moonav · 1 year ago
Text
tagged by @nyxiiis thank you so much for the tag 🥰❣️
last song: seaside rendezvous by Queen
favorite color: blue blue blue 💙
last movie/tv show: I took my mom to see Barbie (which is still in theaters here?? :'D anyways we had fun >w< 🩷)
currently watching: this is where you'll discover that my guilty pleasure is trashy reality shows :'D esp real housewives of whatever city I happen to watch :'D
sweet/spicy/savory: sweet!!
relationship status: single
current obsession: good omens!! <3 picked it up right before the 2nd season and ive been hooked ever since c': im not gonna lie, at first I was super uncomfortable with the religious themes (i dont belong to any church/religion and my interactions with christianity have been mostly negative, thanks relatives) but when I heard the first seconds of bohemian rhapsody, i decided to give it a go and here we are >w< queen is one of my fav bands, I was so happy to see how much of their music is in good omens :D
last thing i googled: ’moomin shop esplanadi’ a new moomin shop opened today in Helsinki so i googled the opening hours 🥰 im going to visit it soon with a dear friend, i cant wait!!🥰 theres already like 2 other moomin shops in Helsinki buuuut still 😆
again thank you so much for the tag C': this was such a welcome distraction and made me smile c': <3
Im tagging everyone who sees this and wants to do it!!🥰❣️❣️ and tag me in your posts, id love to read your responses 🥰
3 notes · View notes
thats-a-lot-of-cortisol · 6 months ago
Text
My mom just sent a message to the family group chat suggesting that my siblings download the 'For the Strength of Youth' magazine on their Gospel Library app and talked about how much the youth magazines helped her testimony growing up and like, cool. Fine. Don't know why the 'sending random spiritual thoughts in the gc' thing started out of nowhere when it hadn't been a thing for a decade but this is just another one of those, and you're ofc allowed to talk about things that are significant in your life.
I don't think sending the 'What I Did When Someone Close to Me Challenged My Faith' article right afterwards was strictly necessary though 🙃
#hi bg mutuals 👋 i'm gonna vent about this from time to time. if any mutuals dont want to see it block the 'apostake' tag#trying not to read too much into it b/c I think I did last time something like this happened#and i dont want to make an ass of myself even if neither time would actually be in front of my parents#but like...i know that they know that one of my sisters is clearly PIMO#they went through her phone a couple weeks ago and i have no idea if they read my texts w/ her#but if they did they probably saw the conversation i had with her about some of the really common shelf-breakers#and telling her to take looking into it at her own pace b/c it's scary and overwhelming#(a conversation SHE started btw)#and when i talked to my parents about the larger context of that whole situation i talked about not having space to step back#and their response was that they give plenty of space b/c they dont make her go to seminary???#that's not the same thing as letting her openly question & potentially leave the church idk what to tell you#like. besties i dont know for sure what caused it (which is NOT making things better. it just feels potentially passive aggressive)#but from my end? it sure looks like it might be a reaction to that. probably not JUST that (friends exist) but.#if you think I'm whispering anti-mormon rhetoric into my siblings' ears just ask me. i'm very much NOT doing that#i'm just. talking? to them? when and if they come to me with questions?#and not making my answer 'well there's a reason our parents raised us in the church! ☺️'#(an actual argument given in the article my mom sent)#hate it. thanks#apostake#jay rambles#ok to interact#im not challenging anyone's faith. my patience though? INCREDIBLY challenged#gotta figure out how to work my way around a 'hey please dont send spiritual thoughts to the gc *I'm in*' talk tactfully#they've been pretty chill about me leaving over-all?? at least to my face#haven't pushed me to go to church w/ them; was fine with me not visiting for easter; didnt try to convince me to not drink coffee; etc#it's just. frustrating that they're not giving my siblings that still live with them that same grace#my sister's 17 ffs#it's very possible im way overreacting to the article. but what is tumblr for if not screaming into the void#religion#mormonism
3 notes · View notes
agayconcept · 7 months ago
Text
.
#oh for fucks sake#if i have to listen to my shithead of a mother bitch and whine and moan about me being disabled one more fuckinG time i s2g#she's been going on for 20 mins abt how annoying it is that i had to go lie down for a bit bc i had a migraine and a pain flare up#which meant i guess that she didnt get to make dinner when she wanted to (i told her she could just eat w/o me like who cares)#so now she's on a rampage abt how inconvenient it is to her and how i ruin her schedule and her life all the time etc etc#and when i responded calmly w 'well what would u like me to do- snap my fingers and not be disabled anymore? u TOLD me to go lie down.'#she exploded and is like 'oh noOoo ofc not nothing is ever ur fault u just accidentally do these things'#bitch WHAT THINGS ?????#exist as disabled ??? be in so much pain i spend most of my life these days in bed ??? be unable to function to ur standards ????#do u Hear urself ??#now she's sitting on the couch pouting and fuming like a toddler bc i was in bed for 2 hours instead of 30 mins (bc too much pain to get up)#and throwing a tantrum like that is in any way normal or acceptable behaviour#'u always do this! but nooo u can do w/e u want cant u ?? u dont have to consider others!!'#ma'am...#a) no i dont have to consider others when it comes to taking care of myself and my debilitating illnesses. that's an insane thing to suggest#b) nobody told u u could not do w/e the fuck u wanted while i was out of commission. u just did this to have more to complain abt#c) ah yes bc i 'want' to be bedbound in excruciating pain. that was a choice i made. for funsies. for the bit.#whaT ?????#god someone save me im gonna lose my mind w this shit#not to mention she's also belligerently drunk so like. there's that also. cant have any proper convo bc of it (not that i wanna talk to her)#jesus fUcking chrisT#i gotta get out of here#this woman is so immensely hateful#ya sorry i ruined ur life by being born this way and now ur stuck 'putting up' w me and 'my shit' (<- actual things she has said many times)#fuuuuuck me.#anyway.#negative#ableism#verbal abuse#ask to tag
3 notes · View notes
the-smiling-doodler · 5 months ago
Text
slams my head violently against the wall /neg
#the yapper#sighs.#gonna rant in the tags for a bit. (feel free to respond‚ i dont mind. i just need to get my thoughts out there)#also if you see any ships/characters censored its not because i hate them. its because i dont want them to pop up on the main tags !!#i fucking hate. hate hate HATE it when people shit talk certain design choices and ships and aus in the fandom#well. in any fandom really. but this is my ppt blog so this is what i'm gonna be talking about#but anyways back on track#i dont care if someone doesn't like something. thats the not the problem#the problem is when they don't like something and start being super fucking mean about it#i dont care if you hate d*ynap or p*ppyn*gs or oc x canon or tall c*tnap or skinny d*gday or [x] au or etc. i respect your opinion.#i DO care however‚ when you start being a dick about it. i dont respect you anymore when you call an au bad or shit when it doesnt feature#your favorite ship. i dont respect you anymore when you get mad at/disrespect an artist for drawing a character in a way you dont hc#or when you go under an artist's drawing to say 'cute.... but [x] is better ^_^' (boils my fucking blood. just say its cute or look away.)#or when you get mad at them for not centering their au around the ship you like. all of this includes when you do it behind their back‚ btw#i'm not asking anyone to engage with content they dont like. but good lord.#can you not talk about the stuff you dislike without putting them and the people who enjoy them down?? you sound like a jerk.#hrfhdg idk dude. it just makes me so angry and sad. please do better you guys.#sorry if this came off as too harsh. i'm just really sleepy and upset right now. so sick of this entitlement and these fuckass ship wars#it's so draining#im gonna take a nap and see if it makes it better#i'll also start drawing when i wake up !! sorry for anyone who was waiting in my askbox. my mind's just been occupied lately
1 note · View note
littlebirdy0301 · 1 year ago
Text
(cw grooming mention) TELL ME WHY IM JUST SITTING IN MY ROOM CHILLIN, REMINDED OF MEMORIES FROM EALRY HIGHSCHOOL AND ALL THE SUDDEN HIT LIKE A FUCKING TRUCK THAT I GOT GROOMED AT 14/15
#CW grooming#cw trauma dump#I’m tagging this accordingly so don’t read if you don’t wanna hear about this subject. I just wanna get it out without telling irl people#I cannot fucking believe this. This realization hiT ME LIKE A FUCKING TRUCK WHAT THE SHIT#As a freshman I was friends with this senior. I was learning what it meant to be in queer spaces & learning what queer friendships were lik#And queer friendships that are also Theatre Kid friendships are often very touchy. Lots of behavior that is typically read as romantic#Hand holding cuddling playing with hair etc#So it was a bit like that with this 18 year old senior#They asked me out (in front of all our drama class friends & whatever other students happened to be around)#& I had no idea they had romantic interest so I was shocked. Didn’t know what to do or how to process#I ended up saying no telling them it was b/c I just realized I was queer & wasn’t out & didn’t wanna hide dating from my family#The memories are fuzzy but we kept talking & it still had the overly affectionate queer vibe#And they’d say romantic things to me and I think I’d say things back because I was still in a whole new world of discovering myself#And didn’t know what I was or wasn’t feeling#So when they’d act that way I just felt like I should act that way back#I was so young and immature and didn’t know anything at all about myself. I came from a stuffy conservative background so it was all so new#Then over time they pursued me romantically again and I (again not knowing anything & just taking a shot in the dark) said yes#They were in a relationship at the time too and suggested polyamory#And another red flag was that at one point I referred to their bf to them as “your man” and they said “sweetie that’s our man”#But I had never fucking met this guy!! Never had one conversation with him!!!!#And in actual ethical polyamory there would’ve been a discussion about all of our comfort zones and which of us wanted to be together#But I was just left to guess what the situation was so I assumed that they were dating both of us but he and I weren’t dating eachother#Because again!!!! I didn’t fucking know this man!!!!!!!#But anyway#when we actually “got together” it was all over text and it didn’t last long at all#Because THANK GOD my gut was telling me that something was VERY OFF#so THANK FUCKING GOD I broke up with them over text before I ever hung out with either of them in person post-getting-together#I am so fucking grateful right now that I listened to my gut because I’m sick thinking about how things could’ve gone if it went on longer#I avoided some major fucking trauma by getting out before I’d hung out at all with them in person. Fucking christ#Holy fuck I can’t believe it’s taken me 7 fucking years to fully realize what happened
1 note · View note
sm-baby · 11 months ago
Note
I want to see all the carnival AU bios again, but finding Zooble's is too hard, even when using the search. I hope there's a more organized way to view them.
(Trying to come up with nicknames that said characters would give my characters.)
CARNIVAL AU MASTERPOST + BOUNDARIES
Tumblr media
Augh... I never know how to organize stuff! But here is a mini master post of the TADC Info Cards (edited):
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
The Main Cast (Minus Zooble :C)
Zooble ( Plus Zooble!!! :3)
Shiny Cards ✨
Lesser AI
THE GLOINKS!!!
Tumblr media Tumblr media
Level layout
OFFICIAL COMIC:
The Entire Comic has also been dubbed by @volticglitch !! If you're not a reader, You can watch their dubs instead!! Here is the dub
Your best friend!
Jesterly duties
The hallway
Crying
First clue
Special event!
Foul language - a silly
Excuse me?
Leave!
A word with Bubble
Let it Settle
CONCEPT ART:
Characters Relationship Chart ( Bonus, OC relationship Chart!)
The Tent
The Funhouse
Cutscene
Pomni expressions
Character design
Meet Pomni
ALT character skins (Bonus, Maid skins because of course I did)
Pomni expressions AGAIN!!! (and a bonus)
The Jester's Circus tent (and a bonus)
References
Shape language ramble
LOREEE:
Neck pieces
Neck pieces (prt 2)
Neck pieces (prt 3)
Silly Frilly
Toxic Positivity Duo
Quick Ragatha Doodle
The Rabbit
Non-sentient Pomni
Pity Laugh
First act of violence
First and only visit
DOODLE DUMPS:
First look
Meet Jax
Meet Ragatha
Meet Kinger
Meet Able
Zooble's room
Theatre shinanigans
Thanks for listening
Jax Doodles
Ragatha doodles (Feat. Kaufmo)
Caine doodles
Queenie?
Colored doodles
Eye popping
Jax Ko-fi request!
SILLIES!!:
The "Sillies!!" Section is moved HERE becuase the mastpost couldn't take any more links!
╔══ ❀•°❀BOUNDERIES/FAQ❀°•❀ ══╗
"Can I make OCs In Carnival?" - Yess!! Multiple people already have and they make me so happy! do whatever, as long as you're happy and having fun!! " Can I make NSFW?" - Yas and slay, just be sure to warn and spoiler it, etc. etc. be responsible when posting NSFW! " Can I make Fanfics?" - Yes and please show me!! that would be lovely!! " Can I dub/voice your stuff?" - Yes but, I have only one rule... show me pleaaasseeee pls pls pls 🥺🙏 " Can I ship the characters/self ships/ OC x Canon?" - Aughh.. this is gonna suck to explain cuz its a lot to ask.. You're allowed to ship any ship! My only boundary is that it doesn't include either Pomni or Caine being with others who are not eachother! For example: Ragatha x Jax ✅ Pomni x Jax❌ Kinger x Queenie✅ Kinger x Caine❌ As long as the ship does not include Pomni or Caine individually, I'm all aboard!! I respect Jax x Pomni shippers, as well as Kinger x caine shippers, I just don't like them myself and don't want to accidentally stumble upon them in the tag! I do apologize if that's a lot, it just makes me uncomfy! Bounderies can be very tight! :')
6K notes · View notes
bweirdart · 1 year ago
Text
EVENT OVER! THANKS EVERYONE WHO JOINED IN U ALL DID AN AMAZING JOB <3 SEE YOU AGAIN NEXT YEAR IN MARCH FOR #mARTch OR NEXT OCTOBER (2024) FOR A NEW SET OF PROMPTS!!!!!
Tumblr media
OC-TOBER 2023 PROMPTS!!
general tag: #oc-tober / my prompts: #bweirdOCtober
F.A.Q:
Do I have to draw EVERY DAY?
NO! I highly encourage skipping as many days as you need to avoid burnout! There are 10 main days in the event (marked with a ⭐ star) that you can focus on if you don't feel up to doing every day, or you can choose your own adventure and just do the prompts you personally like!
Do I have to DRAW?
NO! You can also write fanfiction snippets, repost older art that fits the theme, tweet headcanons/backstory, roleplay in-character as your oc ... genuinely anything that fits the theme is OK!!
Can I start early?
YES! I understand some people work at a slower pace and might need a head start! So long as you wait until October to post it, you can start working as early as you need!
I missed the start of the event .. do I have to catch up?
NO! Please don't stress about days you missed, you're allowed to just skip to the current prompt!
RULES:
1. MAKE FRIENDS! The community is the best part of this event .. please try to follow new people, ask questions about ocs you like, compliment people's styles, ask friends to create with you, etc!
2. TAKE IT EASY! Skip a day if you're tired, busy or just not interested in the prompt. You don't have to catch up on it later. This is supposed to be fun, not work!
3. BE KIND! Please think about the people around you - don't give people unwarranted harsh criticism, content warn for themes/imagery in your work that could trigger someone, don't create anything hateful, etc
MORE:
text version / tips and ideas on bweird.art or below ↓
star = main prompts | no star = optional
INTRO WEEK
1: FAVE OC ⭐
-Which of your characters is your favourite right now?
2: NEW OC
-Who is your newest OC?
-Design a new OC right now
3: OLD OC ⭐
-Do you remember the first OC you ever made?
-Is there an OC you haven't drawn in a long time?
4: RE-DESIGN
-An OC who has changed a lot over the years
-Take an old OC and update their design right now
 
BACKSTORY WEEK
5: RELATIONSHIPS ⭐
-Who is important to your OC?
-Do they have a partner?
-Do they have a best friend?
-Are they close to their family?
6: SYMBOL
-What imagery do you associate with your oc?
-Are there any colours, flowers, animals or concepts that symbolize them?
7: PERSONALITY ⭐
-How does your OC behave?
-What are their positive traits?
-What are their negative traits?
-Are they extroverted or introverted?
8: PAST
-What was your OC like as a child?
-Where did they grow up?
-Are there any significant moments from their past that shaped who they are?
9: FUTURE ⭐
-Does your OC have a goal they're working towards?
-What will your OC look like when they get older
-Do you have a planned ending for their story?
PALETTE WEEK
10: pumpkin patch palette
#251604 #1E3807 #5B5E1A #A2A657 #EBA00F #F3ECCC
Tumblr media
11: hot cocoa palette
#520B13 #BB382E #E27E6D #88392C #AF5D40 #E1AFA4
Tumblr media
12: midnight zone palette
#000007 #000049 #183885 #004D4F #0E8788 #FFF1C0
Tumblr media
13: peachy palette
#DE6450 #DB9171 #FFC1AE #FEE1AD #FFF2E0 #D9D8D8
Tumblr media
14: haunted house palette
#552506 #6E25AA #ED690B #F925A0 #8F8BA7 #A6C1AA
Tumblr media
FUN + GAMES WEEK
15: MEME ⭐
-Post memes that remind you of your OC
-Draw your OC as a meme
-Fill out a character meme (classic deviantart style)
16: FOOD
-What is your OC's favourite food?
-What is their least favourite?
-Can they cook?
17: EYES-CLOSED ⭐
-Draw your OC with your eyes closed! No cheating!
-Write a scene without looking at the keyboard! Keep the typos in!
18: SWAP
-Swap the style or aesthetic of two of your OCs
-Species or gender swap AU
-Invert an OC's colour scheme
19: INSPIRATION ⭐
-Is your OC inspired by any pre-existing characters?
-Are there any particular songs/lyrics that inspired something about one of your OCs
-Do you have a dedicated pinterest moodboard for your character?
20: INVENTORY
-What does your OC carry around with them on a daily basis?
-Are there any objects that have sentimental value for them?
-Loot drop for your DnD OC
 
FRIENDS WEEK
21-25:
There's no specific daily prompts for this week, but here are some ideas you can try ...
-Art trades with friends who are doing the event with you
-Your OC interacting with a friend's OC
-Gift art for someone whose OCs you like
-Work together and collaborate on something with a friend
-Roleplay an OC scene together with someone
 
HALLOWEEN WEEK
26: FEAR ⭐
-What is your OC scared of?
-Draw one of your OCs trying to scare the others
27: MONSTER
-Do you have any monster OCs? (eg: vampires, werewolves, creatures, ghosts...)
-Draw a human OC as a monster
-Design a new monster
28: TRICK
-Play a trick on an OC
-Do you have an OC who would play tricks on people?
29: TREAT
-What is your OC's favourite halloween candy?
-Give an OC a special treat to make up for yesterday's trick
30: MAGIC
-Do any of your characters have magical powers?
-Give an OC a magical or cursed artifact
-Create a magic-using OC like a witch or wizard
27: COSTUME ⭐
-What is your OC dressing as for halloween?
6K notes · View notes
sugar-plum-writer · 5 months ago
Text
Company Cam-Girl <3
Tags: Gang-bang [Toji, Sukuna, Gojo and Suguru]; Use of toys [vibrator]; slight-bondage; size-kink; camera; public-exposure; nsfw + more nsfw; porn with slight plot; manhandling; unprotected sex; spanking; over-stimulation; cream pie; c*mplay; rough sex; lot's and lot's of very dirty talk; explicit; MNDI!; (18+); smut
A/n: This is probably the most explicit thing I might have written; my hazy imagination is getting too much. This period is killing me so it's just pure filth, this is pure porn with a little plot so MDNI!
Synopsis: What happens when a slight back talk results in getting railed and over stimulated like crazy by 4 big men in the sex-toy company?
Word count: 2.6k
[Pic not mine I randomly found it on the internet; I'll change it the owner requests ]
Tumblr media Tumblr media
Your heels clicked on the floor as you walked, the place you worked was- explicit to say the least. You would have never expected to work in a company like this when you graduated- literally; a sex toy manufacturing company? beyond your wildest dreams
You were working here all because of pure desperation. Broke with college debts does not make life easy. The position gave good pay, insurance, good bonus, what else could you ask for? hence you continued working.
You worked in the marketing department which was a headache as it sometimes made you wonder how to advertise certain devices.
"Y/n- the manager is calling you to discuss the latest high-intensity vibrator ad!", one of your colleagues yelled giving you the papers and walking away
You looked at the paper which outlined the build, the components, the types of intensity, movements, etc normal people would look away and even be embarrassed but- after a while, it became average to you like another Tuesday.
"Alright, tell him I'll be there, " you yelled, browsing the pages as you entered the office.
x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x
"This design is so outdated… we need a new design-", Suguru muttered as he sat at his desk scrolling annoyed, the cigarette hanging off his lips
Toji clicked his tongue as he leaned back on his chair, "Damn if only we could experiment it on someone and record everything down", his deep voice sent a shiver down your spine
"I could always get a hook-up to try it out~", Gojo muttered with a smirk, "I don't mind"
"You fools", Sukuna scorned, "A hook-up won't give accurate data- her fucking brain will just be mushy, ask any questions-", he rolled his eyes, "her replies will just be fucking moans"
"Don't any of you have a girlfriend or somethin'?", Toji groaned as he grabbed his beer bottle, drowning it down, "You can get her and we can experiment"
"Nah- I asked my ex once she nearly threw a god-damn vase at my face", chuckling Gojo scrolled through his phone
"Ah, shit-"
With a groan, they collectively sighed. The atmosphere in the room was tense- after all, they were your superiors, you were just a mere girl from the PR department
"um- excuse me", clenching the papers tight you looked at them all, "T-The documents have an error-", you tried to keep your voice stable
"Oh shut up woman", Sukuna glared as he walked towards you, "Can't you read the room? or are you senseless?"
"Huh-?", rage-filled your veins, you were already annoyed with overwork- been working so hard not to let it get to you but this- this was the last straw.
"You are the senseless one!", you snapped back, "You assholes can't even design a vibrator properly! Look at you discussing this shit!", you scorned and shoved the paper on Sukunas face as you glared at the others
"What did you just say you fucking bitch-", Sukuna grabbed your jaw pinning you against the wall
"You deaf?", glaring into his eyes you scoffed, "I said you assholes cannot even design a fucking vibrator"
"Yo, calm down", Gojo yelled as he made his way towards you and Sukuna
"Fuck off-", his grip on you tightened choking you
"What a pain in the ass", Toji grabbed Sukuna with Suguru and pulled him back
"Tch", groaning he let go of you while Gojo picked up the fallen papers
"You alright?", Sugurus eyes locked with yours- something about his cold black eyes- gave you goosebumps all over your skin
"Y-Yeah" Gasping for air you coughed as you looked at Sukuna who was starting to calm down more
"You said we can't design a vibrator, right?" Toji smirked with a dangerous glint in his eyes
"Y-Yeah..", You backed away afraid. Something about his expression makes you instinctively back away as if your body subconsciously tried to protect itself
"Why not be our test subject? we lacked one anyways~", with a sneer he leaned in. The atmosphere in the room changed as all eyes were on you.
"Your fool brain finally came up with a good idea", grinning Sukuna fixed his blazer, "What do you say woman? or are you too scared?"
"W-What!? no way never!", you immediately shook your head shaking it crazily
"Awwww come on~ it'll be fun I promise!", Gojo nudged you wrapping his arm around your shoulder
"No way!", slapping his hand away you glared
"See you said we can't design good vibrators", putting out the cigarette in his mouth Suguru shrugged, "Have you ever even used one of our vibrators to know if it's bad? ever cummed dripping wet?"
You blushed hard, "W-what explicit nonsense are you even saying!?", shoving the papers on his face you scowled
"Oh~ is someone scared?" smugly Sukuna leaned in and whispered near your ears, his hot breath sending shivers down your spine
"N-No I'm not! It's just a vibrator!", shoving him away you tried to push the men away
"Great!", standing behind you Gojo wrapped his arms around your waist pulling you close, "I'll even let you try out my new designs baby~"
"Hey! Bun-head, grab the newest vibrators and bring them here", Sukuna yelled, "We found a pussy to try it on!" he chuckled deviously
"What-!?" before you could say anything Toji cut you off, "Bring some lube too, I just know she's tight as fuck", smirking he looked into your eyes
"Alright, alright- I'll even bring a camera to record it. Need the data", with this- Suguru went to get all the items whistling
All while you stood stunned- how did you even end up like this? How did a small comeback develop to- well- this?!
"You did it to yourself, baby girl, ~ if only you hadn't opened that darn mouth of yours", with a chuckle Gojo whispered near your ears
"oh well, I'll look after you well~"
x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x
"Is the Pussy visible?" Gojo leaned in as he looked at the screen of the camera
"Yeah, just gotta zoom in more", Suguru adjusted the camera, the RBG ratio, etc as he zoomed in
With your legs spread apart on Sukunas desk- your panties are removed as your cunt's all visible in the camera. Rather than an office it looked like a porn production set.
"Hm…she's tight", Toji looked at your cunt, "I wonder when's the last time she got fucked", Sukuna muttered
"Shut up!? what the fuck do you think you are even saying-", embarrassed you looked at both of them annoyed, "Just by looking at my- my pussy you think you can say such things?"
"Doll, I have seen enough to know what pussy has not been fucked and how well it was fucked", chuckling Sukuna smirked
Hearing Sukuna's comment Toji, Gojo and Suguru snickered
"Damn right", smiling smugly Suguru stood up and walked towards you
"You-", too stunned to speak you just lower your head, "How can they say such things!?" you think as you take a sharp breath blushing; almost embarrassed with the explicitness but it was low-key hot.
You hated to admit it but you were aroused as fuck. The cool air brushed against your cunt making the walls quiver, 4 hot guys gazing at you as they discuss what's the best way to record your pussy holding vibrators in the office. It made you get even more wet with your cunt oozing out and dripping, making a mess on Sukuna's desk.
"Look she's already dripping and making a mess how cute~ how needy", Gojo chuckled
"Well can't leave her like this can we?" with a smirk rolling up his sleeves Sukuna started circling his fingers around your clitoris- flicking it a bit making you gasp
"W-wait!" trying to stabilize yourself at the sudden wave of pleasure you try to focus elsewhere, your hands and body trembled at the way he abused your clitoris
"Where's your mind goin'?" Toji cups your breasts and starts kneading them, pinching and flicking the nipples making you squirm and moan
"T-Toji wait ah-" your eyes widen as your feel Sukunas fingers do deeper stretching you out ruthlessly, "She's tight- Fuck", he gritted his teeth
Tossing your head back you try to cover your mouth but it was instantly pulled away by Toji, "Can't have you cover your mouth now can we sweetheart?", smugly he pulled your shirt up and tied your hands with it
"Nice boobs you got here", Gojo brushed his hand against your breasts, fondling them, "I wonder how hard the nipples can get heh~", smirking he brought his lips closer to your nipples and started sucking on them making you moan even louder, "Gojo- ah! 'tis too much wait-!" earning only a chuckle from him as he sucked even harder biting it
"The Vibrator No 1 is ready~ let's see how well you take it darling", smirking Suguru stood beside Sukuna- turning the vibrator on and putting it down on your cunt grinding it, the movements so good you felt you were on cloud 9; while Sukuna continued to move his fingers deeper stretching you out.
"Smile for the camera doll", smirking Sukuna slapped your pussy which stinged a bit but also made you so fucking wet it was embarrassing
The intense stimulation from the vibrator immediately made you arch your back, toss your head back and let out the loudest moans you could muster, it was stimulating- too stimulating.
It was too much- your poor pussy could not stand so much abuse. It was all puffy, sobbing wet, begging for mercy as it dripped and oozed pre-cum. Tears stained your cheeks as you whined and moaned
Your breasts were off even worse, the biting and sucking of Gojo had swollen your nipples so much. The bite marks covering your breasts stung but also gave you so much pleasure wanting more
"Fuck- who knew we had such a natural cam-girl?", licking his lips Toji just watched your expressions hungrily wanting to devour you
"I know right? Should have fucked her and filled her up first", chuckling Suguru increased the intensity of the vibrator to it's highest limit making you gasp and moan, squirm all at once, "Let's see how loud she can scream eh?"
"Oh my God! it's too much ah-" tossing your head back you squeezed your thighs shut as your eyes rolled back and you climaxed instantly because of the intensity
"Stay still, how bratty", slapping your thighs Sukuna spread your legs open forcefully holding them down, his fingers covered in your release, "Heh- who said the vibrator was bad huh? look at the amount of cum", smirking he licked it off his fingers making you blush harder and be even wetter.
"D-Don't-!" you frantically tried to wipe your cum off his fingers too bad Toji held your arms down all tied up
"I wanna taste some too~", licking his lips smugly Gojo with a quick movement shoved his fingers inside your cunt and licked it
"How sweet I can eat her out forever~ Try some Suguru"
"Oh don't mind if I do~"
Seeing them taste your cum from their fingers made you almost lose your mind and your brain felt mushy. The camera still recording everything that they were doing to you. It was so crazy
"Hah- finally stretched out, what a good fucking pussy", Sukuna smirked satisfied
"We can finally put the vibrator in~ shall we put two?", Gojo chuckled as he gazed at your cunt
"I think she can take it~" smugly Toji looked you in the eyes, "She's such a good girl after all. Aren't you baby?"
"Well" with a sneer Suguru finally put the vibrator inside you with the highest intensity, "Let's see what she can do, go at it girl show what you got~"
Hungrily they all gazed at you, their eyes those of starving wolves who wanted to completely devour you, fill you up- breed you so fucking well like the way you deserve. You had no idea what a raging boner they had seeing you and your cunt.
"Oh my god- ah- hah~", moaning you squirm as the vibrator continued to hit all the right spots- making your whole body-shake, your walls clenching so tight- holding on for dear life; "Fuck it's so good!", biting your lips you closed your eyes as you felt your brain going numb.
It felt like it was designed specifically for you, the way it hit your G-spot was driving you mad. It kept pushing you over the edge again and again.
"Shit", biting his lips Sukuna approached you, his hard-on evident, bulging fully, so big it made you wonder if it would even fit.
"Moaning like a whore just from a mere vibrator", unbuckling his pants he removed the vibrator making you sequel and whimper
"Guy's let's give her the best fuck of her life shall we?", smirking he positioned himself to your entrance and slammed in without warning, doing deep, hard and fast thrusts- hitting your G-spot again and again
"Fuck, so good, shit how was I missing out on such good pussy"
The vibrator already broke your brain in the beginning and now feeling Sukuna fuck you, so big- so hard- filling you up so well drove you even more over the edge. Your throat had gone dry from all the moaning
Toji, Gojo and Suguru also unable to keep their hand to themselves any longer; unbuckled their belts with their hard on started jerking off standing beside you, letting out grunts and moans imagining fucking you. Making you suck on their dicks like the good girl you were.
Seeing how big they all were you wondered how your poor cunt will ever be able to take them all inside.
Your vision was going white with all the pleasure as you clenched around Sukuna's dick, squeezing him so tight he tossed his head back pussy drunk just wanting to feel you all around him.
You don't know many hours went by all you know is they all took their turns fucking you- in all positions, filling you up with their cum; praising you and telling how much of a good girl you are, how well you are taking them.
You were fully- completely knocked out and brain fucked. The office fully messy from the desk to the couch and all vibrators gone.
x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x-x
The next moment you wake up, sharp pain shoots up and down your body as you groan.
"Oh look who woke up, our cam-girl", chucking Toji sat beside you while the others crowded around you
That's when everything hit you all at once and you look down finding yourself completely and utterly naked.
"You took us all in so well baby~ my dicks never been more satisfied", Gojo lifted you making you sit on his lap and kissed your neck
"S-Shut up! I need to go!" you blushed hard and tried to stand up but tripped
"What a brat, you really think you can stand? how annoying, you were better brain fucked", Sukuna immediately grabs you supporting you to not fall
"You!-" feeling your blood boil you immediately try to open your mouth to yell all kinds of profanities
"Oh she's awake", Suguru entered the room smirking, "Still naked is she? are we going for another round? Because I am down"
"I'll die if we do another round!?" in panic you look at them all in the eyes earning a chuckle and a light slap on your ass from Sukuna making you whine
"Shut up you aren't going anywhere from today onwards you are our girl"
"Huh!?", you gasp in shock
"Everything we did is recorded", Gojo chuckled grinning, "Suguru even finished processing it darling~ thank you for your-", he tossed a vibrator to you and winked, "lovely data"
You stand utterly stunned knowing there is no way out from this, they'll eat you alive whenever they please. You are officially the company's cam-girl and test-subject.
Congrats on your promotion~ <3
My Masterlist!
1K notes · View notes
hellsitegenetics · 9 months ago
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia ("tw trypophobia", etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: according to democracy, yes
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
Tumblr media
2K notes · View notes
f1smutwriter · 5 months ago
Text
| 𝐎𝐛𝐞𝐝𝐢𝐞𝐧𝐭 𝐠𝐢𝐫𝐥 (𝐜𝐥𝟏𝟔)
Tumblr media
Dom!Charles x Inexperienced!Reader
Pt1, Pt3
Summary: Charles teaches her some of the basic of sexual pleasure.
Warnings:SMUT! Oral (male rec), fingering, thigh riding, Unprotected sex (girl you better stop), edging, explaining kinks (a warning itself), dom/sub, dirty talk, praise kink, degrading kink, tiny threesome mention, bit of anal, hair pulling, rough sex, begging, pet names (good girl, mon cœur, baby, princess, etc), more I probably missed
Notes: This is part two of gently, you guys wanted it I delivered plus it was actually so fun to write. Please give me more things to write about in running out. ENJOY!!!
Tag: @redmoonsthings
——————————————————————————————————————————————————
I’m cuddling with Charles his hand on my thighs rubbing softly. It’s been a week since we had sex and I’m already starved, I’ve been trying to bring it up but he tells me not yet. “Amour” I whispered shyly making him hum. “Oui, amour” he said making me blush more at his accent. “C-ca” I stuttered not being able to speak.
“Speak like a good girl” he said rubbing my thighs. When he said that I whimpered lowly hoping he didn’t hear me. “Needy today aren’t you” He smirked making me hide my face. “Well can you blame me you haven’t touched me in over a week” I whined out causing him to burst into laughter. “Princess if you needed me so bad you could have just asked” he whispered lowly making his accent go thicker and deeper. “I did but you said I wasn’t ready” I pout looking down at my lap feeling embarrassed.
“I need you to speak up, okay. Gonna need you to be a good girl” He grumbled as he pinched my thighs making me gasp out. "Gosh I keep forgetting that you're so sensitive to everything" He chuckled feeling my cheeks turn red hiding my face. He slapped my thighs roughly making me yelp out. "When I speak to you don't hide your face, understand" He said sternly feeling myself nod without a second thought. "Good girl" He whispered in my ear.
I get lifted out of my seat and get put in his lap. "Here's what were gonna do okay. You're gonna take off those pretty panties you have on and ride my thigh got it" he demanded as I nod yes to him wanting to obey every order. "W-wh-what's thigh r-riding" I stutter out nervously.
"My sweet innocent girl, thigh riding is when you rub that sweet cunt on my thigh til you squirt" He smirked as he moved my on his lap "How about you take them off, now" he growled taking off my panties. He runs his fingers through my soaking wet fold, feeling myself let out a small whine. He pushed my body down on his thigh making me gasp at the sensation, he started moving my pussy on his thigh. I moaned out, throwing my head back at the feeling of him flexing his thigh to give me more friction.
I closed my eyes in pure pleasure making him smirk. "Feels good, huh" He commented as he moved my hip on his thigh. My breath hitched when I feel the right amount of pressure on my clit to make me go light headed. I move my hips on my own needing more friction, as I slowly feel the knot in my stomach. "Cha" I moaned moving my hips faster and faster. I look at him watching a smug smirk on his face, as he lays his hands behind his head. I whined out rubbing my clit to get their faster, but he slapped it away. "Earn it yourself" He said sternly making me move my hand out of the way.
I move faster feeling the same bubbling sensation get more and more apparent. "Cha-baby m-my tum-my" I moaned trying to get my words out properly. "Aww my sweet girls gonna cum huh, but she's not so sweet anymore. she turned into a little slut" He teased as I go faster on his thigh. "P-ple-ase need t-t-to" I whined squeezing my eyes shut. "No you don't get what you want today" He smirked taking me off his lap. I whined out needing to finish so bad but I hold onto it.
"Want you to do something for me is that okay mon amour" He whispered raspy making me nod yes in an instant. He slid down his pants and boxer making his cock hit his stomach, causing him to hiss. He stoked himself a few times before looking at me. "Think you can take my cock baby" He whispered making me look at him with wide eyes before nodding yes instantly. I lay on my stomach looking at him up close. I trace all the veins that were on his v-line making him groan a bit. I see shiny liquid at the head on his cock making me touch it. "what is that" I whispered as I feel the sorta sticky substance on my finger tips.
"It's call pre-cum just like how you get wet so do I" He explained softly stroking the back of my head. "H-how do I s-s..take you in my mouth" I asked not being able to say the term making him smile at my shyness. "Just lick like a lolly pop and suck gently no teeth or it hurts baby" He said softly nodding at the instructions. I lick the liquid softly making him groan at the sudden pleasure to his bright red tip. "f-fuck baby" He moaned as I take more of his cock in my mouth. I moved my head up and down licking his tip once I get to the top. He bucked his hips causing his tip hit my throat, but I didn't gag so he looked at me in shocked. "You don't have a gag reflex" he asked making me shake my head no. "I'm gonna have so much fun with you baby" he smirked before he put my hair in a ponytail making guide me deep down onto him. I feels my eyes tear up up I try to go farther down.
He groaned throat fucking me causing me to tense up. "Relax your jaw and throat okay" He said causing me to listen. He started throat fucking me once again hearing him curse in French under his breath. I accidentally gazed my teeth on him causing him to moan loudly, I look up to see if he's okay but then I feel him pull me off. "If you kept going I would have came and I don't want that yet" He mumbled causing me to understand what he meant. I move up and down faster and faster wanting him to push over the edge. He pulled my hair taking me off of him, feeling myself pout. “Don’t pout don’t want to cum in your mouth” he whispered to me while cleaning my mouth of saliva.
“Why not” I pout causing him to let out an amused chuckle. “Because why would I want to cum in your mouth when I can cum in your pussy” he smirked as he sees my wide eyes. He sees my face turn more red at the sudden dirty talk. “You like me talking to you filthy, huh” he asked making me nod yes instantly. “Dirty talk kink interesting” He smiled as I look at him in pure confusion. “K-kink what i-is that” I asked him making eye contact. “A kink is something you’re into sexually, like I love being dominant to you or foreplay. Don’t worry I’ll explain everything soon” He smiled reassuring to me that he was gonna explain everything. “Or we will explain” he mumbled lowly not allowing me to understand. “Huh” I asked confused causing him to shake his head.
“Lay down” he ordered making me listen in an instant. “I keep forgetting how perfect your pussy is” He mentioned as he slips his fingers through my soaking fold. Then I feel him slip a finger in me feeling myself moan loudly. He worked his finger in and out trying to get more sounds out of me. “Does it feel good. Like when I fuck you with my fingers” he whispered as a loud moan slips past my lips. He enters another finger to go with his first one, feeling my eyes roll back into my head. He curled his fingers perfectly feeling him hit the same spot he hit the other day. “Found it huh” he smirked moving his hand fast. All of a sudden he takes them, making me whine.
He sits up causing me to be confused, he pats his lap feeling myself sit on it. He grabs me by the waist and sinks me down on his cock. I gasped out loudly at the sudden fullness, he moves me up and down softly causing me to close my eyes. He looks down at my stomach and sees a bulge on it. “Feel that princess” he whispered in my ear pressing down on the bulge with his hand. “I’m so deep I’m in your stomach” he groaned causing me to moan out. “He moves my hips feeling myself moan as I bounce slowly. He groaned from the friction making me go up and down faster. “That’s it good girl move for me” he moaned as I move faster and faster.
I moaned loudly feeling his tip hit spots inside me I didn’t feel get hit the other day. I throw my head back grinding my hips to make us both feel good. After a few minutes I started feeling the burn in my thighs making me whine out. “Need help” he chucked causing me to nod. All of a sudden I feel him buck his hip. I moaned loudly gripping his shoulder meeting his thrust. “That’s my good girl” he chuckled as he slips his hand between us and rubs my already simulated clit. I grip onto him feeling the same pressure I’ve been having all night. I clench around him giving the warning I was already so close. “You’ve been such a good girl. Cum baby cum for me” he moaned making me scream out and cum all over his cock.
That triggered his release spraying his warm seed in my tight hole. “You came so quickly were you needy today” he teased me, I whine at him hiding my face. “Don’t worry we’re not done” he smiled putting me on my hands and knees pounding in and out of me. I screamed out arching my back and tears spilling out of my eyes. “What did you think we were done. Sometimes your a stupid little thing” he chuckled drilling in and out the sounds of skin slapping together and my moans were the only thing you can hear in the room. He gripped my hair pulling it making me look at his lustful eyes. “I’m making this pussy feel so good huh” he groaned as I nod at his answer. “Talk” he demanded making me scream out. “Feels so good feel you everywhere” I moaned out still feeling his cock pound in and out.
I moaned out gripped the sheets, as the sudden feeling of my second orgasm of the night. “Cum baby come on cum for me” he groaned griping my hair with such a firm fist. I moaned loudly cumming all over his cock, he moaned out spraying his seed in me for the second time. I whimpered out collapsing on the bed, trembling from the power orgasm. He pulls me into his embrace shushing me quiet. “Did so good my good girl” he whispered scratching my head cuddling in his chest. “Go to sleep baby go to sleep” he whispered as I doze off into peaceful sleep.
“I love you so much words can’t even describe it.”
——————————————————————————————————————————————————
Notes: If I’m being 100% honest my writing is getting so much better. But I have bad days in writing to. But I hope you like this part 3 will be coming soon don’t worry. Hope you enjoyed!!
632 notes · View notes
chuuyasheaven · 5 months ago
Text
“ ➸ Nothing matches your touch !! ”
Tumblr media Tumblr media
SCENARIO. Chuuya was on a week long mission, and you missed him and his touch very dearly. You tried to wait for him but couldn’t, even hearing his voice through the other end of the line was turning you on. You tried touching yourself but he does it the best, so once he’s back, he gonna make up for those touches you were longing for.
TAGS. C. NAKAHARA / FEM! READER, husband! Chuuya, wife! Reader, pet names, masturbation mentioned, eating out, p in v, praise, overstimulation, slight teasing?, they are fucking but making love at the same time (if it makes sense), short probably, grammar, etc.
NOTES. This was started on the morning of my math final, idk when I’ll finish it (I FINISHED IT ON SATURDAY!!’) .. enjoy! And were are JUMPING into the story :3
Tumblr media
Your fingers were running through his ginger locks as he grabbed onto your waist, never letting you go while his lips were on yours. It’s been only a week but it felt like several weeks going by slowly. Chuuya couldn’t admit how much he missed you, how much he missed your touch on his body. But you had no problem to, you were telling him that as soon as he went through that door.
“Missed me that much, sweetheart?”, he asked in a teasing tone as he placed you on the bed. He knew you did, way more than he probably did. You nodded as you leaned back, waiting for his next move. Chuuya got his knee between your thighs when he also got on the bed, hovering over you with a smirk. “Want me to make up for every night I wasn’t here?”, Chuuya didn’t really give you a chance to answer that, he simply just kissed you again, god how much he missed those soft lips of yours. When he pulled away once more, he shoved his knee against your cunt slightly, you let out a strained whimper at that. “Fuck, you’re probably wet right now, aren’t you?”, you nodded desperately, getting more worked up as more time passed. “Please, Chuuya, I missed you.”, the lust in your voice made his dick twitch in his pants. “Don’t worry, I got you, baby.”, he cooed.
The shorts you were wearing gave him easy access to remove them quickly along your panties. “Did you try to touch yourself while I was gone, doll?”, you nodded slowly, waiting for him to finally touch your wet cunt. “It didn’t feel as good as you do.”, Chuuya placed a quick kiss on your lips before slowly going lower to sit between your thighs. “Yeah?”, you nodded again as you felt Chuuya caressing your thighs while spreading them to get closer to your cunt. “Can’t wait to taste you again.”, he admitted with slight excitement, digging into your cunt immediately. Once he started to eat you out, your head threw itself back in pleasure. Chuuya ate you out like a starved man, god, he didn’t know how he survived so long without tasing you for about a week. Your fingers found themselves tangled up in Chuuya’s red locks again, unintentionally pushing him in deeper. His hands found themselves on your thighs and held onto them for more stability. “Ah– Chuuya, I’m close!”, you moaned out, this only made him eat you out sloppier, his tongue knowing which places to hit to make you see stars. Your thighs began to slightly shake, the knot in your gut was close to snapping, and Chuuya kept on giving you more pleasure until you cum undone on his tongue. “Fuck, c’mon, cum on my tongue, doll. Let me taste you more.”, his words rather muffled as he was still between your thighs, still very close to your cunt. The vibrations from his words sent you over the edge, making you cum almost instantly. When Chuuya got back up from between your legs, he was smirking, licking up any of your essence that was trying to escape. “Good girl,”, he praised you, walking towards you slowly while undoing his belt. “Ready for the rest? Or are you already tired?”, Chuuya knew the answer to that one, and his guess was confirmed when you gave him a short response on it. “N–no. Please, I need you so bad.”, all he could do was chuckle low as he was staring down at you, his cock hard and excited. “Yeah? You need me this bad, sweetheart?”, Chuuya bent halfway down to get close to your face, stroking his cock slowly before lining it up. “Want me to fuck you as good as I can, hm? You want me to make you scream my name as loud as you can?”, Chuuya whispered against your lips as his tip was teasing your now sensitive cunt while he was talking dirty to you, slowly letting it drag itself up and down your folds. His teasing got you even wetter than before, you were whimpering from the stimulation he was putting you through. “Chuuya. . please.”, you begged him in a desperate whisper, making him smirk.
“Please what, baby? Can’t wait any longer?”, you shook your head, he chuckled low once again, pressing his tip on your cunt, not pushing it in just yet. “So desperate f’me. . I can feel how wet you are, baby. Who am I to make you wait any longer?”, and with that, he pushed himself in slowly, capturing your lips into a kiss quickly before cursing under his breath. “Shit, you’re so fuckin’ tight for me, you might squeeze me dry, doll.”, Chuuya started to move, starting off slow so you would get used to the feeling. Soon enough, he started to get faster, chasing after your orgasms. You had to grip the sheets from how fast he was getting, his tip continuously hitting your sweet spot. God, you might never get over how big he actually is. “You’re doin’ so good, princess.”, he praises in between grunts and thrusts, his grip on your waist tightening. All you managed to do was to scream out his name in between moans, locking your legs around his waist to get a better angle. It didn’t take long for you to feel your second climax nearing itself, clenching down on his cock at least twice. “Chuuya!”, was all you managed to say that wasn’t slurred. Chuuya, on the other hand, was grunting from all this, he wasn’t able to fuck you this good for a week! His cock started to twitch inside your overstimulated cunt, letting him know that he was growing close too. “Chuuya, g–gonna cum!”, you warned him again, Chuuya was speeding up even more. “Can you hold on f’me, princess? Promise I’ll make this fast.”, you nodded, trying your best to wait for him. After a couple of fast thrusts, which hit your sweet spot way too good, he felt himself starting to cum. “Cum, sweetheart! Fuckin’ cum for me.”, his cock was twitching inside you again as you finally came over it. While Chuuya was emptying his load into you, the last couple of curses fell under his breath. “Fuh–huck. .”, your tight grip on the sheets got loose again, both of your chests falling up and down from breathing heavily after the session you both had.
“ You did so good for me, baby. Let’s just stay like this for a little, yeah? ” ♥
Tumblr media
491 notes · View notes
miley1442111 · 5 months ago
Text
(part 5)party choices- a.donaldson
------------------------------------------------------------------------------
Tumblr media
------------------------------------------------------------------------------
a/n: fem reader but as per usual, imagine what you like :)
summary: when you find out about his betrayal and how your relationship truly ends. (dw there are more parts after this :))
pairing: art donaldson x reader
warnings: angst, feelings of disappointment, hurt, cheating, sexual content, etc. +
PART 5 of 12
------------------------------------------------------------------------------
Art thought back to the party as he lay in bed that night, regret bubbling deep in his stomach.
-----------------------------------
He followed you around the party for around 40 minutes before he broke off to find Patrick. He didn’t mean to walk in on them, hell, they weren’t even in a room, they were doing it in a shed, it was fucking ridiculous. Partick had just pulled him in, he consented, sure, but he wasn’t thinking straight. 
“Pat?” Art called into the darkness of the night. “Patrick?”
“In here,” he heard giggling from the shed just a few paces away. 
He opened the door to be met with a very naked Patrick with Tashi beside him. “Jesus Patrick!”
Art looked up as the two of them laughed at his reaction.
“What, it’s not like you haven’t seen it before,” Tashi teased. 
“Fuck off,” he sighed. “I’ll talk to you later-”
“Don’t leave,” Patrick smirked. 
“Yeah Art, stay,” Tashi teased. Art felt so conflicted as he nodded his head. He loved you, he wanted to fuck you, but he wanted this too.
-----------------------------------
The second he left the shed, post-orgasm clarity hit him hard. He‘d just fucked Tashi Duncan (and technically Patrick Zweig watched). Your competition, the woman who hates you, the woman he promised to steer-clear from. 
Fuck.
He went to find you immediately, planning on telling you and letting you break up with him. But… When he saw you, so beautiful, that damn plum dress clouding his judgement, he walked up to you, wrapped you up in his wraps and kissed you as you giggled at his antics. 
He drove you back to your dorm and followed you inside, falling asleep beside you as guilt buried itself in his body. 
He couldn’t even respond when you told him you loved him. 
-----------------------------------
The worst part was that Art knew he’d fucked up. He knew it was an awful idea to try and hide it from you and he regretted not telling you the second it happened. He was aware of how bad this was, not that all the other shit he did to ruin you. Yet he still did. 
You were enraged. You were sick of letting this pathetic boy rule your life. You were done.
-----------------------------------
“C-can we talk?” he asked, cautiously approaching you as you ate in the canteen of the challenger. 
“About what?” you snapped. “You got what you wanted, you have Tashi.”
“I don’t want Tashi,” he mumbled, staring at his feet. “I want you, and I know I don’t deserve you.”
“You cheated on me.” 
“I did,” he admitted. 
“You cheated on me, then strung me on for 6 months, Art. You slept in my bed, you fucked me, you kissed me, and you promised me you loved me, all while you knew you;d fucked someone else,” you listed off. “Go fuck yourself, Art. I hope you choke.”
Art could feel his throat burning. “Alright,” he said, his voice barely above a whisper. 
-----------------------------------
You’d caught wind of Tashi’s injury a week after it happened, and you felt sickly satisfied. Karma. 
You only saw Art and Tashi together, and found out they were dating a few weeks after they got together. 
You were sitting in your dorm when there was a knock at the door. You opened it to find someone who shocked you. 
Patrick Zweig.
-----------------------------------
art donaldson masterlist :)
navigation for my blog :) (criminal minds, obx, the bear, marvel, top gun, the hunger games, challengers :)
people who asked to be tagged :) @fkaams
538 notes · View notes
roksik-dnd · 1 year ago
Text
For everyone who asked: a dialogue parser for BG3 alongside with the parsed dialogue for the newest patch. The parser is not mine, but its creator a) is amazing, b) wished to stay anonymous, and c) uploaded the parser to github - any future versions will be uploaded there first!
UPD: The parser was updated!! Now all the lines are parsed, AND there are new features like audio and dialogue tree visualisation. See below!
Patch 7 dialogue is uploaded!
If you don't want to touch the parser and just want the dialogues, make sure to download the whole "BG3 ... (1.6)" folder and keep the "styles" folder within: it is needed for the html files functionality (hide/show certain types of information as per the menu at the top, jumps when you click on [jump], color for better readability, etc). See the image below for what it should look like. The formatting was borrowed from TORcommunity with their blessing.
Tumblr media
If you want to run the parser yourself instead of downloading my parsed files, it's easy:
run bg3dialogreader.exe, OPEN any .pak file inside of your game's '\steamapps\common\Baldurs Gate 3\Data' folder,
select your language
press ‘LOAD’, it'll create a database file with all the tags, flags, etc.
Once that is done, press ‘EXPORT all dialogs to html’, and give it a minute or two to finish.
Find the parser dialogue in ‘Dialogs’ folder. If you move the folder elsewhere, move the ‘styles’ folder as well! It contains the styles you need for the color coding and functionality to keep working!
New features:
Once you've created the database (after step three above), you can also preview the dialogue trees inside of the parser and extract only what you need:
Tumblr media
You can also listen to the correspinding audio files by clicking the line in the right window. But to do that, as the parser tells you, you need to download and put the filed from vgmstream-win64.zip inside of the parser's main folder (restart the parser after).
You can CONVERT the bg3 dialogue to the format that the Divinity Original Sin 2's Editor understands. That way, you can view the dialogues as trees! Unlike the html files, the trees don't show ALL the relevant information, but it's much easier to orient yourself in.
Tumblr media Tumblr media
To get that, you DO need to have bought and installed Larian's previous game, Divinity Original Sin 2. It comes with a tool called 'The Divinity Engine 2'. Here you can read about how to unstall and lauch it. Once you have it, you need to load/create a project. We're trying to get to the point where the tool allows you to open the Dialog Editor. Then you can Open any bg3 dialogue file you want. And in case you want it, here's an in-depth Dialog Editor tutorial. But if you simply want to know how to open the Editor, here's the gist:
Update: In order to see the names of the speakers (up to ten), you can put the _merged.lsf file inside of the "\Divinity Original Sin 2\DefEd\Data\Public\[your project's name here]\RootTemplates\_merged.lsf" file path.
Feel free to ask if you have any questions! Please let me know if you modify the parser, I'd be curious to know what you added, and will possibly add it to the google drive.
2K notes · View notes
lomlhwa · 9 months ago
Text
y'know what they say about guitarists (c.s)
Tumblr media
pairing: guitarist!san x vocalist!reader
preview: san has watched you flirt with entire crowds. he just wants some of that attention too.
tags/warnings: fem reader, mentions of drummer!mingi, bassist!yunho and stage manager!seonghwa, ONE BED TROPE WHO CHEERED, possessive san, spit play, pet names (good girl, pretty girl, sweet girl), praise, pussy drunk san, dacryphilia, lots of hickeys, unprotected penetration (wrap it before you tap it), creampie, cockwarming
trigger warnings: n/a
w/c: 2.0k
song recs for this fic: any chase atlantic tbh (slow down, swim, heaven and back)
a/n: this lovely fic is dedicated to @kitten4sannie to celebrate my return to writing! i hope you like this ml!
Tumblr media
as you’re onstage playing a gig for a couple thousand people, you feel like you’re in your element. nothing feels better than being onstage with your bandmates. your hips sway to the music coming from the musicians sharing the stage with you.
you give playful winks and body rolls to the fans in the front row. something that always catches your guitarists eye. though, his rhythm never falters. 
jealousy always courses through him. he wants to receive those playful gestures from you. you even wink at mingi, your drummer from time to time. the beloved bassist, yunho, receives the most of your onstage affection. hugs, cheek kisses, etc. makes the male fans jealous. makes san’s blood boil. 
your angelic voice rings through the in-ear monitors that each band member wears. it sends shivers down san’s spine. so talented and so incredibly beautiful.
as your gig ends, you giggle and thank the fans who attended. “thank you guys so much for coming! i love you! we’ll see you next time!” you bow and flounce your way backstage in your cute outfit. your band members follow suit, bowing and running backstage.
“thank was great guys! well done,” you stage manager says. you wrap your arms around his shoulders and smile. “thanks hwa.” you let go of him and turn to yunho. “yuyu, your guitar playing was extra good today!” you exclaim, smiling so brightly that the sun might have competition. you peck his cheek before running off to your stylist to get changed.
san’s shoulders slump, knowing that he won’t receive those small actions of affection from you. “feeling left out, sannie?” mingi asks, towering over the smaller guitarist. san nods, not bothering to look up at mingi. 
“why don’t you just talk to her? there’s gotta be a reason she’s reserved around you,” yunho points out from across the room. his makeup artist is hunched over him, removing his makeup ever so carefully. 
“talk to who about what?” you say, suddenly coming out of your dressing room. you’re beautiful even now; no makeup and in your pajamas. “no one. nothing,” san blurts out. fuck. he’s so stupid. “okay,” you smile, sipping your water through a straw. 
“you guys ready to go back to the hotel?” you ask and the other three members nod in unison. you grab your bag and head for the door. “san’s rooming with you tonight, y/n.” you look back at yunho with wide eyes. “oh! um, okay.” you give san a confused look before heading out the door.  
san flips yunho off before following you out the door. you all pile into the company van and sit in comfortable silence as you head to the hotel. you file out of the van when you pull up, security making sure no fans get to you. you scurry into the building and do your best to sneak into your hotel rooms. you sigh dramatically as you get the door shut. 
you turn around to find san staring at your hotel room in horror. “what’s the probl-” you cut yourself off when you find that your room only has one queen sized bed. “shit,” you mutter. you drop your bag on the floor before you whip your phone out and dial seonghwa’s number. 
“hwa, what the actual fuck? one bed?” san can hear seonghwa trying to explain. he picks up pieces of the conversation. something about this being all that was left when he was booking. something else about telling you to suck it up. you mutter some insults before hanging up on seonghwa.
“i can just sleep on the floor, it’s fine y/n,” san drops his bag on the floor and sits down on the ground next to the bed. “no, san, we can share the bed. we’re touring. i don’t want your limbs to ache,” you shake your head as you climb into the bed. you pat the space next to you and he clambers onto the mattress. 
after a couple hours, you’re both laying on your backs in the dark, in silence. “hey y/n?” san says, finally breaking the silence. you give him a soft hum in response. “can i ask you about something that’s been bothering me?” he asks. you hum again.
“why don’t you give me the same attention you give mingi, yunho and seonghwa? no hugs, no pecks, nothing. you’ll skip over me just to give the ones beside me those things. why? did i do something to make you uncomfortable? or scared to do those things for me?” san can feel you tense up next to him. he wonders why that’s how you reacted. 
“cause…” you trail off. san can see the outline of you sit up in the dark. “cause i have a crush on you. if i gave you that affection, i would never survive. if i gave you a single hug, i would never let go. if i kissed your cheek, i would never be able to keep it from turning into a real kiss,” the confession hangs in the air like a spiderweb. he sits up, like you did. “why didn’t you tell me?” san asks. you sigh and shrug, despite the fact that he can barely see you.
“i didn’t wanna ruin the band dynamic. i didn’t wanna risk you not reciprocating and making things awkward between us. i was just scared that-” san pulls your head back so he can meet your lips with his. it’s swift, but it’s enough to make you sputter in shock.
“i’ve liked you since we even started this band, sweet girl.” despite being in the dark, he maneuvers you onto your back and hovers over you. his cologne envelops you and you shiver. 
“can i…. kiss you again?” san asks tentatively. he ghosts his fingers over your ribcage, making you squirm. “yes, please, san,” you respond. with your permission, he connects your lips in a surprisingly soft kiss. he lips melt with yours, finding a slow pace. his tongue drags over your bottom lip, asking for your plump lips to part.
your warm mouth welcomes san’s tongue as it pokes and prods at your inner cheek and fights with your own tongue. your hips grind up into his, searching for friction. he groans against your lips and it sounds more beautiful than any sound that’s ever come out of his guitar. 
his hands gravitate towards your hips to hold them down, keeping you from grinding anymore. “we can’t…” san whispers. “they’ll hear us.” you shake your head and pull him back down to you, kissing him more feverishly. “fuck… you make it so hard to resist you.” you whine against his lips, fighting his weight holding your hips down. “please, i need you.”
you can feel a moment of hesitation from him before he just lets himself relax into you. his hands leave your hips and you immediately grind up. his jaw falls open and you shudder at the sound that comes out of him again. 
you grab his hand and drag it under your shirt, wrapping his hand around your breast. your spine arches as he pinches your nipple between his thumb and pointer finger. “sannie-” your breath gets caught in your throat when his mouth moves to your neck and he nibbles on your skin lightly. 
“fuck, i can’t wait. let me undress you, sweet girl,” san begs you, his voice low and desperate. you tangle your fingers in his hair and nod as well as you can. his hand leaves your breast and helps his other hand to lift your shirt off you. you lift your torso up to allow for it to come off you completely. he wastes no time in allowing his own shirt to follow suit. your hands run down his chest to his abs, pressing against the muscle lightly. his hands undo the drawstrings on your sleep shorts, sliding your shorts and underwear down together. 
“off,” you mumble, clawing at his plaid pajama pants. he giggles and slides his pants down, discarding them with the rest of the clothes. he runs his hands over your bare thighs, spreading your legs gently. san’s hands run up and down your skin as he leans back down to kiss you. “condom?” he whispers and you shake your head. “no, wanna feel you.” 
san continues to kiss you as one of his hands moves down to his cock, stroking it a few times. he lines the tip up with your hole and sucks in a deep breath. he presses your thighs apart as he shoves his cock inside you, sheathing himself to the hilt. your hips stutter as your walls flutter around him. 
your jaw falls slack and san finds purchase in kissing your jawline and your throat. he pulls out to the tip before slamming back into you and you slam your hand over your mouth to keep from crying out. 
san lifts himself onto his palms to trap you between his arms. “you know what, sweet girl?” he says between thrusts, “you’re fucking mine. you hear me? mine,” his lips are right next to your ear, whispering these words into your brain. “you belong to me,” he grabs your face and forces you to face him.
“your lips? mine,” he kisses you roughly before pulling away again. “your pretty tits? mine,” he leans down to kiss your skin, leaving dark marks in the wake of his lips. “your pretty little pussy? it’s fucking mine,” san speeds up his thrusts to prove his point. your back arches and his tip jabs at the perfect gummy spot inside you. 
“fuck, you’re such a good girl. your pussy is so fucking good. so wet, so warm. you take me so fucking perfectly. my pretty girl. open your mouth for me,” you open your mouth immediately and he leans down to spit in your mouth. “swallow.” your jaw snaps shut to swallow his saliva. 
as your orgasm builds up, tears spring into your eyes. your chest heaves with tight sobs of just how fucking good it feels. “are you crying? does it feel that good, sweet girl?” you wipe your tears away messily, embarrassed that you’re even crying.
wiping your tears was pointless because when his thrusts speed up again, new tears fall immediately. “fuck, oh my god san that feels so fucking good,” you cry out, a little bit too loud. your thighs spasm as you try to close them, but san’s hips between your legs keep you wide open. 
“i’m gonna cum, i’m gonna cum, please,” your hands claw as san’s biceps, your climax being right there. “me too. where do you want it, pretty girl?” he asks, his hips becoming more and more feverish. “inside, fuck, cum inside me.” san bites his bottom lip as his thrusts become sloppier.
you wrap your arms around his torso and bring him down to you so you can dig your nails into his back. he rests his body weight on his elbows and you clench around him. “cumming,” you whisper as your back arches for a final time before stuttering back down. the intensity of your walls gushing around him finally sends san over the edge. 
the two of you just lay there completely still as ropes of cum fill up your abused hole. your legs wrap around his hips so that he won’t pull out before you want him to. “you’re so perfect. you’re so beautiful, so pretty when you cum,” he strokes your hair as he whispers in your ear again. 
“let me pull out so you can go to the bathroom and then we can sleep, okay?” you shake your head. “no. no. stay. roll over so i’m on top. lemme sleep with you inside. please. please, sannie,” you begging goes right to his head and he does exactly as you asked. with you situated on top of him, cock still inside, he pulls the blanket over the two of you. “we have to get up early to shower though, okay?” you nod.
_____________
“good morning love bugs. your throat gonna be okay to sing tonight?” yunho smirks at you and you smack san. “hey! i was the one who said they were gonna hear us!” he cries out. “at least you finally fucked,” mingi comments. 
“yeah, real fuckin good,” seonghwa comments, looking exhausted. he was in the room right next to yours. he shakes his head. “i’m sorry hwa.”
“get in the fucking van.”
Tumblr media
© lomlhwa 2024
983 notes · View notes
demigodpolls · 1 month ago
Text
calling all PJO fanfic readers!
Tumblr media Tumblr media
In the interest of acknowledging great works by fandom writers, DemigodPolls is going to share a big year-end collection of 2024 Percy Jackson fanfic recommendations! In the comment section below or on this AO3 post, leave recommendations for the best PJO fanfics you've read - but there is one major rule: they MUST have been published or last updated in 2024! No exceptions! Reblogs are turned on, but please do NOT leave your recommendations in the reblogs/tags! They will not be considered! Before commenting, make sure that you read the additional specifications below the cut first. If you have nothing to recommend, please do reblog to help support fandom writers and spread the word! Thank you!!!
Tumblr media
What we want:
strong grammar
strong writing skills
accurate/interesting depictions of PJO characters
angst/romance/drama/adventure/friendship/character studies/etc
accurately tagged stories (i.e. stories that don't surprise you with untagged triggering content)
stories written with love for the percy jackson universe and its characters
What we DON'T want:
stories that were published/last updated before 2024
stories about ships that would be age-inappropriate in canon, unless the characters are CLEARLY aged up in the story (e.g. no olympians x teenage characters, unless the younger character is explicitly an ADULT when they first meet in the fanfic)
stories that contain non-c*n, inc*st, p*dophilia
stories under 1000 words
stories that fall under "character x everyone"
stories about original characters (stories that contain some OCs in non-protagonist roles are fine, character x reader/self-inserts are fine)
stories that bash other ships/characters (i.e., don't recommend percabeth fics that bash rachel/perachel)
stories that contain non-PJO crossovers (except for RRverse crossovers, i.e. pjo + tkc is fine, toa alone is fine, tkc alone is not, pjo + harry potter is not)
stories that contain gore/extreme violence/extreme bodily harm
stories that contain cheating/infidelity (I just don't want to read those, sorry)
dialogue-only fanfics/texting-only fanfics
stories that contain W*TTG sp0ilers
Tumblr media
can I recommend multiple things?
yes! just make sure to categorize them correctly under the relevant prompts.
can I recommend my own story?
yes, but you are highly, highly encouraged to simultaneously recommend at least one other fanfic that you yourself did not write - let's spread the love! (not required)
is smut okay?
yes! but you must specify clearly that the story contains smut in your comment, and please don't use explicit/overly sexual language in your recommendation. I also reserve the right to refuse to consider stories that contain k*nks I don't want to engage with. (ab0, hardcore bd$m, parental name k*nk to name a few)
are non-english fanfics okay?
you are absolutely welcome to recommend non-english fanfics to others in the comments! but I will not be able to put them on the final recommendation list, because I only speak english and I cannot personally vet their contents, cannot observe their grammar, and could be terribly misled by a translator. I'm very sorry! however, if you would like to put together a similar recommendation collection of non-english stories, I'd be happy to promote it on this blog.
is percico okay?
someone asked about this specifically, so here's my stance: percico is a controversial pairing due to the debated inappropriateness of the canon age gap (approx. 3 years). I personally consider 3 years between minors to be juuust beyond my comfort zone (2 years), so please respect my decision to abide by my own comfortability and refuse to consider stories that feature age gaps of this size or larger involving minors. however, you can recommend percico fics where the age gap is explicitly made smaller, or fics where nico and percy are both explicitly adults! this same rule applies to any other ship in a similar circumstance - check the wiki for canon ages if you're unsure! (and to be clear, this is solely about ages, not about the individual merit of the pairing itself. respectfully - this is me drawing a boundary about what I am comfortable with, so do not argue with me on this topic).
is caleo okay?
this pair is even more controversial nowadays, so here's my stance when it comes to weird magical circumstances: within the logic of the pjo universe, some things that seem strange from a mortal perspective are standard within the books. i.e., it's not weird to date fellow demigods, even if the person you're dating is technically your aunt/uncle/cousin/etc. likewise, it's not "weird" for a teenager to date an immortalized or de-immortalized teenager, because... I genuinely don't know, that's just how the book logic works. for that reason, caleo works are accepted. we're going to apply this same logic to pairs like theyna, which could also potentially have murky circumstances (although I do consider thaluke to be especially iffy, because it heavily depends on the situation that people write them in - so if you're unsure, go ahead and submit it, and I'll use my best judgement from there). however, I cannot begin to express my extreme disinterest in discourse about immortal dating ethics - like, I would rather do anything else. not trying to be sassy here, but I'm going to ask you guys to not pick a fight about these topics, for the simple reason that I have zero interest in debating over situations that could never occur in real-life.
are incomplete/discontinued stories okay?
yes! I'd prefer stories that have at least three chapters, but this is not required. completed one-shots are also fine!
If someone already recommended a story that I like, should I vouch for it?
if you would like to, then absolutely!! you can respond to the appropriate prompt from this account in the comments, or you can reply to the person making the recommendation. just make sure to explicitly state which story you're advocating for.
Comments that do not follow these guidelines may be deleted!
Tumblr media
How to make recommendations:
There are two places in which you can make your recs! You can click here to leave them on an AO3 mirror of this post, or do so in the comment section below. If the latter, continue reading. Please leave the story name, author username, story rating, main ship, and main characters in your comments - and if you'd like, definitely add some words about why you like it! AO3 direct links are not necessary, but super appreciated. But if it's not on AO3, please ensure that you make clear where exactly I can locate the story. In the comments below, you'll see comments that you can reply to, sorted by ships/lack thereof. Please sort your recommendations by replying to them accordingly (i.e. if you want to recommend 2 solangelo fics and 1 valgrace fic, leave the 2 solangelo recs under the solangelo prompt, then do the same in the valgrace prompt). You MUST explicitly state somewhere if the fanfic contains smut. If you're not sure where to put your recommendations, make your best guess - but absolutely do NOT intentionally mis-categorize your recommendations (i.e, if the pair is not canon, do not put it in the canon pairing section. Seriously. This makes things much more difficult for me while organizing fics, and I'll probably delete your comment anyway.) Lastly, please be mature about shipping. Nothing irritates me more than fighting about percy jackson ships in 2024. If you see fanfics recommended about pairings (or characters!) that you hate, do the mature thing and just scroll past it/do not engage. Character hate and ship hate is not tolerated on this blog. I am very serious about this - if you are starting a fuss about ships/characters, your comments will be deleted and your account will be permanently blocked. Respect your fellow fandom-mates! I will do my best to moderate this comment section, but before looking through them, please understand that I am not responsible for your individual well-being, and there may be fanfic recommendations that are not appropriate for minors/might contain triggering content/etc.
Here's a little form for those of you who find this easier to use, but you don't have to use it!! However, PLEASE do include the following information in your comment regardless:
story name: author: rating: ship: main characters: additional comments (what's it about? why do you like it? etc):
Don't forget, fanfics published/last updated in 2024 only!
Thank you so, so much for participating! The collection won't be published on this blog until late December, so until then, take your time, check those bookmarks, and read new PJO fanfics! Much love to all of you ♡
- demigodpolls
(art by @viria)
(dividers by @cafekitsune)
237 notes · View notes
etanow · 4 months ago
Text
Tumblr media
MASTER POST
The Experimental Monster Laboratory, or Monster Labs, is a TADC AU where the cast is in the physical world! Sorta..
C&A Research Facilities is one of the cornerstones of the science and medical worlds! They do everything; funding research, manufacturing equipment, and research into the known and unknown in an effort to understand everything. To the public, that is.
They experiment heavily in everything, from hiring literal Gods on earth to manage the more ..sensitive divisions; mixing machine and magic, technology and the supernatural, genetic experimentation, you name it, they’ve probably done it! The world outside may not know anything of the advancements they’re researching but there is little C&A Labs won’t allow in the name of progress in understanding and cataloging everything in their universe. Our story takes place in one of the more private residencies deep in C&A, belonging to Caine; a minor God with mysterious origins, unknown limitations, and boundless enthusiasm for learning everything he can about his little science friends.
Tumblr media
╰┈➤ Content
╚═ Unnamed fic (Coming soon...) ╚═ Bubble can cook?? .
╰┈➤ Asks
╚═ Does Pomni act like a zombie? ╚═ Is Zooble's Demon Snake Leg happy? ╚═ Gangle is in a Situation.png ╚═ Gangle's temperament ╚═ Has Ragatha ever shocked anyone? ╚═ Gangle love RAAAH ╚═ Do Caine and Ragatha fight over Pomni? ╚═ Why did Gangle summon a demon? ╚═ Why does Pomni wear a bell collar? ╚═ Kinger's eye ╚═ What if there was a baby crying? ╚═ Death trauma [Gangle and Pomni] ╚═ Kinger has ONE hobby outside of Bugs ╚═ Is Zooble protective of Gangle? ╚═ What happens when you touch Pomni's brain? ╚═ JAX DATED SOMEONE?? ╚═ What does Jax do? .
╰┈➤ References
╚═ Intro Cards ╚═ Height Chart Lineup ╚═ Zooble Demon Snake Leg Intro Card /j ╚═ Queenie ╚═ Gummigoo ╚═ The Sun Room ╚═ Logo .
╰┈➤ Arts
╚═ First ML AU Post ╚═ Second, exploring outfits ╚═ Design sketches part 2 ╚═ Pomni + flower language ╚═ Showtime + Ragapom doodles ╚═ Jax not practicing lab safety ╚═ Abstragedy cuddles ╚═ Raga doodle ╚═ Ragapom doodle ╚═ Jax and Meadowsweet ╚═ Pomni staring out a fake window.png ╚═ [Gives pomni flowers] ╚═ more doodles ig
.
╰┈➤ Misc.
╚═ Caine Lemon Rant [Animatic] ╚═ Zodiac signs?? ╚═ Caine gets called a Tumblr Sexyman and cries ╚═ Bubble Looksmaxxing ╚═ Jax wants to take ketamine with you (Romantically) ╚═ Caine eats a lemon [Animatic] ╚═ BUNNYSUITSSS ╚═ Magma doodles ╚═ Magma doodles part 2
.
╰┈➤ Pomniverse
╚═ Wonderland and Zombni are friends :D
.
╰┈➤ Boundaries / Q&A
╚═ Any story plans? I'm not sure yet, currently writing a fic and several comics on the way.
╚═ Any boundaries? None, so go crazy! I am OK with gore, NSFW, angst, violence, etc, just be sure it is tagged/TW'd appropriately as not everyone is OK with that content. I'd also like to see please LOL
╚═ Can we create fanart/fics/content? Can we dub or fancam? Yes of course!! Please tag me, I'd love to see all of it! I'm tracking the tag #TADC Monster Labs AU for other's content
╚═ Is NSFW allowed? Yes, both art and fic, so long as it's marked appropriately I'd very much love to see!
╚═ Can I ship the characters, self-ships, or OC x Canon? Yes, ship away! Just be aware the only au-canon ships are Caine/Pomni, Ragatha/Pomni, Gangle/Zooble, and PAST Ragatha/Jax.
╚═ Can we make OCs? Go on ahead! Here is a PSD file for the blank template and the PNG can be found here.
╚═ Who are you?
✦✧ Hi I'm Audi! 26, she/they. Full-time office worker, I do art in my free time. ✦ My current interests are TADC, RWBY, Looney Tunes, and Trolls. ✧ I draw using a custom PC, a Huion Kamvas 16 (2.5K), and Adobe Photoshop. Currently learning to use Procreate. ✦ I do not RP and this isn't an ask blog, asks interacting directly with characters will probably not be answered. ✧ Asks are not guaranteed to be answered, sorry if yours isn't but please don't spam/send multiple times! ✦ Commissions and requests are not open at this time, thank you. ✧ My main tumblr is Audi-art. My Twitter is Hammerspaced.
366 notes · View notes