#one foot beep

[nicothedestroyer]

Hop

[pronounrespector]

Can I say something

[dailyeca]

why dont u like cars eca

what's there to like about em.

[endlessthxxghts]

Biology

“Uncle”!Joel Miller x afab!reader | w/c: 5.4k

Summary: Joel hurt his back at work, so you've been helping him around the house until he heals.

Content/Warnings: able-bodied, female sex anatomy, and inherently fem!reader. No description of reader, everything is neutral (ex. “your bottoms,” “the curve of you” — nothing is specific in the way “you” are described). Age gap (reader early 20s, Joel in 50s). EXPLICIT MATERIAL PRESENT. HEED THE WARNINGS. WEIRD boundaries are crossed…you're not blood-related to Joel, but you were raised like you were. You call him “uncle.” Pet names (baby, darlin’, sweetheart, etc.). Pussy pronouns (she). Innocent touches until it isn't. Sexual tension galore. Slight dub-con. Icky Joel. Icky reader. Pussy grinding. Dirty talk. Slight degradation (“bitch” is used only once). Multiple orgasms. P in V unprotected. Reader is on top. Lots of teasing about the nature of yours and Joel’s relationship. If there’s anything that should be up here but I missed or I made any improper tags, please let me know!

A/N: Hi, my loves! This is slightly different than what you’re used to coming from me… All I can say is, you’ve read the warnings! Don’t bite if it is not your flavor! But for those who do like, I really hope you enjoy! And to my love @strang3lov3, thank you for prompting this and encouraging this side of my brain to finally stop hiding in the shadows. And thank you for your eyes on this and the mood board as well. I love you.🩶

masterlist | notifs blog

“Hey, hon, when you headin’ over to uncle Joel’s?”

You glance at the timer on the oven. “In about ten minutes after these cookies cool. Need something from me?”

“Can ya grab my toolbox before ya leave? Forgot it there the other day,” he replies. “Figured you could get it since you’re already goin’ there today.”

“Sure thing. It’s not the heavy one, is it? Because I don’t know if that old man’s back is ready for a heavy lift like that yet.” The timer on the oven beeps. You slide on your oven mitts to pull the tray out. “Made two batches by the way. How many you want? I’m taking some to Uncle’s, too.” 

About a week ago, Joel had a contracting accident. Some newbie wasn’t watching the older man’s back as Joel climbed up a wobbly ladder, and the next moment, Joel’s footing slipped. He landed right on his lower back, a piece of wood perched on the ground, sitting at just the right spot on the floor to render him immobile. Tommy, Joel’s younger brother, and your father, his best friend since before you were born, are the only two Joel trusts to get the job done perfectly, so Joel put them two in charge until he heals. 

Bed rest, the doctor had ordered Joel, for at least three weeks. It’s been one so far, but with you offering to be his nurse — one that forces him to stay in bed unless he needs to eat or use the restroom — he thinks he just might be back to work by next week. If you’ll let him, that is. 

“No, it’s the small one, hon, you got it,” your father reassures you. He lovingly slaps his growing belly as the trays hit the kitchen counter. “Y’know, darlin’, ever since you moved back, I’ve been gainin’ some weight. Can’t imagine what you’re doin’ t’ Joel over there.”

Your lip pulls up in a smirk. “Joel is in good hands, y’know. And technically, I don’t have to leave you any,” you say with a challenging brow, pulling the cookie trays out of his reach. 

“No, no, I’m not sayin’ that,” your father’s eyebrows raise in worry. His daily cookie is very important to him. “You can leave me like… five… or six.” 

“I’m just gonna leave you a whole batch. The six are gonna be gone before I even leave the house,” you tell your father as his hand subconsciously reaches for the cookie tray. 

He scoffs, “Ya have no faith in me.”

“So what’s in your hand already?”

“Whatever,” he mumbles, walking away with a mouthful of warm cookie dough and melted milk chocolate chips. 

“Uh huh,” you yell back. “Gonna be leaving in just a sec. I’ll see you later.”

It takes less than ten minutes to get to your uncle’s house. You unlock the door using the spare key he gave you as a teenager, and immediately, nurse mode is activated. 

“Uncle Joel!” You yell, exasperated. He turns around from his place in the kitchen, painfully slow. He’s going to make his back worse. “What do you think you’re doing?” You place the fresh cookies on his dining table along with your keys. You cross your arms angrily for good measure. 

“My coffee’s cold. I was warmin’ it up,” he huffs, annoyed.

“Bed, please.” Your hands find his waist, and you guide him back to his room. “You know I’m here around this time. You didn’t wanna call me first to see where I was?”

You ease him in a sitting position at the edge of his bed. He grunts as his ass meets the mattress. He grumbles his response. “Need to start gettin’ back to everythin’ independently, y’know that, don’tcha?”

“Is your memory going with your back, too, unc?” 

“‘Scuse me?” He looks at you incredulously. 

“Three weeks were the doctor’s orders. Not one,” you tell him, putting your foot down. 

He lays himself down with another wince at the motion, no acknowledgement to your words. God, he’s so stubborn. 

“I’ll go make you a fresh cup,” you tell him, feeling sympathetic for the man. His work is his life, and it’s not going to get any easier with age. 

Making your way back to his kitchen, you wash out the coffee pitcher, replace the grounds and the filter, and do some light cleaning as you wait for the bitter, brown liquid to brew. 

It’s only been five minutes since you returned to the kitchen, and the painful moans and groans from his bedroom have only gotten louder. You search around the place and find the heat pack you bought a few days ago and pop it in the microwave. You grab some pain meds, fill up a glass of water, and just in time, the microwave sings to you, telling you your contents are ready. 

Ignoring the coffee for a moment, you make your way back to Joel’s bedroom. His eyes are closed, but his entire body is tensed up in pain. Poor guy. You knock at his door to catch his attention before entering. “Unc?”

One eye peels open. “Yes, nurse?”

“Funny.” A sarcastic laugh leaves your throat. “Come take these.”

He makes no move to get up. 

You set the painkillers and the water on his bedside table, the heat pack wedged underneath your armpit. You start to reach for Joel to help him up, but he stops you. “I got it,” he grunts. You let him have this win. 

You hand him the glass of water first, then the pills. He swallows the painkillers in one big gulp, swallowing down the rest of the water in another. He eyes the heat pack in your arm. 

“Do you want-”

“Yes,” he says immediately, reaching for the soft warmth. 

“Lay down first, I’ll put it underneath you.”

Without another word, he positions himself. His body jerks when your soft hand slips underneath his back, pushing him to lift a little while you slide the heat underneath. “This okay?”

“Mhm,” he forces out, eyes clamped shut. It’s not okay, you think. 

“How would you feel on your stomach?” you suggest. 

“Dunno. Never tried.”

“Well, then.” You set the heat pack down, and it’s your turn to crawl, uninvited, into his bed. You walk on your knees towards the opposite, unoccupied side, adjusting the pillows in a way you think might be the most comfortable. This isn’t your first rodeo dealing with an old man’s back; you’ve got your dad. This is, however, your first rodeo dealing with an old man more stubborn than a screaming goat not getting his way. “Come on.”

“No.” 

“What do you mean no?” 

“That ain’t gonna be comfortable.”

“How do you know?”

“I jus’ do.”

You pinch the bridge of your nose and take a deep breath. “I swear to God. I will flip your ass over myself if I have to.”

“You’re bossy,” he spits.

“So you’ve said.” 

Not giving him a chance to prepare, you hook your one hand at his side and your other on his hip, and you pull him towards you. It doesn’t fully flip him over, but it does the trick in getting him to finish the rest of the action himself — albeit, with a very strained yelp from the back of his throat. 

He groans for a few minutes more as you adjust some flat pillows underneath his belly and then prop the lukewarm heating back right at the base of his spine. You’ll probably have to heat it up in ten minutes again, but it’ll do for now. You stay in your spot for a minute, and already his pained noises begin to subside. 

“Better?” You know it is. You just want him to admit it. 

And when a single huff with zero protests from the grumpy man reverberates around the room, you know you’ve won this round. 

“I’ll go get your coffee now,” you hum. 

A soft rasp of your name has you spinning back around as you reach the room’s threshold. 

“Hm?”

“Thanks,” he tells you. 

“It’s what I’m here for, unc.”

You put his fresh cup of coffee in a thermos this time. You can’t imagine how often he’ll get up being in this position, but at least the freshness will be there with every sip he does end up taking. 

“How’s it going?” You ask him as you set his coffee nearby. You feel the heat pack on his spine, and it’s as you called it to be by now: room temperature. “Want me to reheat it?” 

“‘M okay,” he replies, voice groggy. He must’ve fallen asleep. 

“Okay.” You stand there for a moment. You can tell the heat helped, but his body isn’t entirely relaxed. He’s still tense, as if a nerve or something is being pinched. 

You recall your memory from a while ago before you moved back with your dad. Your brother, who is a mixed martial arts athlete, had a sparring session that hurt his back, nearly in the same area as Joel. He had you running his massage gun over his muscles nearly every night for a month straight. “It needs to uncoil somehow,” he told you. An idea crosses your mind then. 

You saunter to Joel’s en suite bathroom in search of some type of lubricant. Sitting loud and proud on the center of the bathroom counter is a little bottle of Equate’s Personal Liquid Lubricant. Your brain falters for a second, the bottle of lube throwing you off your original plan. That is absolutely not the kind of lubricant you were looking for. Shaking away the image from your mind, you bend down to look in the cabinets underneath. Bingo, a bottle of Aveeno body lotion. This should do. 

You invite yourself onto his bed for the second time today. “Let me give you a massage.”

“What?” His head turns to you now, utterly confused. He definitely heard you wrong, he thinks. 

“Let me give you a massage,” you repeat. “It’ll help.”

A massage actually does sound nice right now. But you’ve been nothing but bossy this last week while Joel lays here helplessly. He’s bored. And he’s had enough. “It ain’t gonna help.”

“How do you know?”

“I jus’ do.”

Jesus. Haven’t you had this conversation before? You mentally slap your forehead. Again, leaving him no other options, you reach for his flannel atop his shoulders and begin to pull them down. 

“Hey, hey, wait, now what in the hell-” He tries to stifle back a laugh as he wriggles in your hold, trying to playfully push you off without hurting himself more in the process. 

You quickly release his clothes, hands up in surrender where he can see them. You’re just realizing now just how forward your action must’ve been. “How am I gonna massage you-” 

The embarrassment written all over your face has Joel tearing up as he tries to hold his wheezing laugh in. With his eyebrow quirked at you, he responds, “If you wanted me naked, kiddo-”

“Jesus, ew! Really?” An unbearable heat spreads across your cheeks. Your eyes are downcast, looking everywhere else but him. “It- it’ll be better if I can directly touch-”

Only then do you feel the bed shaking with his laughter. He’s fucking with you. And here you were, about to offer something that would relieve a whole lot of pain. “Oh, fuck you,” you scoff, pulling yourself up and making your way off of his bed. 

“No, okay, wait,” he laughs, trying to catch his breath. “Jus’ messin’ with you, who am I to deny a massage?” He raises his eyebrows once, twice. Still messing with you, seeing how far his taunting with you can go. 

“You’re disgusting,” you deadpan. 

“‘M not the one tryin’ t’ massage her uncle,” Joel says as he attempts to shrug his shoulders at you.

“I’m gonna leave now.” One foot makes it to the ground before Joel speaks again. 

“Oh, for Christ’s sake, ya can’t take a joke? I’m only messin’ around. Come back. Gonna leave me hangin’? In pain? C’mon, nurse.” His tone falls softer, sweeter. You can hear the shit-eating grin in his words. And, fuck, why is it making you heat even further, in places beyond your face? In places you shouldn’t be?

“Fine,” you relent. “Stop saying weird shit then.” You still can’t look at him. Not after the way your body decided to react in the shift of energy. An abrupt shift of energy, as far as you can tell. 

He’s your dad’s best friend. Your uncle, for crying out loud. Not by blood, but still. There’s never been a feeling beyond that. Sure, you’ve had your silly little school girl crush on him during your young teenage years, but that was your hormones being your hormones. You grew out of them. Even your own father can’t deny the conventional attractiveness of his best friend. 

Plus, suggestive commentary is bound to make anyone feel hot. It’s basic biology. Your response is nothing. It doesn’t mean anything. At least, that’s what you convince yourself of when you climb back into your uncle’s— no, into Joel’s bed, trying to ignore the way your panties stick dutifully against your throbbing core.

Joel leans onto his side as you get yourself situated, unbuttoning the bottom half of his flannel, so you can flip up the bottom to reach his lower back. After the bottom half of the buttons are undone, he lays back on his front. “Here,” he calls your name. “Jus’ lift it up from the bottom.”

You scoot closer to him, standing on your knees, and you reach over to grab the hem of his flannel, pulling it up as gently as possible, exposing just enough to be able to reach the irritated areas. You frown at what you see. Inflamed skin, purples and yellows dancing all across his lower back, forcing him away from the very thing he lives for. He may have been a stubborn bitch this entire week, but that doesn’t stop the sympathy you feel for the man. 

You put some of the lotion in your hand, rubbing it between your two palms to warm it up a little. You place your hand on the side closest to you first, moving in circular motions and adjusting your pressure ever so often. “Let me know when the pressure is good.”

So far he hasn’t said much, a slight groan here, an exhale there. You feel a knot as you move lower, so you increase your pressure. You’re met with a literal moan, and you swear you have to bite back your own vocal response. “Fuck,” he sucks in a sharp breath. “Yeah, jus’ like that, ‘s perfect, darlin’.” 

“Okay,” you squeak, your thighs clenching together to attempt any kind of relief to the heat between your legs. 

After a few more passes over the area — and a few more indulgent, harder presses of your palm to pull more angelic sounds from him — you switch to the other side. Except, at this angle, you don’t really have as good an angle as you did before. Your leg swings over his ass, bracketing him in between your thighs, before you can even register the move your body just made. A soft gasp falls from your lips as you feel the new angle you’ve just given yourself. 

“Joel?” You call sweetly. Innocently.”I- I’m not hurting you or anything, am I?”

Hurting? No. Putting him through Hell? Close enough. 

Joel has done many questionable things in his lifetime. Getting involved with taken (married or otherwise) women, couples who wanted a third… Joel has lived through it all. Mainly in his younger years, but nevertheless. He has done and seen many things. But none of these things have ever included getting a fucking hard on for a girl — a woman? — he practically had a hand in raising. You call him uncle, for crying out loud. 

His physical response means nothing. It’s basic biology. The tender yet skilled touch of your warm hands directly against his even hotter skin, lighting every single nerve ending on fire, forcing the blood to course through his veins, to make its way down south— 

“Christ-” he snarls as you practically sit on him. His mouth shuts instantly as his eyes shoot open. He didn’t mean for that to come out. “Y-yeah,” he corrects. “‘M alright.” 

“Just- just let me know,” you tell him. He can hear the shake in your voice. He can tell biology is doing a number on you, too, based on your tone alone, if the heat engulfing his rear as you try your best not to make contact with it isn’t enough to go by. 

He focuses on his breathing as best he can as your hands push slightly past his jeans, getting underneath the seam of his boxers, and then immediately softening your touch as you run your fingers up his spine, awaking a chill he never knew was possible until now. You rub beyond the exposed area of his lower back, reaching his shoulder blades and entirely up to his shoulders, forcing the flannel to rise with your hands. He’s so broad and warm, and you would absolutely be drooling all over him by now if you weren’t so shocked at how tight his muscles really feel. How has this man not gotten any injuries sooner? How was he still doing all this heavy lifting? You dig the pads of your finger tips further into the thousands of tiny knots you feel, and his body jerks in actual pain this time. 

“God damn, girl,” he snaps. “What are you doin’?” 

“How the fuck do you even function?” You sound genuinely horrified. 

“What-”

“Your shoulders and neck are fucking covered in knots how do you even-” you cut yourself off with a disappointed click of your tongue. “You need to flip over.” 

Fuck. 

“Why?” He asks defensively. 

“I’m gonna break these knots. I need to start from the front.” 

“Ya ain’t gettin’ anywhere near my neck, I swear to God-”

“Quit being stubborn. What did I say earlier? I’m gonna flip you myself if you don’t-”

“Alright, fine, gimme a sec,” he bites. Joel takes a deep breath, at war with himself for how he’s going to handle his next course of action. 

Whatever happens next, there is no avoiding the fact that you will be made aware of the bulging erection between his legs. You can know about it, that’s fine, but the second you make contact, he doesn’t know if he’ll have the strength to control himself. Which is why he rips off the band aid quick. Flipping himself over with you still hovering over him, he tries his best not to touch you. Though, the second he’s comfortable, his focus is on your waist, grabbing you immediately and missing the way your eyes widen at the tenting fabric of his jeans. He pulls you higher up to sit on his lower tummy. 

You squeak out a little gasp as he adjusts you, and fuck it makes the pulsing between his legs even worse. He releases you, bringing his hands back to his sides. 

“Comfortable?” you whisper. You try so hard not to use your voice, worried that it’ll reveal just how turned on you are by this situation you’ve put yourself in. He gives you a single nod, and with that, you lean to grab more lotion. 

The angle you are at forces you to lean the front of your body onto Joel to be able to reach his shoulders. You can feel his body tense underneath you; you can hear his labored breathing as your hands further push away his flannel, working away at each knot. 

You lean forward further, giving yourself the ability to reach just below Joel’s neck. With this action, your hips shift, pressing down against Joel’s belly in a way that sends a sudden jolt of butterflies through your core. Your hands freeze in their movement, breath and fingertips stuttering as your entire face and neck heat up. You sneak a quick glance to Joel, and his eyes are still relaxed. He didn’t notice. 

It takes you a moment to start your movements back up again, but when you do, you can’t help the way you repeat exactly what you did before — allowing yourself another experimental roll of your hips against his soft abdomen. Only this time, you’re way less sly, for the whimper of pleasure you thought you could hide slips right out, right for his sharp ears to take note of. Shit. 

“Y’ alright there?” His eyes are trained on you now; he knows what you just did. Joel sports a quirked eyebrow as he waits for your response. 

“Mhm,” you rush out, ignoring his piercing gaze. 

It takes every ounce of willpower for you to run over the knots in his shoulder again without driving your hips into him, but even the push and pull of your arms is a full body movement, and you feel it. You feel the growing wetness in your core, the growing heartbeat that his bare tummy no doubt can feel now. 

Your body is splayed across him, the warmth of you leaking through your bottoms and onto his hot skin as you pathetically try to play off the fact that you aren’t grinding your wet cunt across him right now. With a rasp of your name, he takes a sharp breath in. “What are ya doin’?” He grunts, pained. Conflicted. 

This is so wrong. But it feels so good. Your arousal — how utterly desperate you are for the older man underneath you — is shone all over your face, brighter than any other feeling of disgust or wrongness you’re trying to convince yourself of. But the internal battle is still there, though, and it forces your hips to come to a full stop. It forces cries of apologies from your lips. It forces regret. 

“I- I’m sorry,” you choke back a sob. “Please, I- this is so wrong, I’m so stupid, uncle, I-” 

God damn it. Joel is too damn hard to deal with this shit now. “Oh, Jesus Christ, will you cut the fuckin’ uncle bullshit?” He finally snaps. His hands spring to life, finding their way up your thighs, tightening once they reach your hips. He forces you to move again. “Ya think I wanna hear that fuckin’ word while you fuckin’ soak me? Huh? While ya rub on me like a fuckin’ bitch in heat?”

“Shit,” you moan, the strength of his hand making the assault against your mound all the more intense. “Joel, please,” you cry, your fingers shaking as you hold onto his chest. 

Your thighs begin to tremble as he maintains a rough pace to your movements, his bed creaking with every shove of your hips against him. His grip on you is one of steel, the pads of his fingers digging into your flesh, no doubt leaving tiny bruises as a reminder of today’s actions. 

He is fucking covered in you — the slick of your desire pooling through your bottoms and into his skin, making each grind smoother. He licks his lips at this, his eyes dark as he drinks you in from above; your own eyes glossy and a sheen of sweat along your skin. “Look at ya, darlin’,” he murmurs, voice low enough to send a fresh wave of arousal pouring from your hole. “Fuckin’ soakin’ me, baby. Needed me that bad, did ya? Was tryin’ t’ tell ya earlier,” he grunts, “Y’know ya just had to ask.” A lazy smirk pulls across his lip. 

You let out a whimper at his words, your hips finally rolling alongside his own guidance, instinctively searching for more friction. “Atta girl,” he groans, “That’s it, fuck- makin’ a fuckin’ mess a’ me, darlin’.” 

You’re panting now, the rhythm and pressure mixed with the filth of his Southern drawl ignites every single nerve ending throughout your body. He watches you with a dark intensity, the brown of his eyes replaced with pure black lust, his eyes unable to stray away from the pleasurable desperation filling your features. 

“Gonna come like this, sweetheart?” He taunts, driving you into him even harder. 

“Mmm- my God, yeah- yes,” you cry out, eyes rolling back as the coil in your belly finally tightens, your breathing ragged as needy moans escape your lips. 

With a final roll of your hips and the utterance of a that’s my girl, the coil finally snaps, pleasure crashing over you, coursing through your veins as you come all over him, your slick unable to stay within the limits of your clothes, leaking and dripping down the sides of him and onto the mattress below. Your thighs convulse around his waist, his hold on you continuing your thrusts, dragging out your orgasm until your own hands find his and rip him away from you.

“Ya ain’t done yet, sugar,” Joel gruffs, grabbing the globes of your ass cheeks and dragging you down, letting you feel his ignored and now raging erection. 

“Never said I was,” you purr, a soft moan blessing his ears at the feel of his bulge against your ass. He can feel your smirk against his chest. 

Body still trembling, Joel lifts your ass in the air, sliding your bottoms down over the curve of your body. The stickiness of your panties pulls off with a wet squelch, the cool air of the room mingling with the wet warmth of your bare pussy, the stark contrast forcing chills to run through your veins. 

“God,” he murmurs as you give a little wiggle of your ass in the air. “Pretty as a peach, huh, darlin’?” He guides you lower, pushing you down onto his bulge. The hardness of him beneath you immediately sends a fiery need to your core. Your hands move on their own as you pull your body up, reaching for the buttons and zipper of his jeans, undoing them with ease despite the eager shake of your hand. You pull the jeans down just enough to let his cock spring free, thick and angry and leaking. 

“Oh, fuck,” you swallow your gasp. “God, I need you so bad,” you whine, already lifting up to line the tip of him to your swollen cunt. 

You sink down with a breathless moan, your head flying back as your hands grip onto his tummy to keep you from buckling. 

Joel’s breathing stutters, his moans filling the air as you practically choke his cock. “Shit- so fuckin- fuckin’ tight.” His hands find their home on the meat of your ass, holding you tight, grounding himself from coming like a damn teenager.

You move slowly at first, savoring the way he feels inside of you, how big he is. God, you don’t think you’ve ever taken anything quite as long and as thick as him. Your heart skips a beat at that, knowing that he’s ruined you for anyone else. 

It isn’t long before the raw need takes over, and you move faster, hips rolling back and forth as you ride him, the wet sound of skin against skin as you alternate to a bounce ever so often. 

Despite the risk of hurting his back even more, he can’t stop himself from gripping you tighter, his nails digging into your flesh as his hips buck up into you, starting their own rhythm, meeting every one of your thrusts. The sensation is overwhelming with the size of him; it’s a perfect mix of pleasure and pain, mixing sweet whines of ecstasy with whines of overstimulation, and it’s the best music to have ever graced his ears. 

“Look at ya,” he grunts. “Fuckin’ made for this, weren’t ya? Fuckin’ made for takin’ this cock, huh, sweetheart?” 

You nod weakly at his words. They send a flutter down your belly to your pussy, and his mouth is all it takes to send you to your second brink of collapse — your heart beating rapidly in your chest as you move, as he drives himself into you without abandon. 

Every thrust pushes you further to the edge, the sting of the stretch, the sensation of being so full — it’s almost too much to bear. He can hear it in the way your cries change. It’s becoming too much. 

“Y’ can take it, sweetheart, almost there,” he grunts. His hands take over in guiding your movements, urging you faster, harder, bringing you both to the cliff’s edge. 

“C’mon, baby, can feel her squeezin’ me, know she wanna come, baby. Breathe, doll, jus’ let go,” he rasps, his words coming in staggered.

The wet tightness of your walls, both the feel and the sound, causes Joel to fall first — a low, guttural groan filling the room as he fills you with his hot, thick spend.

The sensation of him pulsing inside you, unloading everything he’s worth, sends you over your edge, your pussy clenching around his cock as you come, the sensation rippling through you, shredding your vocal cords as you scream out in pleasure. 

Everything goes dark for you, nothing but the fuzzy sound of Joel’s sweet praises at the top of your head as he guides you through your come down. 

“Did so fuckin’ good f’ me, darlin’,” he murmurs. “Sweet girl.”

For an asshole, who knew he could be so sweet? 

You roll off of Joel as soon as your heart steadies, your entire body on fire from all the exertion. You can feel Joel’s body stiffen as you use him for support. His back is killing him right now.

A few moments pass as your eyes slowly start to close, but the deep gruff of your name stops you from dozing. 

You turn your head to the man beside you. “Yes?” 

For the first time today, it’s Joel who can’t make eye contact with you. “Can you, uh… can you-” he clears his throat, trying to rid himself of his awkwardness. “Can you warm up the heat pack again?” 

Your smirk lifts your cheek before you can even try to stop it. “Come again?” 

He lets out a frustrated huff. And he can’t turn away from you. His back is killing him right now. “My back-”

“Yeah, what about your back?” 

“You fuckin’ little shit-”

You giggle as you flip onto your side, your hand holding your head up to get a better look at him. “Your back is hurting, baby? Need me to get the heat pack for you, hm?” 

He doesn’t respond. He just has the deepest, most grumpiest scowl known to man on display. 

“Oh, come on. You need my help, is that it? Need to hear you say it, unc.” You emphasize the last syllable of your sentence, a belly laugh threatening to escape you. 

Oh, two can play at that game. “Yeah, baby, I need your help. I need the help from my beautiful, beautiful niece, hm? My beautiful, needy niece whose pussy gets all soaked jus’ thinkin’ ‘bout me, huh? Gets all wet and needy thinkin’ ‘bout her uncle-”

Your resolve finally snaps, your eyes clamping shut as you cover your ears, loud la la la’s coming from your mouth as you ungraciously roll yourself off of his bed. “Enough, fine! Fine! Fuckin’ nasty,” you groan as you make your way to the kitchen. 

“‘M not the one who started it, sweetheart,” Joel says, a triumphant smile plastered across his cocky face. 

“I made you cookies by the way,” you yell after a beat. “Want one?” 

Joel’s hand reaches for his belly. He doesn’t need one, that’s for sure. “Yeah,” he responds not a second later. 

You come back to his bedroom, heat pack in one hand, no cookie in the other. You hand him the heat pack. You make him adjust it himself. 

“Where’s the cookie?” He asks, a tinge of impatience on his tongue. 

“Oh, I thought you were gonna come down and get it.” 

He looks at you incredulously. 

“I just figured you wanted to start being more independent and all. Given how strenuous you were being a few moments ago,” you offer with a faux innocence.  

“I swear to fuckin’ God, when I get my hands on you-”

“Your hands on me? Yeah? When?” You start making your way out of his bedroom. “Come get me if you wanna show me a lesson. Know you been dying to all week.” 

If he can fuck you the way he did, maybe full-time bed rest isn’t what Joel needs. He needs to stretch and move around; he needs to activate his muscles, especially being on the older side. It really is basic biology.

I would absolutely love to hear what you guys thought of this! Any and all your love and commentary truly keeps me going and motivated even when the writer’s block is at its strongest. Wouldn’t be here without you all. I have so much love in my heart for you! Talk to y’all soon🩶

I cannot get myself to write for Joel or for TLOU without mentioning the horrors occurring in Palestine. Please check out the links in my navigation + bio to learn about the situation in Palestine and also learn about some ways in which you can help🇵🇸. Reading and interacting with those links takes 5 minutes of your time at the bare minimum.

Leaf divider by @saradika-graphics

[loveanddeepthroat]

can i mc reader and sylus where mc ends up in hospital after a mission gone wrong and sylus shows up but she wants him to leave in case someone sees him there

Careless

Pairing - Sylus x f!MC

Summary - You landed yourself in the hospital overnight after a mix up at HQ had you fighting too many Wanderer’s alone. You’re already bummed about being stuck at Akso, so the feeling of dread when Sylus turns up unexpectedly only adds to your unease.

Word Count - 2.3k

Warnings - Set in a hospital. Angst and fluff.

The incessant beeping of medical machinery echoing throughout the ward was getting to your sore head.

Akso Hospital was rammed full of casualties and emergencies, seeing as it was a Friday night. You felt a bit out of place amongst the partygoers and adventurous folk who had taken their fun a little too far.

In your opinion, you didn’t really need to be here. The eggplant coloured bruise on the right side of your forehead definitely looked a lot worse than it felt, but the doctors weren’t buying your claims that you weren’t in any pain.

Likely because you were wincing when you’d said it.

A night under their watch was what the doctor ordered, and it wasn’t up for discussion. You were just relieved that Doctor Zayne was working away for a week. He’d have checked you in indefinitely and scheduled an hour long lecture on why you needed to be more careful.

A mix up at HQ had the system only requesting that you attend a spontaneous Wanderer attack in Linkon Library. Just one had been reported, but seven of the ruthless bastards had accosted you the minute you stepped foot in the evacuated building.

Confident that you could handle them, you didn’t bother calling in for more Hunters. As it turned out, that confidence was misplaced, and the last thing you remembered before blacking out was a loud screeching sound. You had no idea what it was, but it hadn’t been important in your unconscious state.

When you eventually awoke in the hospital, Jenna had been hanging over you, immediately giving you the third degree for continuing alone. You should’ve known that the alert for only your assistance had been a mistake in the system, and you should’ve insisted that someone accompany you no matter what it had said.

She made sure to drill that into your head more than once.

Admittedly, you were glad to see the back of her once she had finally left. Your head was starting to throb with the volume of her voice, and all you wanted was the bliss of being unconscious again.

It was late now, and you were exhausted. Sleep was looking to be impossible tonight, however. There were several other patients on the same ward, all admitted with varying ailments. The injured man opposite you had done nothing but stare coldly from the moment he was wheeled in in a full leg cast.

You tried to speak to him. You offered him a polite smile, which was met with a sneer. Whatever his problem with you was, it was beginning to get on your nerves.

You just wanted to go home.

“Miss,” a softly spoken nurse greeted as she approached your bed. “There’s a visitor here to see you.”

You frowned, wondering if you heard her correctly over the hustle and bustle of the ward. It was well past visiting hours, and you couldn’t think of anyone other than your colleagues who knew that you were even at the hospital.

The man with the broken leg frowned, too. “What? She gets special treatment because she’s a so-called hero? I should get visiting rights, too!”

“Would you like me to let him in?” The nurse asked, ignoring the grumbling patient.

Him. That didn’t exactly narrow things down.

“Uhh,” you faltered, a little unsure. You didn’t want to cause any issues with the other patients. “Are you sure?”

The nurse nodded and smiled, though it looked a bit forced. It almost seemed like she was desperate for you to say yes to your mystery visitor.

“Okay,” you finally agreed. 

The look of relief on her face was not lost on you. She quickly hurried away to retrieve whoever came to see you, leaving you to endure the displeasure from the man opposite.

“I used to be a mailman, you know? If it weren’t for me, people wouldn’t have had their mail. Do I get special treatment, though? No, of course not. You Hunters get all the glory and adoration. And I’ll tell you another thing—”

“You’ve told her plenty.”

Prominent footsteps sounded from the doorway, the atmosphere immediately becoming heavy and tense. You almost choked on absolutely nothing at the sight of him.

Sylus.

Your eyes flared, heart hammering against your ribcage like a drum. He couldn’t be here. The risk was far too great.

“I wasn’t talking to you,” the grumpy man sneered back, looking him up and down, “…vampire.”

It was a colourful insult, and one that made your unwelcome companion chuckle. “If you’ll excuse us,” he began, the swirling red vines of his Evol appearing to drag the man’s cubicle curtain to a close at a leisurely pace. “Mailman.”

To your relief, there was no backlash from the irritated patient across the room. Although that did make you wonder if he wasn’t retaliating by his own choice, or if Sylus had silenced him somehow. The latter wouldn’t have surprised you.

“What on earth are you doing here?!” you hissed quietly. “You can’t be here, Sylus.”

Crimson eyes didn’t meet yours, his cold gaze set only on the bandages around your head as he approached your bedside, closing your curtain behind him. He didn’t quite look like himself. His hands were balled into fists at his sides, green and blue veins prominently making an appearance.

“I’ll think twice before taking advice from a woman who was very recently knocked unconscious amidst a 7v1 Wanderer fight,” he rebuked monotonously. 

You scoffed. “I’m fine, if that’s why you came. Feel free to go back to—”

“Fine?” His face quickly turned from emotionless to severely unamused as he cut you off sharply. “That’s quite the contradiction, sweetie.”

You raised an eyebrow barely high enough for him to see your questioning expression. The gesture hurt, which wasn’t helping your case. “To what?”

He dragged a plastic chair towards your bed before sitting down, his ankles crossed in front of him. You couldn’t really read his demeanour. He almost seemed cross with you.

“To what I saw from Mephisto,” he responded tightly.

Mephisto. 

That explained the screeching you heard before you slipped into unconsciousness. “And what exactly was Mephisto doing there?”

Sylus merely shrugged, offering nothing verbal in response. The lackadaisy gesture did nothing but piss you off. You’ve told him countless times to stop sending Mephisto out to keep tabs on you, and each time it seemed to fall on deaf ears. 

He clearly was not pleased with you, but you weren’t stupid. He was here because you had concerned him. Sylus was a busy man, especially at this time of night. He wouldn’t have come just to berate you with words that could’ve been put into a text message.

Not that you knew where your phone was.

The atmosphere between you both fell into silence, only the sounds of medical machinery filling in the lack of conversation. You didn’t really know what to say to him, and he wasn’t typically the type to lose his words. But it was clear to see that he didn’t know what to say, either.

After a long moment, he cleared his throat, his hands flexing in his lap. “I told you those guns of yours were pathetic.”

“There’s nothing wrong with my guns,” you mumbled with a roll of your eyes.

“So it’s a skill issue?”

You glared harshly at him, flinching noticeably as you did. You weren’t sure what was bothering you more, the pain in your head or the mood that Sylus was so clearly in. 

His features softened ever so slightly as he recognised your pain. Still, that didn’t stop him from being an asshole. “It’s one or the other, kitten.”

You felt your cheeks heat up. If there was one thing you didn’t want Sylus to think of you as, it was weak. You weren’t sure why you cared so much, but you did.

“I suppose my guns are a little on the outdated side,” you murmured begrudgingly.

He smirked, his hands finally relaxing a little in his lap. The awkward atmosphere was slowly fading, which you were grateful for. You didn’t want to pry into his mind and make things worse again.

You buried your head a little further into the pillow beneath your sore head, letting your eyes fall shut for a moment. Fatigue was starting to settle in your body, almost dragging you into a swift sleep before your chilly hand was captured in a warm embrace.

Your eyes shot open again, finding Sylus out of his seat and leaning over you. His eyes were a bit wider than usual. “Have they checked you for a concussion?” 

“Yeah,” you told him gently. The close proximity had you flustered. “I’m a little concussed, but I’m allowed to sleep.”

His brows drew together slightly as he studied you. You’ve both had these strange little moments before, when his mask slips away just enough to see his true feelings.

“I’ll be fine,” you whispered in reassurance. “You should go, Sylus.”

He shook his head, his hand tightening slightly over yours. It looked like an effort, but he managed to smirk at you again. “Trying to get rid of me already?”

Beneath that facade of humour, he was a little bit wounded. You wouldn’t point it out, but you could see it. He was a stubborn bastard who wasn’t going to let you push him away, but he also didn’t like that you were trying to push him away.

It wasn’t as if you wanted him to go. Your relationship with him was…complicated.

Complicated in the sense that you weren’t in a relationship, but he had a habit of establishing a level of intimacy between you both that you weren’t blind to. Good morning and goodnight texts, constant invites to events as his plus one with no other reason than to be beside him, and random gifts left on your doorstep so often that your elderly neighbour recently asked if you were ‘getting some.’

A relationship with him would be very difficult to maintain. You both come from entirely different worlds that just could not merge. No matter how much you desired him, you had to maintain your composure.

“I’m not trying to get rid of you,” you sighed. “I just don’t like how careless you’re being by showing up here. Some people do worry, you know.”

He slowly lowered his loom over you so that his nose was just inches away from yours. You couldn’t help but swallow, feeling his steady breath on your lips as he spoke. It was intimidating and yet so intimate that you didn’t know whether to cower or cut him off with a kiss you never knew you wanted. 

“You don’t think I’m worried about you?” he drawled in a rather serious manner.

“That’s not what I—”

“Do you not realise how it looked through Mephisto’s eyes when you were walloped a great distance across a library and crumpled to the floor like a lifeless body.” His teeth were gritted in his mouth, the word ‘body’ coming out tightly like his tongue was rejecting the word. “You’re not the only person who is worried here. Do not brand me incapable of such feelings.”

Your mouth went a little dry, tears threatening to invade your eyes. It wasn’t that you didn’t believe in his worry, and you hadn’t meant for it to come across that way.

“I just don’t want you to risk your freedom for me,” you whispered shakily.

He lifted his hand from where it was holding him up beside your free hand, carefully moving some strands of your hair that had fallen over your bandages. 

“I’d risk it all for you.”

He had never said such a thing to you in all the time you’d been acquainted. You knew that he would carry out every need you might have of him. You knew that he would listen to you sit and ramble on and on about anything, never interrupting you. You knew that he cared about you.

But you were still in the dark when it came to the extent of that care.

“Tell me what’s on your mind,” he murmured.

Thankfully, you caught yourself before you were about to shake your sore head. “Just…trying to figure you out.”

A smile slowly spread across his lips. A real smile. It was enough to make your heart flutter, embarrassingly made noticeable by the heart rate monitor you were hooked up to.

“It would require a lot of brainpower to do that, sweetie. Maybe lose the concussion first,” he said in his typically sarcastic tone.

You managed your own small smile, which blossomed into a chuckle. This was the side of Sylus that had you coming back to him whenever he asked for your company.

His real side.

He kept his hand atop your head, avoiding the bandages completely. His thumb swiped gently over the parting of your hair, pulling you off to sleep again. You were pretty sure that he was doing it on purpose to force you into rest, but you were in no position to argue with him. You were officially exhausted.

“Would you really like me to leave, kitten?” he asked in a soft whisper as your eyes fluttered.

The very thought of him leaving made you a little upset. Despite your attempts at convincing the doctors you were fine, you damn well were not. You needed his comfort, and he needed to know that you were safe and on the road to a speedy recovery.

“No,” you whispered, succumbing to the soothing strokes on your scalp.

A soft brush of his lips was the last thing you felt before you finally drifted off, feeling secure enough to do so with his company.

“Good,” he’d whispered back before you fully clocked out. “I’ll always be careless so long as I get to you.”

A/N - Long time no fic post. I apologise, life has been crazy. I haven’t proof read this cause honestly I’m just too tired so I’ll read over it in the morning and edit any mistakes. Hope you’re all doing well! 🖤

[rottenaero]

They were gonna put Eddie down like a damn dog.

The group had insisted that Steve visit the hospital today, one year and two months after the incident. It was a random day, and he thought, ‘ why the hell not?’

Family Video had been closed for months, doing ‘ repairs’, so he really didn’t have much else to do.

He thought it was weird, the way the group was as far away from the bed as possible, and how when he entered the room, Hopper almost blocked the exit.

He doesn’t question it though, sidling up to the open chair beside Eddie, who was still asleep after all this time, and punching his shoulder lightly.

“ Hey, Hero.”

He’d taken to calling it sleeping instead of what it was, a coma. Sleeping sounded more peaceful, because with sleeping came dreams and relaxation.

Eddie doesn’t respond, doesn’t react. Steve didn’t expect him to.

He turns his head to Dustin, the one who’d called him in the first place. “ So, why’re we gathered here today? Any updates?” He asks, addressing the whole room.

The boy swallows, and something tells him something’s wrong. Really wrong.

“ Yeah, actually. Uhm, since it’s been so long, we were thinking-“ He cuts himself off, crosses his arms and starts tapping his foot. Thinking, probably.

Hopper glances to him, and sighs, deciding to lead. “ We’re gonna have to let Munson go.” He states.

Steve takes a sharp breath.

“ What?”

‘ Let him go’ like this is a job. Like this isn’t him losing his life. He wonders when they decided to do this, in the hospital room for the ten minutes they were waiting.

Eddie doesn’t give any indication he hears what’s being said, the beeps from the heart monitor still steady and even as ever. A constant metronome of the exact same sound on the exact say beat, all the time, always.

Except maybe not always.

Dustin takes over again, arms placating. “ It’s been a really long time, Steve. We’ve come to terms that he probably won’t wake up, and it’s doesn’t have to be sad-“

“ You’re killing him.” He hisses, “ You’re killing him and it’s not meant to be sad?”

Nancy steps forward, seeing it as her time to speak. “ Steve. You barely knew the guy, and you spend all your time here, it’s not good for you.”

“ There’s been no good signs, no nothing, not even when El looks into his brain.” Dustin nods at the girl across the room, who’s fiddling with her fingers.

Steve furrows his brow, “ Oh, so I guess you’re gonna pull the plug on Max too?”

Lucas’s eyes widen, mouth dropping open, and Nancy glares. “ That is not fair, Steve.”

“ This whole situations pretty fucking unfair, so I guess you’re gonna have to explain to me how this is different from Max.” He stands, stance wide as he points to the man in the hospital bed.

“ Max is making progress.” Lucas says weakly, and El sets a hand on his shoulder. The boy deflates.

He turns toward Hopper and Joyce, the latter still not having spoken. The Byers family had moved back to Indiana for God knows what reason, and Steve knows that if he had the money, that he could’ve moved somewhere else long ago.

“ Does Wayne know you’re killing his kid?” He asks.

He’d met the man while visiting, and they’d usually sit in silence and watch baseball or whatever was on. He never questioned why Steve was there, or why he was holding a limp body’s hand and taking off it’s rings and putting them back on.

When they did speak, it was stories he had from Eddie’s childhood, about how he buzzed his head because a spider crawled on him and he was convinced it was hidden in his hair, making babies.

Hopper pinched his nose, like he was being a pest. “ Stop using words like killing, and yes. He said he didn’t want Eddie to have to suffer, and his bills are getting expensive.”

And he blinks, realization dawning.

This hadn’t just been decided, had it? This wasn’t a ten minute decision while Steve was getting ready to come here.

He speaks, his voice low and keeping even through each word, “ You guys had a meeting.” The ‘ without me’ goes unsaid, but still echoes throughout the room like if would’ve if he shouted it.

They’d decided this whole thing beforehand, somehow knowing that Steve would hang on. And he would, will. He can’t let him die, he can’t lose.

Will nods, and next to him Mike and Dustin look ashamed. He would’ve thought they’d hold out more.

He racks his brain for any reason they should keep alive, can’t find one. Somehow, even without one for them, he has a million for himself.

“ If the bills are the reason, I’ll pay the damn bills. He’s fucking alive.” He tries.

“ You don’t have a job, Family Video is closed. Just let it be, Steve. Please.” Robin had been eerily quiet during this entire conversation, and it brings him chills him when she speaks.

His best friend had been in on it.

He crosses his arms, “ I’ll get a job. Listen, I’ve been having dreams,-“ He lies. He lies because there’s nothing true to prove Eddie is getting better. “-dreams that he’s alive in like a dark space, I don’t know- his mind maybe? I just- I really think he’s in there.”

The hope Dustin gets on his face hurts, but he doesn’t care. The guy will wake up and it won’t matter that the ‘ dreams’ never existed.

Maybe it’s because he’s an optimist, and that’s why he’s trying so hard, as pessimistic as he can be sometimes.

“ Why didn’t you tell us?” Dustin asks and Steve licks his lips.

Why didn’t he tell them? “ Despite all this crazy shit, me having dreams that he’s alive still sounds crazy.” He doesn’t look at the boy as he says this, eyes roaming over Eddie’s face.

He looks serene, the bat bite on his face as healed as it can get. The doctors had mentioned swelling on his back shoulder blades, but Steve thinks his would be swollen too if he sat on them for a year.

‘ A year and two months.’ He corrects himself.

He stares at the hair that, occasionally when it got matted, Steve would go through and brush it, not wanting him to wake up to being bald because a doctor seemed it necessary.

Wayne mentioned how much he hated the shaved head, and he wouldn’t put him through that again.

As he looks at him, he thinks ‘ I’m doing this for you, so you better wake up, asshole.’

Dustin’s eyes are wide, staring at the members of Hellfire. Steve could only describe the look as ecstatic.

“ Holy shit, I mean, holy shit!” He laughs, and Mike breaks into his own grin.

Jonathan chimes in, disbelief sketched into the lines all over his face. “ Sorry, but doesn’t that seem too convenient? I’m not saying you’re lying Steve, just… If El didn’t find anything, that’s pretty much it.”

His lips form into a line, determined. “ I told you, I’ll be paying for whatever. It’s no skin off your back, or money out of Wayne’s pockets.”

Joyce nudges Hopper when he goes to speak, and nods at Steve. “ If you wanna try, sweetheart, you can. But I don’t want you visiting too much, it’s doing you more harm than good.” She wraps him in a hug, before leading the ex-chief of police out of the room.

Slowly, everyone vacates, until it’s just Steve, Eddie, and El.

She doesn’t make a move toward the door, eyes locked onto his face.

“ You’re lying.” She whispers like a secret.

He nods.

She looks toward Eddie, nervous, and she messes with the hem of her shirt when she starts to speak again. “ I lied too.”

She doesn’t elaborate, walking out of the room without anymore information, and Steve blinks.

The hospital has to call Wayne to confirm the transfer, that's how he learns of the circumstances. He doesn't say much of anything, aside from a promise of a visit on Tuesday before he hangs up.

That night, that same fucking night, he gets a call.

It's the front desk lady, voice distressed rushing through an explanation.

" Eddies gone...Only blood in his bed...We don't know where he is."

Steve stares at the wall, the rest of the words falling upon deaf ears.

Someone had probably found out where he was being held, murdered him a year later for his crimes, and stashed the body away.

He sets the phone back in its holster without saying anything to the other line. Not even a goodbye, or a thanks.

He thinks, it only for a second, that he should've let them just pull the plug, it would've been far less painful.

A creaking brings him out of it, and his eyes dart to his door.

It's dark, too dark, and Steve's aware the Upside Down fucked him up in incomprehensible ways, and now every shadow looks like something,

But there was definitely someone in his house.

He keeps slumped on his bed, the same position as when he'd answered the call. He doesn't flinch when the door pushes open enough for a body to slip in.

There's the sound of something dragging along the carpet as they come closer, probably a shotgun, or maybe they're gonna beat him with his own nail-bat.

He doesn't care to decipher the shape, instead shutting his eyes.

A hand grabs his, sets it on dry skin. His thumb touches a rough patch, a scar like feeling.

One his hands had roamed over while patching up his stomach, refusing to get looked at. That concave patch of scratchy skin that they tell you eventually will just be soft, scarred, but normal.

The skin stretches, and he feels a cheek.

Somehow, he thinks if he keeps his eyes shut, he doesn't have to face the thing in front of him, that it somehow isn't real.

A scratchy, disused, and croaky voice sounds out.

" ' Hey, Hero.' "

[stellawish]

bunnies and penguins

genre: fluff fluff fluff warnings: just satoru being good dad idk :o pairing: dad!gojo x mom!reader

As soon as you closed the door behind you, Satoru looked down at his son and cooed, "Looks like it's just the two of us, buddy," he pinched his plump cheek. "Haru, Mama went to have fun with Auntie Shoko. What are your plans for today, buddy?" Your three-month-old baby looked up at his father and blinked a couple of times.

Summer was in full swing. The July heat was intense. Satoru trudged towards the refrigerator. After stocking up on some cold soda and snacks, they headed to the living room. Sitting comfortably on the large sofa, he placed Haru on his left thigh and wrapped his arm around the little boy.

While he sipped his grape soda and flipped through the channels in search of something interesting, he paused for a moment when a bright advertisement appeared on the screen. Small animals, the characters from Sanrio, bounced up and down on the beach. Haruo squealed with delight.

Satoru noticed that his son's attention was focused on the screen, and he yelled again when the white character—Cinnamoroll—appeared on the TV. "You like him, Haru?” he kissed his chubby cheek. “Huh oh right, he looks like your favorite plushie."

Since day one, Haru has always slept with that one plushie. When you were still pregnant, Gojo won you it at a festival. As soon as you held it in your hands, you decided that this bunny was meant for your son. Since then, it has always accompanied him during his daytime naps and nighttime dreams.

Satoru stroked his son’s chubby belly and glanced at the time. "Snack time, baby." He put down the empty soda can and stood up with Haru, heading towards the refrigerator. With his left arm he held his son close while his right hand reached for the milk.

Satoru warmed the milk and checked its temperature by dropping a couple of drops on his wrist. After ensuring that it was fine, he returned to the living room. Turning off the TV, he cradled the baby in the crook of his arm and brought the bottle to his small lips. Haru immediately grabbed the bottle with both hands and began to take big sips. Satoru chuckled "Take your time, buddy. I know mommy’s milk is very yummy but we don’t want you to have a tummy ache" he said, stroking the baby's plump cheek with his thumb. The gentle sounds of feeding filled the silence of the living room

Satoru looked down at the fluttering white eyelashes and the thin eyebrows. His heart was filled with a such an overwhelming wave of tenderness. This is his baby. Yours and his. Although several months had passed since his birth, Satoru sometimes looked at the tiny bundle and couldn’t believe that he was really here.

The fruit of your love, the symbiosis of you and him, was here. Now, he gazed at his son and thanked the universe and God for such a precious gift. He gently took his son's tiny hand and began to examine his small fingers. "One, two, three, four, five." Five little fingers. He brought his tiny hand to his face and kissed it gently.

Then he softly ran his fingers over the baby’s plump leg, tickling his tiny foot. The little one smiled without looking up from the bottle. "One, two, three, four, five." He counted his tiny toes. This habit of his had started since Haruo was born. When they brought him—tiny, red, and screaming—to Gojo, he couldn't believe his son was here. Later, he lay in bed with you, and together you gazed at your baby. Satoru was struck by how tiny his fingers were.

Haru moved, pulling Satoru from the depths of his memories. He looked at his son and saw that the bottle had already been emptied. He set it down and carefully picked up the child, placing him on the shoulder. He began to stroke his back gently until he heard a distinctive grunt. "Good job, buddy"

beep-beep

He turned his head and saw that his phone was behind the pillow. He stretched out and took the phone in his right hand. A message from you appeared on the screen.

my goddess 💘😫

hi toru. shoko and I already met up. we're heading out for coffee.

You send a selfie with Shoko. Satoru opened it and smiled. "Baby, look! It’s mommy and auntie Sho!". He pointed the screen at the baby’s face, and the little one cooed.

what are u guys up to? 👀

Satoru opened the camera on his phone and called to his son, "Hey, baby, look here! We'll send this photo to Mom." Gojo grinned and made a peace sign while baby looked up at the camera.

we got bored so we decided to watch some tv

He send the picture and u replied,

aww my cute babies😘

A bit later, Gojo reheated the yakisoba you made, while baby lay in his rocking chair, making soft gurgling sounds. After finishing his meal, Satoru picked up the Haru and carried him to the nursery. "Time for a nap, baby," he said, kissing baby’s soft cheek.

After changing the diaper, he opened a drawer with onesies. Every time he looked at the tiny clothes, Satoru's heart fluttered with cuteness. "Haru, should we choose this one or this one?" In his left hand, he held a tiny white onesie with small yellow ducks, and in his right, a grey onesie with a penguin on it. The baby cooed. Satoru raised his eyebrows. "With a penguin? A wonderful choice, baby."

After that, he sat down in a rocking chair and began to rock gently, stroking his son's small back. The baby in his arms started to yawn.

Satoru ran his lips through his son’s thin hair sniffing his sweet baby smell. He softly touched his forehead with his lips, along with his tiny nose and plump cheeks. Satoru couldn't get enough of his adorable son.

A few minutes later, the baby's eyes began to close, and his breathing became steady.

Satoru continued to admire his sleeping son for a bit. As much as he loved holding him, he knew he needed to make a work call. For a few minutes, he remained seated, savoring these moments of closeness with his son. He carefully stood up and placed the sleeping baby in the crib. Gently, he ran his finger along the child's cheek and adjusted the bunny plush. After ensuring the baby monitor was set correctly, he quietly closed the door behind him.

more dad!gojo HERE

hey guys you liked previous post so here we are! if you want more dad!gojo and mom!reader let me know I will gladly do more! and as i said before english is not my first language soo yeah

reblogs and comments are highly appreciated guys<3

tags: @3lliesrifle @achbbys000 @happytreetale @mashtura

dividers by: 2. @enchanthings

[moondirti]

jigsaws

— surgeon! simon riley x resident! reader

angst. anxiety. panic attacks. neurosurgical procedures. medical setting. mean simon. d/s undertones. 3.3k wc

There's a reason no one likes working with him.

Tough. Censorious, or hard to please – whispered wearily by nurses with permanent distaste etched into their crow's feet. He scathes anyone not accustomed to his abrasive exterior; a talus pile of whetted rocks, poised to flay you open should you take the plunge so confidently. Rubs your skin raw, brutally worms his way into your flesh, infamously bars rescue, allowing only saltwater to cradle your open wounds in the aftermath. Nothing about his criticism is comforting, not in the way an attending's support should be.

It sounds inflated. Excessive. Your intern year, you let the horror stories float you by as though they were nothing more than dust motes in an old room. To be expected, no? Hospital's are brutal for even the briefest of visitors, let alone a man who's worked here twenty years. In hindsight, you see that it's a type of discredit only the very fortunate can claim; inaugural residents and medical directors, those who do not have to deal with the virulent terror himself. You know better, now. Really.

Still, it feels as though you're being punished.

The air in the operating room is heavy. Clotted by a thick sense of unease. It's never like this, usually. Though the smell of burnt bone, blood, and remnant antiseptic is always a force to be reckoned with, you've gotten very good at shunning your nose for favour of your other senses. To tune into the vital monitor's beep, or the distinctions between this lump of amorphous tissue versus that lump of amorphous tissue. Reinterpreting them based on the plans you revised while scrubbing up, focused fingers around delicate tools prodding. Cutting.

Reliable perception is fine work. You've honed your personal ability the best you could.

The first lesson Dr. Riley teaches you, and rather gratuitously at that, is it takes just one person to throw it off kilter.

There's an impossible itch right where your mask hooks over your ears, latched nastily onto your scalp. Nothing you can address physically (sterility before comfort), though you're aware that its source isn't so easy as to scratch away. Figurative, then. An unwavering neg, pointed by a pair of cold eyes in your periphery. You're tempted to look up, throw off his stare with one of your own, but you think he wants you distracted.

So, you shift your weight and centre the electrocautery to another portion of abnormal growth. It comes apart like stale bread.

You haven't felt this micromanaged since medical school, when professors would loom over your shoulder and mark the clumsy way you sutured incisions shut. But where your grade had been on the line then, it's a person's life now. You seem to be the only one privy to that fact, or perhaps the one surgeon who cares.

Because Dr. Riley watches you over his wire-rimmed specs, grunting ambiguously under his breath like you can't hear him standing just a foot away. Maddening in that it's quiet, idle. To question it would be putting the burden of critique on yourself. To let it continue–

Sweat pools beneath your collar. The spotlights don't help, either, heat lamps on your roasting nerves, highlighting the wet sheen of your temple to whoever cares enough to notice (just him). Focus feels a vain pursuit, attention zeroing in and out of control. You're caught in the violent dance, swept away, water beneath your feet, between the operation and everything else. Everything else, like the ground that suddenly pushes too hard beneath you. The walls, stretching further and further away. There'd be nothing to catch you should you fall – a possibility that gains traction by the second, your vision spotting with exhaustion.

You almost lose it before a flash of green reels you back in.

It's instinctual. Entrenched response to a colour that only ever means one thing. Looking up at the neuronavigation, you watch as the silhouette of your apparatus veers dangerously close to the patient's motor cortex, highlighted in nausea-inducing neon for maximum visibility. Dr. Riley's presence darkens the space next to the screen, a point of singularity that consumes anything within its event horizon. Though it's the last thing you want to do, you coast a hesitant look over to him.

A surgical gown is meant to be ill-fitting. You find he fills the fabric in a manner antithetical to that design, shoulders stretching it tight across his neck, tree-trunk arms drawing tense pleats around his joints. Even his cap, wrapped smoothly around his forehead, ripples with every shift of his brow. Doubled-up gloves warped to the contours of his hands, thick fingers and knuckles. You watch the way they twitch, distorting the latex like a swift fish underwater, and swallow the stone lodged in your throat.

"I can't read your mind, Doctor." Your attending snaps when you take too long to elaborate. His voice is rough, a sucking chest wound in the sterile air of the OR – too raw, natural in a way these halls don't see. You squirm uncomfortably in the force majeure. "What's the hold up?"

"Um-" You pull away from the glioblastoma, your patient's head remaining tightly in place by a positioning frame. "I'm concerned about resecting this part. It's all wound up in healthy tissue, right up against the motor cortex. A wrong move could cause permanent damage."

Dr. Riley doesn't move. Instead, his blank stare flicks down to the surgical site, digesting the truth for himself. The anesthesiologist beside you holds her breath. You wish you had it in you to do the same, but your lungs already wheeze for oxygen as it is.

Somewhere, dim and timid in the recesses of your mind, it occurs to you that this isn't normal. No attending should actively foster an environment where help is punished, especially not while being paid a hefty salary to do exactly that. A dour attitude is one thing – everyone has their days – but you know nurses with greater burdens that boast smiles and little stickers on their ID badges, running on three hours sleep while dealing with bedpans and lewd comments all day. Your search for guidance, then, is certainly not the worst thing in the world.

(No matter how stern the look he gives you is.)

"You need to make a decision. Hesitation in the OR can be just as fatal."

Great load of good that does.

But it was to be expected. Pre-op, you sat down with him to discuss the acceptable margins, and got as much out of that conversation as you did this one. Review the imaging. You've been given the functional mapping for a reason. Never mind that it was standard procedure to check-in regardless; he handles you like you're a child playing dress-up, waving around tools too complex for your grubby hands to operate. Asking him anything is validating what he believes, like kindling wood into a roaring fire. Your mouth smacks to the taste of ash.

The discoloured mass growing off your patient's brain seems to glare back at you. Ugly, yellow, and stained in a coating of blood, severed from its sisters that now lay dead on an adjacent table. It kills you to let it stick, to progress to hemostasis with an increased risk of recurrence. Should this individual ever come in again, their pain would be on your hands – a real possibility you cannot reckon with, for all you know how devastating a toll it would have. The last time it happened, you promised yourself you would never allow it again.

(A mistake that even the greenest of medical students know not to make. Promises are null in this field. They'll blow out like bad tattoos, ink smudged under skin. Patients die, families grieve, doctor's bear the guilt – to fool anyone about it would be doing a greater disservice. Conciliation is not your job. It is not a duty you owe.

Not even to yourself.)

"I… I think we should stop here to avoid any potential issues." You resolve, lips pursed painfully tight. Your hands shake, bullet of emotion ricocheting within your ribs. Your nerves are shot, you tell yourself. It'll take time to compose them, time you don't have. Better to shelf this, then. You're doing the right thing by wrapping it neatly for another day, if that day should ever come.

Dr. Riley huffs.

Or, not.

"CUSA," He clips to the scrub nurse, who shakes as they place the tool into his impatient hand. It's all you can do to watch in horror as your attending commandeers your case, addressing the portion of concern with offensive expertise. The activity on the neuronavigation doesn't so much as blink as he emulsifies the target tissue, tumored cells dissociating from the surrounding matter like butter.

And it isn't a learning opportunity – hardly anything at all when he washes the area in saline solution, manoeuvre over as quickly as it started. Instead, your attention sticks to the casual disrespect he felt was necessary. Snubbing your insight like it was dirt beneath his shoes, too competent to even address your error with words. Humiliation rips like a wave up your neck, washing your ears and cheeks in balmy warmth. Underneath it all, settled like wet sand on the shore, you find that it is not your bruised ego that's left, but rather a wilder, darker thing.

Shame at having failed him.

(How obnoxiously redundant.)

"Think you can manage the duraplasty, Doctor?" Derision distorts his expression into something crueller than his usual indifference. You hate to think it suits him.

"Yes."

It's only an hour later that you're granted the chance to break down.

After wound closure, scrubbing out and postoperative discussions with the patient's family, you think you'd have moved on. Things like this happen – it's what necessitates post-graduate training in the first place – and you're certainly not irredeemable for having faltered on the line. At least, that's what the logic delineates. It mutters its assurances like dogma in your head, insisting that because it is rational, it is right. Any other day, you would be inclined to listen to it.

But that's the thing about being strung out beyond measure. The only sentiment with teeth, sharp and stubborn, is anguish. Indignity. Self-turned anger. You replay the scene like something new will come of it, a silver lining or a divot to pin the blame in anything but yourself. The scalp staples back into place, the dressings wrapped tight. The hibiclens soap lathers up to your elbows, your skin itchy as it dries. The family is thankful, little tears dotting their eyes. The storm passes, waters rippling into quiet calm. And still–

In the wake of it all, you're irrevocably changed. Raw.

There's a little closet for occasions like these. You're relieved to find it empty, void of anything but rusted buckets and mildewed mops. It's a welcome crowd, certainly, borderline claustrophobic compared to the wide floors of the OR, and you sink to the floors within the tight, comforting embrace. Immediately, hot tears spring to your eyes, rabbit heart racing along hollowed ribs. Emotion rushes your throat, tumultuous and messy, piling half-formed grievances on top of one another until they form an intricate, prodigious beast.

Impossible to tackle, worse to tame.

Could you have done anything different?

Is there a reason why he hates you?

Are you cut out for this?

Is this worth never getting a good night's rest?

Do you deserve any of the opportunities you've been given?

Would they be better off in the hands of someone more competent?

No answer claims any. Unresolved, they wriggle underneath your flesh, feeding on the muscle keeping you intact. Tunnelling through your marrow, soft matter fattening them up. You feel as though you're shifting to accommodate them, anatomy morphing into an ugly sack of dermis and maggots. True reflection of a degraded conceit.

The dark, at least, remains omnipresent. Clean against your skin, or purifying, in some odd way. If there is no witness to your misery, then perhaps you can pretend it doesn't exist. That it doesn't affect you as much as it does, or how you won't be thinking of it during every case to come–

A knock rattles you out of your reasoning.

"Hey." Kyle's voice is soft on the other side of the door.

You make your best effort to wipe the wetness from your cheeks, warbling a quiet come in to your chief resident. Fluorescent light intercedes on your little sanctum, spotlighting your crumpled frame. The pitying grimace that twists his face is enough indication that you did not do a good job at hiding your affliction. You must look pathetic.

"We missed you at lunch."

"Wasn't hungry." You sniff, taking his hand to pull yourself up.

"That bad, huh?"

"Worse than you could've prepared me for."

He snickers. It alleviates some of the weight off your chest, this. Conversation to remind yourself that there is more to the world than your angst.

(Only some.)

"It'll get easier, I promise. He's harsher on the juniors."

"I think that's not for you to say. Tell me, has there ever been a superior who didn't absolutely adore you?" Your voice sobers to a close resemblance of Laswell's. "Good work on the diagnosis, Dr. Garrick. I'll admit, I wouldn't have caught that myself."

The man in question lightly shoves your arm, wrinkling his nose in distaste. "Okay, hush. I get it. Still–"

"You don't have to do this, you know." You smile until it gets too much to sustain, then turn to gather your white coat from behind the front desk. The note of positivity his companionship brings is fickle. Appreciated, but not enough to balm the sore blisters of Dr. Riley's rebuff. That'll take the weekend, likely, holed up in your room with nothing but a cuppa and old How I Met Your Mother reruns. "I'm fine, really. I'd rather just continue about my rounds and forget he exists."

But Kyle sighs. Sighs, and bites his cheek in that same way he does when he has to deliver bad news to intakes.

You blanch. "Don't–"

"He came looking for you in the mess hall. Something about the report." The unsteady composure you've built within yourself immediately dissipates, as though it were nothing more than an absorbable stitch. "You know better than to skip out on post-op briefs."

Your voice is weak when you speak again. Breathless. "I'm sorry."

"I don't blame you, darl. But he wants to see you in his office, now." Kyle's face is sympathetic. It doesn't do you much good. "I'll cover your rounds in the meantime."

"Thanks."

And despite your true gratitude, the words ring as empty.

"Sit."

Like a marionette suspended on string, you do as you're told.

Dr. Riley's office is barren of any personal adornment, cast in the same austere template initially given to him. There's a leather couch tucked prim under the window, throw pillow flat on one end. A wire file organiser sits atop his desk, papers fighting for space between the flimsy bookmarks. Pens in a cup, a stapler by his keyboard. All ordinary, inconclusive belongings, that which you sift through like a ravenous creature, slobbering for clues at the life your attending leads.

Ironically, the one thing that offers any inference is an empty photo frame, faced towards the rest of the room, away from him.

You don't like the uncomfortable feeling it inflicts.

"The family." He levels a bored look to you, that which hardens the longer you take to address his ambiguous question. In the harsh lights of the operating room, his eyes looked nearly black. Now, sunlight paints a clearer picture. Taupe and sepia, flecks of various browns brightened by the pale blue underline of his mask. "Doctor."

Floundering, you search for the clouded memory of your discussion with the patient's relatives. It ripples, faintly, between your revels in self-pity. If you needed any censure of your disordered priorities, that is surely enough.

(Funny how he continues to criticise you, even unintentionally.)

"Good. Hopeful. I told them you managed to resect the entire thing, and detailed the plan going forward." It's as though your hands are compelled to move by electric shock, charged full of destructive energy. You rub your face, twiddle your thumbs, scratch the armrests of your chair; trying any measure to defuse the bomb you feel ticking beneath your chest. "They give their thanks."

All the while, he remains steady before you.

A moment of tense silence clears. "I just submitted the operation report." He says, derailing the conversation to what you suspect has always been its purpose. "I mentioned your inability to close the surgery."

You damn near choke on your spit. He notices, of course, and raises a challenging brow.

"I- I'm sorry, but that isn't what... I was perfectly able to complete it." Your protest carries none of the strength you will it to. As is always the case around him, you're made to sound like a defiant student, instead. Pouting and stomping your foot, inflating your strict sense of justice to an occasion that does not call for it.

"Oh?" You know you're not crazy for thinking that way, either. He speaks in faux conciliatory tones, brows knitting together as his argument waters down to one he thinks you can digest. "Would you rather I have said you refused, then?"

You shake your head, staring down at your lap. You really, really don't want to be here. Is it worth it, then? To stand your ground when the worst that will come of his misstatement is an inquiry from above? The strength has long since left you. Now, it is a matter of bloodletting. Leeching the struggle before it festers into something greater, a malady you cannot control.

"No."

"Make up your mind, Doctor." He hums, grabbing a protein bar from his drawer before standing. He doesn't have to round his desk to tower over you, but he does. Heat radiates off him in waves, blushing your neck so that when you look up at him, owlish, your face flares with stockpiled fervor.

You wonder if it could be read as desire.

"You know best." Shutting down has never been so disencumbering. Acquiescence, upending an ivory flag with the knowledge that you don't have to bleed any longer.

His lashes flutter. When you blink, they seem closer than they were before.

"That's right." Dr. Riley practically fucking purrs, chest rumbling thoughtfully at your chosen response. A pressure settles between your legs, bloating desperately into that bundle of nerves that inhibits all reason. "So next time, if you have a problem with the way I do things, you'll address it to me directly instead of snivelling like a bloody prat. That way, maybe I'll explain it to you, too."

A nod is not enough.

"Yes, Dr. Riley."

He cocks his head, fiddling with the wrapping in his hands. His fingers are scarred, brutish, though they tear the foil with all the precision in the world. Your acceptance does not feel nearly as final, expectation thickening the space between you. The title startles to your tongue, then. Novel. Unsure. You haven't called anyone it since secondary. You do not know whether he'll take to it kindly at all.

"Yes, sir."

But his eyes crinkle at the corners, pleased, and it more than fills the hole he harrowed out from you earlier. Your reaction to the approval should be documented, given a name and listed somewhere on the DSM-5.

(Nothing about it feels healthy.)

"Good." He pushes off the edge of his desk, tapping a knuckle to your chin. Instinctively, you open your mouth. The protein bar fits between your teeth, pasty and dry, but his pulse vibrates near your lips and–

You bite down anyway.

(But oh, does it feel good.)

[masterlist]

[forhappysake]

"Because I love you."

A/N - Guys I'm really into these sappy pieces recently. Pls feel free to send requests for something else if inspired. Also, I might be doing a pt.3 to Teach Me at some point, I just have to pick where the story is going.

Summary - A showdown with an unsub leaves you in the hospital. Spencer can't help but feel guilty. Could almost losing you push him to confess his love? (spoilers: yes it does)

Warnings - spencer x reader, BAU level violence, some angst on Spencer's part, fluff, and a love confession

You stared down at your hands, battered and bloodied from your futile attempts to fight back. Caught off guard during an interview with a man who was only supposed to be an eye witness,  not the unsub himself, forced you to fight for your life. By the time the neighbors heard the scuffle and called the local police to come to your rescue, you figured you looked like you’d been through seven rounds of an MMA fight. Your head ached, your eye was swollen shut, and you nearly cried in agony with every breath as you were certain you’d broken a rib. 

After a tense standoff with the local police, the unsub was in custody, leaving you on the floor with your many wounds. You managed to stand yourself up and walk out the door to the waiting ambulance, only to collapse into the EMT’s arms. You felt yourself being loaded in the back of the vehicle as they started an IV. As consciousness drifted away from you, you couldn’t help but wonder where your team was. 

***

You awoke in the hospital to the steady sound of your heart monitor beeping and muffled conversation from outside your room. Your bloodied clothes had been traded in for a hospital gown at some point, and your midsection was bound tightly with some sort of bandages, you assumed to keep your rib in place. You managed to open your good eye in an attempt to find the source of those muffled voices. Your eyes landed on Emily and JJ speaking in the corner of the room, voices hushed. 

“He can’t blame himself. None of us saw this coming,” Emily said, her voice stern but laced with concern. 

JJ shook her head. “He feels terrible, Emily. I’ve seen him come in and out of here crying three times in the last two hours. He rarely cries.” 

Who could they be talking about?

Emily looked at the floor in silence, trying to formulate a reply. JJ cleared her voice to speak again. “They’re partners, Emily,” JJ said, “Of course he’s going to blame himself.” 

Spencer. 

Deciding you’d had enough of eavesdropping, you did your best to sit up, only to let out a whimper when a sharp pain pierced your side. JJ and Emily turned to face you, surprised looks on both their faces. 

“Hey, just lay back,” JJ encouraged. She rushed to the bedside, placing a soothing hand on your arm.

“How long have I been asleep?” you asked. 

Emily shook her head, “Only twelve hours, which isn’t very much considering what you’ve been through. I’ll tell the doctors you need another IV and some pain medication.”

As she turned for the door, you shook your head, “Emily, wait.”

Emily turned to face you, coming to stand at the foot of your bed. “What is it?”

“Where’s Spencer?” you asked. Emily looked to JJ, the two of them sharing a knowing glance. You and Spencer had always been close, as partners and friends. 

“He’s been going back and forth between pacing the parking lot and the lobby for hours. I can’t imagine how many steps he’s taken,” Emily joked. “I’ll go get him for you.” With that, she turned and left the room, leaving you and JJ to catch up on what you’d missed in the last few hours. 

JJ explained what happened after you’d passed out: how the unsub was in custody, finding another victim in his basement, and the team realizing that they’d sent you out to interview the lunatic on your own. “We just thought he was going to give you some information about the case. We had no reason to think that he was the one who-”

You shook your head, holding up a hand to stop her. “I didn’t think so either. It’s why I agreed to go alone. Nobody’s at fault.” 

JJ nodded, a solemn look on her face. “I’m just so glad you’re okay. We were all so worried once we connected the dots. I was telling Emily - I haven’t seen Spencer so stressed in years.” 

As if on cue, both you and JJ turned to the sound of rushed footsteps coming down the hallway. Spencer’s tall frame was running (no, sprinting) down the hospital corridor. You felt a small smile tug at the corner of your lips as he burst into the room, hair danging in front of his eyes and clearly out of breath. 

He approached your bedside, leaning down so he could be face-to-face with you. You could only see him with one good eye, but you did your best to smile to show him that you were doing alright. You brought a hand to his face, pushing the fallen strands of hair out of his eyes so you could see him more clearly. “Hello to you too,” you joked. 

“Y/N-” Spencer started, the tears quickly gathering in his eyes, “I’m so sorry. I should’ve gone with you. I should have known that-” 

“That the guy who called into the tipline was actually the unsub? Spencer, be logical. None of us knew. I was just telling JJ, nobody is at fault.”

A single tear fell down his cheek as he examined your injuries. With each scratch and bruise he found, he felt another crack forming in his heart. He hadn’t protected you. Wasn’t that what he was supposed to do? He was your partner. Your best friend. He loved you, that he knew. He’d forced that love to be as platonic as he could make it, trying to avoid ruining your perfect friendship. It was moments like this that made that more difficult than ever, as he tried to reckon with his love and his guilt. 

Your bruised hand was still cradling his face. He could feel the bandages against his stubble, and he cursed himself again. It was only then that the other presence in the room became known to him. JJ stood on the other side of the bed, another knowing smile gently painting her lips. Spencer knew what he had to do. JJ knew what Spencer had to do. He looked at her, his eyes subtly asking her to leave the two of you alone. JJ took the hint with a small nod, leaving the room without another word as you and Spencer continued to examine each other. 

“So, JJ’s filled me in on what I missed,” I said, breaking the silence. “Sounds like a pretty exciting half day,” I joked. 

Spencer shook his head, pulling away from your hand. He didn’t go far, though, intertwining his own with yours as he leaned back from the bed. “I was worried sick,” he said. 

“I can tell, Spence,” you said, trying to prop yourself up with your pillow. “You really shouldn’t have been. You know I always come out of these things relatively unscathed.” He raised an eyebrow at your statement, taking in your swollen and bruised features. “Well… maybe not unscathed. Alive, at least,” you quipped. 

An eerie silence fell over the room. You could feel the tension increase as the gears turned in his head.

“But what if you don’t someday?” he whispered, his voice far away. You looked over at him, his eyes fixed on your heart monitor and the gentle green lines rising and falling accompanied by the signature beep-beep-beeping. 

You squeezed his hand in an attempt to bring him back down to Earth. “I’ll always come back, Spencer. It’s what you and I do. We come back alive for each other.” 

The tears that had pooled in his eyes earlier spilled over his cheeks as he let out a small whimper. He leaned down, gently wrapping his arms around you as he wept. “Hey, it’s okay Spencer,” you tried to calm him. 

“No, it’s not. It-it’s not because,” he trailed off. You could still feel his shoulders shaking as he cried. 

“Why, Spencer?” you asked once more. “Please, you can tell me anything.” 

Suddenly his sobs slowed. He pulled back from your embrace, taking in your features. Bruised and battered as you were, you were the most beautiful person he’d ever seen. He felt like his heart was going to explode. Before his brain could catch up with his mouth, the words came tumbling out. “Because I love you,” he said simply. 

Your jaw dropped open at his words. While you should’ve seen this coming, nothing could prepare you for the way your heart jumped. If it wasn’t evident from the expression on your face, the heart monitor picked up its beeping, nearly doubling its pace. The sound wasn’t lost on Spencer, who frantically looked at the screen.

“Oh no,” he mumbled, quickly walking to the monitor. “Did I upset you? I’m so sorry, Y/N. I’ve just felt this way for so long and if I keep pretending like I don’t-”

“Spencer,” you cut him off, his eyes meeting yours for the first time in minutes. “I love you too.” 

The look on his face was priceless, and you wished you could have taken a picture, but you did your best to engrave it on your brain forever. His brown, teary eyes brightened in a moment, a glimmer of hope shining from within. “You do?” he asked. 

You laughed, allowing your head to fall back on the pillow behind you. “Spencer, I volunteer to work with you during nearly every case. We split a room every week. I only wished that you’d said this sooner so we could’ve split the bed, too.”

He stared at you in shock. The tears in his eyes long forgotten as a smile crept on his face.

A soft laugh left his mouth as he leaned down to you once more, placing a soft kiss on your forehead, careful to avoid any injured area. “Well, I promise that next time we can,” he said. “And,” he started once more, “I’m never letting you go anywhere by yourself again.”

You smiled up at him, running your fingers over his own. “I wouldn’t have it any other way.”

[simpee9000]

Not Just Friends - 11 -

M.List : Previous Part : 6.7k words

Childhood best friends turned into something more, at least with the label. Katsuki Bakugo, a fast-rising hero and fast-learning guy who is ever so slow in getting attached to and loving someone. Even three long years into a relationship, and your friends even forget you're even dating. Nothing happening, spare a few kisses.. like 3 kisses, during high school. Graduated and living together, and you guys have done absolutely nothing to further the relationship. Are you sure you're not just friends? Also not edited!! CW: Smut, brief domestic violence discussion, virginity loss, aggressive flirting from creeps, gore with pro hero stuff (lmk if i missed any) Applies to all chapters regardless of it is in said chapter.

---

Small beeping machines filled the silence between you and Katsuki as you waited for the doctor to walk in. Your condition wasn't bad so you only had a small room that was used for typical check-ups. The only reason you got the room was to avoid the public due to the status you and Katsuki shared.

The only reason you were in the ER was because even over the course of two months and a handful of weeks, your injury from the break-in was still thin. All healed but the skin was still pink and raised. A wound that goes straight through never fully heals. Katsuki still had issues with his from first year.

You often woke up to him grasping his chest and reaching for pain meds in the middle of the night. Mumbling that he was fine and that you could go back to sleep.

With how closed off he was about his pain, it reminded you of high school, how he avoided any conversation that dared to mention his pain. If you even suggested a support item that put less strain on his arm, he would snap and tell you to do what he says.

Always claiming he didn't need your help.

In the second year, he broke his leg. More so, it shattered it. It was a stupid mistake on his part during a practical exam. He was helping a 'citizen' escape a collapsing building and tripped on the way out. Everything was fine before he tripped but his foot was caught under cement when a support beam fell on his leg.

He pushed the citizen out of the way before they got hurt, everyone saw him get crushed by the building instead. You were watching his class do the practice so you could get a closer look at what might help them.

The practical didn't stop for anyone else, his classmates helped him from the ruble, mainly Kirishima and Uraraka. Lifting the support beam off him and analyzing his condition before taking him out of the exam.

You met them in the hallway, seeing the way Katsuki bit his lip in pain, face entirely scrunched.

He passed out from pain when he was set down in Recovery Girl's room. She rushed you out after that, telling you that he'd be fine when he woke up.

When he did wake up, you were by his side to help him out of the bed. His entire leg was in a cast, that he'd luckily only have to wear a week. At first, he pushed you away and refused any help. But after he got settled in his dorm room, he gave in the slightest bit.

"This is fucking stupid."

"I know," you sighed, sitting next to him on his bed.

"I hate this."

"I know," you adjusted the pillow that was placed under his injured foot. Him lifting it to make it easy.

He sighed heavily, letting his head fall into his pillow.

"Are you in pain right now?" you asked softly, his face was scrunched as if he was in pain.

"No."

You placed your hand on his gently. He had his hands folded together on his stomach. "Do you wanna talk about it?"

"Not really."

You hummed, not knowing what path to take. He was always strange after he was in pain, always running from how he actually felt.

His hands opened for yours, grasping your fingers in his as he stared down at them. "Did you get that new book you were talking about?"

"Hm?" you shuffled to face your body towards him, careful of his legs as you sat on your own.

"The shitty romance one."

"Everything I read is shitty romance to you," you teased, "But yes, I grabbed it before school today."

"What is it now? The fifth fucking book?"

A gentle laugh left you, "Almost, it's the fourth one."

"God damn, you've been reading it since we were 10."

"You've been reading your comics since you could read and I don't tease you for it," you squeezed his hand playfully.

"Mines about blowing shit up, yours are about blowing people."

"Bakugo!" you flushed.

"What? M'Not wrong," he snickered.

"The third book is the only one that went there," you defend, "I only read that one last year. Shouldn't have told you about it."

"Didn't need to, literally caught you red-faced as you read it," he teased.

"Shut up!" you slapped at his shoulder with your free hand.

"It's not like that's the only book like that you read," he laughed, "You have thousands of that filth."

"Do not!"

"Do too!"

"Shut up!"

Katsuki settled his laughter. Thankfully letting the topic go.

He let go of your hands for a moment to wipe them on the bed next to him. He's always been paranoid of his sweat, you assumed a girl in middle school teased him for it and he's been embarrassed since. But you knew he'd never admit it, so you didn't bother to comfort him about it.

"Why do you read that stuff anyway?"

"What? Porn?" you flushed, not really wanting to talk to him about this. You've been dating for a month at this point. Your nerves were on edge at the thought of that territory. No amount of books could prepare you for taking that step with him. You weren't oblivious to how other relationships progressed, you knew how guys thought.

"No," he blushed, "Like the romance shit."

"Oh," you sighed, either in relief or disappointment that the untouched territory remained untouched. "I guess because it's thrilling?"

"How is that thrilling?"

"Like-" you fumbled your words for an example, "Our first kiss."

"What about it?"

"It was thrilling," you paused, embarrassed, "At least for me."

He hummed in agreement, letting you continue.

"Books do the same, in a way. It brings all the excitement and thrill you feel in real life if it's good enough. I get really immersed in it though, I read as if I'm actually there," you rambled.

"You crave that shit or something?"

"Romance?"

"Yeah."

"Of course I do, don't you?"

He changed the topic with a flush of red on his face, too proud to admit his emotions to anyone as he let his hands drop from yours.

The doctor entering your room now, in the present, ripped your thoughts off the past.

She greeted herself gently, talking to both you and Katsuki about your condition, "Thankfully it's only a surface burn, just needs a week or so to heal. Change the gauze after a shower and avoid getting water directly on it for the first couple of days."

Katsuki's shoulders sagged in relief as he ran his hands over his face.

You knew it wasn't bad, but he was worried. It obviously hurt like a bitch, but you weren't too concerned about it. He had it worse currently. You knew just from the face he was making now. He rushed you to the hospital after he realized what he did. Seeing you collapse onto the coffee table, gasping as you held your side in pain.

"If you could step out for a moment, I can finish checking her over and get you guys out of here," the doctor spoke calmly towards Katsuki, "Sir?"

He snapped his attention towards her, clearly having zoned out after she said you were okay, "What?"

"Would you mind waiting outside? We'll meet you on her way out after I ensure everything is set in place."

"The hell?" he pushed himself off the wall.

"I don't mind him being in here," you informed the doctor.

"It'd be best if he stepped out," she gave you a concerned look.

You sighed, she was kind and you didn't want Katsuki to get riled up, "Kats?"

He glared at you for a moment before giving in, "Fine." He walked out of the room with no extra fuss, grabbing your jacket for you on the way out. Making sure to stand so you could see him through the small window provided.

The doctor cleared her throat, "I have some protocol questions for you." You nodded your head for her to continue. She flipped a page on her clipboard, "Do you feel safe at home?"

"Yes," you took a breath in, prepared for the rush of questions.

She looked up from her clipboard, you already answered these questions with Katsuki near you. "This is a safe place, I understand his status might be frightening but I assure you-"

"Stop, he doesn't abuse me."

"Ma'am-"

"I'm safe at home, I promise. I know hero abuse cases are commonly untold but this isn't one," you knew that it was unfortunately common for heroes to get away with abuse. Abusing people who were scared of their status and denying any claims of it. They got away with it almost every time too.

"I apologize," she eyed you, still unsure of if you were telling the truth or not, "I'm just going on what's provided, the wound is shaped as a hand, on both sides."

You winced at the realization, hoping it wouldn't scar. Katsuki saw it already and you knew it didn't help his guilt. "Am I good to leave?" you huffed, annoyed that the healthcare thought your boyfriend abused you, and that your boyfriend thought he did too.

"Yes, but just know," she frowned, "Regardless if you need it or not, there are many resources available for help if needed."

While you were happy she cared and protected her clients, you felt horrible about leaving Katsuki alone to his thoughts. He likely knew the questions the doctor was asking, so you wanted to be by his side to assure him that wasn't what you thought of him in the slightest.

You followed all her steps to leave, having Katsuki tag along behind you until you got to the car. He opened the door for you, hesitating to help you sit down. Rather than offer a hand, he offered his forearm.

When he shut your door, going around to the driver's side, you let yourself relax. You hated hospitals with a passion. They always put you in the worst mood. The air was always stale, and tragedies were always happening in it. It reminded you that any day now, it'd be you facing those tragedies. Katsuki often made you sit in waiting rooms as he got healed from a nasty injury, and you hated it more each time.

But he was here now, that's all that matters. So you scolded your face as you smiled at him. Happy to have him sitting in the driver's seat next to you.

"I'm so glad to be out of there," you hummed. They gave you some pain meds to get through today, so you weren't in any pain. The situation didn't even bug you, though you knew others would disagree.

Katsuki shared no words as he started the car. He's hardly spoken since the two of you left the apartment. Only frantic questions to determine if you were okay or not.

"You okay?" you asked softly.

"Hm?" he hummed, entirely unfocused as he pulled the car out of the parking garage.

"Are you okay?"

"Mhm."

"Katsuki."

"What?"

"It's obvious you're not."

"M'tired," he shrugged.

You huffed in reply. Sure it was late, especially for him, but you knew that wasn't it. You knew somewhat what he was thinking already. You also knew how he would process it. He'd hold this guilt to himself until It was too much to carry himself, and he'd still carry it. His process was predictable but also unpredictable in the same ways. Sometimes he'd want you near, just your presence. Other times he wouldn't want you anywhere near him.

All you could do was show him he had someone if he wanted it. You'd avoid pushing him until you knew he needed it.

So in an attempt to do just that, you let the hand closest to his fall to reach his forearm and squeeze, a small squeeze that was just meant to show love.

He jolted away, moving away as if your hand was the touch of death.

"Sorry," you mumbled in shock, your hand reeled back and held to your chest in surprise. He's reacted negatively to your touch before, but nothing near this. It scared you about how he'd process this.

"Just-" he took a breath, flickering his eyes onto you for a moment before looking back at the road, "Don't."

"Okay."

---

Changing the gauze that night was awkward.

You called him into the bathroom once you were done with your shower and dressed. He padded into the room slowly, his head down as he got the gauze ready.

"You didn't take the wrapping off in the shower?" he asked once you lifted your shirt for him to see your sides.

"Um, no?" you looked down, "Just rip it off for me."

"I don't wanna hurt you," he shook his head.

With a huff, you carefully took your bandage off yourself. Peeling it off your skin before throwing it away. You hopped to sit on the counter, letting him get a clear view of your side.

The wince at your bare skin was obvious. His face furrowed, "You can't change it yourself?"

"Just change it, please? I can't get a good look at it."

"You can just use the mirror-"

"Bakugo," you scolded, "Just bandage it please?"

He huffed, looking from your side to the bandage, then to his hands. "Can I call Mei to do it?"

"You can't avoid touching me forever," you pointed out. 

"I'm not avoiding shit," he glared at you.

"Then change it yourself," you challenged.

He bit his tongue, obviously looking for another excuse to use, "Isn't this too personal?"

"Huh? Literally how?" you asked confused. Out of all the excuses he uses that one?

"I mean, I'm under your shirt-"

"These are your handprints-" you spoke without thinking, stopping when you saw his face drop further, "You've seen me get off, I don't think bandaging a burn on my side is too personal."

His face flushed, "Don't."

You took his warning and didn't bring up anything more 'scandalous' for his sake, "Can you just patch me up so we can go to sleep?"

He nodded before washing his hands off quickly, it reminded you of how he reacted to you. It was reassuring in its own way. It felt nice to know that you gave him butterflies even though he'd never admit it. He was so soft for you, it was sweet.

The wound didn't hurt too much as he put the gauze over both sides, bandaging it after. The drugs were doing their job, tomorrow you'd have to remember to take Advil or something to help.

Katsuki stared while he bandaged your side, traumatizing himself from how he hurt you.

Not wanting him to be in his head, you spoke, "Not too bad."

He offered his arm to help you off the counter, supporting your weight as you hopped down.

Even though you didn't need it, you let him help in the ways he wanted. Letting him pull back the sheets for you, and letting him tuck you in before going to his side. 

If you mentioned how much he was babying you, you knew he'd stop. You also knew that he would pout and fully push himself away from you. So you'd take what you would get.

He was being sweet after all, no harm in letting him continue like this.

"Thank you," you mumbled after he placed his phone down, alarm set for the next day. 

He grumbled out a noise of confusion before he shuffled to face you better. Wanting eye contact despite the dark room. 

"For fixing me up," you spoke softly.

Katsuki just kind of looked at you for a moment. Expressionless before a frown slowly turned his lips, "I'm the one that did it."

"It was a joint effort," you smiled, trying to lighten the moment.

"It's my handprints."

"That may be true but-"

"No buts."

"I was the only one pushing you to get so worked up," you defended him.

He rolled his eyes, moving to lay back down, "Doesn't matter, I know better."

Not wanting him to hold this to himself you tried to argue, "Kats-"

"Go to sleep," his voice was shot dry, only an inch of his actual emotion showing.

"Okay," you whispered. You lightly placed your hand on his back, trying to comfort him. His body trembled lightly.

He often shook when upset.

So you ran your hand soothingly up and down his back.

Despite his claims of wanting to be left alone, to not have any help, he fell asleep quickly with your hand rubbing his back. You followed suit. Letting your thoughts run wild.

You didn't get a single negative from the interaction, you were more so wrapped in the before. Before he burned your sides, which you knew he didn't mean to.

But before, he was kissing you with fever. Like a man starved. One simple challenge had him riled up. Grabbing onto you roughly to pull you closer to him. Letting you lick into his mouth before taking over the kiss more roughly. Moving his hands down so he could guide your hips.

If the moment didn't end so roughly, you liked to imagine the route it would take. The way he would groan into your lips. His arms flexed as you ran your hands over them, trying to grasp how real it could have been.

You'd let him have anything he was willing to take. You wanted him to want you, and in those small fleeting moments, he showed it. He showed just how much he wanted to ruin the both of you.

Sleep came easy, but with the arousal of your dream, you woke up at the small movement of him next to you.

It's only been an hour or two since you've fallen asleep, but you made yourself cozy. Ignoring the pain in your side to lay half on top of him. The movement you woke up to was him hugging you closer, his arms wrapped around you with the comfort of sleep on his mind.

You squeezed him tighter in response, selfishly soaking up the closeness while you could get it. Nudging your head into his neck to get closer to him.

"What are y'doing?" he mumbled, groggy with sleep.

With him awake you regretted your actions, he was a light sleeper when he was stressed. "Nothin," you murmured into his neck, leaving a light kiss.

"Doesn't feel like nothing," he hit his chin to your head, making you rise up, his hands falling off your body.

"I love you," you whispered, looking down at him slightly with how you hovered over his side.

He scrunched his nose, "What are y'doin?" he asked again.

You pecked at his face, leaving a light kiss on his nose before peppering kisses on his cheeks. The dream had you more loving than you'd like to admit. He was moving through the steps slowly but surely.

"Knock it," he grumbled. His hands stretched away from you in precaution. 

"You love it," you backed away for a moment to say, when you returned his face was warm, clearly flustered.

You moved your kiss closer to his lips until you hit them, kissing him softly for a moment before he gave in more. Letting you kiss him a couple of times before he locked your lips with his, biting your lip gently to keep you close. Your lips slowly moved together when you moved to get a better position. Your hips straddled his, just like it was in your dream, and just how you were before. Hands lightly cupping his cheeks as you kissed with loving intentions.

When you let your hands drift down to his chest, holding yourself up, you felt his heartbeat. It was racing against your touch, it ran a thrill through you, a smile gracing your lips as you kissed him a little harder.

His hands sparked up, grabbing your attention for a moment before you went to return to kissing. He has his hands placed far enough away that it couldn't hurt both of you. But his face was still scared. His lips kiss-swollen but his eyes were terrified.

"It's okay," you murmured, kissing him lightly, "I'm okay."

"My quirk-" he spoke between your lips.

"Can't hurt me," you stopped for a moment, "Just keep them over there, it's fine.

"The bed," he tried to find a way out.

With worry that he wasn't enjoying anything, you sat back, "We can buy new stuff," you tried to soothe, your hands running up and down his chest. He was breathing heavily. "If this is more worrying than anything, we can stop, Kats."

"Not scared?"

"Not in the slightest."

"Promise not to touch my hands?"

"I'd say pinky but that'd break it," you joked lightly.

He rolled his eyes, "Fine."

"Fine?"

"We can kiss, or whatever," his hands sparked, his eyes averted towards the ceiling.

"I know what you meant, but fine? Sounds like you're not into it, Kats-"

His hips rutted into you harshly, his feet bracing the movement, you lost your balance and were back to hovering over him. "Shuddup," he grumbled before lifting his head slightly, meeting you halfway. 

The thrill that you read for, lit up all your nerves. 

He was fully kissing you despite his quirk. He was fully kissing you. You think if he was more awake, and sat on the thought of hurting you again for longer, then he'd refuse. But he wasn't.

His movement early proved how into this he was. The length of him hard against his boxers. You were thankful that he was a hot sleeper, the thin clothing letting you feel all of him. You've seen him before, felt him underneath you before, but this felt better somehow. It was probably the reassurance that his quirk was fully there. Going off every couple of moments or after a particularly rough kiss. 

Each spark heightened the thrill of it all. 

His lips were pressed against yours, his tongue slipping between to catch you by surprise.

Your hands traced over his chest but settled on his biceps, feeling them twitch roughly before each bout of his quirk.

"I fuckin' love you," he muttered against you. Voice rough with the kiss.

You couldn't help the smile that crossed over your features as you moved your hips over his. Starting the cherished moment that you lost hours ago.

"I love you too, Kats," you whispered into his mouth. 

He groaned at the action, "Wanna touch you."

A spark shot up your spine when you heard his quirk go off again. You needed a breath and with the way his chest was heaving, you could tell he needed one as well. So you took greedy breaths in as you trailed kisses down his jaw and to his neck. Leaving pink marks behind that you knew would bruise. 

The state he was in right now was disorienting, but encouraging. He looked wrecked. His head tilted back so you could kiss more of his throat. His arms strained and fist clenched as he refused to risk touching you. It made you want more. So as selfishly as this started, you continued down that path the same way you continued down his chest. Leaving marks on his pecs before you shifted your body to kiss further down.

"What are y'doing?" he mumbled, tilting his head down to look at you, wanting you closer.

Talking about what you were planning was more embarrassing than doing it. "Can I suck you off?" you asked quickly.

He rolled his head back, "Jesus Christ."

You swallowed nervously, "Can I?" if he rejected you now, it'd be humiliating, but you'd listen.

He tilted his head back down again, looking into your eyes. "Skipping a couple bases, aren't you?"

You sat up straight again, getting more composed than before as you sat on his thighs. "Well yeah- but if you want me to jack you off first-"

A loud spark of his quirk shut you up. "Can't just say that," he hissed.

"Well, what do you want me to do?"

"You don't have to do anything."

"But what do you want?" you pushed.

You watched as his atom's apple bobbed as he swallowed, "Anything you're willing."

"But you commented on me skipping bases-"

"We can do those later," he cut you off, flustered.

You hummed, leaning back into his space and kissing his lips. Steadily going back into making out with him again. Moving your hands off his arms, squeezing at his muscles as you made your way down. Still working your lips against him as you slipped your hand underneath his boxers.

His entire body was tense as you moved down, but he jolted lightly when you wrapped your hand around him. The touch was probably still foreign to him. Knowing that he's only gotten off once with his own hand. You knew what he looked like from head to toe, but now you knew what he felt like. A steady vein on the underside, connecting to his tip. Veins lightly graced the rest of him. Not only did his dick surprisingly look good, but it made you want more.

When he bit your lip, you remember to focus on the kiss again. Your tongue tangled with his as you moved your hand over him before you moved it away, taking him out of his boxers for more movement.

Returning with less nerves than before. Grasping him lightly before you ran your hand fully over his dick.

After a few motions of your hand, it was clear he was losing it. The motion became familiar quickly so you were able to focus on his reactions. His hips were gently rocking into your hand. Letting you pump his length as he kissed you messily.

He was entirely unfocused, groaning into the kiss in a desperate attempt to keep you close. To give you anything he would.

"Wanna touch you," he whined into the kiss, hips rutting into your hand quicker.

"I know," you mumbled back.

His abs were tensing and untensing constantly, his hands doing the same.

You were surprised he was lasting this long. Probably more stuck in his head rather than the moment. Hardly even noticing when you stopped kissing him, he started breathing heavier.

Steadying your nerves was difficult as you moved further down his body, placing a kiss on each of his abs gently.

He was out of it, his hips rutting desperately to reach the high he craved.

Throwing yourself into your actions was commonly something you did, so it was only fair you did it now. Hesitantly placing a kiss on his tip when you were able, continuing to pump your hand along his length. It was just the extra push he needed, a broken moan left his lips and his hips slowed as he came in your hand. Quirk going off loudly.

"Fuckin' hell," his voice was shot.

It was unintentional, but he came over your lips, covering parts of your face in his cum. You couldn't blame him, it was as unannounced as you kissing his dick. So you continued to slowly pump your hand. 

"Enough," he basically whined.

Seeing him this wrecked was horrible, it made you want him more. But with a look at the alarm clock on his side, you knew he needed sleep. So you pulled away, moving to sit up straight. Wiping his cum off your lips with the back of your hand.

"Where y'going?" he grumbled, voice rough and eyes half-lidded when he managed to open them.

"Bathroom," you mumbled, you would kiss him, but you didn't want to disgust him.

When the small amount of light from the windows hit your face, his eyes widened, quirk popping off again.

"What?"

"Your face," he choked out, "Sorry."

You laughed lightly, "It's fine."

"Did it get in your mouth-"

"No."

"So you didn't taste-"

"No," you laughed at his questions, leaning down to whisper in his ear, "didn't want spoilers."

His quirk popped off as he moved his head to connect your lips. Wincing away after a moment.

"What?" you asked concerned.

"Don't fucking taste that," his face was sour.

You laughed at his face, moving off him to grab a towel from the bathroom. Cleaning your face before tossing him a wet rag. Him catching it easily from where he was sitting on the bed. "Sorry," he mumbled out.

"Hm?" you hummed, not entirely hearing him.

"Can't get you off and shit," he grumbled.

You laughed lightly, "We'll work around to it eventually I hope, if not, I'm happy just like this with you."

His frown deepened, quickly putting himself back in his boxers before you sat by his side again.

But you paused at the side of the bed. Where his hands were lying was burnt to pieces, a hole being singed into the mattress.

---

Unfortunately, you had work the next day. Though you could use the day off, you didn't want to get behind on work. Or spend another day alone in the apartment. Katsuki left without a goodbye. Only a short text saying he was at work. That was sent two full hours before he normally went in.

You shuffled into your office as usual, looking over the text again. Trying to wrap your head around his behavior since the hospital. It made complete sense for him to be wavery of his quirk, but you've never seen his quirk go off for small touches and he was avoiding those after you returned to bed. Having romance off the table for a while was fine, but everything else? That would be harder to live with. You shared small touches ever since you can remember, so going without that would be beyond weird.

The last two months were like that, and you didn't want to go back to that in the slightest. Sure your career progressed a lot, but you liked having Katsuki around. Even though he hardly gave them, his hugs were the highlight of your week. He flushed anytime you said that, and you didn't want him to take that away.

"What the fuck?"

Mei's pissed-off tone dragged your attention off your phone.

"Huh?"

"You fucking broke up with Bakugo?" she glared at you.

"What are you talking about?" you continued to your desk, throwing your stuff on it without a care.

"Why are you limping?" she did a quick scan over you.

"Sprained ankle," you shrugged off, she already seemed pissed enough, telling her Katsuki blew a hole in your side wouldn't help.

"Deserved, probably broke his heart."

"Since when did you care about his heart?" you glared at her, annoyed at the way she was taking your 'break up.' She was supposed to be your best friend, not his.

"Since you wrongfully broke it."

"He's fine-"

"Deku said he has been moping around all day."

You stopped for a moment, "He has?" you'd need to call him during your lunch break if so.

Mei threw her hands up, "Yes! Obviously! His girlfriend of three years dumped him because she can't get off!"

"Mei, you were telling me just a couple of days ago that I should dump him for that."

"I didn't mean it! There's plenty of other ways to get your rocks off."

"I don't want to hear about it," you cringed.

"You could probably make one-"

"Mei!"

The rest of the day followed on a similar footing. Not so much as ways to get off, but questions on why you and Katsuki broke up. People stopped by constantly asking about it, trying to get their taste of the office gossip.

They took your winces of pain as sadness, somehow, saying apologies and asking their questions after.

You couldn't catch a break, when you called Katsuki he let the call go straight to voicemail. Taking away your small bit of peace.

It made you leave work early, tired of the questions and wanting to meet Katsuki sooner rather than later. You also forgot to take pain meds to deal with your side, so you felt horrible. Regretting slightly how late you stayed up.

In a similar manner of how you entered work, you threw your keys on the table and stepped into the living room. Seeing Katsuki's stalk blonde hair.

"Kats," you placed your hands on his shoulders in greeting. Surprising him from behind the couch.

He jumped out of his skin at the feeling, "When'd you get home?" he turned to you frantically.

"Just a second ago? Did you not hear me?" he could normally sense someone's presence a mile away.

"No," he frowned, turning back away from you, shrugging your hands off his shoulders.

You frowned, moving around the couch to sit next to him, "Are you okay?"

"Yeah," he dismissed, looking down at his phone. Headlines with his name filled his screen, all negative.

"Z' said you've been moping."

"Nerd doesn't know shit."

"Katsuki, it's obvious."

"No, it ain't."

"Really?"

"I'm fine, knock it."

---

Though you hoped that he was just grouchy and sleep-deprived that day, he continued to be off. Obviously not fine, even a week after everything.

He was constantly avoiding your touches, no matter how small he jumped away from them. The light touches you used to place on his arms, even before the watch, were no longer okay.

Fully distant and he made no move to talk about it no matter what.

You tried to make small nudges towards him but he wasn't having it.

It was like you truly were just friends at this point. Even with you stood behind him as he cooked for the two of you, in your home together.

"Are you not going to talk to me?" you asked after the silence got too heavy for you to bear.

"What is there to talk about?"

You rolled your eyes, "You act like I shocked you when I was just grabbing the plate next to you."

"What about it?"

"Bakugo."

He turned to face you, abandoning the vegetables he was chopping. With the opening you stepped closer to him, cornering him into the counter.

"What are you doing?"

Slowly, you reached for his hands that were clenched at his sides.

"Stop," he moved his hands further behind him.

"Kats," you spoke softly, voice broken. Seeing the one you loved since elementary school back away from you hurt. For them to act like your touch was poison? It was a different type of pain that was heart-wrenching.

He was taking every step backward. Even in high school, he let you hug him, but now it was nothing. You didn't want that. Not in the slightest.

"Can you back up?"

You shook your head, looking down to gather yourself a touch more.

"You can't do this Kats."

"Do what?"

Tears brimmed your eyes when you looked up, "You said you were going to try."

"Yeah? Then I fuckin' burned you," his voice was rough, eyes were just as watery as your own.

"I'm fine-"

"You weren't."

"What about after that? You let me touch you then."

"It was a mistake."

You stepped back, thrown for a loop at what he said. "A mistake?

He swallowed nervously, "No- I meant me risking it. That was the mistake. Nothin' else."

"But you didn't even hurt me?"

"You saw the hole I left in the mattress. If I moved my hand for even a second, that would have been you."

You huffed, "Running away from it won't help."

"Don't care, not risking hurting you."

"I care Katsuki," you reached for him again, grabbing his hands even with his reluctance, "You never hurt me before with simple touches."

"I don-"

"Even in middle school, you let me hug you. Before all the training," you tried, "You know your limits."

"I thought I did," he spoke as if he was a failure.

"Because you do, I just pushed them. Look, no watch and no flirty touching?" you asked, begging internally.

He furrowed his brows, looking down at your hands, debating. He was giving in and it lightened the weight you felt on your shoulders, "Are you okay with that?"

"Yes, I just can't deal with none of you. I need your hugs," you laughed lightly, trying to brighten the mood with a tease at him.

"Fine," he sighed.

You hugged him tightly at the opening, thrilled that he agreed. Even if you were pushed off him moments after, his hands being held away from you to keep you safe.

---

Being back at square one was strange. The two of you figuratively danced around each other. Fleeting touches as if you were just friends. The romance was ripped from the relationship regardless of the agreement. You said no flirty touching, but every touch felt flirty.

It had you staring at him in longing.

"What?" he snapped after you stared at him for a solid minute. He was just trying to wash the dishes.

"Can we kiss?" you asked without a thought.

The plate he delicately held blew up into pieces.

"Fuck," he glared at you as he threw away the pieces of glass, "No."

"Come on," you pushed lightly, "You only sparked up when we kissed last because things went further."

He rolled his eyes, "Ain't risking it."

"We don't have to risk anything, you can hold your hands behind your back or something," you suggest, "Can't hurt the air."

"No."

"Can we try once?" you pleaded.

"You agreed no flirty touching."

"It's less flirty and more loving," you tried.

"Bullshit."

"Please, Kats?"

He glared at you for a moment, biting his lip in thought, "Will it make you shut up?"

"Yes."

"C'mere."

You pushed yourself closer to him, lifting yourself off your chair so you could lean far enough across the counter to meet him. You felt stupid when he only gave you a peck.

"Really?" you huffed.

"You said a kiss," he shrugged, washing the dishes with a smirk. Obviously happy that he annoyed you.

Even though he was happy he annoyed you, he seemed more happy about the kiss than you. Any interaction after that ended with a kiss.

Adding it onto his morning goodbyes, even with you sleepily accepting his small touch of love. Leaving a small kiss on your cheek was also another go-to of his.

He merged it into his daily routine and you couldn't be happier that you pushed him to do it. You often felt like you were pushing him too far, breaking through his consent. It made you feel horrible. The only thing that kept you from caving in on yourself was that he voiced many times that he loved touching you in any way possible, his only fear was his quirk.

That was the only reason you kept pushing, he'd tell you to fuck off if he wanted you to.

So you kissed him for longer each time.

When you got too into it, he'd gently pull away, "Can't."

"I know," you replied softly, your pain must have been obvious.

"I would trust me-"

"I know," you smiled at him. You didn't want him to feel bad about something he couldn't control.

He huffed, clicking his tongue in annoyance at himself, "Wish I could use this fuckin' watch. Then I could fuckin' do something."

You eyed his watch, "What exactly did the doctor say?"

"Hah?"

"About your watch?"

"Said I shouldn't have my quirk fully off."

"So you can have your quirk partially off safely?"

"Fuck do I know, why does it matter?"

"Well if your quirk is mainly off, you couldn't hurt me."

He eyed you for a moment, "So I can use it again?"

You looked at his watch-clad wrist in debate, "Once the doctor clears it, yes."

"Fuckin' finally," he smiled, kissing you roughly in excitement, "You have no idea the things Imma do to you," he whispered into your lips.

---

-Next Part-

In them m.list of this fic (I won't add you otherwise, sorry) comment if you want to be added into a tag list <3

@supersecretsamm @maeveorsomethinggg @zoast32 @54fangirl @ellielover69 @aomi04 @mithicakurogo @ez4raa @suki0 @wildernessflora @dumbbitchenergy17 @schniti-is-in-the-house @xbieditz @poemzcheng @jaxyy219 @truwaifu @111june111 @eyesforbkg @mushroomsneedystuff @kazuumii @keiva1000 @atashiboba @ofcqdesi @americasass1942 @kaboomkayla @ilovedenk-i @iamyoursonly @albakugo @fairiesgloss @limitedstar @i-bitch-you-bitch @drageonix24 @sinyaaa @oddball08 @imsuperawkward @lomlchi @anime-manga-fanatic @irlpadfoot @chocoyanchan @gollumsmygel @yuptha-tsme @icedemon1314 @alstrums @andysdrafts @your-mum3000

[hanjsquokka]

MILF Next Door - [ Han Jisung ]

🐿 SYNOPSIS : Jisung gets a new neighbor and he's completely head over heels. Love at first sight — in his opinion. And he's not going to let an adorable three year old get in the way of true love.

GENRE : strangers to potential lovers, light fluff, smut

PAIRING : neighbor! jisung × fem! single mom reader

CONTENT WARNING : perv! jisung, jisung is a simp and he's horny, mature language, mentions divorce (not between jisung and reader), single parenting, (smut warnings under the cut)

WORD COUNT : 4.5K

AUTHOR'S NOTE : this is just trash tbh but here we go

minors dni. if you click read, you agree to nsfw content

SMUT WARNING : sub leaning jisung, slightly dom reader, oral (m receiving), riding, nicknames (good boy, baby, etc.), jisung has thing for moms, orgasm denial, piv, unprotected sex (pls don't do this)

Jisung was curious — to say the least. He was working on producing a song for his friend Changbin (honestly one of the best rappers Jisung had ever met) when he heard loud thumps from the corridor outside and the apartment next door. He heard a lot of shuffling — thanks to the wonderfully thin walls, and it was safe to say that he had gotten a new neighbor. He'd been trying to get a peek at them, in a completely friendly way obviously, but they seemed really private or they went out a lot. He was just about to assume that it was probably another working adult when one day, he was on the balcony in the morning for some fresh air. He'd been working the whole night and desperately needed to inhale something that wasn't carbon dioxide.

Which was when he spotted... you. You were putting some pots in your balcony, maybe for a few plants. Who was this beauty and why have I never seen her before? You looked pretty. Far too pretty for Jisung to stop staring at you like a literal creep. Thankfully the microwave started beeping loudly, so he had to go back inside and save his re-heated dinner from going cold. When he went back out again, you were gone. All that was left, were a few empty pots and packets of seeds.

I have to see her again.

Jisung not to secretly tried to get another look at his new neighbor, trying to determine when you would go out so he could casually bump into you and say hi. It was highly unlikely you were still single — who would not fall for a pretty girl like that? But he had to try.

After a week, he gave up. Maybe you just wanted to be left alone. He was returning home late one day, tired from his long day at the recording studio with Changbin who was not satisfied even after twenty retakes of the same verse. He was so tired, his vision was blurry and he bumped his foot loudly against the door. "Shit!" He cursed, wincing as he tried to step back. He was just about done with everything when the door next door opened, revealing the insanely pretty girl with concern masking your features. You were wearing pajamas, some part of his brain noted, pajamas with squirrels on them. Why did that make make him feel things?

Great going Jisung. Amazing first impression.

"Sorry, I heard some loud noises — are you okay?" You asked. You pushed away the hair covering your eyes. He took in more of your features. Your wispy bangs, your almost black eyes, your nose, the pink in your cheeks and your lips. Oh god. He could feel all sorts of wild thoughts running through his mind. Most of which were not child friendly.

Jisung couldn't look away. "Yeah. Yeah I'm good. Thank you." He said, mustering a smile to match the one forming on your face. I'm doomed. "You're new... right? I'm Jisung. Han Jisung." Nice save dork.

"Y/n. I've been meaning to introduce myself. I've just been busy and —"

You never had time to finish your sentence because a kid appeared in the doorway, rubbing his eyes and clinging onto your leg. What the — "Mama..."

"Sorry baby, did I wake you up?" You asked softly, picking up the kid in your arms. Jisung's heart was plummeting. No way. No fucking way — "I was just saying to the nice man next door. Say hi." The little boy waved cutely.

Jisung returned the gesture, too stunned to speak. "Is he your...."

"Huh? Yeah —" Your face broke into another huge grin. "This is my son, Sunghwan." The sleepy kid perked up at the mention of his name before starting to doze off again on your shoulder. "I should put him back to sleep. It was nice meeting you Jisung." You bowed and went back inside your house, closing the door behind her, leaving Jisung in a state of utter shock and confusion.

The pretty (sexy) girl next door was not only taken, but you were married and had a kid. Why did the universe like toying with his heart so much? Jisung went inside his own house, closing the door with a grumpy face. He really got too ahead of himself, didn't he?

A few days later, he ran into the pretty married girl with an adorable kid at the supermarket. Well — he ran into your adorable kid first. Jisung was piling up on snacks since he needed the sugar, when he spotted a small child trying to hold onto candy bars and grab more from the shelves. Upon getting a closer look, he noticed it was the kid from next door! He couldn't just leave the little boy, now could he? Not when he knew him. He had to take responsibility as a neighbor and a decent dude to bring him back to his mom.

So he approached the kid. "Hey little guy, where's your mom?" He asked, crouching down to his height. He really was cute (just like his mom).

"She buying vegetables. Bleh." The kid made a disgusted face, making Jisung laugh.

"You don't like vegetables?"

"No. They gross. I like candy!" He said excitedly, holding up the goodies that he piled in his small hands.

"Okay then, what about your dad?"

"Dada sees me every Fri-day.” He said carefully. “Only Mama here.” He looked around in confusion. “Mama?”

Jisung was still caught on the sentence about his dad. He sees him every Friday? That sounded a lot like… those child custody things he saw on TV. "Okay little guy, let's go find your mom first. She must be worried." He held out his hand. "My name is Jisung." He offered a smile.

"Ji-sung?" The kid held onto his hand. Jisung began leading them down the aisles. "I'm Sung-hwan! Sunghwan!" He said with a giggle. Aw man he's so cute.

"Sunghwan huh? That's a nice name." Jisung noted as he looked around for you. He soon found you near the cereals, looking worried. "Aha, we found her!" He took a very long glance at your figure and had a few seconds to fantasize over her long legs before Sunghwan shouted.

"Mama!"

You snapped your head in their direction, relief washing over your face as you knelt down so the kid could run into your arms. "Sunghwan! How many times have I told you to not run off like that!" You chided, but you held onto him tightly. You stood up, your gaze meeting Jisung's. A smile formed on your face. "Jisung, right? I can't thank you enough! I looked away for two seconds and he was gone and—"

"It's alright." Jisung brushed it off, but his heart was going crazy inside his chest. She's smiling at me and she's talking to me! "I found him in the candy aisle. Little man has taste."

You looked at kid, who had an innocent look on his face. You shook your head. "I should've known. But anyways, thank you." You held Jisung's hand to shake it. Holy moly.

"It's okay. Really." He said, a huge smile on his face. "Do you need some help?" He asked, looking at the shopping cart that was full of groceries.

"No, no, it's okay —"

"No, I could help, seriously. You look like you have a lot on your hands already." Jisung said, looking at the kid was trying to pick up a box of cereal from the shopping cart. "I live next door, it really isn't an issue.”

“Honestly, that would be really helpful.”.

"No worries." Jisung said casually.

Which was how he found himself in the apartment next door, setting down the bags of groceries in the kitchen. The house was neat — except there were toys everywhere. Sunghwan was way more than thrilled to show Jisung each and every one of them. He even began narrating the story of why his Mickey Mouse stuffed toy had a bandage (bad encounter with a dog at the park) which made Jisung laugh. He would've loved to spend the whole day there, if he didn't get a call from Changbin.

"Oh, that's work. I gotta go." He said, standing up.

"Thank you again, Jisung." You said, coming out of the kitchen.

"I told you, it's okay." He chuckled. "I like helping people out."

"Jisungie, you have to come back and play with me, okay?" Sunghwan had gotten up from his place and was now holding onto the fabric of his jeans. It was adorable. "I no show my Legos." He pouted. This kid was pulling at his heartstrings.

"I mean, if it's okay with your mom…” He tried off, meeting your eyes. Please say yes.

"Of course you can." You nodded with another one of those bright smiles.

"Yay!" Sunghwan jumped around.

"Say bye, Sung." You told the kid, who waved brightly.

"Bye Sunghwan. And you too Y/n. You can call me if you ever need anything." Jisung told you, putting his hands in his pockets. "I'll see you guys later." He saw himself out and back to his own house. That kid was the ticket to get close to you. You're single (as far as he understood), which means he was doing no wrong. Besides, moms are super sexy (she was an absolute milf). God, he was getting too excited. He grabbed his things and headed to the recording studio.

Safe to say the Jisung was absolutely fucked. He was goner the day he saw you dressed up in a dress that was too short for his mental wellbeing. It was supposed to be a normal day. He started babysitting Sunghwan quite often because you had job interviews packed for the whole week. Since he loved you oh so much, the second he swung open to the door to meet your nervous face, asking him if he could watch Sunghwan for a while.

Truth be told — Jisung didn't exactly hear what you said. He'd known you for a month and he was already down so so bad. He only saw your pretty lips moving, the way you fiddled with your fingers as you tried to explain it to him. But Jisung. Oh god. He just stared at you like a lovesick fool and immediately nodded to save his ass when you finished speaking.

Which was how he found himself in his apartment the next day with Sunghwan and his Legos spread out across the living room. Jisung had to work on this track for Changbin and he also had to watch the kid so he decided to multitask. I mean, how hard could it be to take care of a three year old?

Jisung found out his answer within five minutes when said three year old completely trashed his house with Legos. He couldn't walk two feet without stepping on one of the bricks, making him bite his lip in pain so he wouldn't let out a yelp.

“I'm just going to let myself in!” The second day of baby-sitting, Changbin just appeared in his apartment for no reason. This was probably the worst possible situation is overly loud friend could've walked into. Jisung could practically see his face morph into confusion, his eyes widening and his jaw dropped. “Since when do you have a kid?” He asked loudly. Even a deaf person could hear him at this point. “When did you get laid bro? You've been bitchless —”

“Okay!” Jisung cut him off, covering Sunghwan's ears. “Let's not use colorful language when there is a child present.” Only after Changbin muttered a half-hearted sorry did Jisung uncover the kid's ears. “He's my neighbor's kid —”

“You knocked up your neighbor?—”

“Will you please shut the fuc — shut up please?” Jisung took a deep breath. “I'm baby-sitting. His mom has job interviews and she asked for help and I couldn't say no. The kid's too cute.” He shrugged. Just thinking about you made a small blush creep up on his face, his ears turning red. He's never been down so bad for a person before like this.

“Holy shit —” Changbin completely ignored the don't curse there's a fucking child in front of you warning. “You like his mom.” He mouthed the last two words. Guess he didn't trade all of his brain cells for those muscles. “I should've known you actually had a thing for older woman when you brought up —”

“Enough of my embarrassing past and just get on with why you're here.” Jisung was not going to relive his teenage embarrassments. He'd done some things he's not so proud of and Changbin took every chance to make sure he never forgot them.

His friend left a while later. You texted saying that you would be home in a few. He took Sunghwan back to your house after cleaning up all the toys in his. All was well.

But everything turned topsy-turvy the second he saw you entering the house with that purple dress you wore for your job interview. It stopped just where Jisung's imagination started to wander down the gutter. It hugged your curves perfectly and accentuated your boobs so well that it made him dizzy.

"How'd it go?" He asked you once you sat down on the couch near him, playing Legos with Sunghwan, who was absorbed in his kids show playing on the TV. Jisung was sitting on the floor, so your bare knees were brushing against his shoulder, creating waves of tingles over him.

"It went pretty well." You answered, moving those magenta stained lips of yours. I wonder what it would feel like wrapped around my cock. Jisung had to mentally slap himself. Whatever sexual attraction he had to you was not disappearing in anyway — if anything, it increased every second he spent in your presence. For some reason, everything you did turned him on. The past few weeks ended in cold showers every day to calm himself down. "You're spacing out. Have something on your mind?"

Yeah, you. "Nah, I was just thinking about this song I was working on for my friend." Nice save. "The beat isn't perfect, you know? I've been tweaking it for days, maybe I should just let it be."

He saw you put your hand on your chin to think. "Well, I don't know much about music but maybe you need a fresh perspective? I think I read that somewhere. Something about not working on it for a while...."

"That... makes sense." He nodded slowly. "Maybe I just need some fresh air, you know?"

Sunghwan perked up at that. He jumped onto Jisung, a big, goofy smile on his face. Jisung found himself seeing you in the kid. His smile, his laugh, the way his eyes crinkled at the edges when he was happy — he was almost exactly like you.

"Jisungie! Park!" He exclaimed with a giggle. "Let's go to park!"

"A park? Now? Maybe tomorrow bud, your mom's probably tired."

"Yeah Sung, we'll go tomorrow. I promise." You ruffled the kid's hair.

"Pinky promise?"

"Pinky promise." You repeated with a laugh. Sunghwan went back to playing with his Legos. "By the way Jisung, if you're free on Friday, you wanna go watch a movie?"

"Hmm? Yeah, yeah I'd be down." He nodded absent-mindedly, watching the boy run around the room with a Lego car.

"Great." You gave him another one of those smiles before walking to her bedroom. Jisung's eyes were on your ass as you disappeared from the corridor. Wait a minute. Sunghwan will be with his dad on Friday, right? Did you just... ask him out?

"What did mommy say?" Sunghwan asked Jisung.

"Mommies are confusing." He said. "But sexy."

"Sixy?" The kid repeated.

"No — no not sixy! Uh, uh —" Jisung panicked. "Hey, I found this Lego set on Amazon and I thought you'd like it." He quickly whipped out his phone to show him to take his mind off of what he said. God forbid you found that he was talking about how you looked in front of your own kid.

That night after going back to his apartment, he laid in bed, his cock in his hands as he stroked himself to the thought of you. Unconsciously moaning your name loudly (maybe a bit too loud) as he imagined you there, jerking him off with your soft hands and that fuckable face with your big eyes, your lips wrapped around him as you took him in whole — yeah, he came pretty hard after that.

Friday took way longer than Jisung wanted. He was antsy the entire morning in the studio, leg bouncing as he sat on the chair while Changbin recorded in the booth. He was so out of it, he didn't hear his friend calling him thrice from outside the little room until Changbin smacked the back of his head which momentarily brought Jisung out of his dreamland.

How could he focus? When he was just a few hours away from spending an evening with you? Only you? He loved Sunghwan, don't get him wrong but going to a movie together and getting dinner afterwards and maybe — just maybe Jisung could spit out the words he'd been holding hostage inside his mouth ever since he first laid eyes on you. Dear Y/n, I've liked you since the second I saw you in your balcony and I was hoping you could rail me —

The second he got home, he took a shower, brushed his teeth again, and spent twenty minutes trying to decide what he should wear. A suit was too over the top and a normal t-shirt and jeans would look like he didn't care. He had to look cool but interested. In the end he opted for a plain black shirt over his loose jeans. He styled his dark hair with a part in the middle and sprayed some cologne on.

Two mental breakdowns later, he was standing in front of the movie theater where you told him you'd meet him. He tried to act all nonchalant but he was slowly losing his mind as he stood there like a loser (it was for ten minutes).

When you finally arrived, he swore his heart stopped beating for a good few seconds as his eyes raked over your little top that dipped low in the front. Did you do it on purpose? Did you know the way his heart started to a marathon every time he looked at you? How the fuck was he supposed to pay attention to a movie when you were dressed like that?

“Sorry I'm late. Dropping Sunghwan off took a little longer than expected.” You adjusted the strap of your handbag which was resting on your shoulder.

“I just got here too. It's okay.” Jisung played it off coolly. It was all worth seeing that smile on your face. He took a moment to mentally note that he also liked the subtle pink lipstick you wore today, but his favorite had to be that magenta color. Just imagining himself stained in your kisses — his face, his chest, his d —

Han Jisung almost publicly humiliated himself for the nth time this month.

The movie was fine. It was some romcom that you liked. His attention was more on you. Your reactions to everything, the way your eyes sparkled as you pointed to the screen, the way your eyes turned into crescents as you laughed at whatever corny ass jokes Jisung made that weren't even that funny.

Dinner… Dinner was far more difficult. He could barely pay any attention to what you were saying. He was more focused on your fingers and your freshly painted magenta nails. Magenta was going to be his fucking end. He could barely keep himself from imagining how good those freshly manicured hands would look wrapped around his cock. Oh god, he was getting hard again. He was only snapped out of his thoughts when you said, “You want to go home?”

“Huh?”

“You look tired. And I'm probably boring you —”

“No, no — never.” Jisung shook his head.

“Then what's wrong Jisung?”

Fuck it, he couldn't take it anymore. “I like you Y/n.” Silence. The silence after that was killing him. He swallowed hard and took a big gulp of water as his face turned redder than red.

“Well I know that. Why do you think I invited you out on a date?”

Every time Jisung believed he couldn't be more surprised, you just had to go and prove him wrong. “What?” He breathed out.

“I know you like me. You're not very secretive about it.” You chuckled, twisted the pasta in your plate onto your fork. “I like you a lot too.” What the actual fuck? “I never thought I'd like someone so fast after… everything. But you proved me wrong.” You shrugged. “But my real question is… do you jerk off to me every night?”

That's it. Jisung knew the thin walls of his apartment would come back to bite him someday in the future. He was betrayed by his own house. He was absolutely mortified you heard him fisting himself to you. He turned impossibly more red. He could barely stutter out a response but he stopped when he saw that teasing smile on your face.

“It's a good thing I feel the same way.”

The cab ride home was torture. Not only did you like him. But you wanted to fuck him too? And it definitely did not help whatsoever that you hand rested on his thigh and slowly inched upward, agonizingly slow towards the obvious tent in his pants. His dick was so hard it hurt in the confines of his pants. He bit down on his lip so hard when you brushed over his bones and then started to palm him through the fabric. Oh fucking hell… You were teasing him. He could see that smirk on your face as he almost whined when you pulled away because the cab stopped.

The second you stepped foot in his apartment, he pushed you against the wall next to the door and smashed his lips against yours. Hungry and needy. He pressed his body against yours, pulling you along to his bedroom (how he got there, he had no clue). His hands were everywhere. Touching and caressing every part of you. Your hair, your waist, your ass — it was heaven. You threaded your fingers through his fingers, lightly tugging at the strands. It was enough to elicit a soft moan from him, muffled by the kiss.

“Tell me Jisung…” You said quietly as you pulled away from him. “What did you imagine about me?” You pushed him onto the bed and as you got on your knees. He lifted his hips as you pulled down his pants along with his boxers, releasing his dick. It was red and stained with precum and so hard.

But you didn't do anything. “Please.” He whimpered. “Do something.” You smiled at him deviously before beginning to stroke him at a slow pace. Too slow. “F-Fuck.” He threw his head back with a groan. You were barely doing anything and he was so far gone. You carefully took him into your mouth, inch by inch. Your mouth was warm, your plush lips wrapped around his cock was making him lose his mind. He wanted to grab your hair and fuck your throat but he couldn't move his body. It was like he was frozen, only able to buck his hips into your mouth for some kind of friction. You finally — finally started bobbing your head up and down, the tip of his cock touching the back of your throat each time. “S-Shit. Fuck. Don't stop.” You went faster after that, fondling with his balls. Your tongue swirling around the tip and your hands on his balls, he could feel that band in his belly about to snap. “Fuck. Fuck I'm gonna —” Before he could reach that sweet release, you pulled away with a pop, innocent eyes staring up at him. He let out a loud groan at that. “W-Why —”

He stopped himself when you stood up and took off your pants and panties and crawled onto his lap, sinking onto him slowly. A soft moan escaped both your mouths when his dick was completely inside you. “Fuck you're big.” You whimpered, trying to adjust to his size. It gave him a bit of an ego boost. You started to bounce on him, letting out the most sinful moans Jisung ever heard in his entire life. “Perfect little dick. Filling me up so well.” You groaned. His dick twitched. Your walls were sucking him in, milking him. It was too much. He was already on edge from his denied orgasm, but the way you were talking to him? Fuck. He wasn't going to last.

“S-So tight.” He whimpered. “F-Fuck. Feels good.”

“Feels good baby?” You asked. He nodded frantically. “Are you gonna cum?” He nodded again. “Hold it for a bit. Only good boys get to cum. Have you been a good boy?”

“Y-Yes, fuck —” He squeezed his eyes shut as your walls clenched around him. “Oh fuck —” Jisung was determined to save the last of his dignity (not like he had much in the first place) and tried to get you off too. He met your thrusts half way, his dick repeatedly brushing against that spongy spot deep inside you.

“Right there.” Your nails dug into his skin but he didn't give two shits. “‘M so close.”

“Let me make you cum too.” He kissed your chest, your breasts and wrapped his lips around your hardened buds, alternating between the two of them. From the fucked out expression on your face and the way he was two seconds from filling you with his seed, he two took of his fingers and found your clit in no time, rubbing harsh circles on the sensitive numb making you cry out as your orgasm washed over you. Jisung came a moment later, his body spasming as he came down from his high.

“Fuck, that was amazing.” You panted, your head laying on his shoulder. Jisung could barely even nod in reply. His dick was still inside you as your juices and his pooled onto his thighs and onto his sheets. It was a mistake to look at where your swollen pussy lips swallowed him whole and he could feel himself getting hard again.

Yeah. He definitely had a thing for mommies.

©hanjsquokka | copying, translating or republishing my work is strictly prohibited

[moonlight-prose]

RIGHT WHERE YOU LEFT ME

➛ 04. FELLED BY YOU

a/n: i've served three chapters of angst and teasing and almosts that never came to fruition. but today is the day! today logan howlett gets fucked. i mean...does the fucking. you know what i mean. there's gonna be some hints of pain, but really he's starting to focus more on getting it right this time around. so be prepared for the filth to come.

summary: the importance of you slammed into him during your two weeks spent apart. yet when he's forced to confront the truth, he finds himself stuck between having you or hurting you.

word count: 9.7k+

pairing: logan howlett x f!reader

warnings: EXPLICIT SO MINORS DNI, wade continues to be the worlds worst wingman, yearning, angst, fluff, flirting heavily, nasty sex, p in v sex, logan gets flashed in a good way, oral (f receiving), reverence and romance, logan is an idiot until he's not, exhibitionsim (kinda if you squint really hard), pain play cause he's a whore, he lifts you cause he's strong like that.

PREVIOUS CHAPTER | NEXT CHAPTER | SERIES MASTERLIST

Time didn't exist in a linear line for him. Never a single point that drew his life from one spot to another. His constant loss of memories and different universes left him numb to the concept as a whole. He found it better to ignore the thought—move past the tragedies that came next quicker than what already happened.

What was time to an immortal man who'd lived through too much already?

What did he have left to lose?

He never found himself counting the minutes, hours, and days before you. To him, they were a jumble of things that only shifted to become one solid fact. A year he'd never get back. Moments he might one day lose. Faces he would one day come to outlive—to see grow old and pass. People he'd never meet again.

He didn't bother with it.

Until he spent a night wrapped around you and fell asleep with no nightmares. He woke up long before you ever would—dawn barely cracking across the night's darkened armor. The clock on your nightstand read five a.m., but his body shouted something different. He wasn't fatigued like every other morning coupled with endless nights of no sleep, dreading the next time he had no choice but to close his eyes.

Logan almost wished he crawled back into the bed in order to watch you be roused from sleep with the beep of your alarm. He should have. At least then he'd be counted as a smart man for not sneaking out and heading home. Even thinking of what came to your mind when you woke up sent pain down his chest.

"Punch buggy!" A gloved fist slammed into his shoulder with enough weight behind it to cause the car to jerk left.

"Fuck!" he growled, slamming his foot on the brake and whipping around to embed his claws in Wade's leg. "Sit the fuck down and shut the fuck up!"

"Rules of the highway Log–"

Red splattered against his makeshift yellow suit as he dug his other set of claws into Wade's chest with a roar. In his peripheral vision he caught sight of a small red car whizzing by. The driver laying on the horn with an anger Logan felt at the base of his stomach. Wade pointed to it with a smile in a meager attempt to lighten the mood.

He wouldn't say he was on edge. That would be a pathetic attempt at lying.

He passed edge one week and six days ago. Twenty-four hours after leaving your apartment Logan met the edge of his anger, and flew right off without bothering to keep himself in check. Two weeks without your presence. The sound of your voice, the warmth of your scent. Two weeks of a fucking mission Wade convinced him to go on; with the claim that they'd be back before Friday.

Which wound up extending to yet another five days of being stuck in the back fucking woods of Virginia—stuffed into an already small truck. The rhythmic clunk of the shovels in the bed slamming against the side already had him gritting his teeth. An hour of driving with Wade's game of spotting cars caused him to almost crack his molars.

Logan wasn't a patient man.

He swung first and asked questions later. That was his way of living. Two weeks of counting the seconds as they passed by like molasses only seemed to reaffirm that fact. He knew irony lingered in the truth; an immortal man who held less than an ounce of patience in his body.

There had to be a joke in there somewhere that Wade would no doubt yank out before the end of this trip.

Retracting his claws, he settled back in his seat to glare at the deserted long road ahead of them that seemed to lead nowhere. The car became a prison he couldn't escape an hour ago. And the appeal of trying to kill the man beside him only grew the longer he sat there. Logan already felt like a piece of shit for leaving with no explanation. He didn't need Wade's blood to make it worse.

With a huff he slammed open the car door and got out. The air was hot, stale, and left him choking in the leather suit that already clung to his skin. He tugged at the collar, sucking in air to get his heart to stop racing.

It proved to be difficult when your face distraught with tears began to morph, take shape into the you he couldn't save.

"Something tells me this has nothing to do with not getting to visit pound town before we left." When he was met with a wall of silence, Wade's head fell back with a groan. "Please hold while we deal with another existential crisis guys. He'll get there eventually."

Logan's fingers curled into fists. Wade—relentless as he was—refused to be pushed away this time. He leaned against the car, twirling his baby knife as Logan tried to hold back every ounce of fucking anger that needed an outlet. None of it was pointed at the Merc with a Mouth. Not even the nonsensical comments could penetrate Logan's otherwise silent exterior.

No, Logan knew exactly where the anger was directed. He knew that all of this rage stemmed from his own self loathing. For doing to you what he knew would hurt the most. For doing...exactly what the other you did.

Leaving wouldn't give him the opportunity to run from his pain. Fuck he figured that out a long time ago, but that never stopped him from trying.

He was an old dog with one singular trick. Hurting the ones he loved.

"Just call sweet angel up, say that you're with your old pal Wade, and explain in extreme detail how you'd love to bend her over every surface in that apartment you stare longingly at like you're waiting for her to return from war."

Telling him to shut the fuck up would only incur more bullshit to leave his mouth. Logan chose the easier route and stared into space; focused on the way his heart began to slow the more he thought about that night. How you slept against him without fear. Your hands pressed to his chest, face tucked into his shoulder. Somehow in the span of a few hours you were able to make him feel normal again.

"How much longer do I have to deal with your fuckin' bullshit?"

"One day give or take who drives."

"You're not driving."

Wade shrugged. "Your mistake." With a swift turn, he leapt into the bed of the truck and grabbed the two shovels. "Now give me a smile with those Tony award winning teeth of yours cause we've got work to do."

The endless nothingness of fields and flat ground would eventually drive him insane. One more day didn't sound awful if he knew that you were waiting for him at the end of all this. But that remained the problem he couldn't solve—the nightmare that followed him in his waking world. What if you weren't there? What if that was his final chance and you made the choice for him?

He sighed, squinting his eyes against the sun. "Alright. Give me the damn shovel."

The constant tapping of your boss's pen was going to drive you insane. Although if someone were to ask you, this wasn't the first time in the past two weeks that you were holding onto your temper by the skin of your teeth. In fact, you couldn't recall a time where your body and mind had been this on edge. As if you were a rubber band pulled tight, ready to snap at a moment's notice.

"Three days off?" Her voice remained monotone—grating against your already racing mind.

"Yes," you replied.

The request would go through without issue; you'd been here before, asking the same routine questions. Only this time you felt the unease from that morning begin to work its way through your body. Doubt lay heavy on your heart the more you ran each minute in your mind. Combing over where you might have gone wrong—what would have made him want to leave.

Waking up without Logan wasn't what set you on a path to self-destruction. At first, you were logical enough to assume that he was a busy man; being a superhero and all. He must have a good reason as to why he slipped out of your bed before the sun could fully rise, leaving behind nothing but flowers that now sat dead in a vase, and a brand new door.

Two weeks without a single word—without an explanation or a reason—began to grate on your mind. Pulling at each worry with an intensity that left you winded. Until you were forced to confront the idea that this whole thing...what you and Logan intended to start...wasn't what he had in mind to begin with.

"I'll grant you the days." The slow build of relief flooded your nerves that were already shot to shit. "Just next time you decide to sneak a guest in, please make sure he signs for a visitor's pass."

A familiar wave of discomfort spilled in your chest. Getting caught wasn't on your schedule of things to happen when it came to your job. Then again, having Logan in your life wasn't a part of your plan either. Yet somehow that happened as naturally as taking a deep breath of fresh air.

He didn't step into your life with a stoic aura of peace.

Logan crashed into it head first without a choice.

You remained a gravitational pull, an orbit he couldn't escape from, and without warning he'd been pulled to you. Where he'd exist until it was time for him to be set free.

What remained of your fear—the one thing that kept you from falling wholeheartedly—was that one day Logan might come to the decision all on his own. Without bothering to tell you, or let you in on the secret. That after all that happened...he might want to be set free. If he didn't already.

The walk back to your apartment dragged longer than it should. Your steps were slower, mind entirely distracted from the task at hand, and body aching from lack of sleep. Two weeks without Logan left you questioning why you bothered to pursue him at all. Why had you given him so much freedom to roam in and out of your life? Especially when you'd never done that with any other person before.

You knew the answer.

Logan offered you a chance to live in a way you never thought of before. Fear of the unknown kept you complacent; stuck in your ways. In such a short time he managed to slowly peel away what still remained. The anxiety that lingered in your heart at the thought of being loved—of falling in love.

He shattered your walls without even trying.

Accepting that is what left you struggling to breathe after drowning in what he gave. You were supposed to be the one to lead him out of the dark waters, back to a shore of safety, yet somehow he pulled you right in with him.

That is what kept you right on the edge of whatever this could possibly become.

You wanted to ask him why he left. Dig into his thoughts and pull free your answers. He might give you a fight—knowing what Wade told you about him having a tough exterior—but this wasn't nothing to you. All you wanted was to know that he held the same belief. That this meant something.

Calling his phone never worked—going directly to a voicemail box he never set up. Texting him wasn't an option, and you couldn't exactly write him a handwritten letter to send off without an address of where to go. Which left you here. Stuck in the radio silence and waiting for a response to crack through all the static.

Digging for your keys at the bottom of your work bag nearly caused you to miss the woman standing by your door. Her hair was tied into a messy updo, showcasing the familiar white streaks you'd seen before. Something akin to joy flushed through your body as Vanessa pushed away from the wall—two coffees held in her hands and a paper bag that smelled eerily like bagels tucked into her arm.

"I wonder when I'd see you again," you said, catching her smile as you slid the key into your new lock with ease.

"Blame Wade. He's been keeping me hostage for weeks."

You snorted, tossing your bag and coat on the table. The flowers—now dried and falling to pieces—still remained the centerpiece of your apartment. Petals were scattered along the wood, some now on the floor. But you couldn't find it in yourself to throw them out. You still held out hope that they might bring him back to you, even if he didn't want to return.

"I don't need to know the gory details," you sighed, accepting the tepid coffee and cold bagel. "How long did you wait?"

"Thirty minutes." She fell to your couch with a groan, kicking off her heeled boots. "I figured you were well into the first stage of wallowing and might need someone to drag you out of it."

"I'm not–"

Her eyes fell to the bouquet, lips pursed as if fighting a smile. "And those are from who again?"

"Just because I kept them doesn't mean I'm wallowing." You collapsed beside her, exhaustion withering your body quicker than the sun did with those flowers. "I just haven't cleaned yet."

"Right."

Vanessa had been your friend since Wade moved in across the street and accidentally almost killed you in the middle of the street. She wound up apologizing for him with two bottles of wine and hours of conversation. Even in the midst of their breakup, she still solidified herself in your life with nights of movies and days out in the city. You never thought you'd get a friend out of living here, but somehow life without Ness in it felt bleak.

Which gave her the ability to read you like an open book. She'd seen what you looked like after a breakup—she’d endured countless talking stages with you—and was able to pick out the signs of what your pain looked like.

"He's coming back, you know."

Your heart fluttered at the mere mention of his existence; you silently cursed yourself for it. "Did Wade tell you that?"

She nodded, taking a sip of the shitty cold coffee with a grimace. "I love the man, but he has the worst timing."

"Timing?" You sat up, alert for the first time since waking up alone. "What are you talking about?"

"I figured you didn't know," she sighed. "Logan didn't leave because he wanted to. Trust me I'm pretty sure if given the choice he'd lock both of you in here until we had to call the police." She didn't give you room to interject—even as you started to speak. "He's an X-Man babe. And well Wade—dipshit that he is—decided to drag him on a mission at the worst fucking second."

The words hung in the air for longer than either of you wanted, but your mind was racing a mile a minute. Mission. A fucking mission. How could you have been so quick to jump to conclusions?

You knew who Logan was the second you met. Understood the importance he held. Yet you never pieced together that two weeks of no contact might have meant something entirely different than a breakup.

"He's..."

"On a mission," she replied—lazily biting into her bagel.

"With Wade?"

She spoke around a mouthful of cream cheese. "If he could die, he'd be a goner."

Already the picture was starting to form. Logan stuck for two weeks with a shitty phone that didn't work, constantly bugged by a man who had a mouth that shit talked faster than he could think. He left to try and be the man he wanted people to see him as. The man that still held a legacy in this universe.

You simply forgot to contend with the fact that you weren't just opening your life up to James Howlett...you were making space for the Wolverine too.

"A year's worth of panic just crossed your face. Wanna talk about it?"

What was there left to say? That you'd been an idiot for believing Logan would leave you high and dry? For letting your doubts get the better of you yet again? Or should you explain that for two weeks you felt an emptiness that scared the absolute shit out of you? As if he ripped a hole in your chest with his claws and had no intention of patching it back up.

"Wade told you this himself?"

She stood, heading straight for the vintage cabinet in your living room that held whatever liquor you kept in stock. "More or less. It was hard to hear him over all the screaming in the background."

Somehow her words didn't phase you—even as she continued to speak about the possibility of what they were up to. You caught the words shovel and stole a truck but nothing beyond that. You took the glass of wine without question—mind focused entirely on the man who managed to turn your word on its head in such a short time.

"When do they get back?"

Her lips curved into a smile that told you one thing: I got you right where I want you.

It took no time at all for you to be thinking of the next time you saw him and hiding it from her felt like trying to build a wall with space on the sides. Enough room for her to sneak into your mind and tug out the truth.

"Tomorrow." She took a sip, settled back down beside you, and reached for the remote. "Wade's throwing a party. Your attendance is mandatory."

A second barely passed before your response was spilling free. Excitement now replacing the doubt that willed itself to stay.

"I'll be there."

"Who had money on the great honey badger expedition?" Wade called out to the rather full living room.

You sat curled on the couch beside Vanessa—a red solo cup filled with shitty beer perched on your knee, condensation spilling across your hand. Dopinder was halfway into a story about his first solo job, Colossus was crammed into a small seat, and Logan sat at the table—his eyes a searing burn against the side of your face.

"Shit," Vaness sighed, digging into her front pocket—a twenty slapped into Wade's hand with a kiss.

You gasped. "Traitor."

"I really thought we were gonna win."

"Who did you bet against?" Your eyes caught sight of the cash getting slipped in Althea's hand—her smile cocky enough to give Wade a run for his money. "Of course."

"If it makes you feel better, Wade is done trying to play matchmaker between you two."

You wondered if you said the word bullshit loud enough it would penetrate through Wade's wall of not listening. The temptation was there. Though you decided to remain silent...for Logan's sake.

Since they returned, he barely said more than a few words to you. Them being hello and I tried to call. You both knew the second part was purely fictional, but figured it was easier to remain silent about it. Arguing wasn't something you were keen on doing—given that he had more than enough time to offer an explanation.

Yet he chose to put distance between the two of you. Sitting in sullen silence, a glass of whiskey nursed slowly and eyes latched onto the way you laughed.

He wanted to speak to you. Tell you how often he thought of you—how many times he made a note of something interesting or funny to regale you with once he returned. But the knowledge that you might very well hate him for leaving silently and without a promise of return, put everything to the back of his mind.

Reconciling with you was the first thing he planned to do.

Yet like he did in his own universe, he chose to keep you at arms length. Away from the insanity of his volatile emotions and dangerous demeanor. You were too good; too breakable.

"Fox and friends!" Wade's voice dragged his attention away from you. Even mere feet away Logan felt you right down to his fucking bones. "I have a special surprise for you heathens. Yeah that's right I'm looking at you Sugar Bear."

A hand gripped Logan's shirt, dragging him up from the chair as he struggled not to slam his fist into Wade's throat. "We're gonna play a little game I like to call Forty Five Minutes In The Closet. I'll pick two people and they'll have to hide the two hundred and seventh bone in the human body."

"It's called seven minutes in heaven. Dumbass," Al muttered.

"No. No, that's something else."

Logan felt the hair rise on the back of his neck at the sight of your smile. How you lit up at Wade's humor. You wore a pair of jeans and a t-shirt, yet he couldn't place a time where you looked more beautiful. If it weren't for the grip Wade had on his shoulder, he'd be asking you to meet him in the hallway—an apology already set on the tip of his tongue.

"Anyways!" Wade shook him violently—knowing that if Logan met his irritation with violence he'd have another problem to worry about. "I nominate this broad shouldered—thick muscled—thunder cunt from down under cunt to be our first contestant."

His eyes flicked to the side, lips curving into a smirk that could only be categorized as diabolical. "Drink some water girls cause things are about to get good."

Vanessa smiled, yanking your arm into the air without warning. "I nominate her to go with him."

"That's right you do baby!" Wade shouted.

"No," Logan growled, yanking his arm away from Wade.

Only to catch how your face fell. You tried to mask it with a laugh, but he could see the damage was done. All the doubts that you fought against began to slowly rise to the surface; each moment spent with him now a time you wanted to get back. But like a trooper, you stood with a glare in Vanessa's direction, and walked towards the hall closet barely big enough for two coats and a broom.

"Go go," Wade shoved him (violently) in your direction, and held the door for Logan to squeeze in beside you. "Now some ground rules. The walls are paper thin so if you end up dancing the Devil's Tango, we'll be making popcorn to go along with the show. Oh and any procreations that come out of this automatically get named Wade."

"You're disgusting," Logan snarled.

"Wade I don't think–"

You heard a loud have fun from everyone outside before the door slammed shut. Darkness swallowed the both of you whole. Yet you felt how close he stood even with your eyes still trained on the door. Heat radiated off his body in waves, soaking into yours with ease. His breath came in quick but released slowly as if he was trying his best to keep his temper steady.

At this point blaming him for losing it wasn't an option. Not when you never expected the night to wind up like this.

You sucked in a deep breath, hands shaking when your heart began to race. You tried to appease every improper thought that entered your mind, but failed spectacularly as they kept on coming. Another sharp inhale echoed mere inches away—his body tensing as your scent deepened. Calling to him like a siren song he needed to answer.

"Stop that," he ground out, fingers curling into fists to keep himself apart from you.

Your eyes met his searing gaze even in the pitch black. "I'm not doing anything."

"You're not. But your body is." He huffed, feeling his willpower begin to splinter when your heart jumped. "How long do we have to...ya know..."

It took you a minute to realize that Logan was suddenly bashful. The urge to reach for a flashlight to see the red that most likely tinted the top of his ears reared its head. You would have done it if it weren't for the way his entire body flinched. His back now pushed against the wall furthest from you.

"Seven minutes," you murmured. "Are you okay?"

"'M fine."

You'd never seen him this on edge before. So close to snapping.

Perhaps it was the way he reacted whilst in your vicinity, or the fact that this was the most he'd said to you in twenty four hours. But the doubt you harbored for two weeks slowly began to shift into a wave of anger. One that demanded at least one final answer as to what you were doing here. What this meant to him.

You wouldn't continue pining after a man who couldn't give it to you straight; not after you gave him so much.

"At least now I can ask you what's going on."

He stiffened, his head snapping up to see your face begin to shift—your tone sharper than before. "What?"

"You heard me Howlett." His lips twitched at the sound of his last name. You fought the urge to land a punch to his jaw he'd barely. "Two weeks of no contact. You gave me nothing. And I was fine with it because I knew you were with Wade, but this? Avoiding me so you don't have to give me a reason as to why?"

"Honey–"

Your eyes narrowed, shutting him up quicker than he expected. "I'm not done talking." Another deep breath set off the last of your rant. "If you don't want to continue whatever this is then that's fine. I've moved on from guys like you before. I can do it again. But now you don't even want to be near me. I don't know what I did to make you–"

The step he took came unexpectedly. As did the next and the next until you were pinned to the wall behind you—his hands on either side of your head. Whatever fight you had left in your system fizzled out when his head dipped and lips slid down the side of your neck. Kissing gently at the vein he longed to sink his teeth into.

"Logan," you gasped, tilting your entire body his way. The reaction was involuntary. As if he possessed you in ways you never expected.

The smile he pressed to your cheek told you he liked it.

"That's what you think huh bub? That I don't wanna be near you?"

"Y-Yes..."

He chuckled. "I just spent two fuckin' weeks in a car with that walking mouth. You think I went of my own free will?" The breath that ghosted along your cheek caused your whole body to shiver. "'M stayin' away honey cause if I get too close I'm gonna do things to you that you aren't ready for."

A fire began to unfurl in the base of your stomach, rapidly coursing through your body without a single warning. He let it happen. He held you there, lips so close you could taste his whiskey on the tip of your tongue, and waited for you to speak. Waited for you to make your final choice about him.

"And if I am?" Your fingers curled into his shirt, chin lifting in a show of defiance. "Ready?"

He groaned at the sight of your fire coming back, his forehead falling to press against yours. "Don't say shit you don't mean."

"I do mean it."

Logan felt his entire body crumple as the familiar sound of his claws echoed in the small space—dust from the now split wall dropping onto your clothes. He could hear Wade's shout of disdain through the already thin walls. But his sole focus was on the way your breath quickened, how your fingers dug beneath his flannel and onto his thin beater.

"What do you want from me honey? Say it. I'll fuckin’ do anything."

The echo of your breathy whine fucked him up for good; ruined any chance of sanity for the rest of the night. If the closet wasn't so damn small he'd grind you along his thigh to watch your mouth go slack. He'd drop to his knees to taste you and drag you over the edge again and again without any intention of stopping.

"I want an apology," you replied, shaking him loose from the haze of lust he found himself stuck in.

His lips curled into a smile. "That right?"

You nodded, fighting against everything in you that screamed to keep this going. To let him kiss you senseless and fuck you against the wall. You didn't care that you were still in Wade's apartment, you didn't care that you were probably down to four minutes and a handful of seconds.

This felt pivotal to the shaky ground you both balanced on. And you were desperate to see what became of the mess that would no doubt come crashing down around you.

"You left." The words were a high gasp as his hand splayed against your stomach. "I-I missed you."

A rumble echoed from the bottom of his chest. "Yeah bub? Ya missed me?"

The words were on the back of your tongue, an explanation on just how much you ached for him. How nights without hearing his voice left you battling demons you usually kept at bay. But his hand was rucking up the bottom of your shirt and the heat of his calloused palm was against bare skin. Dipping lower as your mouth dropped open.

"You got no idea," he growled, lips so close to yours it caused your heart to scream. "How much I fuckin' thought of you. Of this." Fingers slipped beneath the top of your jeans and your head fell back against the wall. "Thought about how sweet you'd taste for me."

"L-Logan–"

He smiled. "Let me give you a proper fuckin' apology."

Echoes of laughter filtered through the already thin door as someone (most likely Wade) told yet another joke. At any other time you would dig up the last strand of your common sense and put an end to Logan's movements. Any other time you'd have enough coherency to understand that if you got caught neither of you would live this down.

Any other time that would have been the first thing on your mind.

But Logan's fingers brushed the edge of your navy blue laced underwear, effectively killing every thought in your head before it could fully form. Your hips canted up into his touch, fingers burying in his hair to tug his face closer. He felt too far even as he pressed you against the cold wall—his body emanating enough heat to have you gasping for air.

"I can smell it," he rasped. "Drivin' me insane honey."

A moan climbed up your throat, but he silenced you easily. His lips found yours in the darkness and you felt your heart cry at knowing he was back. That he wanted you.

You clung to him, tongue meeting his in a messy reunion. All teeth and quick stunted breaths and spit you felt cling to your joined lips. You swallowed his groan with a soft whine of your own. His hand dipped one inch further, fingers prodding against your patch of hair, and you felt your stomach clench.

"Oh–" Your gasp was sharp, loud enough for Logan to cringe as it echoed in the small space.

That didn't stop his fingers from sliding through your slick with a stunted moan. His lips a hot press against your cheek—body caging you into the drywall.

"Gotta be quiet," he whispered.

"S-Sorry–" You dug your teeth into your lip hard enough to taste copper. All in the hopes that it would silence every sound that was desperate to be set free. With the curl of his fingers he struck against your clit in rough strokes, dooming you to the shame that would no doubt come once the both of you stepped out of this closet. "Ah!"

His lips slammed against yours, tongue plunging into your already gaping mouth. He tasted like whiskey. Like everything you longed for in the past two weeks.

Your heart clenched in your chest as he upped the pace of his fingers—the wet echo of your slick now bouncing off the walls. A tremble began to form in your legs and you tugged on his hair to signal what was about to come. But Logan remained one step ahead of you.

He smiled, ignoring the aching throb of his cock as he coaxed you towards a quick and blinding release. One he would replay in his mind for the rest of the night. He knew Wade probably stood outside the door with his ear pressed to the wood, but found he didn't mind. Because you were in his arms, with your lips against his in a dazed kiss, and he had never felt such bliss before.

"C'mon honey. Lemme see you."

"'M almost there," you breathed, eyebrows furrowed and lips parted.

He wanted to eat you alive.

"I know you are. Can feel you leakin' on my hand." His teeth scraped against the shell of your ear, hips grinding along your thigh for some relief. "Let go so I can fuckin' taste you."

A blinding heat began to build faster than you had time to latch onto it; his fingers now tapping roughly against your pulsing clit. You reached for it, let that feeling begin to consume you. Only for something heavy to slam against the closet door—startling the both of you.

Logan ripped his hand away, his body stumbling to the opposite wall. He looked flushed. As if you were the one about to rip a mind numbing orgasm out of his body. Not the other way around.

You coughed, fixing your shirt and jeans as the door swung open. Wade's cocky smile told you everything you needed to know. Being subtle and playing this off was no longer an option, because he knew what you were up to. He could read it on your face.

"What ya thinkin' about?"

"Wilson–" Logan growled, moving to stand in front of you—his claws itching to slide free and dig into Wade's super-healing flesh.

"Wasn't talking to you peanut." He peeked over Logan's shoulder, his smile big and bright and glaringly obvious. "Don't tell me. You two were also debating the logistics of bringing back Robert Downey Jr. to the MCU."

"Shut your goddamn–"

"Because I think it's a money grab. I mean come on Iron Man? Again?"

Logan began to reach for his neck, but your hands pressing to his waist forced him to freeze. You pressed a kiss to his shoulder with a laugh as you squeezed past the both of them. He felt his heart twist in his chest tight enough to send pain down his spine.

Wade still smiled like an all knowing asshole, but the sight of you joining Vanessa on the couch with a sheepish smile eased the nerves that still jumped under his skin.

"Not another word," he spit, shoving a finger into Wade's chest to force him back a few feet.

The man merely smiled—eyes flicking down to the glaringly obvious bulge in Logan's jeans. "Don't tell me. Whiskey dick again? I've told you it's common–"

His claws came free with a roar. Wade's familiar shriek now echoing through the apartment as he sprinted towards your spot on the couch. In the hopes that you might be able to tame the animal intent on ripping him to shreds.

He could count on one hand how often silence echoed throughout the apartment at night. Each time being when Wade disappeared to Vanessa's place with the intent of returning well past the afternoon. Trash still lingered here and there after the small party, but he ignored it in favor of pouring another glass of whiskey.

Falling to the couch with a groan, he felt the weariness of two weeks with Wade on the road resurface in his body. Eventually he'd will himself to sleep. Still plagued by nightmare after nightmare. Except his mind was stuck on the thought of the closet. How you arched into his body with a whine, how wet you were for him in such a short span of time.

There was something addicting about seeing you confront him with your anger. All the fire you kept locked away suddenly became the sole focus of your energy and Logan found he couldn't get enough.

An hour after you were walked home by Vanessa (Wade in tow behind her), he still could smell you on his fingers. The way your scent clung to his shirt when you were up against him. How you moaned for him. So pretty and willing. He couldn't remember the last time he'd sported a hardon for longer than an hour; yet in your presence they always seemed to fucking happen.

The whiskey kept his mind settled on the present moment. On Althea's snores in the background and the city noise that spilled in through the open window. If he was lucky, he'd get twenty minutes in a hot shower with his hand wrapped around his throbbing cock.

That alone kept him from passing out on the shitty couch—his mind hazy and drunk on lust.

A beep from his now charged phone drew his attention to your window across the street. The light was on. So he knew you were awake. But the sight of you walking out into your living room—a black robe wrapped around your body—had him sitting up straight. He reached for the device, flipping it open to see your name flash across the small screen.

Logan couldn't even remember pressing answer. All he knew was that your voice filled his ear seconds later.

"Hi," you said, tone breathy and high. Flashes of you from earlier began to enter his mind.

"Thought you went to sleep honey."

You smiled, pushing the window open—your phone tucked between your cheek and shoulder. "I tried."

"Nightmares?"

"No," you sighed. "Something else."

The feeling from earlier began to lick at his veins again, smoldering beneath the surface of his skin. "Yeah?" You nodded. "What is it?"

The sharp inhale of breath gave him a clear and straight answer. One that had him spreading his legs a bit wider on the couch—eyes fixed on the way you fidgeted with your hands. He wasn't able to get you off earlier; just barely on the precipice of an orgasm before you were rudely interrupted. And though you wouldn't say it out loud, he knew you still felt the remnant of an ongoing fire.

"Wade was kind of an asshole earlier about it," you mumbled.

Logan had never seen you this shy before. He wanted to sear the sight into his mind.

He chuckled, low and raspy; you felt it in your stomach. "He's usually that way."

"He got in the middle of us," you sighed.

"He did." Logan leaned forward, elbows braced on his thighs, and watched as you stepped a bit closer to the window. "What about it honey?"

"Well–" Your fingers toyed with the tie of your robe, eyes glued to the way he got to his feet and moved towards the glass. "My door is unlocked."

The robe dropped to the ground with a soft flutter and Logan's mouth went dry. You stood bare before him, the phone clutched in your hand—determination on your face. He felt every part of his body scream at the sight of your skin—your breasts and cunt—presented to him this way. You were a marble statue straight out of a museum and he wasn't worthy of even getting a mere glimpse.

Your heart hammered in your chest at the sight of his claws coming free—a growl ripping through the phone line. He looked starving. Practically feral at the sight of you like this. You'd never wanted a man to devour you this way before; as if you were the meal to be served up on a silver platter.

Cold air seeped in through your open window, tightening your nipples, and Logan clutched the side of his window frame hard enough for the wood to crack. Your scent lingered in his nose—driving him past the brink of sanity.

"Don't fuckin' move," he snarled, slamming the phone shut in his large palm and heading straight for his door.

Counting the seconds, you remained stuck on the sight of his now empty apartment. People milled along the street down below—the late night goers that headed towards the subway entrance. You only hoped that no one bothered to look up. Or else they'd see you naked and standing before an open window.

Five minutes barely passed before your door was being shoved open, his boots a loud echo in the stark silence of your apartment. You turned—gasping at the sight of him disheveled and panting. His claws slid back as he shut the door with a soft thud that felt like a gun going off. Whatever words you wanted to say—explanations you longed to give for your behavior—died the second he walked towards you. Intent painted blatantly on his face.

Meeting him halfway, you collided against his body with a breathless kiss. Your fingers clung to his back as his hands gripped your bare thighs and hoisted you up. He stumbled forward, slamming you softly against the nearest wall, and took your mouth with a possession you'd never experienced before.

Logan kissed you with a heady fervor that left you dizzy. After so long, the aching need for you began to ebb into a madness that swallowed him whole.

One that demanded to be felt in its entirety.

"I'm sorry," he gasped against your lips, tongue licking along your teeth. "For leaving."

"Logan–"

He shook his head, gripping the back of your neck to draw you in for another kiss. "'M never leaving you again honey. Got that?"

With a nod, you pulled him back—tasting the remnants of whiskey and a cigar he must have smoked after you left. He growled into you, hips chasing your dripping cunt as it slid along the crotch of his jeans. Soaking him before he could even get a chance to taste.

There was no denying what this would lead towards. What those days of conversations and quick glances would amount to when the tension finally broke. Logan expected to be left with the fragments of a broken relationship that never was. You were adamant on making it become more.

"I want–" You pulled away with a sharp gasp, his lips slotting against your neck—working down the skin with gentle bites. "Want you inside me."

His forehead pressed to your shoulder, a groan ripping from his chest. "Fuck."

Your lips connected to his neck when he began to walk, teeth sinking into the veins that ran down into his shirt. Logan had to struggle to keep his feet straight—his fingers digging into the soft flesh of your ass. He couldn't figure out how he managed to have such a stroke of luck. What occurred for him to have you in his arms, naked and wanton and grinding against his leaking cock that smeared inside his jeans.

A soft moan was pressed to his ear when he dragged your hips along his. The final steps into your bedroom now turning into a race to get you spread beneath him. To finally have you in ways that left him worried for his own psyche.

"Driving me fuckin' insane honey," he bit out against your ear, dropping you onto the soft mattress.

You smiled—eyes dark and shining with a cloud of lust. "So are you." Your fingers tugged at the bottom of his shirt. "I've been wanting you to touch me for weeks."

He wasn't going to fucking last.

Yanking off his shirt, he let both of them fall to your floor—giving you free reign to drink in the sight of him above you. The soft touch of your fingers trailed down his arms, tracing the veins in fascination. Your lips parted, chest rising and falling with each quick breath, and Logan felt the strings holding his self control in place snap.

He dipped down, sucking your peaked nipple into his mouth with a groan.

"F-Fuck," you sighed, nails digging into his shoulders so hard he felt his skin rip before it healed over. His cock jumped with the pain—hands fisting your soft comforter to keep himself stable.

"Do that again."

He caught a glimpse of your fucked out smile before your fingers were digging into his back, scratching lines across his skin. A loud moan slipped past his lips as he worked his way down your body. Lips trailing along your stomach—teeth sinking into your hips so hard it would hurt tomorrow. And you scratched line after line into his skin.

Adamant on leaving a mark that might stay till the morning.

"I didn't get to taste you," he murmured, hands moving to spread your soft and supple thighs.

"The closet was too small—oh–"

His nose pressed to your mound, inhaling the scent that drove him feral for weeks on end. Logan was fully aware how animalistic he turned the second his eyes landed on your glistening cunt. He wouldn't be surprised if drool began to slip from his mouth at such a pretty sight.

"Fuckin' gorgeous."

Hazel eyes darkened at the sight of you clenching around nothing—your hand delving into his already mussed hair. No response existed when he looked at you like this. When his thumbs spread you obscenely with a hoarse groan.

"Logan," you mewled.

Trying to form a coherent word flew out of your mind, his touch all you could focus on. A sharp cry fell past your lips when his mouth sealed over your cunt. Tongue flicking your clit and thumb sliding between your dripping folds.

Your legs were hitched to his shoulders, body bent upwards as he ate you like his last meal. His eyes fluttered shut with a moan and he sucked at your clit, rolling it along the tip of his tongue. Sounds you'd never heard before ripped from your chest, your fingers scrambling to grab onto his arms. To find an anchor in the dizzying pleasure he dragged you towards.

The simmering heat from hours before rose up in your body quicker than you expected. Reminding you that he'd already brought you to the edge once.

This time wouldn't take long at all.

He groaned, two fingers prodding at your entrance, and buried his tongue between your folds. The wet sound of his mouth sent a flare of need through your chest—drawing your lungs tight and near the precipice of pain. Breath became nonexistent as he lapped at you—his fingers sinking right down to the knuckle. You clawed at his skin, mouth open and chest heaving.

"Fuck–" Rough pads curled along your walls, striking against a spot you'd never reached on your own. It tore a cry from you, your legs now a trembling mess over his shoulders.

But he kept going. Ate you without stopping. As if breathing was secondary to the taste of you spread on his tongue.

"I-I'm gonna—fuck Logan!"

A growl was mumbled into your cunt, eyes now sharp and focused on your face as it screwed up in pleasure. The echo of your slick filled your ears, his fingers pumping into you and mouth drinking down everything you gave him. It all became too much. Until something bright and searing began to unfold in your body.

His teeth scraped your clit with another rumbled sound, and whatever remained to hold you together snapped. A sob of his name was yanked from your throat, fingers gripping at his hair to keep him still as you grinded against his tongue. And he collapsed onto the mattress, hips pushing into the bed while you used him.

Tears pricked the corners of your eyes when the final dregs of your release began to seep from your body. Even while his tongue continued to lap at you—roughly moaning at the taste of you leaking into his eager mouth.

"Wait," you sucked in a breath, hand pressed to his head to keep him at bay when pain sparked through your body. "T-Too much."

His lips curled into a smile, canines on display and mouth shiny with your slick. "'M gonna do that again." Your eyes widened in protest, only for him to get to his feet. "But first honey. I'm gonna fuck you."

The flame sparked to life again, slowly simmering at the base of your stomach. You met him halfway, crawling to your knees to reach for his belt buckle. Lips sliding against his in a messy kiss as he shared your taste, licked it into your mouth with a sigh. It wasn't until your hand dipped into his jeans that he stopped you—his eyebrows pulled together and lips swollen.

"Hold on."

"What's wrong?" you murmured, kissing his chest and biting at the muscle.

"Not—ha—" His hand gripped your ass at the feeling of you tugging at his jeans; your fingers slipping down to cup him gently. "Not gonna last very long if you do that bub."

You grinned. "It's only fair. After you got to taste me...James."

"Shit." A hand on your throat dragged you back to his lips, to the hot slide of his tongue along yours. "Later. I'll let ya do whatever the fuck you want with me later."

Oh how you liked the sound of that. Images of getting him beneath you, of his head tipped back in pleasure, filled your mind. They begged you to make it reality.

Logan however had other plans.

"But I want to suck you off," you pouted.

He felt his cock leak down your hand, the pearly precum now spread along your thumb that rubbed at his vein. Weeks of starving for you left him an impatient man. Yet something told him you saw it clearly in the way his whole body tensed. His fingers digging sharply into any part of you he could reach.

Reaching for your leg he hooked it around his waist and knelt on the bed—his jeans and boots in a heap on the floor. Your lips never strayed far from his, fingers dancing along his bare back—feeling the muscles shift beneath hot skin. He wanted to lay you out beneath him, but the need for more began to eat at both your hearts.

This wasn't a quick and fast fuck. He wouldn't leave in the morning with no notice. No, Logan knew that when it came time for the sun to rise in the sky, he'd be back between your thighs with a sated smile on his face.

"Gimme a second honey," he panted, gently removing your hand from his cock. "Don't want to fuck this up."

You laughed, nuzzling his cheek as he dragged his head through your folds. "You won't baby."

The word slipped off your tongue with ease, but he felt like a shot had just gone through his chest. Somewhere between the two weeks spent apart and getting you like this—wrapped around him entirely at peace—Logan made a choice. He understood what this meant. He knew that you weren't temporary.

Perhaps it was stupid of him to dive in so quickly. Perhaps you’d regret this choice in a month or two. But he was tired of hiding from a past version of himself that continued to haunt his waking life.

He wasn't going to be the man who ran.

He would forever remain the man who stayed.

Your face contorted the second he began to slip into your dripping cunt—fingers sharply digging into his shoulders as he stretched you slowly. Teeth sunk into your bottom lip before your head fell back—a guttural moan pulling from your throat at the feel of him.

"Big," you rasped, hips canting down to help him.

White flashed behind his eyes when you clenched, a broken grunt pressed to your chest. "You can take it for me."

"I–" Another short thrust had him slipping into you with a sigh of your name. "O-Oh fuck."

He felt his claws bite at the skin of his knuckles, his teeth now a sharp prick at the top of your breast, as you settled into his lap. Sitting on his cock with a garbled shout of his name. His hand cupped your jaw, tilting your face back to his, and Logan could feel the pull of his orgasm draw tight in his body at the sight of you entirely fucked out.

"You with me?"

Lips curled into a soft smile, your eyes fluttering open. "Feels like you're in my chest," you mumbled.

Pride bloomed in his stomach, mixing with the heat that ate him alive. "Yeah?"

No answer was given because you'd decided it was time to move with a shift of your hips. He let you take the lead, giving what you could take and pulling back when your face screwed up in pain. He wasn't a small man—that he understood plainly. But the sight of you grinding along his lap, fucking yourself on his cock, had him nearly begging for more.

You gripped his shoulders, clambered to your knees, and sunk down on him again in one swift plunge. Logan choked on his spit the second you started to ride him in earnest. Sinking down on him in short repeated thrusts, you found his lips in a kiss that melted away into a mess of teeth.

"So fuckin' perfect." He gripped at your hips, pulling you down on his red and aching cock. "Takin' me like you were made for it honey."

A whimper met his ears at the slight shift in angle—the head of his cock now pounding against the spongy part of your walls. He grinned at the sound, helping you move just a bit quicker in order to chase the high that built rapidly in your body.

"You were made to fuckin' take it huh?"

You nodded, eyes bleary with tears. "Uh huh," you sighed.

"Made to fuck my cock," he growled. "To cum on it."

"L-Logan–" you whined, thighs shaking with the effort of riding him. He noticed seconds before you did.

"I know baby," he cooed, pushing you back onto the bed and sinking into you with a sharp thrust that sent his name careening from your mouth. "'S too much for you."

Hooking your legs over his shoulders, he claimed your lips in a final kiss before setting a pace that had you clawing at his shoulders. It was almost punishing how good he fucked you. His hips pounded into yours, the repetitive slap of skin against skin now louder than your combined moans.

You felt the string begin to draw tight again, pulling at each muscle and tendon in your body. The walls of your cunt clamped down tight, drawing him in as your hands braced against his chest—your eyes rolling back at the feel of his body dragging against yours.

"There we go," he grunted, fingers sliding through your slickened mess to rub at your clit in small rough circles. "C'mon bub. Fuckin' cum on it yeah?"

"Ah!" Fighting for breath, you felt your entire body break as bliss flooded your system.

The scream of his name pierced his eardrums and Logan swore he felt his soul snap in half at the sight of you so lost in your pleasure. Chasing his own high, he bracketed his arms against your head, his claws now scratching at the wood of your headboard as he fucked into your pulsing cunt. The feel of your hand on his back, your lips against his jaw, sent him flying off behind you.

A rough snarl tore from his mouth as he came, burying himself deep enough to send pain down your thighs. The warmth of him spurting into you sent another flare of heat down your spine, sating whatever unconscious need you harbored to have him this way.

His head dropped to your chest, claws embedded in your now ruined pillow, as his cock began to soften. Your bodies reaching a level of comfort that hadn't been there before.

You ran a hand through his hair, toying with the locks as your eyes fell shut and legs moved to wrap around his hips. It shocked you how much you longed to remain like this. Pressed against his naked body with sleep lingering on the edges of your mind. You nearly asked if he felt the same, but the contented sigh that brushed against your breast gave you the answer you wanted.

"We're doing that again," he mumbled, kissing at your still hard nipple.

"Soon hopefully," you smiled.

"Mm." His cock stirred to life slowly, sending a wave of surprise down your spine. "Careful what you wish for bub."

"At least let me get some water," you mumbled, drawing his face back to yours—thumb running along his cheek. "Then you can–"

Your eyes flew open at the sound of something blasting from across the street. Logan turned with an irritated grunt as a song began to filter through your open living room window. One that you recognized instantly as WHAM!. Careless Whisper if you were shooting for accuracy.

Logan groaned, dropped his face to the crook of your neck. "I'm gonna fuckin' kill him."

A shout bounced off the buildings, Wade's voice suddenly louder than the song. "That's what I'm talking about honey badger! Al give me back my fucking twenty!"

You laughed, trying to listen to what else he said, even as Logan began to kiss a trail down your shoulder. His mind focused on far more important things than his fucking roommate. The song continued to play, Wade singing along horribly, and you suddenly felt your future encompass you with a warm smile.

A life of joy, of passion, of family.

Sinking into his touch with a sigh, you let the worry fall from you in layers. The promise of this, no longer a fantasy.

note: they finally fucked y'all! if you finished all of this then i love you. drink some water per wade's words from earlier.

[pastryfication]

would you consider doing part 2 to the crash where the boys reunite with reader??

you’re everything that i want

pairing: oscar piastri x f2 driver!reader, lando norris x sister!reader note: part two to this.

content warnings: mentions of hospitals, injuries and a crash.

the hospital hallways stretch endlessly, each corner looking the same as the last. lando and oscar are rushing, a mutual feeling passing through them as they practically run through the busy hospital. but as they finally reach the door to your room, a heavy silence settles between them.

they know you’re stable, but that word had never felt more fragile. the crash, the screaming sirens, the gut-wrenching wait—they had both been on the edge of losing you, and that fear still lingers, clawing at the back of their minds.

lando hesitates, his hand hovering over the door handle. he’s never been afraid of much, but right now, he’s terrified of what he’ll see on the other side. oscar watches him, his own face pale and tight, but it’s lando who finally pushes the door open.

the sight of you hits them both like a punch to the gut.

you’re there, in the middle of the sterile, white room, looking small and fragile against the stiff hospital sheets. wires snake around your body, connecting you to machines that beep steadily, and bruises cover your usually vibrant skin. but it’s your face—pale, tense, and etched with pain—that makes them both freeze.

lando’s breath catches in his throat. he’s seen you on the edge before—crashes, spins, close calls—but nothing like this. nothing that left you looking so broken. his eyes dart over every inch of you, searching for any sign of the sister he knows, but all he sees is pain and it crushes him.

oscar takes a shaky step forward, his heart lodged somewhere in his throat. you’ve always been the strong one, the fearless racer who never backed down, but the way your face contorts with pain as you struggle to take a breath sends a jolt of terror through him. he’s seen you battle opponents on the track, but now, you’re fighting something invisible and relentless, and he feels powerless to help.

you look up as they enter, your expression caught between relief and agony. “hey,” you whisper, trying to sound normal, but your voice trembles, thin and strained. it’s a sound they’ve never heard from you before, and it shatters whatever composure they were clinging to.

lando reaches you first, his eyes glassy as he tries to keep it together. he grabs the nearest chair and sits down, taking your hand in his, squeezing it as if he’s trying to ground himself, too. “you’re okay,” he says, but his voice wavers, thick with emotion. “you’re… you’re going to be okay.”

oscar stands frozen at the foot of your bed, swallowing hard as he takes you in. seeing you like this, in so much pain, makes his stomach twist violently. he wants to say something—anything—but words feel stuck in his throat. all he can do is watch, his eyes filled with fear and helplessness.

you try to smile, but it quickly turns into a grimace as another sharp wave of pain crashes over you. your breath hitches, and you grip the bedrails, your knuckles turning white. “it hurts,” you admit, voice cracking as tears pool in your eyes. “it hurts so much.”

lando’s face crumples, the sight of your tears breaking something inside him. he squeezes your hand tighter, his other hand gently brushing a tear off your cheek. “i’m here,” he says, his voice breaking. “we’re both here, okay? we’ve got you.”

oscar finally moves, his legs feeling heavy as he sits beside you on the bed. he gently takes your other hand, his touch light but firm and grounding. his eyes are locked on yours, filled with raw, unfiltered emotion. “we’re not going anywhere,” he says softly, his voice laced with a mix of fear and determination. “just breathe. we’ll get through this.”

you lean into him slightly, seeking his comfort even as the pain spikes again, sharp and unrelenting. oscar’s thumb rubs slow, soothing circles on the back of your hand, and he places a long, lingering kiss in your temple as if trying to share some of your burden. “i’m right here,” he murmurs, voice low and calming. “just breathe with me, okay? we’ve got you.”

lando’s other hand rests on your arm, rubbing gentle, reassuring circles. his eyes are glued to your face, his heart aching at every wince, every pained breath you take. “you’re the toughest person i know,” he says, trying to keep his voice steady even as his own tears threaten to spill. “if anyone can get through this, it’s you. and we’re going to be here every step of the way.”

you nod, feeling the burn of pain and the flood of emotions all at once, but their presence—their unwavering support—gives you something to hold on to. it’s enough to keep you breathing through the pain, knowing you don’t have to face it alone.

oscar presses a soft kiss to your forehead, his lips lingering once again as he fights to keep his own emotions in check. “we’ll get through this,” he whispers, his voice filled with quiet determination. “one breath at a time.”

and as you squeeze their hands tighter, you realize that’s all you need right now: lando’s steady words, oscar’s calming presence, and the unshakable reassurance that they’re here, right beside you.

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[milf-murdock]

The Accident

Simon “Ghost” Riley x Reader (Established Relationship)

Summary: Simon gets the call that you’ve been in an accident and are in the hospital.  Warnings: Health scare, mention of hospitals, accident (non graphic), brief mention of injuries (non graphic), hurt/comfort, Soft Simon  A/N: This piece is dedicated to a very sweet anon who has been through a lot. Anon, I hope this brings you some comfort <3 I’ve also decided to submit it to @glitterypirateduck's May Writing Challenge! This is one of my favorite tropes, so I hope you all enjoy! Special thank you to @sim0nril3y for taking a look and for all the support

The knife glides effortlessly through the tomato, the metal utensil familiar in Simon’s grip. He makes quick work of the produce, fingers moving rapidly and precisely. “Knife skills aren’t just for the field,” he chuckles to himself as he adds the chopped remains to a bowl before turning his blade on a shallot. 

Just as he slices into the root, the clattering vibration of his phone against the countertop interrupts. Simon frowns at the unfamiliar number flashing across the screen. Not many people had this number; he wasn’t one to get stray phone calls, which is exactly how he likes it. He has half a mind to send it to voicemail, but something tugs at his edges. At the last second he swipes across the screen and raises the phone to his ear. The line is empty for a moment. 

“Simon?” The sound of your hoarse voice has Simon’s spine straightening, instantly on high alert. 

“What’s happened.” The sharp words come out more like a statement than a question. Simon’s heartbeat quickens. 

“I’m okay,” you start, but your wobbly voice betrays you. "But there was an accident—" Simon is in motion. Dinner is forgotten on the counter as he heads for the door, stepping into his boots on the way. 

“Where are you?” There’s a commotion in the background, some kind of beeping that Simon can’t make out. He catches your hesitation as you wait to reply. 

“Love. Where. Are. You.” His words are clipped, and for a split second he fears the phone might actually splinter in his hands given how hard he’s clenching the device. 

“I’m in A&E. I—the ambulance just brought me here.” 

Simon’s world tilts before him, and he squeezes his eyes shut, breathing in deep. One single stabilizing breath is all he allows himself before opening his eyes, resolute determination clear on his face as a decade of training takes over. 

“I’m on my way.” The phone clicks off as he grabs the keys off the hook by the door and rushes to the car.

The drive is a blur; he doesn’t pay attention to how fast he’s going, or what color the stoplights may be. Traffic laws are relative—he’s a man on a mission. His sole focus is getting to you. His heart pounds in his chest as he navigates the final turn, the hospital finally coming into view. 

The car barely comes to a full and complete stop at the entryway before Simon’s door flies open. 

“Sir, you can’t park here!” A disgruntled attendant calls out to him as he exits the vehicle, but Simon doesn’t even slow down, stepping around the irritated employee before barreling through the hospital entrance. 

Only to be brought to a halt at the open lobby before him. 

Shit. He hadn’t even thought to ask what room you were in. The frustration intertwines with the panic, and Simon has to force it down. 

He’s here. He’ll find you. 

And so Simon finds himself at the mercy of the kind, elderly receptionist, who seems to be taking her sweet time locating your information. 

Simon tries not to crack the counter beneath his grip, foot tapping against the ground in irritation. You could be in surgery, you could be bleeding out, any number of things could be happening right this moment, and there is nothing he can do. Simon silences these thoughts, keeping the panic at bay. “Keep it together, lieutenant,” he reminds himself silently. 

The receptionist, Shelley, her name tag reads, is unfazed by his erratic state, eyes squinting as she adjusts her glasses and leans back from the screen. Simon runs a hand down his face, using every ounce of self control he has to keep up a semblance of propriety. 

“Ahh,” Shelley announces triumphantly. “Here they are! I found them.” She turns her gaze to the hulking man in front of her, taking in his large form and tentatively eyeing the tattoos along his forearm. “Sorry, what was your relation to the patient again?” She asks, a note of uncertainty laces her tone. 

“I’m—” he hesitates. No words come to the tip of his tongue. He’s not a boyfriend for christ’s sake. Not your husband, though he wished more than ever he could use that word right now. 

“Spouse? Partner?” Shelley raises an eyebrow, trying to help fill in the blanks here.

Simon swallowed hard. “Yeah, partner. Just, can you tell me where they are? Please.”  

He’s not sure what comes over him as he tacks on that final plea. The desperation is clear in his words, but he couldn’t care less. Fuck it, he is desperate. Desperate to see you. Desperate to know you are okay—see it with his own eyes, feel your hands in his. 

Shelley’s pointed gaze turns to one of sympathy. “Room 315, dear. The lift is to the right.” 

The words are barely out of her mouth before Simon’s in motion once more. No time for the lift, he thinks to himself as he heads to the stairwell, taking the stairs two at a time up to your floor. Brown eyes frantically scan every room number as he searches for yours before finally finding the correct digits outside the room furthest down the hall. The metal of the door handle is cool beneath his touch as he pushes open the door, charging into the room.

He comes to a stop at the foot of the bed, eyes frantically scanning your body, taking stock of each and every visible injury. He can hardly control the wave of emotions that threaten to pull him down as he takes in your bruised and bandaged appearance. 

They’ve already set your arm in a sling, and there’s a large bulk encompassing your entire right leg, the bulk of it obvious even under the thin hospital blanket. An array of cuts and scrapes mar your perfect face, and the sudden onset of pure, unadulterated rage threatens to swallow him whole. 

‘I’m going to kill them,’ the words echo in his mind–a dozen violent deaths planned out for whoever did this to you. 

“Simon,” your hoarse voice calls out to him, but he can’t hear you over the sound of the roaring in his head. 

‘I’m going to hunt them down. And I’m going to fucking kill them for this.’

“Simon,” you say his name louder, firmer, and attempt to sit yourself up. Pain radiates through your body, piercing through the haze of pain meds, and you can’t help the cry of pain that escapes your lips. 

That is what pulls Simon out. On instinct, his feet move towards your bed, hand reaching out to clasp around your free hand. 

Your lower lip trembles. “Simon.” The word is pitiful on your lips–a plea, a prayer, a cry for help. 

It’s enough to pull Simon from the depths of this rage–revenge can wait. 

“I’m here.” Simon’s voice wraps around you like a warm blanket, and the dam breaks, tears flowing fast and freely. “It was awful,” you gasp out between sobs. Simon makes soothing shushing sounds as he holds your hand tight in his own, his other hand reaching up to gently brush the tears away, taking care to avoid the scrapes that litter your skin as you recount what details you can remember of the accident. 

“Shh, love, it’s okay,” he murmurs, pressing a kiss to your temple. “‘M sorry I wasn’t there, babe.” Bile threatens to rise in the back of his throat as the guilt settles in.

“Should’ve been there, should’ve never left your fucking side.” He stares at the layers of gauze wrapped around your leg, hidden beneath the thin blanket. 

“Simon. Look at me,” you insist, waiting for those brown eyes to turn back to you. “Don’t go down that road, Si. There was nothing you could have done to stop this.” 

“You don’t know that,” he bites back. Simon immediately regrets the harshness of his note. “You don’t know that,” he tries again, softer this time. “Should’ve been there.” He runs a hand over his face, the adrenaline is fading, causing the events of the past hour to finally catch up to him. He exhales sharply and looks back up at you, eyes determined. 

“But ‘m here now. It’s over. I’m here.” He gives your hand a gentle squeeze. “And I’m not going anywhere, love.”

True to his word, Simon stays by your bedside the entire three day stay in the hospital. He denies your pleas to go home and sleep in his own bed, insisting on sleeping in the rough, uncomfortable hospital recliner. Not only was the furniture laughably small for a man of his stature, but after the first night, Simon is convinced it was designed as some kind of long-term-torture device. Not once does he complain though, dismissing your worries with a casual wave of his hand. “Slept in worse conditions in the field, love. This beats a forest floor.” Though by night two, Simon isn’t so sure. 

He’s always struggled with nightmares, but those nights in the hospital, his dreams turn to something worse: losing you in a car accident. The scene replays over and over in his mind’s eye until he’s woken up with a start, covered in sweat, and gasping for air. His eyes instantly lock on to the vital signs monitor above you, watching the thin green line of your heartbeat bounce up and down in a steady rhythm. He slows his own breathing down to match pace with yours, staring down at you as you sleep soundly. He watches the subtle rise and fall of your chest, further confirmation that you’re alive. 

When he finally gets to bring you home, he acts as though you’re made of fine china, driving ten under the speed limit. He carefully guides you into the house, hands ready to catch you as you struggle with the metal crutches. 

“Fuck,” you spit in frustration. “They made it look so easy in the hospital.” 

After the second time you almost trip over them, Simon’s exasperation gets the best of him. 

“Easy, swee’heart,” he implores, a note of desperation in his voice. “Just got you back, yeah? Can’t have you goin’ right back to A&E.” 

He wishes more than anything he could just scoop you up into his arms and carry you straight to the bedroom, but with your leg in its current state, he has to settle for just hovering, perpetually at the ready to catch and support you. He swears the walk from the car to getting you settled in bed takes an entire year off his life. 

That first night back at home together, Simon lays awake, watching you sleep. The combination of finally being back in the comfort of your own bed, along with the lack of obnoxiously loud machines beeping and being encumbered by wires, means you fall asleep almost as soon as your head hits the pillow. Simon lays beside you, as close as he dares to get, still so weary of your injuries. He leans over to press a gentle kiss to your temple, just above where a deep cut runs down your face. His finger hovers just above your skin as he traces the shape. “‘M sorry, love. I promise, I’ll take care of ya. This won’t happen again.” His words are barely above a whisper, drowned out by the soft snores of your breathing. He presses one more gentle kiss to you before turning out the light. 

[lanabuckybarnes]

Would you write a plus size reader w either bucky or steve(or both) where they are her first real relationship and she gets scared that she doesn't deserve to be with either of them and so she tries to push them away so she doesn't get hurt but instead they show her why she is their person.... like tooth rotting fluff and the filthiest smut..... if that's okay if not no worries

| All Yours, Only Yours |

18+ Minors DNI

✧Pairing✧ Bucky Barnes x Plus Size!Reader

✧Warnings✧ A lil angsty, Sharon being a big bully (like seriously you’re 50 and you’re bullying someone? ick), Name calling, Angry Buck, Crying, Bucky is a simp, Confessions, Marking, Dry humping, Oral (F), Fingering (F), Teeny bit of cum play, Dirty talk, Unprotected PinV, Praise, Petnames, My shitty writing — again very tame for me but i didnt want to go overboard. If there any more I’ve neglected to add please let me know.

✧Word Count✧ 4.3K

✧Author Note✧ I really hope you enjoy this and I've done your request justice, I honestly tried my best but idk…Anyways!!! Much love to everyone, please let me know what you think. Love ya xxx

“Still not answering?” Natasha asks from her spot in the cockpit, concern evident from the wrinkle between her brows.

“Nope” he spits his reply, reeling from the whole ordeal. He thrusts his phone into his jean pocket, sick to the back teeth of nothing but a black screen greeting him instead of your sweet little messages.

“Did you piss her off or something?” Sam tries to lighten the mood but is swiftly shut down, his hands rising in surrender at the killer glare the brunette shot his way.

“Calm down everyone, we’ll be home soon so we can figure this out” Steve, the voice of reason commands order within the small confines of the jet. He sits, a gloved hand rubbing over his friend's shoulder trying to reassure his muddled brain but to no avail.

Bucky is pissed. He’s pissed and he’s worried sick. A week he’s been gone for and he’s missing you like crazy. The only issue? You are ignoring him, straight up ghosting his brooding ass which is completely unlike you. Often on missions when Bucky clicks his phone on he’s greeted with a flurry of messages from you; photos of little birds you see on your walks, photos of alpine taken at odd angles and constant little messages that make his heart full and ready to continue his painstaking missions—none of it, just a notification from your favourite restaurant offering a discount to keep him happy.

As soon as this jet landed he was going to get to the bottom of what was going on and then he was going to cuddle you to death as punishment. Not that he’d let anyone else know that.

One Week Earlier…

Beep beep beep. Bucky’s alarm sounds at the ungodly hour of five am, his groan following. He didn't want to get out of this bed, he was too warm, his huge body wrapped around yours. Your movements spurred his own, your arm reaching over to switch off his alarm while he pushed himself into a sit, thoughts already on the mission afoot.

“Morning,” your raspy voice purrs, bringing his attention back to you. His eyes fall to your face; following the slope of your puffy cheeks up to your barely open eyes, your hues peeking through only enough to tease him. Putting his weight on his right arm he’s on top of you before you can blink, his head tucked into the crook of your neck, peppering tiny kisses along the warm skin.

“Morning princess,” he bites back his yawn, shifting so his hips slot in their spot between your plush thighs, loving the way they wrapped around his narrow waist just the way he loved. Practice truly did make perfect. His dark vibranium fingers drifted from your collarbone, over the swell of your breast until it found its favourite perch on your hips.

“So fucking pretty” he breathes, his pupils dilating to let more of you in — until you pushed him away.

“You gotta get ready Mr” you giggle, moving your foot so you could push him further away, ruining his plan B of pinning you down by your hips.

“Don’t remind me…”

His cold left hand hooks around your ankle, pushing at it until your knee hinged, bending up and out. A suspicious hardness presses against you, a wicked smile on your boyfriend’s face.

“I mean it Buck we can’t, Nat will be kicking that door down any minute” he groans at your words knowing that you are completely right. That lock had been replaced an embarrassing amount of times because of that exact situation. You hated rejecting him, knowing that he could easily put you back to sleep until midday if he wanted. After a small standoff between you both you warn him again, an arch in your brow and a growl behind his name.

“You’re such a little tease, you know that?”

You laugh, sitting up, watching him skulk around the room in nothing but his grey Calvin Kleins, “I haven’t done anything!”

“Sure you haven’t” he argues, moving over to you again, his metal fingers looping under your chin to tilt your head back to gaze up at him, “Looking so fucking sexy in the morning and I can’t fuck you stupid. That’s not teasing that’s damn near criminal.”

You groan, rolling your eyes at your pouty 106-year-old man. You inch closer to his mouth, a sickly sweet definitely not bratty smirk on your face. “Get your ass ready.”

“Fine…but only because you looked so fucking sexy ordering me around,”

“Bucky!” You shout after him, blush on your full cheeks. He only smirks over his shoulder, pushing his briefs to the floor at the entrance to the bathroom, giving you a full view of his posterior.

You get up too, knowing you had been awake too long to fall asleep again. You get ready with the shower as background noise, pulling on some workout clothes. Today you decided you’d try out the gym right here in the compound, you’d been to many different ones in the past; often polluted with the smell of days-old sweat and men reeking of testosterone, grunting and groaning at weights you could only dream of lifting.

An hour later, after waving Bucky off on his week-long mission you were in the gym.

“Hey” you smile as you pass Sharon, her blonde hair whipping as she ducks and weaves to dodger imaginary punches the bag throws out before throwing a couple of her own. She offers you a tight-lipped smile, her eyes straying from your face down your body. She takes note of your long top and shorts that settle around mid-thigh compared to her sports bra and tiny shorts — her flat stomach and sculpted legs on display.

God you wish you had just as much ventilation. Just as you go to place your earphones in your ears you hear a scoff coming from Sharon’s direction. You pay it no mind, setting the treadmill for a nice incline and pace, pressing the timer until it shone with the time you wanted.

The treadmill slowed for the cooldown. Your eyes moved from the display in front to glance over your shoulder, the gym was empty. You grab your bottle only to realise thanks to your distraction you'd finished off your water. You stop the treadmill and hop off, making a beeline for the kitchen. The walk to the kitchen from the gym wasn’t that long but with the feeling of your sweat culminating in places you didn’t want it to be it was almost torturous.

“I couldn’t believe it when I saw her,”

A gaggle of hushed laughs comes from the kitchen, stopping you. A familiar dread coils in your stomach, reminding you of when you were young, the children pointing and laughing — joking at your expense.

“she must been on that treadmill for about five minutes and she was all like huff huff” she laughs obnoxiously “Her face was like a big tomato, I almost died trying to keep myself from laughing” Sharon continues.

The group cackles again at your expense, almost doubling as Sharon makes the huffing noise again. You cling to your shirt, pulling it from sticking to your body. These women you thought were friends did just what everyone else did.

“She’s pathetic, I don’t know what Bucky sees in her” Your heart stops. That little devil on your jumps and cheers at the confirmation of what it has been telling you since the start of your relationship with Bucky. You were never enough.

“I can’t wait for him to dump her once he gets sick of her wide load.”

Tears fall on their own accord but you don't register them, too busy inside your head being suffocated by every doubt and self-conscious thought you ever had since you confessed your feelings for the super soldier. You didn't deserve Bucky and everyone thought that too.

Back at your room, freshly clean. You scrolled through your messages from Bucky. The little hearts next to his messages no longer felt genuine like he was only doing it merely to save your feelings from being hurt. You were nothing but a burden that he was forced to bear; it wouldn’t be long before like Sharon said, he got sick of the clinginess and the need for reassurance and broke up with you.

Well, you weren’t going to be a burden any longer. You wouldn’t let him break your heart first. You turned your phone off, tucking it into your bedside drawer.

—

“Bucky wait!” Sam calls from the quinjet but it goes ignored. Bucky’s face is twisted in annoyance as he takes wide, purposeful steps towards the tower doors. He was going to find you and you were going to tell him why the fuck you were ignoring him.

He ignores the shouts of his name as Nat, Steve and Sam follow him indoors, smashing the elevator button with his thumb and stepping inside. Once on your floor, he stormed like a charging bull to your room, slamming a gloved fist on your door in a poor excuse for a knock.

The loud knocking from the other end of the room had you jumping back in your seat, the slee overtaking you gone in an instant. Your heart lurched at the familiar face, worn from exhaustion and malice clear from the scrunching of his forehead and tick in his cheek muscle.

“Oh hello, where have you been?” Bucky snaps, glaring down at you as you use the door as a shield from his scrutinising eyes. Here it comes, the moment you’d prepared for all week. You don’t think you’ll go back to dating apps, too many weird me—

“You know how worried I was when you didn't answer me all week?”

Huh. “Huh?”

“‘Huh?’ Are you joking? You ghosted me, left me scared to death on a mission halfway across the globe and all you can say to me is huh!” His blue eyes glisten and you look at them closer. There was no anger there, only concern and fear culminating in swirls across his blue orbs, rearing its head in rage across Bucky’s face.

“Bucky I—” you try but you can’t find the words, each syllable sticks in your throat, balling up until it feels like you can no longer breathe. The week of bottled-up emotions spills forth at the sight of him — at the revelation that he was utterly terrified. Tears fall from your eyes before you know it, your lip wobbling as you keep trying to speak.

Bucky’s shoulders tense at the sight of tiny tears falling over your full cheeks, guilt replacing his earlier pain,

“Fuck c’mere baby” he pulls you close, bending at an almost uncomfortable angle just to hold you as close as humanly possible.

“I'm so sorry for being so annoyed but you have to see why I was so scared something had happened to you. You left me on read for an entire week and blanked my calls. That isn’t you, you know how scary that was for me?” He whispers so softly, backing you up to sit on your bed.

In his arms, surrounded by his warmth and scent the week you had fell from your mouth like alphabet soup, from the gym to Sharon to how hard it was to ignore your phone knowing that Bucky would’ve been calling you every single day but you did it to protect your own heart. Nothing was kept a secret.

“I’ll kill her,” he growls when you finish, muscles tightening even more around you.

“Buck.”

“Right…sorry, I won't kill her” He lied between his teeth, well sort of. He wouldn’t actually kill Sharon but he knew you'd be upset if he did anything to her which he was indeed planning to do but to save you any more pain for the evening, to keep that teeny tiny smile on your face he lied.

“What makes her think she has any fucking right to speak on other people’s appearance anyway?”

“She wasn't lying…” it came out in the tiniest little voice, maybe your way of silently hoping he didn't hear it and he wouldn’t have if it weren't for his super soldier ears.

Gripping onto your wrists Bucky flipped your world in an instant, the breath leaving your lungs as your back makes contact with the bed, your wrists caught on either side of your head.

“Are you lying to me doll?” He says, raising a brow at you.

“No…”

“You are! You're lying right to my face,” he argues, pressing your wrists further into the mattress below. Your eyes fall shut as his face inches closer to yours.

“Look at me princess,” he waits until you open both eyes again, looking up at him as if he strung the stars in the sky “There is not a single thing that I'd change about you and I mean that. I fell in love with you the way you are now, you aren't some bitch that gets off on making fun of others. I fell head over damn heels for you because you are you.”

His eyes sparkle with adoration, his hands running up and down your body softly. The juxtaposition of metal on one side and warmth on the other sends shivers up your spine.

“I love you,” he breathes, leaning down again till your lips graze his. A teasing smile pulled on the pink corners of his mouth, a similar glint in his eyes, “you know that right?”

“Yes,” you nod, pushing up to close the distance between your mouths but he pulls away.

“I don't think you do,”

“I do Buck I promise.”

“Well…” he began, the glint in his eyes dulling as want engulfed the colour, “let me make sure.”

Bucky takes his time. He has to knowing that you're feeling small. Slowly his lips slot with yours, ushering out sweet little sounds to replace the broken ones that still thrum fresh in his mind.

“I love you,” he says again, capturing your hitched gasp with his tongue as he pushes it past the seam of your mouth, the tip flicking against your own to entice it to mingle. Slowly but surely the tension drips from your shoulders, your arms moving from his grip to trail up over his rigid stomach and chest. They sink below the shoulder pads of his jacket, pushing it off his broad frame and onto the floor beside the bed. Your hands paw at the exposed skin on his arm, fingers squeezing, nails scraping over the corded muscle.

“All of yours…all of it.”

Each time the seal of your mouths broke you chase them, planting kisses teeming with nothing but raw desire onto kiss-bitten lips. The words that Sharon said are long gone from your mind now, replaced by the man in front of you. Everything you smell, taste, touch and see — it's all him.

The brunette slips off his glove; his warm and cold, metal hand grips your hips, pulling you up into his lap with a squeak.

“You feel that?” He grunts, moving from your mouth down your face to your neck. His lips suck and his teeth nibble, marking you, proving to anyone around that dare dispute his love for you again. With undeniable strength he grinds you down into a sizeable bulge poking from his tight jeans, he hisses at the contact, letting a hand fall to your ass with a small spank.

Your arousal seeps through your thin panties making them stick to your dainty folds; your clit buzzes at the delicious scratch the metal of his zip brings you — a gasp catching in your throat every time your neglected nub catches the pull tab.

As much as he worshiped the way you dry-humped his cock, soaking the front of his jeans. Bucky is desperate. After a week of no contact, not even a tiny emoji heart never mind a raunchy photo, he needs something — anything. And he's going to get it.

“Get on the bed” he demands, pushing at you ever so slightly. “Panties off.”

You do as you are told, fingers frantically hooking into the waistband of your underwear, rolling the material over your thick thighs until they hook around a single ankle.

“Spread those legs for me baby, lemme see that sweet little cunt.”

You hesitate for a second, your legs twitching to open but knees knocking again as you close them. Blown pupils snap onto your face his jaw clenched hard and his nostrils flared. Before you can react his calloused hands settle gently, luring you into a false sense of security.

They soothe down your thighs as his blue eyes study you. Inch by inch his dull nails tap over your beautifully wide thighs until he's back at your kneecaps. With a soft unassuming smile, bucky pushes your legs wide, a rush of oxygen leaving you as your sopping folds are exposed to the cool air of the room. He doesn't give you a chance to breathe before a warm hand smacks over your wet folds, your body jerks, an unabashed moan flying from your parted lips.

“Don't fucking deny me this” he growls, fire roaring in his eyes. “You ghosted me for a week, now you're gonna lie there all pretty and let me eat this sweet fucking cunt.”

You nod, biting your lip. At the first presence of him between your legs, his hot breath billowing over your labia, your eyes roll into the back of your skull. Over each fold, ridge and crevice his breath fans, a shiver rolling over your spine each time; without warning he lays his tongue flat and wide, licking a strip from hole to clit. His tongue disappears and he does it again, guttural sounds falling from him at your taste mixing with the sharp trills you let out.

“Sing for me baby, let me know how good I'm making that pretty pussy feel” He delves in like a man starved, devouring your cunt as though it were his first and last ever meal on earth. He'd die happily if it were.

You were a mess, a mess of pleading cries. Your legs shake against his powerful hold, your hands grip his unruly brunette locks. Letting his hands drop from your thighs he stops his slurping to lay a soft, sweet peck on your raw clit. He smiles up at you, his face glistening with your juices visible thanks to the city lights peeking in through your open windows. Your mind wandered, wondering if the people in the building across could see the way Bucky fucked his tongue into you, curling the long muscle up to press against that ridged spot on your upper walls — he hit it with ease every time.

Using your distraction as an advantage bucky moves a hand to join his mouth, sliding his fingers in alongside his tongue for a second before he pulls his tongue from you. He moves, looming over you with a massive shit-eating grin at how much he unravelled you. you should've been embarrassed at how wet his face was; slick ran from his stubbled upper lip over and below his chin. You had done that to him and he wore it proudly. His fingers push deeper and curl out, coaxing the coils in your stomach to snap.

“Come on baby I know you feel it” he speeds up, the sound of your messy pussy almost as loud as your harsh breaths and whimpers.

“Buckyyy” you squeal, gripping at anything you can.

“That's it, baby…you're squeezing around my fingers, are you gonna cum?”

You nod but it's not enough for your man. He dips, nipping at a pebbled nipple and that's all it takes for those tightly coiled ropes to pull taut and snap. A sound you've never heard from yourself erupts from your lungs, your fingers clutching at bucky, the sheets, anything. Stars peppered your vision, blocking out the smug image of your boyfriend, blood rushing in your ears muffling his words of praise.

“Come back to me baby, that's it, good girl. such a good girl” Bucky coos, his fingers slipping out to rub lazily at your clit. He keeps going until you jerk harshly in his hold.

“You did so well, such a good fucking girl cumming like that for me” He praises, kissing your cheek and then your mouth, a smirk pulling at his lips when you moan at your taste.

You flash him a big dopey smile in return, your eyes hazy and your plump little cheeks flushed. You look gorgeous; Bucky had seen many things in his long drawn-out life but nothing could ever compare to how you looked fucked out beneath him.

He would stay like this forever…if his cock wasn't aching for release.

He stands, fiddling with his belt and fly until it comes loose. He wastes no time in pushing them both past his round ass and onto the floor, his cock springing free. His shirt goes next, thrown somewhere in your small room letting you get the full experience of what Bucky had to offer you. Layers of corded muscle ripple beneath his silky but scarred skin, his chest peppered in tiny curly hairs that sink below his sternum and over his abs where they begin to thicken until they finish, well trimmed at the base of his thick, heavy cock.

His eyes never stray from your body as he takes himself in his hand, pumping once, twice, his thumb catching the precum leaking from his tip. He kneels back between your welcoming legs, rubbing his slick thumb over your lips. A hushed chuckle vibrates in his chest as you suck the thumb into your mouth, eagerly licking his taste from the digit.

“Such a dirty girl,” you giggle, pulling back until his thumb slips out of your mouth with a pop. “Do you think you can handle one more hm? Can you let me fuck that little hole?”

“yes Buck” you smile, your eyes falling shut as he kisses you again.

“good girl” he growls, moving your legs over his own before grabbing a pillow to squish under your hips. With one hand he pushes the head of his length through your mess, dipping into your hole before running back up over your clit. He does it a few times, occasionally slapping his cock against you, praising each tiny sound you let out.

“Please Buck” You toss your head back, grinding your hips up to meet nothing. At this rate, you were going to come to nothing more than his teasing.

“Please what?” Oh he's a piece of shit. He knows what you want because he wants it too. He waits for a beat, enjoying your huffs of frustration. “Tell me and I'll do it.”

With the last of your sanity, you cry out, “fuck me buck ple—ah”

You slap a hand over your mouth as he spears into you, stretching you like he does time and time again. It never gets any easier with a size like Bucky’s; his tip kissing your cervix with each thrust and your walls sing at the almost painful stretch.

Bucky’s thrusts are delightfully slow, letting you feel each drag and push, each rigid vein on his pulsing cock. There is no fucking involved, he's making love, making sure you know that he would spend eternity wrapped up in your body no matter what size you are. The deep coloured marks along your neck and between your thighs would attest to that.

“Fuck” he moans, mouth gaping. “Don't think ill last long princess” His vibranium fingers fall to your soft belly, skating over the smooth skin to your full hip.

He squeezes hard enough to leave marks, “fucking mine.”

His thrusts speed up, his head snapping back and eyes rolling. His balls bounce rhythmically against your ass, the bulbous head of his cock smashing into the end of your cunt where a dull ache forms — a warning of future hurt when you wake tomorrow. You don't care, not when his free hand dips between you both, pulling back the hood of your sensitive nub and flicking it over and over.

He feels the way you tighten around him, holding him in a vice grip, “hold it princess, just a little longer come on”

“I can't Bucky please” you whimper in response.

“Yes, you can baby—oh fuck I'm close” his weight falls atop yours, smothering you in him. His hips stutter, his balls pulling up towards his body.

“Cum now, soak my big fucking dick.”

The slamming of the headboard ceases when his thrusts slow to shallow grinding, his mouth swallows any sounds you let out.

“Such a good fucking girl for me—shit” he sighs, slips from you with a hiss.

“Buck—”

“Shh pretty girl you're alright” he holds you close for a while, holding you tight to his broad body. Tears fall from your cheeks but he swipes them away. You don't know why you ever doubted Bucky, he's the only constant in your life.

“I love you” He whispers as the blood rushing in your ears settles, running through your veins in exhaustion.

“I love you too”

“Don't you ever listen to those idiots again, because I will show you over and over what you mean to me” Bucky promises with a kiss on the crown of your head.

You smile, laying your own lazy kiss over your thumping heart. You like the sound of that.

I DO NOT give permission to have my work copied, translated or reposted. If you see my work anywhere else except this page I have not given consent for it to be used.

Comments, Reblogs, Likes and Asks are always appreciated, however if you like this fic please consider reblogging to help it reach a wider audience. They let me know that you are enjoying what I read and give me motivation to write more.

Thanks for reading~