#look this is a tumblr BLOG okay. a BLOG. i can do this ^___^

[alpaca-clouds]

BG3 fans, we gotta talk CPTSD

Okay, I have spend about a week considering writing this blog, but I really gotta say, that it is something people really need to understand. See, I mostly see this issue with Astarion and his depiction in fandom. However, I would argue that it is a thing that affects literally all characters that play some sort of bigger in this entire game. Including many NPCs.

But let me start with Astarion. See, I wrote the blog two weeks ago about people being judgy on people, who do not want to have graveyard sex with him. Mostly people will argue how Astarion should be allowed to have his agency in that moment - while I argued that whoever the player is playing should have also agency in that scene. Including the agency to say "no" for whatever reason. I also included that my Tav absolutely denied Astarion, because he was not trusting that Astarion in the scene really was ready for it, for a variety of reasons. Which is very much a valid reason for someone not to want to sleep with someone else. (Literally every reason is a good reason for that, mind you.)

And obviously there came the comment, that went basically: "As someone who was raped I am very appalled by you saying that raped people cannot consent." Which is very much not what I said.

What I said was, that my Tav did not consent. Yes, he did not consent because he thought Astarion was not ready for it - but he is the one not consenting. It does not matter for this whether his assumption about Astarion is true or not. Tav does not feel comfortable in the scene, so Tav does not want sex right there.

However... If you consider the drow orgy scene, Tav is also very much right. If you do that scene after defeating Cazador, Astarion is enthusiastically consenting to that orgy, but he still ends up dissociating during the scene. (And in that scene, even if your character notices it, you cannot go "Stop!" Which I hate.)

Here is the thing. If you are in the BDSM scene, you might actually have encountered a scenario in real life where someone was enthusiastically consenting to something - only to them realize, that they were not into it at all. And people can withdraw their consent IRL at this point. Only that in this game, obviously you can't. So within the game choices I will just start out with "no" for this character.

Still, that is actually not what I mainly wanted to talk about. No.

What I wanted to talk about is the other thing. I absolutely know that for a variety of reasons a lot of SA survivors do identify with Astarion, and I do not want to take that from anyone. I think it is amazing that we got a character with whom we see this issue portrayed seriously. And let's face it. Especially in tumblr fandom circles, we will have a lot of SA survivors, because the userbase of this website is majority afab, and many are queer. And we know from statistics that queer afab people are even more likely than non-queer afab people to experience SA at some point in there life. So, yes, Astarion is going to be embraced by this community makes sense - even without his dashing looks.

But here we get to the actual meat of the issue: Astarion was not just raped. Astarion was abused in a variety of ways - some of them sexual - over the course of 200 years. He went not through a single traumatic event, but an ongoing trauma that, again, lasted for 200 years.

Or to put different: Astarion does not have PTSD. He has C-PTSD. Complex trauma. The kind of trauma that develops when the trauma lasts over a long, long time, without the survivor getting a chance to ever really properly ever relax. Something that was very true for Astarion's time under Cazador. He was under constant threat of rape, torture, and other forms of violence.

While CPTSD is a form of PTSD, it has some differing symptoms - and additional symptoms from plain old PTSD.

I found this graphic on this blog here, and found it fairly good in the depictions. (If you google CPTSD you will find several graphics like this.) It shows very well the additional symptoms, compared to normal trauma.

Generally speaking, CPTSD brings a lot stronger issues with self-worth, interpersonal problems, and emotional regulation. CPTSD folks are often prone to emotional outbursts (this graphic names anger, but technically it can be all other kinds of emotional outbursts - which is why at times CPTSD gets confused with BPD).

And Astarion is written like this. He shows very much all the symptoms of CPTSD. And let's be honest: That is an issue he will have to deal with for a long, long while.

But... As I said, the same is actually true for pretty much all the characters.

If you look at the companions, it is obvious.

Gale spent at least a year in constant fear of blowing up. While Mystra's abusiveness towards him within the relationship prior the orb is more fanon than canon (though the relationship was defnitely not an easy one), the "one year in constant fear of death" is very likely going to instill some form of CPTSD in him.

Karlach was a slave for 10 years, forced to fight in the hells. While she will also probably suffer from certain forms of PTSD more common in soldiers. Additionally I would argue that she also has some CPTSD from tiefling-racism. While she does not bring it up often... She does seem to have a thing there.

With Wyll it is a bit more complicated. Yes, for him I would see the kind of CPTSD I have - parental abuse related. Ulder was not openly abusive, but neither was my mother, and guess what fucked me most up in my childhood, despite experiencing some really bad violence elsewhere.

Shadowheart was abused by Viconia and midwashed and tortured and was forced to kill her fucking pet mouse. Bonus points that a lot of it happened during her childhood. She very much is gonna suffer the consequences.

Lae'zel... Do I really need to say something about her upbringing among the Gith?

Then we have Halsin. We know fairly little about his background, given that he is very coy in talking about it. But his "three years as a drow slave" definitely make it likely that he has developed some form of CPTSD.

And then we have Jaheira and Minsc. For whom just the... Well, look folks, the adventuring lifestyle would logically also leave you with CPTSD of some sort.

Even if you play a Tav who entered the game after having a very untraumatic life... They will spent what has to be at least two months with a tadpole in their head threatening to kill them - while half of Baldur's Gate is trying to do the same. They'll have PTSD after this at the very least, if not CPTSD. (Even though, let's face it, chances are we all gave our Tavs more than enough background trauma to go along with it, right?)

And same goes for so many other characters. The tiefling refugees. Our main villains (especially Gortash and Orin). Cazador. The other vampire spawn (duh). The list goes on.

So, what am I trying to say here?

Well, for once I just want to make sure folks understand that CPTSD is a thing that exists and while being similar to normal PTSD differs in some points. Including the fact that people with CPTSD have a high likelihood to make very rash decisions driven by instable emotional states, that might be harmful to them on the long run.

And mind you. In real life most people with CPTSD have it because either they were bullied for a long time, or were in an abusive relationship of some sort. (Abusive parents, abusive partners, abusive friends/roommates.) But even in those heightened scenarios the game represents for the most part - the issues are gonna be still mainly the same.

[oc-challenges]

WELCOME TO OC HALLOWEEN CHALLENGE 2O24!

SMILE because it's time for the annual oc halloween challenge! We will see the evil, hear the evil, and speak the evil with these spooky challenges brought to you by @aliverse, @astarionbae, @endless-oc-creations, and @come-along-pond!

If this is your first time, here's the lowdown; This is an event that takes place over the 31 days of October and presents oc creators with Halloween-themed challenges to encourage creativity, foster community, and have fun! Some of these have guidelines/suggestions, but this is very much a free-for-all so you can ignore them if they don't fit with your interpretations.

RULES

DO NOT copy others edits.

If you are doing crossovers, PLEASE make sure that the creator of the other oc is okay with crossovers.

If you want your post to be reblogged onto this blog, it must contain the hashtag ohc2024.

Feel free to ask questions, I promise I’m more treat than trick.

Everything is up to the creators interpretation, although I have tried to include some examples for help!

Have fun!

Day One: Godly Parent

Whether Greek, Roman, Norse, Egyptian, or any other; What "God" could have created your oc?

Day Two: Mystical Communication

There are tons of ways we think we can communicate with those beyond our realm such as Tarot Cards, Oujia Boards, Prayer, EMFs, or even through other people with otherworldly powers. Which method would your oc use? Or maybe they are the communication tool?

Day Three: Merch/Memorabilia

When we really love something, we want a piece of it with us. What merch would people buy of your ocs? Ex. Dolls (like funkos or Barbie crossovers), Clothes (like shirts or sweatshirts), Buttons/Patches, Dishware (like cups or plates), trading cards, posters, or even spin-off books of the show they star in.

Day Four: If They Were Canon AU

You could create an actor oc who plays your character or even make edits about how you think your ocs faceclaim would promote/interpret their character and get along with fellow cast members.

Day Five: Social Media AU

Within their canon, what would your ocs Instagram, Twitter, TikTok, Facebook, Tumblr, Snapchat, and/or YouTube look like?

Day Six: Role Swap AU

Give your oc a role in their story that is different than the one they already have. Whether this is making a hero a villain or vice versa, your victim a survivor or vice versa, or anything else you can think of.

Day Seven: Butterfly Effect

One choice could change the trajectory of our lives or any game we play. Show us the effects of your oc making the wrong choice when they originally made the right choice, befriending someone they originally hated, or even just missing their alarm.

Day Eight: Multiverse

Maybe you have multiple ocs with the same faceclaim, maybe you have a friend(s) who have ocs with the same faceclaim that you've wanted to do a crossover with, or maybe you want your oc to meet some of the actual characters their faceclaim has played. No matter what it is, it's time for your ocs to meet their multiverse counterparts!

Day Nine: Literature AU

Put your oc into an alternate universe based off a book you enjoy whether it be a classic or a newer one, no matter the genre.

Day Ten: Dungeons & Dragons AU

Have your ocs play DND, make an au based off a classic DND campaign, or just tell us the stats of your oc in DND terms.

Day Eleven: Ghost AU

Sometimes when we die, we don't leave. Tell us the unfinished business that keeps your ocs ghost on Earth, who your oc would haunt, how they would haunt, or anything else related to your oc being a ghost!

Day Twelve: Supernatural AU

Make your human oc a supernatural creature or your supernatural oc a different supernatural character.

Day Thirteen: Video Game AU

Show us some of what your story would look like as a video game or put your ocs into your favorite game.

Day Fourteen: Musical AU

The doctor said I couldn't talk, he didn't say I couldn't siiinnnggg! Put your oc into your favorite musical such as Hamilton or Mean Girls, or come up with some original lyrics to show what you think your story would look like if it were written as a musical.

Day Fifteen: Nostalgia

Take the books, shows, or movies you enjoyed as a child and put your oc into them! Or, show us what your oc enjoyed as a child.

Day Sixteen: Fairytale AU

One of the most classics of classics. Make your oc a character in your favorite fairytale, whether you prefer the Grimm or Disney version, or make up a fairytale about your oc!

Day Seventeen: Being is Believing

For day seventeen, think about superstitions, urban legends, or folklore and either make your oc a part of them, make your oc experience them, or tell us which ones your oc believes.

Day Eighteen: Beloved Pet or Object Turned Human

It's not unusual for someone to grow an emotional attatchment to an animal or an inanimate object. What would your ocs beloved pet or object say if they turned human and could speak your ocs langauge?

Day Nineteen: Genre Switch

Whatever the genre of your story is, swap it with another one. Maybe your romance story is now a horror story, your comedy is now a tragedy, or your historical realism story is now future sci-fi.

Day Twenty: Darkest After Dawn

Things can go so right for so long and then suddenly so wrong. Show us what happens when something rains on your ocs parade, when a perfect day turns into a horrible night, or a dream vacation turns into a nightmare trap.

Day Twenty-One: Apocalypse AU

Put your oc into an alternate universe that's been thrust into an apocalypse whether that be because of zombies, aliens, radiation, or the Earth trying to reclaim its land.

Day Twenty-Two: Time Problems

Let's play with time for this challenge. Picture your story as if it has always taken place in a different time, throw your oc into a time loop, or have them somehow travel through time.

Day Twenty-Three: Horrorify A Song

Take your favorite Halloween song and tell it's story, or even take a perfectly innocent song and give it a horrifying meaning! Both using your ocs, obviously.

Day Twenty-Four: What's Your Favorite Scary Movie?

It wouldn't be Halloween without some good scary movies. Put your ocs into one of your favorite scary movies!

Day Twenty-Five: Horror Location

This is an easier throwback to one of the week long challenges we've done for this event. Make something that tells a horror story of your oc at a certain location such as a Hospital/Asylum, Summer Camp, Place of Worship, Cemetery/Tomb, House/Apartment, Hotel/Cabin, or Farm/Ranch.

Day Twenty-Six: Horror Subgenres

Another throwback to a week long challenge we've done for this event. Make something that tells a horror story of your oc within a horror subgenre such as extraterrestrial, apocalypse, monster, time loop, isolation, time loop, cult, doppleganger, or anything else you can think of.

Day Twenty-Seven: Horror Archetypes

Which horror character tropes do your ocs embody? The Final Girl or The Killer? The Accomplice or The Harmless Antagonist? The Harbinger or The Nonbeliever? The Comedic Relief or The Hysteric Annoyance?

Day Twenty-Eight: Solo Costume

Show us what your oc would dress up as for Halloween! Would they dress sexy? Scary? Lazy? Practical?

Day Twenty-Nine: Couples Costume

Show us what matching costume your oc and their love interest would wear! Peanut Butter & Jelly? Morticia & Gomez? Bert & Ernie?

Day Thirty: Group Costume

Show us what costumes your oc and their friend group would coordinate. Are they the Scooby Gang? The Wiggles? Mario Party Characters?

Day Thirty-One: Here's A Treat!

The Halloween potluck isn't happening this year but we still want to encourage interaction and giving. So, choose someone to give a treat! This could be an ask, an edit, some writing, or even a playlist.

[astrxealis]

looking forward to this wednesday nov 23 a LOT for so many reasons oh my god. so seniors in business strand are all having their lil shops and stuff and so i pre-ordered some cute jewelry (matching bracelets w my besties !! and then crystal jewelry, rose quartz aaa) and there's gna be more that'll be there then ofc, some are not anymore tho bcs only pre-orders </3 ANYWAYS. FUTA 2ND TRIAL MV. NEW SONG PREVIEW SOUNDS SO COOL and SALAMANDER COVER !!! futa my fav (real) and his va is amazing at singing fr. also it's uhh hannah montana the character's birthday and one of my best friends is super into that and got us into it too so i'm into it (again & properly now! was kinda into it as a kid ofc) so we're going to watch a lot of stuff then methinks <33

[gremlinhourz]

i hate tumblrmart i hate tumblr live i hate the tumblr app put the blog tab and search tab back where they are supposed to be

[necrotic-nephilim]

i love your fics and the ideas you describe for the ask games. i'm especially fond of your takes on the rarer pairings and i always smile when i see your posts in the ship tags <3

and don't stress too much about not posting anything, real life is important and participating in fandom should be fun, not something you have to force yourself to do. god knows fandom burnout is real, especially if you feel like people are expecting something from you. just keep doing what makes you happy :)

ghgfhgjhkjhjhg this was so sweet, thank you so much! i *love* talking about rarer rarepairs, especially if it gets other people to ship them too. the popular ships are fun and all, but i truly love spreading rarepair propaganda.

that's very reassuring, thank you <3 i've loved everything i posted here so far and have not felt pushed to post anything i haven't enjoyed, but sometimes i forget i can like. use this blog for whatever i want and not *just* headcanons/fics/mets/etc lol. and i also forget i don't have to rush myself. it's annoying to want to write and either not have time or not have the words work. i used to run a fandom blog in my teens that got very large and felt like a chore and i was so stressed about the need to perform and the numbers and all of that. like if a fic didn't do well i saw it as a personal failing and forced myself to write popular headcanons just for the numbers game. was not fun or sustainable in the long run and i think it contributed to me no longer having any taste for the ship i primarily wrote for. so for too long i treated existing in fandom like a job lol. i've mostly gotten it through to myself that this is a space for me, but i occasionally forget when i'm so caught up in all the things i want to get to for this blog. my to-write list is a mile long and i need to be bonked with a paper towel roll, i think. so it's very kind of you to say this bc the reminder is nice <3

[budugaapologist]

tbh liking hien on tumblr feels like liking edward again :/

[istherewifiinhell]

[Blearily awake from critical fell asleep on couch incident] anyway i think ppl will always partially loose me in anything with regards to self care and amelioration if you do not acknowledge a persons inalienable right to hurt themselves and get worse.

[happypeachsludgeflower]

@staff i suggest that year in review should include a personal analysis section in our settings.

Like how many people unfollowed me? How many times was I blocked? I need to know how many people I successfully pissed off without trying, okay??

this is vital information.

[weezerlvr228]

Hello!!! I want to talk about weezer but im too shy! I wish i had more weezer friends

AWW ANON NO WORRIES!!! i was like that too!! best thing ive found is to just comment + interact w weezer fans on tiktok, like maladroitlover579 is super duper nice! :D people r very very nice on tiktok , but of course u could always dm me and we can talk abt weezer all you’d like !

[nomairuins]

i am okay tho i just have momeys sometimrs . please do not ever worry abt me guys

[jimingyue]

Cat Tumblr Dashboard Simulator

🖋️ meowful-musings Follow

🕊️ birdwatching Follow

what's wrong with dry food??? my humans feed me it all the time and i think it's fine

💀 elusivehider-deactivated948204

op wheres the natural feeding option

🌲 outdoorsy Follow

you guys are getting fed?

#im a barn cat so maybe im missing something here #meowtthew don't look

7,192 notes

☀️ pawsitive-affurmations Follow

ITS OKAY TO BE A MOGGIE

ITS OKAY TO BE A MOGGIE

YOU ARE NOT LESS VALID IF YOU ARE NOT A SPECIFIC PEDIGREE!!!!!

☀️ pawsitive-affurmations Follow

extra special shout out to cats who have "common" coat colors. grey tabbies and black cats i am rubbing against your head affectionately <3

🪤 m0usetrap01 Follow

as a grey tabby i really needed to hear this :"3

#i feel like i never see positivity posts for moggies even tho we're the most common type of cat....

154,688 notes

🎵 rage-against-the-meowchine Follow

i cant believe there are cats ACTUALLY advocating for kittens to be separated from their mothers before 12 weeks??? kittens still need to learn how to interact with other cats before being placed into their furever home omg you guys know you're advocating for undersocialized and aggressive cats right

❤️ loving-paws284 Follow

um op some of us??? matured early??????? i was separated from my mother at 7 weeks and i turned out fine... interesting how you assume that kittens being separated from their mothers at a younger age will lead to the degeneracy of the next generation...hmm i wonder where i've heard that before...

🐈 fluffy-the-cat Follow

OP got bit too hard during a play-fight as a kitten and it shows XD

🐟 tunafeesh Follow

also op have you ever considered that just because somecat is kind of scared and unable to deal with strange cats or humans, it doesn't mean they don't deserve to be adopted?? you sound like a vet psyop honestly

🎵 rage-against-the-meowchine Follow

oh meow god saying that kittens should be fully weaned before leaving their mother is NOT veterinarian rhetoric and i never said that they deserve to be euthanized!!! my mother literally died when i was 3 weeks old and it seriously messed up my development so stop putting words in my mouth, thanks

anyway friendly reminder that underweaned kittens are prone to illness and often struggle with basic cat behaviors like litterbox usage, and in some nyavinces it's even considered kitten abuse

#discourse #cant believe "kitten abuse is bad" is controversial now

32,456 notes

🍃 naturalliving Follow

BORN TO DIE

WORLD IS A FUCK

猫神 Kill Em All 1989

I am trash cat

410,757,864,530 DEAD BIRDS

#outdoorliving #outdoorcats please interact #outdoorcat friendly

48,971 notes

🎣 salmonpurina Follow

can't believe cats are uncritically reblogging that born to die world is a fuck post. i know it's funny but op is literally an outdoor cat truther

#like cmon now you just have to go to their blog #lulu speaks

34 notes

💀 tabbystripes-deactivated098712

gentle reminder that pushing cups off the table is not cute and can cause a lot of distress in your human!!!! gentle reminder that our teeth and claws can easily hurt them more than they can hurt us!!!!

🐰 evil-tabbystripes Follow

evil reminder that the cup should always be pushed off the table. evil reminder that you should always bite and claw at your human no matter what. you can do whatever you want forever

💀 tabbystripes-deactivated098712

make your own pawst

💀 laser-point-deactivated8574721

umm i know a tomcat who did that and his human ended up putting him down so...

👬🏻 nyasunaruenjoyer Follow

Nyaverage shelter cat behavior

#not nyaruto #re-nyab #pickles shut up

545,460 notes

🌈 nyaoi-warrior Follow

saw two male cats sleeping together on the porch today. homeow behavior imo

💡 discourse-meows Follow

hey um what the fuck??? it's really not okay of you to go assuming other cat's sexualities, especially cats you don't even know???? as a queer cat i'm VERYY uncomfortable. real-ass cats didn't consent to your nyaoi fetish, thanks

🌈 nyaoi-warrior Follow

1. i was making. a joak

2. i'm literally gay???

#literally what's your pawblem

7 notes

🎩 amazingcatshow12 Follow

reblog if you've ever caught the laser pointer

🎩 amazingcatshow12 Follow

i know you fuckers are lying

🍭 gaykittens Follow

this tom hasn't caught the laser pointer

🎩 amazingcatshow12 Follow

shut the heull up

988,653 notes

🐾 b-e-a-n-t-o-e-s Follow

grey toebeans >>>>>>>>> pink toebeans and don't let the haters make you believe otherwise

🐁 ladymouser Follow

op shut the fuck up ALL toebeans are beautiful!!! just bc you're miserable and insecure doesn't mean you can bring others down based on things they can't control

🐾 b-e-a-n-t-o-e-s Follow

oh so the cat-human separationist wants to preach to us

[brazen-art]

Chiropractors near you:

(continue your art journey today by looking at this cool murkrow that my friend drew!)

[lovewithoutresin]

.

[fingertipsmp3]

Also forgot to mention a guy in my class today said that blogging is narcissistic. I just sat there like 🫠

[mwagneto]

hungarian/nomadic magyar tumblr circa 998AD dashboard simulator

🏞️ vándor-ló-979 Follow

not yall still spreading emese's foundation myth??? she literally claims she fucked a bird????? like either she's lying or she cheated and she's trying to cover it up or well. i dont even want to consider the third option

🪺 magánügyek Follow

tengri forbid women do anything???

735 notes

🦅 szél-könnyű-szárnyán-szállj Follow

okay im sick of the discourse let's do this.

8,572 notes

🐎 istván-rovására Follow

that took so long lmao -> !!!!!!!∧◇ᛏ⋈∧

481 notes

🐴 csillagösvény Follow

i'm so serious rn if you support """istván""" in any way just unfollow and block me. we do NOT need him or his dumbass god and what he's been doing to our people to spread his religion is shameful.

🐴 csillagösvény Follow

btw we all know your real name is vajk stop larping as a christian it's EMBARRASSINGGGG

✝️ esztergom-örökké Follow

love seeing my mutuals reblogging this /s anyway op has multiple posts on their blog supporting quartering and human sacrifice. in case you were wondering. anyway stand with István

🐴 csillagösvény Follow

1) we dont even do human sacrifices, are you fucking stupid??? show me ONE post where i talk about that. 2) are you seriously forgetting that your bestie istván LITERALLY QUARTERED HIS UNCLE?????

#sorry to put this dumbass on the dash😭 dont even engage just block them #ur not making it up the tree of life lmao #discourse

3,264 notes

🌅 bolygó-kárpáti Follow

friendly reminder that just because you're white passing doesn't mean you're not a real magyar!! people with mixed parents are just as valid <3

🏇 attila-népe Follow

cranky coz ur ancestors decided to mix with the europeans arent you

🧺 lemezelő Follow

isnt your girlfriend literally frankish????

🏇 attila-népe Follow

you had to have done some serious stalking to find that💀 and first of all i didn't have a choice, my parents picked the tribe, and second of all she's not my "girlfriend" i got her via ritual kidnapping (WITH consent. before anyone gets weird)

🌐 a-kiber-kovács Follow

Couldn't you have kidnapped another magyar woman? Or someone from another mongoloid tribe?

🔅 hadúrsimp Follow

ohh sure so now human pet guy is gonna chime in to advocate for the kidnapping of our women while being lowkey racist. what are you even doing on nomadblr????

🌅 bolygó-kárpáti Follow

what the fuck happened to my post

19,276 notes

🪔 rakabonciás Follow

for the nth time, you're only a true shaman if you were born with teeth OR with extra fingers OR in the sac. the rest of you are faking & we can tell.

🦅szél-könnyű-szárnyán-szállj Follow

okay people keep spreading this but this is literally just wrong?? like congrats on the 6 fingers op im glad u and Little Golden Father have a special connection (genuinely) but like. táltos and sámán and mágus and garabonciás and javas etc are all different things with completely different requirements and life paths which you should definitely know if you're claiming to be one?? especially since your post says shaman but you're listing the criteria for a táltos, and your username looks like a play on garabonciás so. which is it🤔 maybe get your facts in order before trying to gatekeep

anyway don't listen to op!! your connection to the Upper World is yours alone and you're the best judge of what the Fathers and Mothers want your path in life to be!!

646 notes

🛐 mea-culpa Follow

It breaks my heart that the majority of my people still refuse to see the One True God and insist on sticking to their pagan spirits. I fear that when judgement day comes, we will all be wiped out thanks to their foul godless ways.

🐴 csillagösvény Follow

how tf am i godless when i literally have dozens of gods? little mothers and little fathers are in everything all around us & it must suck ass to live in a world where you're not surrounded by the small gods that inhabit everything. manifesting that the fene and the guta tag team beat your ass tonight

🔅 hadúrsimp Follow

hadúr will literally strike op down personally. he told me himself. whispered it to me sweetly even

🐴 csillagösvény Follow

while i agree with you, i feel like you might also have ulterior motives, nomadblr user hadúrsimp

#but live your truth! doubly so on the posts of these freak repressed bible lovers. meanwhile on the #COOL side of magyarhood we walk around butt ass naked!!! op have fun never experiencing joy ever again tho #discourse

198 notes

👑 sanctus-stephanus Follow

posting from an alt so i don't get cancelled but lowkey i'm starting to think koppány was right.... maybe this christianity thing isn't gonna work out after all

👑 sanctus-stephanus Follow

WRONG BLOG

👑 sanctus-stephanus Follow

THIS WAS A JOKE. IGNORE THIS

🪺 magánügyek Follow

ISTVÁN????????????? 💀

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.