique anymore. and your chance is gone, your sobs echoing around the room at another failed attempt.
you climb off the pillow and fall on your side, crying into the towel trying to muffle your anguished noises. you have the fleeting thought to think that you're overreacting, but fuck that. you’ve literally been unwillingly denying yourself for a month.
after you’ve cried yourself out, you get up and start to clean up the mess you made. when you lean down to pick up the shorts you flung across the room, you hear jimmy and sassy start yowling outside of the room. and faintly, you hear the front door open.
fuck.
a giggle slips out of charles as the cries of the cats are heard outside of the apartment door. max shoots a glare at charles for laughing at his children, before he loses the fight and a smile slips out in response to the monegasque’s. finally managing to slip the key into the lock, max speaks, “we’re supposed to surprise her by being early, cha—maybe we should’ve let the cat’s know when we called earlier today?” they step through the threshold, quickly shutting the door behind them so the cats won’t run out. charles makes a questioning hum as they both start slipping out their jackets, “they are cats, mon minou. i do not think they care about anything other than when you come back to feed them.”
max side eyes him heavily as he squats down to untie his sneakers, and looks around slightly confused, “i think we are missing a greeting from one more kitten, wouldn't you say, charles?” the man in question nods in agreement, while finally petting jimmy and sassy to calm them down a little bit. whenever the two of them return home, you usually race to the door along with the cats. you give them warm hugs and sweet kisses, help them take their jackets off, and let them know if you cooked a meal for them, or prepared a bath.
but tonight, they don’t hear the sound of your footsteps coming towards them. it’s rare for them not to be greeted at the door, most of the time you beat them to unlocking it, with the alarm system the cats provide.
charles questions, “maybe she fell asleep? we did not tell her that we moved our flight earlier. and we did tell her to go to bed because we would be arriving late.”
max snorts disbelievingly, “when has she ever gone to bed when we’ve told her to,” he starts, “she’s probably just in the bathroom or something.”
the two spend a few minutes paying some attention to the cats, before they begin to get suspicious at the fact that you still haven’t come to welcome them back. they straighten up and start heading towards the bedroom.
max pushes the door open, and everything looks normal except for the fact that you’re nowhere to be seen. the bed is put together, one nightstand lamp is on, and the bathroom is empty. max and charles stare at each other with matching baffled expressions, before you clear your throat in the doorway.
max jumps, “shit!” and charles flinches, “oh, what the fuck!”
your giggles reverberate through the air, and the two men can only laugh along with you. “oh? so you find scaring us funny, schat?” max teases gently. you pad over to him, throwing your arms around his neck to pull him in for a tight hug, nodding softly into his neck as you breathe him in. charles huffs after he’s deemed that you spent too much time loving on max before he pulls you into his own grasp, one arm braced tightly around your waist while his other hand cradles the back of your head resting in his chest. “she’s absolutely frightening, max, can’t you tell?” he teases back, defending you jokingly.
max hums, “definitely. where were you hiding, baby?”
you freeze for second as you pull away from charles’ grasp, before stuttering your way through an explanation, “u-uh oh, i was-um, i was just in the laundry room! i was just putting a few things i had accidentally spilled uh- spilled juice on-yes juice of course, in the uh-washing machine, yes,” you nod firmly, to fully convince them.
the monegasques raises an eyebrow at you and dragged out an, “…….okay, i guess?” max follows up with a sarcastic, “yeah….we definitely believe you!”
you narrow your eyes at him, “are you calling me a liar, max? because, why would i lie about—“
charles cuts you off, turning your head back towards him as he squints at your face. he runs his thumb underneath one of your eyes, and speaks softly, “were you crying, mon ange? your eyes are red and swollen.”
you shake your head rapidly to attempt to dismiss his worry but it’s already too late. max practically teleports to your side and scans your face and with a gasp he reveals, “yes, you did cry. i can still see the tears stained on your cheeks.”
you shift uncomfortably, “yes, okay! i did cry! but it was nothing serious,” you pause and mumble the last part of your sentence, “i was just overreacting anyways, it doesn’t matter.”
max smacks his teeth at you disapprovingly, “hey, don’t be mean to yourself, schatje. anything that causes you to cry does matter. tell us, and we can try and make it better for you.” the two boys wear you down with earnest eyes; the monegasque brushes his lips against your hand comfortingly and the dutchman tucks your hair behind your ears soothingly. they wait patiently and don’t attempt to push you any further, but there’s an unspoken understanding between the two of them; they won’t let this go until you explicitly ask them two. and suddenly, your resistance falls and words start rushing out of your mouth.
“im so tired, okay? i’ve been trying for ages, ages, and i can’t get there! everytime i try, i-i-it’s like i’m right there–right there! and then it never comes! it’s torture. the harder i try to reach for it, the more it slips away, and then it doesn’t even feel good anymore! i thought this was supposed to feel good–and now what’s the point?! i don’t even wanna try again if i’m just going to be–”
“woah, woah, woah.” max cuts you off, “what are we talking about exactly, schatje? have you not been getting enough sleep or something? because we can try and–" you interrupt, “NO! i haven’t came in a MONTH! are you even listening to me?!”
charles chokes on his own breath and max damn near faints. most importantly, they’re shaken at your bluntness around the topic; every time they try to ask if you’ve been finding…relief–for lack of a better word, you tend to snap shut if they use any ‘explicit’ words with you– you tell them not to worry about it. so, to hear you say it plainly reveals how much distress this has been causing you. secondly, the thought that you’ve been desperately trying to get off for a month on your own, is a paralyzing thought. they nearly convinced themselves that you had no idea about anything sexual due to your refusal to answer any of their questions—which there would be nothing wrong with, they’d be happy to teach you how to please them and them alone. it’s a seductive thought, the fact that you’re untouched, that no man has had the opportunity to taint you and ruin your perspective on how you should receive and give pleasure. they’ve been praying for the day you’d be ready to let them teach you how to be good for them. maybe that makes them monsters, for taking advantage of your naivety and innocence, and molding you into their perfect girl, but they stopped feeling guilty for desiring this long ago.
you seem to have missed the fact that you sent their minds reeling and continue venting, “i don’t know what to do, maxy! i’ve been doing the same thing, and it’s NEVER failed me before. it’s cruel that it stopped working when you guys left me for more than a month! no matter how i did it–if i did the exact same things i’ve always been doing, or tried something new, nothing worked! i was literally just considering buying a fucking vibrator! a vibrator, charles, i’d rather run naked in the street than buy that online and have to put in this delivery address–”
charles gently presses finger against your mouth, shushing you. he pulls you into a deep hug, rubbing a hand up and down the length of your back , the motion pacifying you. he hums, and it vibrates through his chest to yours, “mmm, we’re home now, mon ange. there’s no need to run in the streets naked–” “definitely not,” max jumps in, reacting possessively at the implication of other people seeing you undressed. charles rolls his eyes and continues (like he’s not just as jealous as max), “or buy a vibrator. i know it must be so frustrating, to not cum,” you gasp softly, “especially when you’ve been edging yourself accidentally for so long, hm?”
a questioning sound slips from your lips, “hm? what’s edging? i just haven’t,” your voice drops to a whisper, “cum.” max thinks that he’s seriously fucked-up in the head, because he watches how you bury your face into charles’s chest after your whispered word, refusing to make eye contact with them out of embarrassment; and relishes at the fact that you absolutely have no idea about what exactly you’ve been doing to yourself. he’s going to enjoy ruining teaching you everything he knows.
“edging is repeated instances of sexual stimulation and stopping before your orgasm. it’s called that because you are kept ‘on the edge.’ you can do it to yourself or with others,” max states in an unfazed manner. he sees you start to relax, knowing that you find comfort in his matter-of-fact tone.
a pout lowers your lips, “who would enjoy that? it feels terrible.”
max breaks out in a grin, slipping an arm around charles and squeezing at his tapered waist, “you know somebody who enjoys it very much, liefje,” charles blushes at the sudden call out, and watches the way your eyes widen in shock. max continues, “anyways, you may find that you enjoy it when it’s done properly—with people who are experienced enough to make sure you’re feeling good and keep you feeling good… and show you how to have a proper orgasm, hm?” max segways into the important topic, not allowing you to deflect any longer.
charles stops your attempt at hiding in his broad shoulder this time around, and firmly holds your face to keep you facing max. the dutch give charles a nod of appreciation and watches how he shifts on his feet at the acknowledgement; he might have to take care of him after he’s done with you, too. max allows your eyes to avoid meeting his, letting them roam his face as you battle your own insecurity.
“liefje,” max deepens his tone, knowing how you melt at any pitch similar to his morning voice, “there is no need to be embarrassed about your virginity and innocence. you had your boundaries set, and never bent or broke them to make someone happy at the cost of your comfort. no matter how much pressure someone applied to you, you refused to let them have you in one of the most vulnerable positions you could ever be in because you felt unsure or plainly uncomfortable with them. that is something you should take pride in and no one should make a joke out of your virginity for that instance. tonight, you can still make that decision if you are not completely sure on allowing charles and i the privilege of teaching you how to feel satisfied. we will continue to wait for you; you have the power here, not charles or i. do what is best for you at this moment, and if that changes, tell us so, and we will continue or stop at your will.”
the room is silent as the three of you digest max’s spiel. charles and max seem to be completely nonchalant about the matter, but they are trying to hide how anxious they are about your possible refusal, for your sake. of course they are hoping that you’ll accept their helping hands, or lips, or tongues, or coc—but, that’s not their main intention tonight. the goal is for them to start building a deeper level of understanding and trust with you, to where you allow yourself to be in your most vulnerable state with them. and that will take time; they’re not expecting you to completely reveal your innermost workings to them instantaneously. however, they most definitely want to show you how good they can make you feel and how good you can make them feel. and once you internalize that, then they can start working on showing you the wonders of sex—or plainly put, they can start tainting you.
you nod. charles eyes brighten and his cheeks dimple with the appearance of a wild smile. he leans in to kiss you in thanks, but max halts him with one finger to the forehead and a quick ‘aht aht,’ “that won’t do, liefje, i need verbal confirmation—words, please.”
“y-you can…you can help s-show and teach me how to…how to feel good. i am ready to have…,” your voice thins out, and suddenly you shake your head, eyes meeting max’s straight on in an unusual act of confidence, clearing your throat, “i am ready for us to have—i’m ready for you to fuck me.”
max wasn’t exactly ready for that wording and faltered, a little shook. charles on the other hand has to struggle to refrain from laughter. at the mixed reaction, your bravado slips away, and you add, “please?” charles loses the laugh automatically; your timid but desperate widened brown doe eyes stare up at the two of them, flickering between them anxiously, plump lips parted with your tongue flicking out—he has a few ideas of something he can offer to keep that mouth of yours busy.
max rumbles in satisfaction, “see, that wasn’t so hard, was it pretty girl? we’ll work on that confidence of yours for sure—but, i have a few rules for you first before we get started. charles, why don’t you tell our girl the first two?”
“number one, always answer our questions with words; if you don’t, we’ll stop and wait for you to respond. two, if you feel uncomfortable at any point, tell us, and we’ll stop what we’re doing and make it better for you or stop completely if necessary,” charles answers assuredly.
you nod, and max raises an eyebrow at you, “i mean, yes!”
max praises you, “you’re already doing so good for us,” he watches your breath catch at the sentence and figures he may have another praise kink on his hands, “you wanna be a good girl and tell me what you were really doing before we came home?” your cheeks burn and your previous embarrassment returns full force, but you fight through it, not wanting to break the rules right off the bat.
“well, you remember how i said my usual method wasn’t working anymore? i wasn’t lying about that. i only g-get off when you guys leave, andidoitbygrindingonapillow—and i have to put down a towel before becauseimakeamess. so! i really was doing laundry, i just didn’t spill juice on it…i kinda, spilled on it.”
charles’ hands fall away from you in shock, and max really doesn’t know if he can handle another revelation like this from you without actually passing out. you continue to over-explain, “and i i-i didn’t even get to, y’ know (oh my god, she soaked the pillow without even cumming, max!), and i got that wet anyway…and i can’t really control it, but if you guys don’t like it i can try and—“
“NO!” “PLEASE DON’T!”
you flinch away, and they apologize heavily for their overreaction.
“please, don’t, mon ange. i can tell you that max and i aren’t ever going to hate what’s between your legs, or what comes from there,” charles suggests with a smirk, before his face shifts to a more blank state “wait. did…did you have a chance to change?” you hum a little “mm-mm” glancing down at yourself still clad in max’s sweater and cotton panties, “uhm. no, i was a little more concerned with cleaning up the bed before you guys saw it so—sorry, i’m not a little more presentable—“
“are you wearing the same panties, mon ange?”
you freeze, brain lagging at what the monegasque had noticed. “mhm, yeah,” you whisper softly, playing with the hem of the sweater self-soothingly.
“can i,” charles takes a deep breath, “can i touch you, mon coeur?”
you squeak, “yes please, charlie.”
max watches as charles places his massive hand on one of your thighs, spanning the front with no struggle, and gently caresses his hand up, slowly making his way up your thigh. charles taps two fingers gently against you, and you spread your legs a smidge wider, and the sound of your thighs peeling off one another from the stickiness you leaked, reverberates around the room. max can’t help but let a moan slip out. charles slides his hand in between your legs, both of your own hands fisting at the hem of your borrowed sweatshirt, and you gasp at the lightest touch of charles pointer and middle finger against your soaked panties. max sees charles pupils blow wide and mouth drop open in awe—and he can’t wait anymore.
max presses his front to your back, sandwiching you in between them once again, and impatiently asks, “schatje, can i?” you let out a breathy ‘yeah,’ and max doesn’t hesitate to bully his hand in between your legs as well. he cops a more generous feel of your cunt, and groans at the state of ruin your panties are in.
“liefje,” max starts, “walk with me to the bed, please.” max pulls away, and unfastens one of your hands from the sweater to guide you. you turn around stumbling through your first few steps—charles sets you upright more prepared for your legs becoming jello than you are, and helps you over to the bed, one hand firmly set on the small of your back. max sits on the edge of the bed, man spreading comfortably, and watches how your eyes automatically fall to stare at his thighs with a smirk. he glances at charles behind you, who mouths ‘can’t blame her’ with a smirk of his own. the dutch pats his lap, “c’mere and give me a kiss, pretty girl.”
you rush to sit in his lap, slowing at the last minute, not wanting to sit your full weight on him. he huffs, and grabs at your hips situating you firmly on his lap, before leaning in and kissing you stupid. your gasp of shock transforms into a hum of pleasure, letting max have complete control of the kiss. his hand comes up to rest on the back of your head and moves you exactly where he wants, sucking on your bottom lip before slipping his tongue against yours. max kisses like he’s going to run out of time, he ravishes you completely. you squirm against him, pulling away to pant against his cheek needing air. max chuckles, and you only get to whine at his teasing for half a second before charles, who’s now sitting next to max, pulls you into another kiss. charles, on the other hand, kisses like he has all the time in the world, he draws it out. he keeps the kisses slow and closed in the beginning, pausing to pull away and thumb at your lips, relishing at how they’ve already swelled from max’s abuse, the surrounding skin already beginning to turn raw and sensitive from their friction of their facial hair. he continues kissing you, all tongue and sloppy not caring about about the way your hands come up to grasp at his chest in desperation, before switching to absolutely bruise your lips by nipping and tugging at them.
your hips jump forward against max’s, and he can’t stop the groan that tumbles out. you jolt away from charles’ assault and stare at max with an embarrassed expression, “s-sorry—“ max narrows his eyes and dismisses your apology, “don’t apologize for that. you feel good, you’re allowed to show that unless i tell you differently.”
“yes, max,” you answer, even though he didn’t ask a question.
“oh, you’re such a good girl for us, liefje,” he tests. and his instincts didn’t fail him. your hips twitch against his again, and a near inaudible moan slips from your lips.
he turns towards charles, “yeah, that works doesn’t it, cha?” charles nods, eyes still stuck on your lips. max smirks at charles being completely entranced, before turning back to you and clocks the glaze beginning to form over your eyes, “alright now, liefje, i need you to pay attention to me really quickly, hm?”
you hum, bobbing your head a few times, before you manage to get out a “yes, max.”
he holds your head steady with his thumb and pointer finger gripping your chin, “i’m not going anywhere, baby, take your time and focus.” it only takes you half a minute to truly focus in after your heart stops racing to give him another verbal confirmation before he continues. “tonight, neither one of us is going to make love to you—“ your shoulders drop and a frown is quick to spread across your mouth. you really only prepared for the situation that you’d tell them you were ready, and then you’d get railed into next sunday. you start to panic; maybe you came off too depraved, and he’s letting you down slowly—
“hey, hey, hey. no overthinking yet, let him finish, mon ange,” charles calls out to you worriedly, he’s experienced the same thought process you're going through before and would rather try and prevent the self-doubt from overtaking you.
max pets at your waist over the sweater and continues, “not tonight. we’ve just gotten off a flight, and had three back to back races. it’s late, and i’m sure all three of us are tired. we should initiate something like that with a clearer mind,” you feel a little selfish now, his points very valid, “but, i still want to give you an orgasm, okay? sure, you may not be able to get off by grinding on a pillow anymore. you’ve probably just acclimated to it and need to give it a break. so, to compromise: you’ll get off by riding my thigh.”
charles and max wait for your reaction. your frown lightens into a pout, but you’re disappointment doesn’t completely fade away. “how is that any different from riding the pillow? it’s the same thing.” charles laughs shakily, “oh, mon ange. you have no idea. listen to max and give it a try before you take it off the table completely.”
you shrug, and agree, “fine. how do i….uh how do i do the thigh riding, i guess?”
charles turns to look at max, wordlessly asking for permission, and max grants it with a wave of his hand. charles scoots up closer, and shifts your straddle from max’s whole lap to his right thigh. as soon as your pantie-covered cunt firmly presses on the muscle of max’s jean-clad thigh, a soft ‘oh’ croaks out of you. max flexes and relaxes his thigh once and your hips jump up and away from him. max and charles glance at each other; you’re ridiculously sensitive, they’ll have to see if that’s your natural state or if it’s just the result of your prolonged edging and the fact that you were grinding against a pillow not too long ago. charles squeezes your hips, bringing your attention to him, “i’m going to start guiding you now, you ready, mon coeur?”
“mmm, yeah—that felt really good, i want more,” you speak timidly.
“good,” charles states, and then he pulls your hips forward dragging you against max’s thigh, and a flash of heat zings up your spine. you moan, a small, breathy exhale, and charles keeps it slow at first, not pushing you down to roughly or making the motions too quick—he wants you to learn to love the friction again. barely a minute passes before your hips start fighting charles’ guided rhythm, and a frustrated groan slips out of you, not able to fight your boyfriends grip. max clocks back in from where he was watching the pleasure start to flicker on your face and asks, “what are you supposed to do, baby?”
“more-ah, please, charlie,” you moan shakily. charles smirks, “look at you, still using your manners like a good girl—“ a louder moan echoes, “okay, okay, mon coeur. i’ll get you there, i’ll get you to cum like you need, okay? i’ll make you forget all about your manners too, hmm?”
you stopped listening to anything after charles reassured you that he’s going to get you to cum, you believe him. he adjusts his grip on your hips and starts incrementally increasing the pace and pressure for you. your moans start to become more frequent, and increasing in pitch rapidly, the drivers can tell you’re hurtling towards your long-awaited orgasm, sooner than they thought. charles slowly releases his grip on your waist letting your hips take over once he’s sure you’ve gotten the hang of it. you throw your head back in pleasure, your hips have a steady grind and…and you’re feeling good. a suprised laugh slips out of your lips at that and shifts into a sharp moan when max starts flexing his thigh rhythmically giving you a little more texture to work with. max lets his heavy hands fill in for where charles’ and presses you down into deeper slower strokes.
you cry out, it’s a little too much for you, but it feels so good, that you bear with it, they know what’s best for you, anyways. max grins down at you smugly, and you start to tear up a little; he can still feel your hips twitching away from the pressure sometimes. not wanting to push you too far with that motion alone, he lightens up on the pressure but starts bouncing his thigh. the shriek you release surprises all three of you, but you don’t run from it, if anything you lean into it more. one of your hands fists into charles’ shirt for support, and the other falls to max’s, tugging it off your left hip so you can hold it tight. max’s grin softens into a small smile and he kisses your joined hands, and charles leans into press kisses on your neck, praise slipping out of their lips freely.
“doing so good for us, pretty girl.”
“yeah, baby, that’s it. take what you need.”
“don’t be shy, let those sweet moans out for us.”
“just like that, oh! look at that, you’ve leaked all over his thigh,” charles points out. max looks down and registers that his pant leg is sticking down to his thigh and the denim has darkened with the amount of wetness. “oh, yeah. look at that, baby,” max pats on the side of your face, and you can’t even recall when you screwed your eyes shut, but you look down, and a mortified squeal leaves you. not much longer and you’ll have drowned his thigh. the dutchman sucks his teeth at you, “don’t be embarrassed, liefje. i can’t wait until i can taste it straight from the source,” he moves his other hand underneath the sweatshirt, and slips two fingers between your inner thigh while gathering your wetness. he sucks on one finger moaning explicitly at your taste, before offering both fingers to charles to clean off. the monegasque flicks his tongue out teasingly tasting them first, before he makes a quick motion of sucking them in and fully running his tongue in every crevice to get every last drop of your taste.
you moans start to become pitchy little ah-ah-ah’s, and you frantically start rabbiting your hips. you’re so close. max squeezes you hand, and starts up the praise again.
“i wasn’t joking, schatje. when i finally get my mouth on your pretty little cunt, you won’t be able to pull me off of you until i force at least three orgasms out of you.”
charles pulls off of max’s fingers and adds, “i need to give her three or four from my mouth too. i don’t think she’ll be able to handle that many.”
“yes, she can. she’s such a good girl for us, she’d let us keep going until we tell her when she’s done.”
“mmm, yeah—she’s right there, look at that cute little face she’s making.”
“her pretty little o-mouth, we should fill that up for her too.”
“thinkin i’ll fill that sweet little cunt of hers first with my dick—“
what escapes your mouth is definitely a scream, and max can’t bring himself to muffle it even though it’s the middle of the night. he pays a hefty sum of money for this penthouse, they can deal with hearing how charles and him make you scream with pleasure. your orgasm completely whites-out all of your senses; ears ringing, eyes rolled back, skin feeling raw and thighs shaking. max and charles work your hips back and forth a few more times, helping you with the aftershocks until you squirm out of their hands. you fall forward into max’s chest, body trembling, and tears streaming down your face.
max cradles you close and scratches at your head, calling your name a few times to get a gauge of how out of it you are. with no verbal response, he sends charles to get water and a towel to clean you up. max softly murmurs praises at you constantly, and charles joins in with the affirmations when he returns. the both clean you up when you’re still floating; they put you in an oversized tee, not bothering with undergarments, wiping all wetness and cream away from between your legs trying to avoid looking at your cunt directly, they even manage to get your bonnet on for you, and even have time to change the duvet before you start becoming aware again.
you turn and automatically move to snuggle into the crook of max’s neck, but he gently presses a straw to your mouth so you can hydrate after the amount of fluids you seem to have lost. your eyes open, and you croak out a disapproving hum at not being able to go to sleep, and max shakes his head at you, “drink, schat. non-negotiable, pretty girl.” after slowly draining ¾ of the bottle, you pull away and with a shattered voice, start mumbling, “thank you, thank you, thank you—“
and charles leans over to cut you off with a soft press of lips, “no, thank you for letting us give you that, mon coeur.” you hum, whispering out, “i love you, charlie. i love you, maxy.”
they both respond with resounding ‘i-love-you’s back, and start soft conversation just checking up on you before they let you fall asleep.
“i’ve never felt this good before from an orgasm,” you start, “i wanna—i wanna keep being good for you guys. i wanna learn how to feel good like this again, and i want you both to show me how because i trust you. please?”. charles and max both murmur affirmatives to you, and you continue speaking softly, “you guys can take showers now, i’ll probably be asleep before you come back.” after making sure you’re truly comfortable, max and charles head to the en-suite to take the world’s speediest shower so they can cuddle up with you sooner.
shutting the door, max and charles stare at each other in completely silence. charles starts, “are we sure that we’re the ones corrupting her and she’s not corrupting us? because, i’ve almost came in my pants three times tonight.”
max stares at charles with unseeing eyes, “i will never forgot the way she soaked my fucking leg, charles…i’m pretty sure i did come in my pants.”
taglist: @lorarri | @soph1644 | @jaydensluv | @fanboyluvr | @nissaimmortal | @redgonerogue | @hollie911 @saintwrld | @buendiabebeta | @butterfly-lover | @lana-d3l-rey | @dylan1721 | @spicybagel14 | @dhhdhsiavdhaj
© httpsserene 2023
3K notes
·
View notes
Cherry Red, Crimson Blood
Chapter 13: Piece Me Back Together
Summary: Your pack deals with the aftermath of your heat.
Pairing: Poly 141 x reader, Ghost x Soap
Warnings: NSFW, 18+, smut, handjobs, anal fingering, anal sex, unprotected sex (please practice safe sex irl), spanking (it’s like once), choking (kind of), light Dom/sub dynamics, Johnny's praise kink, excessive use of the word cock, heat cycles, mating cycles, brief mention of blood, brief medical stuff, Alpha/Beta/Omega dynamics, Alternate Universe, a/b/o typical classism and sexism, language, and of course a little fluff
A/N: Well folks, we've made it past the heat portion of the fic. Now things can really start moving. Lots of aftercare, some world building, and of course a little spice at the end for you all to enjoy (as if the last chapter wasn't enough lol). I tried to catch all the possible tags for this one but as always, let me know if I missed one. The smut happens in the very last scene, so if you'd prefer not to read it, then skip that last little bit. You won't really miss much. Also, there's a lot of jumping around in time in this one so I tried to mark when things are happening relative to the present moment in the fic.
Want early access to chapters, as well as other bonus content? Consider supporting me on Patreon.
MASTERLIST | <- Previous | Next ->
6 Days Ago
“Looks comfortable.”
Kyle glances up as Johnny closes the door to his room, blanket and pillow in hand. “Slept on worse.” He shrugs, glancing down at the cot set up in the hallway before looking back up at Johnny. “Moving out?”
“Camping in Si’s office for the next week. Keep our distance.” He nods at the closed door.
“Probably for the best.” Kyle says. “Have fun!”
“Don’t enjoy yourself too much.” Johnny winks at him before making his way down the hallway and disappearing around the corner.
Kyle shakes his head, starting to sort through the many bags of supplies they’ve stocked up on in preparation for their omega’s heat. They’re well prepared, all of them, for the next week, Kyle especially. He’s spent the last few days reading up on what to expect, how to best help and support his alpha and omega, and what to look out for in case things start going wrong. He doesn’t think they will. He has a lot of faith in Price and he knows Price will take good care of their omega.
Still, he can’t help but feel a bit nervous. He has a big job to do, even though there’s not much to do until after the heat is over with. He just has to ensure Price doesn’t hurt you accidentally, or maul you to death. He doesn’t think that’s likely to happen, but then again, one can never know.
Kyle lets out a shaky breath, grabbing the bags with the electrolytes and nutrient bars before heading for your door.
It’s going to be a long week.
Present Day
It’s quiet. Has been for almost an hour now. Kyle rises from the cot, slipping his phone into his pocket. He slowly approaches the door, leaning in to listen for a moment before putting his hand on the knob. He lets out a breath before pushing the door open slowly, slipping in and closing the door quietly. The smells in the room are worse than they had been last night, a toxic mix of omega, alpha, sex, and sweat. He takes a moment to breathe, adjusting to the scent.
You and Price are spooned together on the bed, asleep, or at least you are. Price had pulled the blankets up around you, tucking you in. Kyle approaches slowly, not wanting to accidentally step on a wrapper and startle either of you and risk you getting scared or Price getting territorial. He brushes the damp strands of hair from your face, your body temperature significantly lower than it had been even last night. He pulls the forehead thermometer from his pocket, taking your temperature quickly before sending a text to Dr. Keller.
He carefully lifts the blankets, checking beneath. You’re still locked together as he expected, and he lowers the blankets back down, tucking you both in again. He unplugs Price’s phone from the charging cord that he’d plugged in last night, rotating it to your phone. He knew the chances of either of you being aware enough to use a phone for anything would be low, but just in case, he kept them both charged.
He tiptoes through the mess of wrappers and bottles, grabbing the bag of trash that he had started a couple days ago. He picks up the mess on the floor, cleaning off the nightstand as well before setting out a new bottle of electrolytes and a couple nutrient bars. There’s still quite a few left, but those could be saved for your next heat.
Price stirs a bit as Kyle sets the bag of trash off to the side next to the bag of things that would have to go to the wash. He hurries over, gently keeping Price from moving too much.
“Easy. You’re still knotted.” He says, putting a hand on Price’s shoulder as you let out a quiet sound. His skin is warm and sticky from sweat, and probably other things.
Price rubs his eyes before blinking up at Kyle. “What day is it?”
“Morning of the sixth day.” He answers, passing Price the bottle of electrolytes. “I think it’s over. Her temperature’s back to normal. Just waiting on Dr. Keller’s opinion.”
Price hums, unscrewing the cap from the bottle before taking a long drink. “Feel like shit.”
Kyle grins. “Been a long week for you, Cap. How do you feel?”
Price screws the cap back on the bottle before leaning over you to place it on the nightstand. “Like I got hit by a truck and rolled down a hill.”
“Speaking from experience, sir?” Kyle smirks.
Price gives him a look before closing his eyes again, relaxing against your back. He lets out a groan as his knot deflates, his cock slipping from your folds. “Christ, that's going to hurt later.”
“Let me get the bath started.” Kyle says, going into your bathroom.
He starts the water, making sure it’s warm enough before he grabs the epsom salt off the counter and adds some in. He leaves the water running as he moves back to the bedroom, helping Price off the bed first. The alpha groans as he stands, leaning heavily against Kyle’s side. Kyle wraps his arm around his shoulders, supporting Price as they make their way to the bathroom.
“I’ve been beaten, tortured, shot. I’ve jumped out of moving cars, been in helicopter crashes.” Price says, grunting as Kyle helps him down into the bath. “This might be the worst I’ve ever felt.”
“Not quite as spry as you used to be, old man?” Kyle teases, making sure he’s comfortable.
“Plenty spry, but god I forgot how energetic omegas can be.” Price leans his head back against the wall, closing his eyes.
“Just relax.” Kyle says, turning off the water. “I’ll bring her in.”
He heads back into your room, approaching the bed. You’re shivering, eyes squeezed closed and eyebrows pinched. Kyle kneels down next to the bed, placing a gentle hand on your arm. You start a bit at the touch, a quiet whimper leaving your lips.
“Shh, easy love.” Kyle tries to soothe you as you shake. “You’re alright.”
You let out a whine, seeking out your alpha in your disoriented state. The bathwater splashes as Price shifts in response to your call, his own instincts still on high alert.
“Let’s get you into the bath.” Kyle says before gently slipping his arms under you and lifting you up.
You let out a whine in protest, your body sore and aching from the last six days. Kyle quickly carries you to the bath, easing you into the water between Price’s legs. You’re trembling, quiet whines leaving your lips as he eases you back against Price’s chest. The alpha wraps his arms around you, a quiet rumble sounding from his chest as he tries to ease your disorientation and discomfort.
Kyle leaves you and Price there to soak as he heads back to the room to strip the sheets and start the laundry. Most of your pillows and stuffed animals are stacked in the corner of the room by your desk, spared from the mess that the bed has turned into. The sheets are still wet with a concoction of fluids, and he knows they’ll need to soak for a while. He stuffs them into the bag with your clothes, along with your blankets, before he heads down the hall to the laundry room.
He checks on you and Price when he returns, both of you content still in the bath. He can’t help but smile as he watches the two of you, pride swelling in his chest at the sight of his alpha taking care of their omega.
Their omega.
It seems almost strange to think now. They’d gone so long without an omega, and thought they wouldn’t be getting one. Now, six weeks later, they’ve all fallen head over heels for a little omega none of them even knew they needed. He can’t imagine life without an omega now, how well you fit into their pack, how well you fit with all of them, how you’ve only served to make them stronger and more efficient.
He hates to admit that perhaps Laswell was right.
Maybe they did need you after all.
Kyle bags up the plastic mattress protector, glad to see it did its job. He replaces the sheets and blankets for now, knowing you’ll want to nest once you’re more aware. He checks his phone before heading back into the bathroom, kneeling down next to the tub. Your shaking has subsided, reduced to a shudder here and there as you’ve slowly relaxed in the hot water.
Kyle grabs a cloth and your body wash, starting to gently clean your skin, or at least get the sweat and other fluids off. Bruises litter your skin and the claiming mark on your shoulder is scabbed and angry. Kyle carefully washes it, not wanting to apply too much pressure as he cleans off the dried blood still stuck to your skin. He knows it’s going to hurt for a while.
“What did Dr. Keller say?” Price asks as he helps ease you up so Kyle can wash your back.
“Said if her temperature is normal then the worst is over.” Kyle answers. “She wants to do a check up soon, make sure everything’s alright. Said she’d come here to do it, if that’s alright.”
Price grunts quietly as Kyle starts to wash his chest. “That’s fine. Easier than going all the way to the medical building. Simon and Johnny?”
“Fine.” Kyle answers. “Been keeping busy running drills and stuff. Johnny’s been keeping Simon occupied.”
Price hums, letting his eyes close as Kyle washes his neck and shoulders. “Good.”
Kyle makes sure to get all of the soap rinsed off before pulling the plug on the water, carefully lifting you up to stand. He lets you lean against him, grabbing one of the towels to dry you off as best he can. Price gets himself standing, drying himself off as Kyle helps you back to bed. Price joins you, wrapping his arms around you tight as Kyle tucks the blankets up around you both.
“Can I get you anything?” Kyle asks as he sets a new bottle of electrolytes on the nightstand. “Real food maybe?”
“I’d kill for some bangers and mash, maybe a pint.” Price says, a smile tugging at his lips.
“I’ll see what I can scrounge up.” Kyle says, glancing at you one last time before he leaves the room.
Your body aches. There’s a deep soreness in your muscles, and a painful throb between your legs. Your skin feels raw and tight, and there's a steady pulse behind your eyes. A quiet sound leaves your lips before you can stop it, the sound cracking and broken from your raw throat. There's a desert in your mouth again, your tongue dry and heavy in your mouth.
Your thoughts are dragged away from the agony in your body as a quiet rumbling starts somewhere in front of you, your brain going quiet except for the need to seek it out. You press yourself closer to it, meeting warm skin as you try to get closer and closer. You want to bury yourself in it, seep into its depths until you can feel the vibrations of it in your bones. Arms wrap around you, pulling you in closer until you're squished against a bare chest.
You press your face against the soft skin, trying to get closer to the rumbling purr vibrating from deep within. You let out another sound, body going lax as the purr lulls you into a relaxed state. The tension leaves your body, easing the ache in your muscles a bit. Not much, but enough to pull a relieved sigh from your lips.
“Easy, love.” A quiet voice says, another hand touching your back.
You tense slightly at the intrusion on your safe space, but quickly relax as the hand stills on your skin. The calming scent of beta overtakes you, easing your mind to a quiet hum as your alpha and beta work to calm you. You feel a bit disoriented as reality slowly begins to return, seeping back into your brain.
You went into heat.
You remember waking up with the blistering inferno burning hot within you, the insatiable need pulsing between your legs. You remember Kyle being there, the soft scent of him as he helped you prepare, pulling off your clothes and making you drink some of the electrolytes. You remember John entering the room, the way his scent made your brain feel like mush. You remember him sinking his teeth into your shoulder, his knot forcing you open before everything went dark.
Everything else is a dark blur, wiped from your memory after your instincts took over.
You shift against the body you’re pressed close to, a deep ache rippling through you. It hurts, everything hurts. Your hips are sore, your shoulder is throbbing, every muscle feels like you just did a triathlon with no training, and there’s a sharp throbbing between your thighs.
You’re crying before you even realize it, the tears uncontrollable as they slide down your cheeks, the quiet sniffles and sobs aggravating your already aching body. The arms around you tighten, the purring getting louder, but you can’t stop the onslaught of tears.
You flinch as something tickles the skin of your forehead, chapped lips pressing a soft kiss to your hairline. You let out a whine as you continue to cry, your mind a swirl of confusion and disorientation as you try to come to terms with everything that’s happened. You don’t know how long it’s been, what day it is. You don’t even know what happened to you in the last week.
You continue to cry, oblivious to the conversation happening over you, the gentle purring in your ears lulling you into a dazed state as you float in and out of consciousness. The pain of being moved momentarily brings you back before you settle again, laying back against a chest. A baggy shirt is pulled over your head, smelling of your alpha. The fabric feels different than it had days ago when you’d woken up in the throes of your heat. It’s soft, not offending, and it offers you warmth and comfort.
You don’t want to move, you don’t want to do anything. Exhaustion pulls at the edges of your mind as you lay there, the tears still streaming down your cheeks.
He hasn’t stopped purring since you woke up. The low rumble in his chest hasn’t stopped, and neither has the ache blooming there since you started crying. Even in your dazed, half asleep state, the tears still roll down your cheeks, quiet shaky breaths catching every so often. He’s not sure what to do, how to help. He’s never been with an omega that’s cried before. Not like this.
His purring kicks up in volume as you startle awake when the door opens, letting out a broken whimper as your space suddenly gets invaded. He tries to soothe you, his arms tightening around you to try and ground you in his presence.
“Hi, honey.” Dr. Keller says, kneeling down next to the bed, her voice soft and the scent of beta thick in the air. “Still a bit out of it, huh?”
“She hasn’t stopped crying since she woke up.” He says, rubbing gentle circles on your arm with his thumb.
“That’s not unusual.” Dr. Keller says, digging through her bag to pull out a thermometer. “There’s a lot going on right now for her. Besides the exhaustion and the confusion and the pain, there’s a lot of rapid hormonal changes happening. Some omegas can just wake up and hop out of it immediately and be just fine.”
John frees one of your arms so Dr. Keller can take your pulse and blood pressure.
“Others might struggle a bit more.” She continues. “Purebred omegas especially have a hard time coming out of it. They’re more sensitive to those instincts and the sudden cut off of them is rather jarring.” She puts her equipment back in her bag. “Her vitals look good, which makes me confident to hold off on any further examinations until she’s more alert and aware.”
“Are there things we should look out for?” Kyle asks.
“She’s going to be drowsy and fatigued for a while, but if you can’t wake her at all, call me. If her breathing gets shallow or her pulse weakens or she starts developing a fever again, call me. Also check for blood the next time she uses the bathroom. Her vitals aren’t showing any indication of internal injuries, though, so I think she’ll be just fine.” She pulls a pill bottle from her bag. “I’ve prescribed some muscle relaxers for her. There’s a week’s worth in there. It’ll help with the pain and discomfort, but they will make her sleepy. The best thing she can do right now is rest and recover. Once she’s more aware, you can try some soft foods and lots of liquids. If she’s really struggling, I can set up an IV and get some fluids into her, perk her up a bit.”
“Thank you.” John says, shifting you slightly so Dr. Keller can look at the bite mark on your shoulder.
“How are you feeling?” She asks him, pulling out a disinfectant wipe.
“Sore.” John huffs out a laugh. “Nothing I can’t handle, though.”
Dr. Keller hums as she cleans the wound on your shoulder. “I know I’m not here to give you medical advice, but as your omega’s doctor I feel the need to remind you not to ignore your own symptoms. She needs you right now, more than ever. So don’t try to macho man your way through anything. You need to rest just as much as she does.”
“Yes, doctor.” He grumbles, adjusting your shirt once she’s done.
Dr. Keller gives him a smile. “You did a good job.” She turns to Kyle. “Both of you. Don’t hesitate to call me. It’s what I’m here for.”
A smile tugs at John’s lips as Kyle practically beams from Dr. Keller’s praise. He did do a good job. You’re both still breathing after all.
3 Days Ago
“I cannae take anymore.” Johnny pants, his breaths near wheezes as he rests his hands on his knees. “Ye said you'd go easy on me.”
“I never promised anything, Johnny.” Simon says, standing behind him.
“Hell's bells, L.T.” Johnny groans, dropping to his hands and knees. “Gonna kill me at this rate.”
“Don't be dramatic. C'mon, again.”
“Uh uh.” Johnny says, flopping onto his side on the ground. “Am pure done in! ‘S almost lunch anyway.” He rolls onto his back, looking in the direction of the barracks as he wipes the sweat from his brow. “Think they're havin’ fun?”
Simon looks down at him, looming over him like a shadow. “Probably seems like it right now. Be a different story when it’s done.”
“Sometimes I wish I knew what it was like.” Johnny says, turning his gaze up to Simon's face. He can't see much under the mask, and right now is one of those moments when he wishes he could.
“You really don't. It's messy and gory.” Simon offers him a hand, helping Johnny to his feet. “Gotta be prepared to pick up the pieces afterwards.” Simon turns, heading in the direction of the barracks.
“That why you've never taken an omega?” Johnny asks, following him.
Simon stops dead in his tracks, turning to look at Johnny. Johnny's back straightens at the look in Simon's eyes. No, not Simon. Ghost. He's looking at Ghost again.
“Drop it. Or I'll make you do another lap.” Ghost says, his voice taking on the low rasp he gets when he's shifted into the laser focused headspace of the Lieutenant.
“Yes, sir.” Johnny says, following after Ghost as they head back towards the barracks.
Ghost slips into the showers once they enter, Johnny heading to the corner to peek down the hallway towards their rooms. It's quiet now. It hadn't been when they left earlier. He could hear it as they passed the hall to go out the door, the distant sound of moans and the bedframe knocking against the wall. He had fought the erection threatening to tent his shorts all the way to the field. He knows heats are no light matter, but the mental image he's drawn up of you blissed out, mouth open as you moan, back arching in pleasure has been plaguing him for nearly two weeks. He's desperate, practically chomping at the bit to get a chance to see it himself first hand, to see the real thing putting his mental image to shame.
He makes his way down the hallway, keeping a respectful distance between himself and your room. Kyle looks up from his spot on the bed where he'd been scrolling on his phone.
“How're they doin’?” Johnny asks, wiping the sweat from his face.
“Alright. Sleeping for the moment.” Kyle answers. Johnny can only imagine the torture of having to sit and listen to nonstop fucking for the last three days.
“We're gonna grab lunch soon. Want us tae bring ye somethin’?”
Kyle nods. “Sure. That'd be great.”
“Ye got it.” Johnny nods, passing a glance at your door before looking back to Kyle. “Good luck.”
“Thanks, mate.” Kyle says, watching his fellow beta walk back down the hall.
Johnny glances up from his phone as Simon huffs out what's the tenth sigh in the last three minutes. The alpha is seated at his desk, clicking away at something on his computer and occasionally mashing away at the keyboard rather harshly. Johnny's surprised he hasn't cracked a key yet, or just thrown the whole thing out the window. The beta can see how tightly his alpha is wrung by the tenseness in his shoulders, the hard set of his brow, the set line of his lips, the occasional tick of his jaw.
“What's got ye all riled up?” Johnny finally breaks the silence, setting his phone aside.
“Nothing.” Simon grumbles, ignoring Johnny's gaze.
Johnny’s brow furrows and he pushes himself to stand, moving over to Simon’s side. “Doesnae seem like nothin’ to me.” He puts his hands on Simon’s broad shoulders, squeezing them, feeling the tension in his muscles. “Awful tense, Si.”
“Leave it, Johnny.” Simon grumbles, trying to swat the beta away, but he’s insistent.
“Wouldnae be a little omega getting you so tense, would it?” Johnny teases.
Simon turns to him, his eyes darkening. His jaw clenches, hands closing into fists where they sit on the armrests of his chair. “Don’t push it, Johnny.” His voice has that deep rumble to it, the threat of his alpha coming through.
Johnny stares at him, feeling the danger prickling at the back of his neck, but at the same time, he wants to push that boundary. He wants to see just how far he can push his alpha until he finally gives in.
“I don’t know why ye keep torturing yourself like this, Si. Ye know ye like her. She’d be more’n willing-”
“That’s the problem.” Simon snaps, pushing himself up from his seat, forcing Johnny to take a step back. “She’s not doing this because she wants to. She’s only doing this because she’s been told to do it.”
“She’s an omega. Her whole life was going tae be people tellin’ her what to do and forcin’ her tae do things, even if she didn’t want to. Ye think things would have been different if she’d been put with a different pack?” Johnny doesn’t back down from Simon’s glare, having been on the receiving end of it enough times now he’s almost immune to it. “Things could have been a lot worse for her. She might not have wanted to be here, but she is. Ye can’t change that, Si. No matter how badly you might want to.”
Johnny can tell by the slow fall to Simon’s tense shoulders that he’s struck home. The situation wasn’t ideal, but it’s what they were dealt. You’re here with them, and he’s going to make sure you feel as comfortable as possible.
Simon lets out another sigh, turning away from Johnny to crawl into their makeshift bed. He lays down with a huff, closing his eyes. Johnny smirks, slowly crawling onto the two cots pushed together, laying down right next to Simon. He rests his hand on Simon’s thigh, feeling the powerful muscle flex under his hand. He slowly begins to drag it higher, Simon’s eyes opening again.
“What do you think you’re doing?” Simon rasps, but he doesn’t move, even as Johnny reaches the junction of his hip and thigh.
“Yer all worked up, big guy.” Johnny says, leaning his head on his hand, slowly moving his hand over Simon’s very prominent bulge. “Thought I’d help ye.”
“What makes you think I want your help?” Simon says, still laying still.
Johnny lifts his brows, slowly rubbing Simon through his pants. “This looks rather painful, and I seem to be the only option to help, since everyone else is rather occupied-”
Johnny’s words are cut off as he finds himself suddenly on his back, Simon’s hand around his throat. The alpha is leaning over him, a deep rumble vibrating through his chest. “You talk too much, Johnny.” Simon rumbles, leaning close to the beta’s face.
“I’ve been told tha’ before.” Johnny says, leaning up to try and kiss his alpha, but Simon backs away before he can make contact. “By you if I remember correctly.”
Simon’s fingers flex around his throat, a moan spilling from his lips as Simon grinds his hips against Johnny’s. His cock is hard in his pants, has been for a while. He’s not sure if it’s from the lewd thoughts that have been plaguing his mind since you first kissed him, weeks ago, or if it’s just a response to the knowledge that you’re currently fucking their pack alpha like your life depends on it.
Johnny lets out a whimper, bucking up against Simon desperately. Simon tuts at him, pressing against his throat to keep him still on the bed as he sits himself up on top of the beta.
“Naughty little thing.” Simon says, staring down into his blue eyes. “Know you’ve been thinking about sinking your cock into the new little omega for weeks.” Johnny lets out a whine, his cock twitching in his pants. “I don’t think you’ll even make it that long, will you pup?” Simon chuckles. “Gonna cum in your pants as soon as you see her tits, huh?” Simon presses down, putting more pressure against his cock as he rubs it through his pants. “Gonna cum in your pants just thinking about it.”
Johnny holds his breath, trying to focus anywhere except for Simon’s hand. He squeezes his eyes closed as Simon undoes the button on his cargo pants, releasing his throat to tug the fabric down around his knees.
“Bloody hell.” Simon says, wrapping a hand around Johnny’s hard cock. “Prettiest cock I’ve ever seen.”
“I thought Kyle’s was the prettiest.” Johnny says, opening his eyes to glance down at his alpha.
“Kyle’s just pretty.” Simon says, slowly stroking Johnny’s cock. “You have the prettiest cock.”
“Christ...” Johnny breathes as Simon continues to jerk his cock, his hips bucking as he can feel himself getting closer and closer to the edge.
A pathetic whimper leaves Johnny’s lips as Simon pulls his hand away, sitting up on his knees over his beta. He undoes his belt, tossing it to the floor before undoing his pants, pulling them and his briefs down to release his own throbbing cock. Johnny licks his lips as Simon fists his own cock, slowly stroking it.
“Turn around. Let me see that pretty ass.” Simon says.
“Yes, sir.” Johnny smirks, wiggling himself until he’s flat on his stomach, pushing his ass into the air as best he can with his legs trapped between Simon’s.
Simon purrs quietly at Johnny’s response, running his hands over his beta’s pert cheeks. “Prettiest ass too.” He murmurs, gently spreading his cheeks.
“I’m startin’ to think I might be the prettiest.” Johnny says, gasping quietly as a glob of warm spit hits his hole.
“Give me a night with Kyle and I’ll get back to you on that.” Simon says, pressing a finger into Johnny’s ass.
Johnny groans, pressing his face into the pillow. “Fucking Christ.”
“You can take it.” Simon soothes him, reaching down to fish the lube out of the bag he’d tossed it in last night. He squirts some on his finger before pressing further in, spreading Johnny’s ass open. “Good boy.”
Johnny nearly melts into the cot, letting out a pathetic sound as Simon adds a second finger. He’s still sore from the last three days, but his drive to please his alpha pushes away any sensitivity he’s feeling. That, and the lust burning hot in him. Betas don’t have heat cycles, but he might as well be in the middle of one with how horny he’s been these last few days. He knows part of it is Simon being worked up by the knowledge that there’s an omega in heat nearby, and his own body reacting to his alpha. He’s never been around an omega in heat, and he doesn’t think Simon has either.
He’s not sure Simon has ever been with an omega at all before.
More cold lube hits his hole, a second finger pressing in. He gasps at the stretch, squeezing around Simon’s thick fingers. Simon’s other hand trails up his back, pushing his shirt up as he goes. Johnny pushes himself up slightly, tugging the fabric over his head before he relaxes back down against the blankets.
Simon presses a third finger in, working Johnny open with what still won’t be enough, but Johnny won’t complain. He’s taken his alpha before. He’ll do it gladly again.
“Fuck, Johnny.” Simon grunts as Johnny squeezes around his fingers again.
“Cannae help it.” Johnny whines. “Feels too good.”
“Didn’t say you could cum yet.” Simon says, removing his fingers. “Naughty pup.”
Johnny lets out a pathetic sounding whimper, pressing his ass up to try and chase Simon’s fingers. He yelps as Simon’s hand meets his skin, his hips dropping back to the bed at the force of Simon’s spank.
“Stay still.” Simon growls, the cap of the lube popping open again.
Johnny does as he’s told, keeping himself still as Simon prepares himself. He groans as the tip of Simon’s cock presses against his hole, his hands fisting the sheets at the stretch. Simon’s hand rubs his back, trying to get him to relax. Johnny breathes, forcing himself to go lax, letting Simon slip in further.
“Good boy.” Simon groans, bracing himself on the bed as he presses further and further into Johnny’s tight hole. “That’s my good boy. You can take it.”
“Fuck!” Johnny groans, practically preening from the praise.
“That’s it.” Simon groans, pressing in until his hips are flush with Johnny’s ass. “Bloody fucking hell.”
Johnny’s mind goes blank as he’s filled, all thoughts leaving at the feeling of his alpha inside of him. He’s panting already, stretched open around his alpha’s cock. Simon begins to move, rocking his hips slowly, drawing his cock out before pushing it back in. Johnny whines, pushing back against Simon, needing more.
“Please...” Johnny begs. “Please alpha!”
“Fuck.” Simon grunts, bracing himself further before snapping his hips against Johnny. “Like that? That what you want, pup?”
Johnny almost yelps at the sensation, hands fisting the blankets as his body rocks forward on the cot. “Fuck, yes!”
Simon sets a brutal pace, hips snapping against Johnny’s ass. Pleasure numbs Johnny’s mind as the sensation of Simon inside of him. His cock is trapped between his body and the cot, dragging against the blankets with every thrust. He’s going to cum soon, he knows that. He won’t be able to hold it, not with how sensitive he already is.
“Gonna cum, can’t hold it!” He whines, pushing back against Simon’s thrusts for more friction. “Fuck, alpha!”
Johnny cums quickly with a groan, the blankets getting damp under him as he shakes in his release. Simon doesn’t stop, undeterred by Johnny’s clenching around him in his orgasm. He’s going to ring a few more out of Johnny before he’s done.
They’re both in for a long night.
NEXT ->
Taglist:
@bobaprint @ashy-kit @anunintentionalwriter @mockerycrow @hayleybarnesx @protokosmonaut @fruitymoonbeams-blog @blue-blue0 @hindi-si-ikay @thatonepupkai @redwites @kattiieee @141trash @lothiriel9 @dillybuggg @beebeechaos @konigsmissedbeltloop @kaoyamamegami @idkkkkkkk8363 @wallwriterstuff @smile-child-13 @anomiatartle @dangerkittenclaws @bless-my-demons @mystic60 @evolutionarry @red-hydra @lunaetiicsaystuff @linaangel @codsunshine @thriving-n-jiving @slayerx147 @ferns-fics @spicyspicyliving @cityoffallencrows @ttsbaby01 @heeheehoohoohahahihi @sleepyoriana @ihatethinkingofnames10 @cassiecasluciluce @darling006 @sheep-from-rad @ohgodthebogisback @willow-sages @scythemood @daniblogs164 @mirzamsaiph
2K notes
·
View notes
˖⁺。˚⋆˙make you mine | CL16 LN4 ˖⁺。˚⋆˙
pairing: charles leclerc x singer!reader y/n (she/her) x lando norris
genre: social media au, polyamorous relationship
warnings: just polyamory & fluff
summary: in which you never censor yourself online but your boys wouldn't change you for the world
a/n: i luv the polyamory reqs lollll
request!!!: I've been obsessed with Charlando recently so I was wondering if you could maybe write a smau for them with singer!reader, I don't have a plot other than the fact that they are dating someone like Renée Rap with zero PR training, can you imagine the chaos
fc: madison beer
my masterlist
twitter ->
instagram ->
charles_leclerc posted a story
liked by landonorris, carlossainz55, and 432,054 others
landonorris you're telling me
liked by charles_leclerc
user1 omg aw
user2 awww our precious girl
user3 still not used to u dating her
landonorris posted a story
liked by charles_leclerc, yourusername, and 389,766 others
user4 charlando looking after y/n <3
charles_leclerc only if we feed her 🤔
landonorris well..... true
user5 yummm pancakes
francisca.cgomes i miss her
landonorris i told her and she literally squealed at the mention of your name..
francisca.cgomes heheheee that's my girl
landonorris and here we were, thinking she was ours
messages ->
instagram ->
yourusername posted a story
liked by francisca.cgomes, lilymhe, and 982,712 others
user6 omg
user7 i am no better than a man
user8 what have they done this time
liked by yourusername
landonorris baby please we said sorry it was an accident
charles_leclerc ma belle please we're begging
francisca.cgomes posted a story
liked by charles_leclerc, yourusername, and 134,927 others
charles_leclerc she's with YOU?
landonorris return her to us this instant
francisca.cgomes idk what you're talking about 🤷♀️
user9 make em squirm
user10 😍
yourusername 📍 paris
liked by charles_leclerc, landonorris, and 1,043,365 others
yourusername the boys forgot about me but she never would
tagged: francisca.cgomes
view all 8,943 comments
francisca.cgomes i wouldnt dream of it sweetheart 😍
yourusername stop im blushing....
landonorris stop flirting where we can see it charles is distraught
yourusername so was i when i realised you'd both forgotten to include me in your travel plans
user11 LOL is she being serious😭
user12 the most beautiful wags by far
pierregasly go away back to monaco and free my girlfriend
yourusername YOUR girlfriend? huhhh i know you aint talking about my girl kika
pierregasly @.landonorris @.charles_leclerc please make her forgive you so i can live in peace
charles_leclerc you don't think we're trying 😢
francisca.cgomes try harder 😋 (or dont) (i love having her around)
user13 LOL y/n always brings the chaos to social media 😭
user14 i just know lando & charles' PR team are tired
messages ->
instagram ->
yourusername posted a story
liked by francisca.cgomes, carlossainz55, and 671,346 others
lilyzneimer deserved
yourusername right?!
user15 hahaha what a fun spectacle to watch unfold via instagram
carlossainz55 you guys are crazy
yourusername 😘 perhaps true
carlossainz55 no, definitely true
user16 i know this was charles' idea
charles_leclerc 📍 monaco
liked by pierregasly, yourusername, and 844,971 others
charles_leclerc time to get serious for the home race
tagged: yourusername, landonorris
view all 7,375 comments
pierregasly thank god
charles_leclerc 🤨
user17 OMG THEY R SOOO CUTEEE TOGETHER
user18 im so jealous of them
yourusername get my boys on the podium!!!! 🥇
liked by charles_leclerc, landonorris
user19 she gets it
landonorris us going back to being rivals on the track: 😢
charles_leclerc my heart isnt in it, dont worry
user20 omg why is the cutest thing ever
yourusername posted a story
liked by francisca.cgomes, lilymhe, and 612,854 others
lilymhe bored much?
yourusername they are too busy and serious to entertain me. send help
lilymhe im coming to collect you immediately
francisca.cgomes they bored you into becoming an impromptu artiste?
yourusername pretty much 😂 lily said the same thing
francisca.cgomes ok good cause me too. On my way!
user21 trust y/n to supply us with the charlando content 😻
twitter ->
instagram ->
yourusername 📍 monaco
liked by lilymhe, oscarpiastri, and 1,024,736 others
yourusername congratulations to my boys on p1 and p2 🩷✨🎀🥰🌸💘🌷🩰 never been so proud in my life!!! by the way i just dropped a new song called make you mine .. this one's for my boys:))) ily all
tagged: landonorris, charles_leclerc, lilymhe
view all 14,827 comments
user26 NO WARNING?????
user27 what the fuck
lilymhe i screamed tbh
alex_albon can confirm
yourusername oh stop it you guys 🤭
francisca.cgomes IIIII WANNA FEel the RUSHH
yourusername real 👀
user28 SCREAMMMMMM
user29 our chaotic queen 👸
landonorris oh my god baby
charles_leclerc no way
messages ->
instagram ->
landonorris posted a story
liked by yourusername, carlossainz55, and 716,826 others
user30 oh god i love these three
oscarpiastri cute
lilyzneimer love her <33
user31 sickly sweet😭
charles_leclerc posted a story
liked by landonorris, pierregasly, and 801,626 others
user32 the hand drawn hearts is too cute
user33 y/n is the luckiest girl in the world
user34 giggling and kicking my feet over them
pierregasly you guys are crazy
charles_leclerc crazy in loveee 😎😎😎
yourusername posted a story
liked by charles_leclerc, francisca.cgomes, and 974,626 others
user35 the red and orange hearts😭😭😭
user36 them all posting each other celebrating i could die rn
user37 idk who i wanna be more
francisca.cgomes my fav throuple
yourusername how many others do you know
francisca.cgomes not the point!
landonorris
liked by yourusername, charles_leclerc, and 837,907 others
landonorris live inside my mind you can see the shrine got you on my walls ..
tagged: charles_leclerc, yourusername
view all 11,737 comments
user38 omg🥹🥹🥹🥹
user39 omg they are sosososososo cute together i cant cope
user40 oh to be y/n y/l/n
francisca.cgomes a moment for make you mine song of the year 🙏
landonorris pinned 🧷
yourusername iktr 😎
charles_leclerc my honeys 🍯
yourusername hehe
landonorris i love you
charles_leclerc i love you ❤️
yourusername i love u sweeties
user41 the little nicknames🥹🥹🥹
user42 i'd die for them
landonorris same
THE END ❤️🧡
1K notes
·
View notes
Hiii is it alright if I request for a College!Camgirl!Ellie x college!reader? Could I also have a specific 💐 tag for when I ask things 😭😭?
PS: I love your work so fucking much, on my knees for them 💗🙏🏻
-💐
જ⁀➴ yes angel!! thank you <3 sorry this took so long btw!! lowkey had a bender over spring break and didn’t write 🫣
warnings: 18+, squirting, pet names, service top!ellie, camgirl!ellie, consensual video recording. photo credits to @ellies.galaxy on tiktok!
reqs are open 𝜗𝜚
────── · · ୨୧ · · ──────
“you can take it baby. know my girl can.” the auburn haired girl whispered, while guiding your hips to sink fully down on her brand new strap on that sits erect on her pale lap. the aforementioned 8 inch, lavender toy was generously gifted by one of her followers, with a message attached that simply said “to break her in.”
since moving in with ellie, you’ve gradually learned so much about her….possibly more than a roommate should. first, it was her adorable obsession with vintage video games, then the way she brings home little rocks and treasures she finds on the walk to class, then…it was finding her nude in front of a camera with your “missing” thong smothering her face.
but, you couldn’t possibly resist helping her, huh?
the video garnered tons, TONS of donations, likes, and subscriptions. her followers loved that it wasn’t a staged “getting caught” cliche, and that you fully indulged in her perverse energy. since then, she’s gotten lots of requests to keep you around in her videos, which you are more than happy to oblige.
the tip nudges against your cervix, a soft bulge appearing on your abdomen. as she shifts to zoom in on the precious sight, your long forgotten homework falls off the bed, papers sliding all across the floor.
“y’see that? how she’s fuckin swallowing me?” ellie asks the camera as she zooms in on the aforementioned “she”, being your fully stuffed cunt.
“els…please move….” you pant, digging your fingernails into her thighs as an anchor. “i…i’ll do….any-thng…” you whine desperately, dying to just rut into ellie’s hips on your own, but you know better. the first (and last) time you made that mistake, she tied you up with the vibrator on the highest setting for two hours, live-streaming the whole ordeal.
hey, at least she made over $500 off of it.
“show em how you feel, angel.” ellie coos, thrusting in and out agonizingly slow, propping the camera up on her dresser, the perfect angle to capture your doe eyes rolling effortlessly into the back of your head.
“els….ohmgd…please harder!”
without a word, ellie gets the most intriguing smirk on her face, massaging her calloused fingers into your hips for a moment….then suddenly gripping onto them, bouncing you on her cock unrelentingly. screaming her name, your legs go numb. every time your trembling hands go to grip onto her waist for support, she nudges you off, growing wetter and wetter watching you unable to stabilize yourself. a thin white ring forms around the base of her cock, that she scrambles to grab the camera and zoom in on.
“look at that…fuck.” she reaches down and thumbs on your clit, causing you to buck down into her even harder, if that’s possible at this point.
“gna…gna cum els….pleaseee…” you stare right into the camera, knowing that she’s gonna replay that moment over and over again later just to see the pathetic desperation in your eyes, your perfect pout penetrating her every thought.
“go ahead angel, cum all over this cock. show me how good it feels in you. how….how…god…how good i feel in you.”
those last words send you over the edge, collapsing into her while your entire body twitches. your tight, slick walls clench around the toy for the final time, her thumb on your clit encouraging you to drench ellie’s stomach and sheets.
“fuck…i got that shit on camera. you’re so goddamn hot.” she pans the camera down to her toned stomach, where your wetness is splattered. the euphoria hasn’t worn off yet, your eyelids heavy, vision blurry as ellie smooths down your hair delicately, throwing the camera onto her chair and cradling your head into her lap.
“such a good girl f’me…..”
1K notes
·
View notes
Removing the ability to go directly to a specific reblog is a disastrously bad change! I can no longer engage with it when someone reblogs a post referencing the previous reblog's tags, which is, if you somehow missed it, a very common way people interact with each other on tumblr. I also often end up following new people because my mutuals regularly reblogged from them and they have interesting tag commentary; if I can't click through and look at their tags anymore, I'm not going to naturally find new people to interact with, which seems like the kind of thing that tumblr should want to incentivize rather than actively prevent?
I'm aware that this was not your decision personally, in the sense that you were apparently unaware of it at first, but it's a very bad decision, it makes my user experience of the site much worse, and I am going to use multiple avenues available to me to register a complaint about it in order to emphasize this badness!
Whatever this change is supposed to achieve, do something else to achieve it that doesn't remove the ability to actually look at specific posts.
a lot of changes we make won’t be well received by people who have survived the kinda insane ways this site works as-is. that’s the price we have to pay to help make tumblr a growing platform.
i’m sorry, it sucks, i don’t like it either, i’m also someone who’s been using this site for over 10 years and i’m used to the way it’s been working for most of that time. it’s a challenge for me to accept that tumblr isn’t actually working right now for the vast majority of people, who aren’t as vocal as we are.
please do send in feedback, but try to understand that most of what you’re describing is behavior you learned the hard way, and we can’t keep tumblr around if “the way to effectively use tumblr” is learned the hard way.
5K notes
·
View notes
₊✩‧₊˚once more to see you˚₊✩‧₊ pt 2
{nanami x f!reader}
pt 1. here pt 3. here pt 4. here
˚₊✩‧₊summary: You're a manager at Jujutsu Kaisen and things got a little steamy with Nanami in the car after a mission. Now you're left wondering what's going to happen between you.
˚₊✩‧₊tags: nanami x fem!reader, slight angst, explicit smut (mdni) !!
˚₊✩‧₊ word count: 8.6k (I GOT CARRIED AWAY WRITING THIS OKAY)
˚₊✩‧₊author's note: i didn't expect to get so many of ya'll asking for a part 2 but thank you for the kind messages! this one is a bit longer and has mostly backstory stuff and angst in a stupid will they won't they sort of way. idk i think i was in a mood writing this. but i promise there is a little bit of something at the end *wink wink*
˚₊✩‧₊if chapter one was this Mitski song, chapter two is this one, iykyk
••••••••��•••••••••••••••••••••••••••••••••••
You woke up with a start as the sound of a car door closing rang in your ears. You slowly opened your eyes and looked around confused. You sat up quickly, forgetting where you were for a minute. You groaned as you felt a sore sensation in your lower abdomen and you looked down. You noticed a tan suit jacket draped across your body as a makeshift blanket, covering your exposed chest and stomach. Your underwear was on, and you realized that the white fabric you were sitting on was the shirt you had been wearing.
You felt your face go hot as you started to think back over what had happened. You had slept with him. Your hands covered your cheeks as you felt them go red. You had really slept with him. Memories flashed in your mind, his body on yours, his hands on your body, the ungodly noises he let out- the ones you had let out.
You took a deep breath trying to control the blood rushing to your face and looked out the car window. You noticed Nanami had driven somewhere, but why? It was a pharmacy. One of the special pharmacies that partnered with the school to bypass prescriptions.
A man walked in front of the car and you jumped to cover yourself. He looked in, but he seemed to look past you. There was a small barrier. You sighed in relief. Thank god Nanami was a forward thinker.
You suddenly saw the pharmacy door swing open and Nanami walk out with a small white bag. His hair was down but pushed back, his glasses back on and his blue shirt untucked, probably to cover the stain you had left on his pants. You were a bit taken aback, he looked tastefully disheveled…handsome. He went up to the car and sat into the driver's seat. He looked back at you. “Ah, you’re awake.”
You nodded. “Where are we?”
“I stopped by to get you a couple of things. My apologies if I closed the car door too hard.” He reached over to the passenger's seat and grabbed a brown paper bag. He passed it over and you, a little confused, pulled out a T-shirt that said “I ❤️ Tokyo”.
“I apologize for tearing your blouse. If you send me your measurements I can get you a new one, for now-“ you started to put the shirt on and he went silent as he watched you. You pulled your head through the top and blushed as you noticed his gaze.
“Thank you.” He nodded and passed you a water bottle.
“I also got you some pain relief from the pharmacy, I’m afraid I might have been too rough on you.” He grimaced. “I shouldn’t have let myself get so carried away, I apologize.”
“No, no,” you waved your hands and gave him two thumbs up. “It was fine.” You dropped your hands, embarrassed for a moment, you had picked up the habit of doing that from Akari. That reminded you. “Have…you seen my phone?”
“Yes, Akari had been trying to reach you. I answered and let her know you were okay, just…feeling under the weather.” He passed you your phone and you unlocked it to check the 6 missed messages and 3 missed calls from Akari.
-SEX WHAT??
You frowned as you realized you had accidentally sent the unfinished text.
-hello?
Ten minutes later
-hey can you answer me I’m starting to get worried
-Y/N I’m serious, please answer my calls
-I’m going to call Nanami if you don’t pick up this next call
Two minutes later
-call me as back as soon as you can please
You frowned, what were you gonna tell her?
“I told her you were suddenly sick, so we stopped somewhere to rest.”
“Thank you.” You couldn’t figure out his tone. He was helping you out, but also covering for himself. Was he doing it out of respect, or…
“I also bought this for you.” He seemed nervous as he reached into the white bag. You looked at what he handed you. You stifled a laugh. It was an emergency contraceptive. “I’m not sure what you might already do, but just in case.” He stared at the box. “I hope this doesn’t offend you. I just figured, you’re young and wouldn’t want…well a surprise, if you will.” He looked back up at you. “Unless you do, I’m not trying to tell you what you should or shouldn’t do, it’s just in case… I thought I’d give you the choice, please don’t be influenced by what I’m saying… I’m sorry, I-“
You laughed at him and he shut up. “Don’t worry. You’re right, I don’t want a baby right now. I appreciate it.” You stared at the box. “You’re really charming when you’re flustered.” You looked up at him, but he had no reaction. He just nodded once. You looked back down, sort of disappointed.
You both began to speak at the same time and stopped. “Go ahead.” He said.
“Sorry, I was just going to say that I should drive you back. I can go ahead and drop you off at your place. I just need to drop off the vehicle and no one will question if I come back alone as long as you’ve already checked back in.”
He stared at your shirt. “I should have bought you a better shirt.”
You smiled and shook your head. “I have a lot of shirts like this, it’s perfect.” You quickly reached for your pants and struggled a little to put them back on. Nanami just watched. You finally pulled them up and tucked your shirt in a little. You looked back up at him, you caught yourself giving him a thumbs up and stopped. “It’s past 6 so Akari will be the only one to see me since everyone else will have gone home for the day. She won’t even think twice.” His brows moved like he was thinking of something. “Oh, thank you by the way..for cleaning me up.” You handed him back his suit jacket. You picked up his tie and his suspenders and put them in the brown bag. You attempted to pick up his blunt sword but hesitated to touch it. “The building was destroyed…what happened, if you don’t mind me asking?”
Nanami shrugged slightly. “It was only a Grade 2 curse. She could speak some, but she was sometimes incoherent.” He sighed, “It was a very tragic situation she was born from. So I figured I’d destroy the place.”
“He might not pay you.”
Nanami shook his head. “Mei Mei set up the mission, she’ll get her money no matter what.” He sighed. “Either way I don’t care.”
That’s right, Nanami was infamous for not caring about the outcome of missions. At least nothing past the defeat of the curse. He didn’t really care for the politics of defeating one curse but letting another go, or the idea of the clans deciding the codes sorcerers should follow.
“It’s late…” He said, breaking the silence.
“I should drive you back.” You started to move and winced a little.
“I’ll drive to my place and then you can take the car back, rest some more.”
“Thank you.” You smiled at him, but he just turned back to turn on the car.
You sat in silence all the way back, thinking. You looked at your phone and shot Akari a text.
-feeling better, I’m so sorry. dropping off nanami and then heading to the school.
You closed your eyes and sighed. You had just fucked the man you’d been dreaming about for months and now you were…unsatisfied? No, you had a great time. You snuck a glance at him through the rear view mirror. Did he not have a good time? He was being cold again. No, you were reading too much into it. The curse had influenced him to do it, it could have happened with anyone. Your stomach dropped at the realization.
It could have happened to anyone.
Akari was originally supposed to go, if she hadn’t offered you the chance this would be her. Would he have been more talkative with her? People seemed to trust her more, maybe he would be more open. Also, he had said that Mei Mei had set up the mission. Why was he the one that went instead? Had he volunteered? He’d been briefed about the mission so he knew what he’d be facing. He probably thought he wouldn’t be affected. You thought he wouldn’t be affected. But what if…you stopped yourself. You were reading way too much into it. There was no way to know if Nanami had volunteered just to sleep with Akari, but he had gotten you instead.
You forced yourself to stop thinking about it. You were hurting your own feelings over something you had no proof of. But the fact of the matter was, it could have been anyone driving him. You weren’t special to him. If anything, you gave in easily. A feeling of regret began to wash over you. He probably thought you were so stupid and easy. No, you told yourself, he isn’t like that. But there was no way to really know. The car slowed down as he pulled in front of a tall building.
“Would you like to come in?” Nanami asked.
“No, it’s getting late, you should get home and rest too. Today was…interesting.” You said with a smile. You couldn’t see his face as he was staring straight forward. His hands gripped the steering wheel hard, his knuckles turning white, before he let go and nodded. You looked away frustrated. What did that mean?
You both got out of the car and lingered outside. “Oh, your sword.” He opened the door and grabbed it easily off the car floor. You watched as his hands wrapped around the hilt and the veins in his arms popped. “Thank you for everything. I appreciate you covering for me with Akari, and thank you for thinking of my health.” You just looked at him, you couldn’t think of the best way to say goodbye.
“Thank you, for helping me with my…urges.”
You smiled. “It could have been anyone.” You muttered. You saw his brows furrow but before he could say anything else you bowed politely and got in the car.
You watched him stare at you from the mirror as you drove away. His hair unkempt, suit jacket draped over his arm holding the sword, and the brown paper bag in the other.
-
“Y/N!” Akari ran up to you and hugged you. “You had me worried to death. Are you feeling better? What happened?”
“I need to hurry before the buses stop running. I’ll just tell you later.”
Akari rolled her eyes. “I’ll give you a ride. Just tell me, are you okay?”
You nodded. “The mission was easy enough, I’m just embarrassed.”
“What got you sick? Was it the curse? I wouldn’t have sent you if I had known what it was, I’m so sorry.”
“You know?”
She nodded. “I looked up the report. A grade 2 sex curse. I'm so sorry.”
You shook your head. “Don’t worry it wasn’t the curse. I ate at the corner shop outside of my apartment cause I was running late, it was my own doing,” you lied.
“Y/N I told you not to eat there anymore, I got so sick last time I was there.” You nodded apologetic. “Then you were, like, actually sick, in front of Nanami. Oh my god, no wonder you’re embarrassed.”
“What did he say to you exactly?”
She smiled. “He picked up your phone on the last call before I was going to try him. And he assured me you were safe, just not feeling well.” She started laughing. “I asked him to send me evidence, because you can’t trust voices over the phone nowadays, you know, and he sent me this.” She pulled out her phone and showed you a selfie he took. Deadpanned as always. “Not an inch of emotion in his face. I’ve never seen him so ruffled up. His hair looks super messy, did the curse put up a fight?” You clenched your jaw as you felt your cheeks start to burn up, but tried to play it off.
“He said she could speak. And he demolished the place. The building owner was a perv so he decided to just tear the place apart.” You said quickly.
“He must’ve let all his frustrations out, damn.” She looked back up at you. “You look exhausted. Let me drive you home.”
You shook your head. “I can take the bus, I don’t want to bother you.” Akari could tell something was upsetting you and just nodded.
“Okay, but let me know when you get home.”
“Of course.”
-
The bus ride was long, but usually you liked the way it gave you time to detach from your work. Today however, you were frustrated that it gave you more time to overthink everything. You closed your eyes and forced yourself to focus on something other than Nanami.
What were you going to have for breakfast tomorrow? It was your day off. You could go to the bookstore you liked. Or get up early to go to the bakery across town. You were always too late to get your favorite sandwich for lunch, it sold out quickly, but you could tomorrow.
You got off the bus and went inside your building up to your apartment, you walked quickly past the napping security guard who liked to hit on you sometimes. You sighed as you read the sign taped to the elevator. Out of business. You walked up seven flights of stairs quickly and rushed into your apartment. You put down your backpack and went straight into the shower.
You plopped down on your couch with a sigh and grabbed your phone off of the coffee table. You opened up the message Akari had sent and you were met by the selfie Nanami had taken.
-thought you’d like this, personally I don’t get it, but I support you. rest up, hope you’re feeling better.
You smiled.
-thank you, ari.
-let me know if nanami leaves any feedback for me
You stared at the message and decided to delete it.
-appreciate you as always.
You exited out of your messages and went to check your bank account. You were slightly surprised. It was more than you had thought. Only by a couple hundred but it was enough.
You opened up your messages again and tapped on your mother’s name.
-I had a bit left over this week, I’ll send it to you now. Hope you’re doing well.
You proceeded to send her money. You thought about calling but you doubt she would answer.
Your situation was a bit difficult. Growing up it had just been you, your sister, and your mother. Your sister was seven years younger than you, and you had always been close, although that hadn’t been the case for quite some time now.
When you were eight your mother had woken you up in the middle of the night, with your baby sister and a small duffel bag in tow. The three of you had run away from the tiny smoky apartment your father had stuffed your family in. After that you had never lived in an apartment or house for more than a year at a time, your mother was constantly changing jobs, Taking up new hobbies, falling for pyramid schemes, or falling prey to loan sharks. It had always been something or the other. She was usually gone for hours on end, struggling to make ends meet, leaving you and your sister alone for much of your childhood. You grew up quickly and had basically raised her. You took on the extra responsibility young, but you never resented your mother for it. She was also doing her best.
As you had gotten older you began to realize you weren’t a typical kid. You often saw things others didn’t, or sensed some sort of presence when nothing was there. The other kids thought you were creepy and left you alone. Everything escalated when you were 16.
At that point in your life your mom had found some solid footing while working at a small church next to an apartment you’d moved into. She finally seemed happy, she had found herself “reborn” under the light of a savior and the longer you lived with her the more you saw her change. You had never really talked to her about the things you saw, the creatures on peoples shoulders as they walked by or the pair of eyes you felt on you coming from dark corners. But one day after coming home you sensed a strange energy from inside the apartment and once you entered you were met with the scene of your mother praying over a young woman, with a man you recognized as the pastor. You looked above them and noticed a large grotesque creature hanging off of the ceiling swinging himself on his gangly arms.
You stared at it, mouth agape. You had seen all types of creatures, but never one this big. Its bulbous eyes suddenly met yours and its head rotated in curiosity. A wicked forked tongue flickered out of its mouth at you and you screamed. The thing lunged at you and you somehow managed to dodge it as it swung towards you. You began to throw objects at it.
“Y/N! What's going on?” Your mother screeched. The creature grumbled as the objects clattered against it, but it still made its way to you. Running out of objects to throw, you reached under the couch and pulled out a baseball bat. It jumped at you again and you swung the bat down hard onto the top of its head. There was an ugly crack and the thing dropped in front of you. Purple goo oozed out of its head wound and spilled onto the floor.
“What happened? What are you doing!” Your mother stared at you in horror and the priest began to chant something.
“You don’t see it?” You asked in shock. “You don’t see this thing?” You were panicking.
“What are you talking about, what thing?”
“This!” You swung your bat down again on the creature, also wanting to make sure it stayed down. You hit it one last time and it suddenly blew up, exploding all over the apartment.
No one could see anything. The pastor hurried out of the apartment with the young woman, your mother stared at you in horror before following them out.
Your mother didn’t come back to the apartment for two days. Nor did your sister.
The pastor called to let you know they were staying at the church. You had an uncomfortable conversation, where he heavily implied your mother wouldn’t be coming back as long as you were still there.
So you left.
You hadn’t seen your mother again since that day. It had been 8 years. You still tried to keep in contact with her, although it was mainly one sided. You would send updates on how you were doing, wish her well on holidays, birthdays and the like, but she would never respond. The only time she answered was when you had texted her about getting a job and being able to send her money. She almost immediately sent you her bank information. Your younger sister had social media that you followed to keep up with them. They had stayed in that apartment without you. It was the longest you’d seen your mother stay in one place. She was happy, and you didn’t want to take that from her.
Besides, it had all worked out in the end. Thanks to a bit of an incident, you had found yourself under the care of an older lady running a small bakery for around six months after you’d left. That was until you had been approached by someone and been initiated into Jujutsu Tech.
There were only two other students in your year at the school and they had been rather cold to you. Having come in late, and not knowing anything about the sorcery world prior to the curse in your apartment, you were significantly lacking in almost all areas concerning sorcery.
What you did have was stamina, you were an endless supply of energy and didn’t seem to tire as easily. That, if anything, helped you survive the training, the games, the curses, all of it.
You decided to become an assistant during your fourth year. One of the other students, Yuri, planned to join the Zenin clan's personal army, while the other planned on mentoring under a professor at the Kyoto school to increase his ranking after graduation. You on the other hand were not so confident in your abilities.
You had made great strides in progress after having started from scratch, but you never developed a specialty. You had discovered that you were able to use a small amount of RCT, after an incident where Yuri had smashed your face with a staff during what was supposed to be a friendly practice. While you covered your face in pain and tried not to panic as blood gushed from your top lip, you felt the tear and without thinking put your hands up to push the pieces of your lip back together. By the time you went to the medic they said there was not much they could do as you had already healed it. However, with your inexperience you had healed it to a scarred state. They had explained that the small boost of adrenaline from your injury had allowed you to concentrate enough to heal. However the overall consensus from the higher up was that they were not interested in training you any further on it, or rather you weren’t worth training.
So here you were, having worked as a manager for the past 5 years, and still only having very little cursed energy. The two years prior were spent training under different managers until you could be trusted on your own. Akari had trained with you but at a faster rate. After all, you were sort of an outsider.
Your phone pinged as you received a message, snapping you out from the memory.
-he just asked me for your number and I gave it to him, let me know if he says anything crazy or inappropriate. He may be higher on the power scale, but remember my roots.
You stared in shock at Akari’s message. He had your number…why would he want it? You put your phone down. If he texted you, you didn’t want to see it. You curled up on your couch and bit at your nails. What had you gotten yourself into. You should have refused his advances. He wasn’t in his right mind. You cursed at yourself again, you should have thought about the consequences, the aftermath. It was going to be so awkward. You sighed and stared up at the ceiling.
Take a breath, you told yourself. You hardly ever saw him. Today had been the first time in the two years since Nanami had been back in the sorcerer world, that you had actually been in close proximity to each other. Alone anyway. You had seen him in meetings, briefly, that’s how this stupid crush had started. You didn’t really have to interact with him and you were fine acting like nothing had happened, sure you’d be a little sad, but that’s probably what he would want too. You bit your nails nervously. What would you do if he did want to see you?
You shook your head. There was no use in wishful thinking. He hadn’t given you any signs that he was interested after all. Sure, he had invited you into his place but you felt like it was just a formality. He had just rocked your shit after all. You thought back to the way he gripped the steering wheel and the glimpse of confusion when you had said it could have been anyone. What was that? Frustration? Over what?
You sat up as you remembered the pharmacy bag. You walked over to your small kitchen and grabbed a glass of water.
Sitting back down on the couch you glanced at your phone nervously. You didn’t want to flip it over. You sighed and reached for it. It was late, if you didn’t answer it wouldn’t be that strange and at least you’d be able to think of a response if he had said anything.
You checked your screen. Nothing. Somehow that hurt you a little. You tossed your phone again and laid down on the couch, closing your eyes. Whatever. You couldn’t do anything about it. Whatever happened had happened, and whatever was to come would be a problem for the future, no use worrying about it now. You slowly felt sleep take over and you dozed off.
-
You awoke to the sound of your phone buzzing, and after looking around blindly and half asleep you found it. You pushed a button and held it up to your ear. “Hello?” Nothing. “Hello?” You looked at the screen and rolled your eyes. It was just your alarm. You groaned and let your phone clatter to the ground.
That’s right, you had planned to get up early to go to the bakery across the city. You closed your eyes and took a deep breath. You got up sorely and yawned. You picked up your phone again and hesitantly checked your messages. Nothing. You didn’t know if that was better or worse.
After stretching and getting ready for the day you headed to the bus stop to go across town. You were going to relax completely today. You weren’t going to think about what happened. You weren’t going to think about him. You weren’t going to think about the meeting tomorrow. Your smile dropped. You had a meeting tomorrow morning with all the staff. Usually you wouldn’t have to worry since the higher grade sorcerers rarely showed up to the weekly meetings; however, they had announced this meeting would be mandatory, there had been some incidents related to the investigation of a child's death. Nanami would most likely be there. You scrunched your face. No use stressing about it now. You didn’t know how he would react and again, it was no use worrying about it.
After getting off on your stop you headed over to the bakery. You had gotten there right before the lunch rush. You went inside and were greeted by the girl that worked there. You smiled back and picked up a sandwich. You thought about grabbing two, one now and one for tomorrow's lunch. You smiled and looked around for a different kind of sandwich. You grabbed a bottle of water and went up to the cash register.
“Oh these are two of my favorite sandwiches.” The girl said.
You smiled warmly at her. “I don’t know which one I want to eat first, I’m saving one for my lunch tomorrow.”
“Hmmm, tough decisions.” You nodded in agreement.
You heard the doorbell ring behind you as someone came in. “Hello, welcome-“ she stopped and stared for a bit before putting on a huge smile. “Oh hello Mr. Nanami! It’s great to see you today.”
You felt your face start to burn up and you froze. You stared down at the sandwiches. You could sense it was him. You took a deep breath. Relax, you told yourself. You turned around and immediately met his eyes. You smiled at him and bowed your head. He smiled back slightly and walked up to you.
“Good morning, Keiko.” Nanami said to the girl, there was no emotion in his voice. “Good morning y/n, how are you doing today?”
You stared at him for a bit before answering. “I’m doing good. How are you?” You felt like you were being a bit cold but you didn’t know what else to say. Your brain was not working.
He nodded and looked down at your purchase. He added a sandwich and silently pulled out his wallet, and passed his card to Keiko. You stared at his hand and felt your cheeks blush again.
“Thank you.” You said quietly. He grabbed the bag, thanking Keiko and walked over to a small table. You followed and sat down across from him. He pulled his sandwich out and handed you the bag. He pulled the newspaper he had tucked under his arm out and laid it on the table.
“Thank you for buying my lunch.” You repeated. He nodded. He was so awkward. Or were you the awkward one? You didn’t know what his intentions were and you were getting frustrated. “Did you want to talk about yesterday?”
His face suddenly had a slight blush although he didn’t move. “Only if you would like to.”
“I-“ you didn’t know what to say. You were silent. You felt him watching you behind his glasses. You gripped the bag and took a deep breath. You’d already fucked the man, why were you nervous? You looked back up at him with new resolve. “I have some questions.”
He nodded in approval. “I do as well.” You were surprised, what could he possibly be curious about?
“You go first.” You said.
Keiko was suddenly coming towards the table with a coffee in hand. She set it infront of Nanami. “Sorry to interrupt.” She said before stepping back to the counter.
Nanami took the cup and blew on it. You watched anxiously, your frustration slowly building up. After a sip he put the cup down. “You can use RCT, why are you working as an auxiliary manager?” You were a bit taken aback. That’s what he wanted to ask you? He put a finger up to his shirt collar and slowly pulled down to show you his neck. You remembered now the injury he had sustained by the curse yesterday.
“When did I..” you murmured to yourself. You had forgotten that you had intended to patch him up. You had passed out instead. “I can only use a small amount. It’s nothing really.”
“You’re wasting your potential,” he said sternly. “You could be helping people.”
“I would hardly say that. Like I said, I barely have any cursed energy. I don’t know how I do it until the injury is in front of me. Besides, no one would teach me how to use it.” Nanami took another sip of his coffee. “Is that the only thing you wanted to ask me?” You said annoyed. Nanami hesitated to put the cup down.
“Are you angry at me?” He caught you off guard again.
You frowned. “No, I don’t think I am.” You thought about how to express your feelings. “I think, I think I’m more frustrated with you.” He gave you an inquisitive look. “I don’t know how you feel about what we did. Regret? Indifference? I know you’re not the type to really show your hand, but I’m not that way. I need to know because I don’t want to give off the wrong impression.”
“And what is that?”
You sighed. “I’m just going to be honest with you. We’re adults aren’t we?” You looked up at him. “I have feelings for you.” You blushed but didn’t dare look away. “I’m confused by what you- what we did. I know you were under some sort of influence and I can’t help but feel guilty about everything. The more I think about it the more it eats me up, I don’t think the lines of consent were crystal clear…but I don’t know how you feel about it. I’ll apologize profusely if I have to. Unless you feel differently… Basically..I want to understand your feelings before I can let myself feel anything else.” He didn’t react. “Okay?” You felt your face burn up, but you were proud that you were able to say all that to him. Wait, did any of that even make sense? You thought to yourself.
He was silent as he finished his coffee. Your stomach grew more and more tense as you waited for his response.
“I apologize for any miscommunication.” He said finally. “I’m afraid I’m not the best at expressing myself either. I’m not sure what to make of what happened yesterday. I will relieve some of your worries and tell you I hold nothing against you. In fact I’m grateful you were able to help me.” He looked down at the empty cup. “But to be honest I don’t know where to go from here either. I’m not interested in pursuing a relationship… I don’t believe romantic attachments are smart given our line of work, I don’t take these things lightly.” You scoffed. You couldn’t help it. “That being said,” he continued. “I would like to know where you want to go from here. As you said we’re both adults, I think it would be in our best interest to hear what each other would like.”
You just stared at him. “What is it that you want then?” He was swinging the next step back at you but you didn’t want that. You wanted to hear it from him first.
“As I said I’m not interested in-“
“Then we’ll pretend like nothing happened.” You said sharply. You didn’t want to hear it again. It was like you thought. He didn’t want you. It was never about you. He did like Akari, you had been a mistake. He stared at you silently. You took a deep breath. You looked up at him and smiled. “Okay.” You sighed. “Glad we got through that. I’m fine with doing that. I will say I’m a little embarrassed, but now I can work on getting over it.” You looked at the bag with your two sandwiches. You quickly picked it up. “Thank you for lunch today. We’ll call it even. Don’t worry about my shirt, otherwise I’d start to think about the dry cleaning bill for your suit.” You got up from your seat hastily.
You bowed and started to walk away. He grabbed the bag to stop you. “You are angry with me.”
You looked back at him and couldn’t hide your frown. “I’m hurt.” You mumbled. His brows furrowed. “I don’t think I was ready to talk to you. I apologize for how I’ve been acting. I still need time to process everything.” You turned away from him. “I…I’ll see you tomorrow.” As you walked away you noticed Keiko bringing another coffee towards the table. You smiled at her as you exited. You hurried towards the bus stop and stopped. The next bus would be there in 25 minutes. He would see you standing there. You groaned and walked past your stop. You pulled out your phone and called Akari.
She picked up almost immediately. “Hey, Y/N how are you today?”
“I need a drink.”
“It’s 11 am, girl.”
“I’ll be pregaming until you’re off. 8 work for you, at our usual spot?”
“We have a meeting tomorrow morning.”
“Since when has that ever stopped you?”
“It’s stopped you before. What’s wrong?”
You sighed. “Get me drunk enough and I’ll tell you.”
Akari sighed sarcastically. “If you insist.”
-
“Cheers!” You clinked your mug with Akari’s and Ijichi who had also decided to join you. You were already five drinks ahead of them and were feeling great. Good enough that you were trying to convince Akari to join you in performing karaoke next.
“Ijichi, you go up there with me then.”
He shook his head. “I won’t be any good.”
“Y/N why don’t you just go on by yourself, put on a good show.”
“You know what, I totally should.” You said smiling from ear to ear. You stood up and clapped wildly for the people who were currently performing. Some others joined you and cheered them on. You loved this place. Akari and you had stumbled into it one night and the warm ambience and amazing food had made you regulars.
You made your way to the stage and took the mic. You waved confidently as people cheered you on. You motioned to the DJ to play the next song. You laughed and clapped when you saw it was one of your favorites.
Cue “Dress Down” by Kaoru Makimoto
You were smiling, dancing, having the time of your life, almost getting to the last chorus of the song when you noticed more people coming towards your table. You waved cheerfully as you noticed Shoko, Ijichi must’ve invited her. You moved around the stage and your heart stopped. Nanami was also sitting down. You looked at him and your eyes met. He paused before sitting down all the way. You stopped singing for a bit.
He sat and turned his head away, you turned away as well. You sucked your teeth and kept singing. You were having a good time. You smiled again thinking about how ironic it was that you had run into him twice on the day you didn’t want to see him.
You finished the song and bowed dramatically as people cheered and clapped. You handed the mic off to a girl dragging her boyfriend on stage and gave them a thumbs up.
“You’re quite energetic,” Shoko said to you as you sat down next to Akari.
“She’s 7 beers in, I’d be surprised if she wasn’t.” Akari said.
“Rough day?”
You smiled at Shoko and scrunched your face. “Rough life.”
“Cheers to that.” She raised her mug and everyone around raised theirs as well.
“Cheers!” You gulped down your drink and let your eyes go to Nanami who was silent. You smirked. “Who’s doing karaoke next? I can’t be the only one who does it tonight.”
“Ijichi san, you should go up there.” Shoko said after downing her entire beer.
Ijichi blushed, “Ah, I don’t think I’ll be any fun to watch.” You smiled and snuck a glance at Akari. It was so obvious he had a crush on her.
“Come on Ijichi, as long as you have fun it doesn’t matter.” You said playfully shoving him. “Or do a group performance.” You looked up at Nanami. “You and Nanami, now that I would love to see.” You laughed and Shoko smiled amused.
“Have you really had 7 drinks already?” Nanami asked.
You squinted your eyes at him and smiled. “Is that a challenge?” You chugged down the beer in front of you. “Ah, how refreshing. 8 now!”
“She’s very good at handling her drinks.” Akari said. “Well, beer anyways.”
You furrowed your eyebrows at her. “That was one time!” You laughed and waved down the waitress. “Let’s get another round. Is anyone else starving?”
The night went on and you and Shoko chatted up realizing you had a lot in common. You ended up doing two more karaoke songs. One with Akari and thanks to Shoko, you managed to convince Ijichi to go up with you. You and him performed like your life depended on it. And the crowd ate it up. You were smiling from ear to ear again. You weren’t gonna let Nanami make you upset in your own space. In fact, why were you even upset? Was it so bad that he wanted to pretend like nothing happened? If anything it made things easier. You weren’t exactly in any position to date, especially not someone higher up. You smiled and waved at Akari from the stage. She smiled and waved back and you noticed Nanami talking to her. Your smile faltered but you just took another drink before looking at Ijichi and singing again.
Good for them. You would do anything for Akari, so stepping aside for her to be with him wouldn’t be a problem. You only had a crush.
You finished up the song and headed back to the table. “-you’re making it obvious.” You caught the tail end of Shoko and Nanami’s conversation.
“Where did Akari go?” You asked.
“Bathroom.” Shoko said. “You should quit your day job and become an entertainer Y/N, the crowd loves you.”
You smiled. “The old timers here love me, I don’t think it would translate well outside.” You laughed. “Besides, they loved Ijichi too! If I do quit you have to join me in my new career.”
“We’d miss him terribly.” Shoko said. Ijichi blushed again and you laughed.
“Very true, cheers!” You raised your glass. You weren’t sure how many drinks you had downed at this point. “To Ijichi and everything he has to put up with.”
“Cheers!”
Akari came back to the table and plopped down next to you. “We should wrap up soon. We have a meeting in the morning.” You pouted. She gave you a look. “It’s almost 2 am.”
“Oh!” You said surprised. “You all let me drag you out for so long?” You stood up and bowed dramatically. “Thank you for indulging my night out.”
Shoko smiled. “Anytime, you’re a star.” She winked at you playfully.
“Shoko, marry me please.” you said clasping your hands together jokingly.
She laughed and finished her drink. “I’d have to get in line.” Nanami shot her a look and you laughed. “You should come out with us more. Ijichi, Nanami, Utahime, and I go out for drinks every other week or so.” She looked at Akari. “You too dear. The sane sorcerers have to stick together.”
Nanami excused himself to use the restroom. Shoko smirked once he was gone. “He’s going to try to pay the bill but I already got it.”
You looked at her shocked. You grabbed her hands. “Shoko, please marry me.” She laughed again.
“Where have you been all my life?” she said smiling.
“Want me to drive you home?” Akari asked you.
You nodded and slapped your hands together again this time bowing down to her. “Yes please.”
“Of course!” She said proudly.
“Let me run to the bathroom real quick.”
You excused yourself and headed towards the bathrooms in the back. You smiled as you passed people, you hated to admit it but you were a bit buzzed. You were a little extra friendly when you were like this. You laughed to yourself. It was fine as long as you didn’t run into- you saw him coming out of the bathroom and walking towards you. The hallway to the bathrooms was rather narrow. There was enough space for two people to stand side by side but not much. He looked straight ahead as if he wasn’t even going to acknowledge you. Oh well, you thought. You continued on merrily.
As you passed him you felt his hand brush past yours and felt him slightly tug on your sleeve. It was quick but you felt your heart flutter and you stopped.
“Nanami.” You said as you turned to look at him. He stopped but didn’t turn around. “Why did you do that?” He was silent, still not turning. You walked back towards him standing inches away. You quickly looked past him, ensuring no one was approaching. You grabbed his sleeve. “Is anyone coming?”
“No.” He said.
You sighed and dragged him into the bathroom.
You quickly locked the door behind you. The amount of times you had accidentally walked into a couple being intimate was astounding. He stood a couple of feet away from you and stared. You turned back to him and smiled. “I know what this looks like, but I just want to talk. Really.” You put your arms up to wave your hands. “I’m a little tipsy but if anything I have the words to say what I finally want to say. Let’s talk.” He stepped closer to you, closing the gap in an instant. “Oh fuck.” You said taken aback, he had pinned your back against the door.
“I don’t want to talk.” He said gruffly. Moving his lips closer to your ear.
“Obviously. I don’t think you said a single thing to me out there. Are you-“
“Are you really okay with forgetting what we did? It didn’t bother you? It didn’t leave an impression?”
“Now you have questions.” You couldn’t take him seriously. The alcohol was not helping. You looked up at him and smiled coyly. “You want the truth?” He just stared at you. You leaned your head closer to him and pressed your cheek to his so you could whisper in his ear. “You took my virginity.” You kissed his cheek as you pulled your face back. You looked at him and his face was red. You giggled and put your hands up to cup his face. “I couldn’t forget you if I tried.” He slowly moved his face closer and you leaned in to kiss him.
You both suddenly and passionately kissed each other, Nanami wrapping his hands around your body to pull you closer. He was almost as desperate as he had been in the car; tugging on your lips and rolling his tongue into yours. You winced as his glasses poked into your face and he quickly took them off. You stopped for a bit and smiled at him. “You’re beautiful.” You said giggling.
He furrowed his brows and moved forward to kiss you again. He pinned you back against the wall again and you hoisted yourself up by his shoulders to wrap your legs around his waist. He steadily rocked into you and you moaned as his bulge hit your sensitive clit. You grinded desperately back on him. You shuddered as you were already coming close and you moaned into his mouth. “Nanami, wait.” You removed your arms from his shoulders and lowered yourself. You slid down onto your knees and worked on his belt. You giggled to yourself, you were feeling bold. You hungrily pulled out his cock and smiled as he tensed. You wrapped your hand around him and he let out a breath. You licked a long stripe and smiled as you watched him grow red. You took the tip in your mouth, swirling your tongue over the top, but he suddenly moved your face back.
“If we do that, I won’t be able to control myself.” You laughed and frowned, feigning upset. “I don’t want to ruin your pretty face tonight.” He pulled his pants further down and lifted you up to stand. “Your cunt on the other hand…”
You smiled. “You’re good.” You quickly pulled down your safety shorts and underwear as he pulled you up by your waist, allowing you to wrap your arms around his shoulders for stability. Using his knee he pushed your legs open and moved a hand down to steady you before teasing your folds by rubbing up on them. “Hurry, they’re going to notice we’re-“ he entered you and you gasped. You were still a bit sore from yesterday, but once again he was hitting that spot that sent tingles into your stomach. “Fuck!”
He smiled and started rocking his hips into you. Kissing you and muttering words of praises. You felt your climax rapidly approaching and you couldn’t help but moan and buckle your hips wildly against him. You felt him speed up and you were suddenly in total bliss. You felt the heat quickly build up inside you before it flooded your entire body. You climaxed and felt yourself clamp down on him. “Fuck.” He said as he slammed his hips into you deeper and deeper before settling there with a final jut and coming deep inside of you. His grunts as he came made you smile and you peppered kisses on his face. He put a hand up under your chin and guided you to kiss his lips. You pulled back and smiled at him happily.
There was suddenly a knock on the door and your head snapped towards it, startled. “Y/N you in there?” It was Akari. “Are you okay? Is your stomach upset again?”
You felt Nanami slide out and he quickly grabbed some toilet paper to collect what oozed out of you. “Yeah, it’s me. Sorry. I guess it wasn’t the best idea to go out drinking after I fucked up my stomach yesterday.” Thank you, you mouthed to Nanami who had wiped you clean and was now wiping himself. “Did everyone else leave?”
“Nanami still isn’t back. Shoko said he might have gone out for a smoke, I didn’t know he smoked honestly.” You looked back at Nanami and he shook his head. I don’t. He seemed to say.
“Okay, just give me like 3 minutes and I’ll be out there, I’m sorry.”
“You’re good!” Nanami looked at you with pleading eyes.
“Come home with me,” he whispered. You blushed and considered it.
“I..I can call a taxi if you want to go ahead and go home, I honestly might be longer.”
You heard Akari laugh from the other side of the door. “It’s no problem, god knows you’ve seen me worse. Actually do you want to just spend the night at my place and we can head to work together? I do live closer so you’ll get to sleep in a bit more.”
Nanami shook his head and you frowned at him. “That sounds good.” He looked upset. You smiled slightly. He was way more expressive without his glasses. “Tell the others I’ll be right out. They can go without me.”
“Okay, I’ll tell them there was a line. Your secret is safe with me.”
“You know I love you right.” You said to Akari. You heard her laugh again.
“Shoko was right earlier, she has to get in line, I’m gonna marry you first.” You heard her walk away.
“Why won’t you come with me?” Nanami asked seriously.
Your smile dropped as you thought about it. You shrugged. “I don’t know you. I don’t think it would be appropriate.”
“Really?” He said in an annoyed tone, as he zipped up his pants and handed you your underwear. You rolled your eyes and smiled at him. You reached up to take your panties when he playfully raised them higher. “Let me help you with that.” he lowered his arm and lowered himself down, opening the band to let you slip your legs into them. He slowly slid them up your legs, letting his fingers trace your skin. He stood back upright and hovered his face in front of yours smiling mischievously. You blushed and slipped on the rest of your bottoms.
You sighed as you wrapped your arms around his shoulder and he gently placed his hands on your waist. “You said it yourself, you’re not interested in pursuing a relationship with me.”
“I-“
You shook your head and cut him off. “Why would you take me home other than to just fuck me again? I have a bit more self respect than that. Besides, I told you I had feelings for you. I don’t want to give myself hope.” You looked down, feeling a bit somber. “I don’t know why we keep running into each other like this, but I know I don’t have your heart even in the slightest. I know I’m not who you were hoping for.” He looked at you confused. He opened his mouth to speak but you kissed him to shut him up. “You need to start carrying around condoms, you’re going to get someone pregnant like this. Wait two minutes before you walk out.” You quickly slipped out of his embrace and opened the door.
“Y/N, wait.”
You closed the door behind you and looked at the person waiting to go in. “I’d wait for the other bathroom to open up, give this one time to air out. I’m sorry.” You said and walked away. As you walked you noticed how sore your lower abdomen was. The alcohol was wearing off and what you had just done was slowly sinking in.
••••••••••••••••••••••••••••••••••••••••••••
˚₊✩‧₊nana here: i'm sorry for ending this with another cliffhanger but i didn't want to make this any longer than it already is and i also didn't want to give y'all a chapter without a little spice. i'm still trying to figure out the direction of part 3... theres a lot of things that i introduced here that might just not go anywhere oops. i have a whole project in my head but it might be something for ao3 isntead idk. i'll be sure to wrap this up neatly tho. anyway thank yall for reading and remember that if you saw a typo, no you didn't. shout out again to cath for reading my god awful writing and editing it haha
pt 1. pt 3. pt 4.
550 notes
·
View notes
╰┈➤ ❝ desire • l.n c.l ❞ vii
part six - part eight
➪ Charles hasn't paid much attention to you after your daughter was born but a certain Brit does.
➪ life goes on and it's up to you to decide who stays and who goes.
➪ established relationship mom!reader x dad!Charles x lando
➪ reader really growing and living her best life like she should. Spelling mistakes add character 😉 if you haven't been tagged, know that I either wasn't able to tag you or simply forgot to add you to my list, I'm not ignoring you, please send me a message if i did!
➽──────────────���─────────❥
y/nusername
📍 Nice, France
liked by landonorris, milliexoxo and 2548,543 others
y/nusername life. 🐠
tagged: landonorris, milliexoxo
view all 1,888 comments
charlesgirlies can you tell zoë to stop growing so fast? 🥺
yukisan who's the other girl?
↳ bott_ass their nanny
yukisan since when?
bott_ass girl how should I know? 😭
norry4 cutest little kid on the block 😍
milliexoxo ❤️
mrsnorris once again lando hanging out with them..
↳ norrizz okay and?
mrsnorris what about Charles? How would your bf react if you hang out with anorhers guy all the time?
norrizz pretty sure they broke up
mrsnorris sure because you know them personally right?
norrizz no girl because in one if her vlogs she's moving, she now lives in Nice without Charles or is that something couples do nowadays??
chilisainz so what if her and lando hang out, they're good friends! You should follow y/n a bit more before you judge them..zoë adores lando and the other way around. They're good friends
hamilt44n can't wait for bahrain in two weeks, hope I get a chance to meet you!
yourmumsuser my beautiful grand baby 🥰🥰🥰❤️❤️❤️
landonorris we did in fact find nemo 🐠
↳ y/nusername and now we've lost dory :(
milliexoxo we'll have to go to the aquariums again to look for her!
norrislandooo stop it why is this so cute?! 😭
charliecharlie who's millie?
norrislandooo their nanny
charliecharlie why she look so young?
norrislandooo idk lmao y'all Charles girlies so obsessed with y/n and all the people she's hanging out with
milliexoxo I'm 19 that's probably why I look so young, thanks 🤩
norrislandooo oh god, she's one of us 😭
➽────────────────────────❥
➽────────────────────────❥
y/nusername
📍 bahrain
liked by charles_leclerc, landonorris and 555,465 others
y/nusername week 1. 🇧🇭
tagged: milliexoxo
yourmumsuser my pretty pretty grandbaby ❤️❤️❤️
norry4 y/n back on the tracks LFGOOOO
julieeeexo zoë is such a cute little thing 🥺
milliexoxo my cute little gurlfriend is stealing the show 😍
↳ landonorris just like her mum
norrizz lando norris get out of here, stop trying to flirt with the milfs for gods sake 😂
manon_roux ma petite princesse me manque :( (missing my little monkey)
bott_ass can't wait to see you and jenson judge Danica on love tv 😍
↳ hamilt44n honestly can't wait for y/n to shut Danica up
charliecharlie I don't think jenson would've survived another season without y/n 💀
charles_leclerc ma jolie princesse ❤️ (my pretty princess)
➽────────────────────────❥
➽────────────────────────❥
y/nusername posted to their story
➽────────────────────────❥
➽────────────────────────❥
y/nusername
📍 Saudi Arabia
liked by milliexoxo, landonorris and 478,745 others
y/nusername week 2. 🇸🇦
view all 1,889 comments
milliexoxo okaaaasy mom 😍
↳ y/nusername 😐
charlesgirlies millie >>>>> noelle
bott_ass millie >>>> manon
charlesgirlies millie is queen <3
milliexoxo stop it, the fame will get to my head 😇
hamilt44n is zoë always so happy? 😭
norrizz okay girl, I see the subtle hints 👀
↳ norry4 the nails 😭
charles16 they're orange not mclaren colors..
norry4 same thing to me 😭
charles16 y'all reaching too much, she's still with charles
norry4 it's alright bestie, I've been living in delulu land too, I'll help you through it
yukisan I love you mother, I hope you know that 🥰
landonorris amazing photographer, could you tag him?
↳ y/nusername @.lando.jpg
landonorris nice, great guy that is
landonorizz YOU'RE TELLING ME LANDO TOOK THAT SEXY ASS PICTURE?!
luhamilton I bet they make sex tapes 👀
landonorrizz only fans when??? 👀
➽────────────────────────❥
➽────────────────────────❥
➽────────────────────────❥
y/nusername posted to their story
➽────────────────────────❥
Desire taglist; @fangirl-dot-com @sainzluvrr @writingworlds @chezmardybum @lewisvinga @xjval @fanficweasley @rockyhayzkid @aundercover @thecubanator2 @minchedchilli @crimeshowjunkie @alisoncasey21 @eeviepepi08 @shamelesspotatos @sleepybrokenmelle @leireggsworld @janeholt3 @iamahalicinationn @dessxoxsworld @kapsylia @22yuki @dark-night-sky-99 @sheslikeacurse @nerdreader
Everything taglist; @thomaslefteyebrow @hopefulinlove @smoothopz @softboystarkey @honethatty12 @cixrosie @parkersmjs @ireadthensuetheauthors @celestialams @be-your-coffee-pot @heli991113 @kodzuvk @reality-is-a-con @80sloverry @bibissparkles @myescapefromthislife @lanando4 @elliegrey2803 @ravisinghs-wife @harrysdimple05 @minkyungseokie @pretty-little-bunny382728 @thatgirlthatreadswattpad @severewobblerlightdragon @cherry-piee @namgification
Lando taglist: @beatricemiruna @simp-for-fictional-people @landossainz @christianpulisic10 @bored-brunette2 @i83andrew
2K notes
·
View notes
affection, ln4 ❀ chapter i. clueless
masterlist || chapter ii
in which everyone can’t believe that a certain mclaren driver and f1’s resident rich girl aren’t dating already
contains: smau, oblivious lando & oblivious reader
liked by landonorris, carlossainz55, danielricciardo, and 223,211 others
yourinstagram a much needed vacay
view all comments
landonorris im still offended by the lack of an invite
yourinstagram thailand is for the girls, not sorry!
bsfsinstagram there was a strict no lando norris rule for yn
user i have gyat to go to thailand
liked by yourinstagram
carlossainz55 the book is upside down dummy
yourinstagram i’ll turn you upside down
oscarpiastri what an informative post yn
yourinstagram hehe, can’t wait to see you
user omg yn at the next race???
user literally what are all these f1 boys doing in her comments
user shes a nepo baby i think
user her dad is mclaren’s biggest sponsor so she’s able to attend a lot of f1 events
user my fav honorary f1 wag
yourinstagram wag?? i’m very much single thank you
daniel ricciardo 🌚
yourinstagram don’t give them things to read into daniel.
lanny
i miss you
hey yn
miss youuu
when are you coming back
thailand can’t be that fun
y/n/n
thailand is totally that fun
in fact we’re about to go on a boat
lanny
you can go on a boat over here
y/n/n
it’s not the same 🙄
i don’t know why you’re so hung up about me taking a vacation
monaco gets boring sometimes
lanny
yeah but the second i get back from racing around the world you’re already gone
y/n/n
well i’ll be in the uk just in time for silverstone
lanny
you’re going back home?
y/n/n
my father said it’d be good to be around for a home race
so i’ll be in the uk for some time probably, it’s been a while since i’ve been back
lanny
okay good
i better see you cheering for me
it’d be embarrassing if my best friend was rooting for someone else
y/n/n
i’ve got my mclaren 4 cap ready to go
cant wait to see you ❤️
liked by yourinstagram, oscarpiastri, maxfewtrell and 533,444 others
lando.jpg home dump
view all comments
yourinstagram and it’s all just a bit too much…for littol lando norris
lando.jpg im hiding in your walls
yourinstagram creep
maxfewtrell stream time? 🤔
lando.jpg let me race first bro
user not lando feeding yn pasta and lobsterrrr
carlossainz55 aye, was this a date??
yourinstagram he wishes, he got me from the airport & we went straight to eat
danielricciardo who’s that cutie?
yourinstagram i’m right here!
danielricciardo oh..i meant lando
oscarpiastri 😬
user im so confused, are they dating??
user no, but they’ve been like best friends since lando’s rookie year in mclaren
user shes better than me, i would have fallen in love…
liked by mclaren, landonorris, oscarpiastri, and 745,234 others
yourinstagram couldn’t be prouder of my boys!!
tagged landonorris and oscarpiastri
view all comments
mclaren loving the love from our papaya girl 🧡
yourinstagram mwah
user yn ate today on the paddock
user she’s wearing lando’s hat im gonna cry
bsfsinstagram ugh get these men off my feed and show me ur pretty face
yourinstagram i was held at gunpoint and told to post this :/
landonorris the 6th photo…
yourinstagram ikr can you believe that loser got p2?
landonorris not too much now
oscarpiastri i look crazy
yourinstagram you look so cute??
oscarpiastri you shoved a camera in my face while i was eating
yourinstagram i did nothing wrong 🥰
user who was the man you were with on the paddock though?
yourinstagram my father!
user girl your daddy fine
liked by bsfsinstagram
bsfsinstagram user you have great taste
maxfewtrell send me that lando photo please
yourinstagram will do 🫡
45 likes
onlyyn i luv a good arfter prty
view all comments
danielricciardo me when i’m on the hennessy
onlyyn hehe
landonorris im looking for you
bsfsinstagram please don’t do anything crazy babe 😭
onlyyn i’ll try
lanny
y/n
where are you?
i thought you were with oscar
y/n/n
i let oscar leave! he looked tired
lanny
you should’ve told me that then
i would’ve kept an eye on you
are you drunk
y/n/n
i’m not a child oscar
lanny
*lando, but i’ll ignore that
and i’m not saying you are yn
there’s just people here that can be like
weird is all, who knows
are you drunk??
y/n/n
i don’t know, i’m not sober
are you drunk
lanny
i’m not sober
y/n/n
i thought you hated alcohol?
lanny
carlos convinced me to do some shots with him and max…
i regret it a little
do you wanna go home
y/n/n
yea
my feet hurt
lanny
i’ll carry you until we get to an uber
so can you tell me where you are now??
y/n/n
i’m in the bathroom
lanny
don’t move, i’ll come get you
y/n/n
god you’re the best ever lando
lanny
yeah i know 😁
2K notes
·
View notes
you wanna guess the color of my underwear
note : divider is from @/anitalenia. I wrote this because I listened to that Charli and Billie song on loop and couldn’t get it out of my head AND I ONLY FOUND IT THIS MORNING UGHHH this is literally just smut. I also kinda already wrote something like this but I love pussy eater Leon he’s real in my head. mdni
wc : 1k
tags : @lottiies
desc : Leon just loves eating you out. smut!! - oral (f receiving), not proofread, fem!reader, ID!Leon
Leon always paid the utmost attention to you when the two of you were alone. It didn’t even stop there, he’d send you gifts if he could when he was away, always adding a note to let you know how badly he missed you. Other times just finding a way to call you and let you know how badly he wanted to come back home.
And he was eager, too. Even better.
You and Leon must’ve been dating for two years by now, he knows he’s handsome, you couldn’t help but feed his ego day by day. Although, when he’d come home from a mission he’d be stuck in his own head and a lot of the time it was your job to get him out of it. It never took long, you’re pretty sure he’d do anything for you, especially when it comes to making you happy.
Leon’s always ready to get on his knees for you, too. Once again, even better.
You didn’t even have to ask for him to eat you out most of the time. It’s like it was the first thing in his mind when it came to making you feel good, or proving how badly he missed you, maybe even just doing it because he loved having his head buried between your legs.
He’s quick to work happy to please you for as long as you’re willing to let him. The achey jaw and sore knees come with the job.
He doesn’t even wait to get you inside the house today, he’s got you laid out in the backseat of his car, kneeling down o the floor between your legs. The angles odd, but he makes it work.
Leon hasn’t really even done anything yet, just holding your thighs in place atop of his shoulders as he licks over the center of your panties, the skirt you previously wore tossed aside somewhere in the car, he’s still in the suit he wore to work today. This has been going on for five minutes, not that you minded, he bought you these panties for a reason. You’ve been a bit of a tease since before the two of you even slept together, this problems only grown since you found out he’s obsessed with you.
Leon looks up at you through his eyelids all the while, stopping for a plot second to shoot you a smirk.
“You gonna keep me waiting?” You ask him, moving your thighs to adjust the position you’re laying in, only for his grip to tighten.
“No, ma’am.” Leon licks over the wet patch on your panties one more time before he lets go of your thighs and leans back. He takes his left hand, pulling your panties to the side. Leon’s other hand pushes your thighs a bit further apart, then trailing down to let his thumb rub against your slit. His thumb slips between your folds to gently pull them apart, you study his face carefully, letting out a shaky breath as his thumb rubs over your clit.
Leon swallows before he spits onto your already wet cunt, continuing to use his thumb to tease your clit and rub his spit around.
“Don’t take too long,” You mumble, following it with a small giggle. Leon smiles at you, his movements stopping so he can move his hands to help angle your hips up a bit.
“You know I always take care of you.” He whispers, his mouth is on you not even a second later, dragging his tongue through your folds and sucking greedily. The moan you let out is almost embarrassing, your hands go up to dig your palms in your eyes as he continues to lap up your arousal.
Leon’s gotten better at eating you out over the years, you never complained much, previous boyfriends you had had refused to even do this, Leon found that ridiculous. But having his face stuffed between your legs at least once a week was an amazing feeling.
You whine when Leon pulls off of you the tiniest bit, letting your arms fall to the sides of your head as he peppers kisses up and down your slit.
“Taste so good,” He murmurs against your heat, his kisses becoming a bit sloppier as his tongue slips out once again. “Love you.”
“Love you, too.” Your voice is all breathy when you say it. You gasp when his thumbs push your folds apart again, pressing his face further into your cunt as he sucks and licks at your entrance, his nose bumping against your clit.
This time, one of your hands makes its way into his hair, holding him against you. Leon’s chuckle is muffled against your pussy, you can feel his drool and your juices coating your sensitive flesh, your back arches as his tongue probes against your hole. His movements only get more aggressive after that.
You whine out his name, he hums against your skin and turns his attention to your clit, sucking it into his mouth and running over it with his tongue.
“Jesus, L-Leon- fuck-!” You moan, your grip on his hair tightens and you hear him groan, but he doesn’t let off.
“I know,” His voice is still muffled, “C’mon.”
Leon continues to urge you on, you can’t find any words to respond with, the only noises coming from your throat being moans and whimpers. You cum into his waiting mouth not even two minutes later, he still doesn’t pull away from you.
After he’s sure you’re all cleaned up, he presses one more kiss to your cunt before he pulls your panties back over, giving your clothed heat a soft slap. Leon rests his arms over your thighs and looks up at you as you sit yourself up, his face is all wet, he doesn’t seem to mind.
“You’re my favorite girl.” His voice is a bit rough, you love it.
“I better be.” You pant softly, bringing one of your hands up to run over his tousled hair. Leon’s hands move to run up and down your sides, giving you a soft squeeze.
“Hungry?”
“Yeah,”
“I’ll help you up. Let’s go, pretty girl.”
818 notes
·
View notes