#thank you for reading my guidelines!! | Explore Tumblr Posts and Blogs

sinfulspencer · 15 days

Text

Once upon a dream

Prompt: It’s difficult to face a coworker you just had a wet dream about…

Pairing: Spencer Reid x Fem!Reader

Rating: mature (18+, minors DNI)

Warnings: light dom/sub dynamic, SoftDom!Spencer, breath play, mating press, fingerfucking, unprotected sex, breeding kink, creampie

Words: 3.3k

A.N.: Enjoy, my sweet filthy friends. And a big thank you to @ameliemaaaee for beta-reading this.

MY MASTERLIST. MY GUIDELINES. SEND A REQUEST. MY TAGLIST.

“I’m so happy that we’re together again.”

Spencer’s arms caged me against his body as his lips captured mine in a breathtaking kiss, full of longing and desire. The familiar sensation of being home settled in my belly and I basked in it, giggling against Spencer’s mouth. I had missed him so much - I hated when I had to stay behind for a case, but it was for my own well-being.

“We don’t need to talk about the case.”

Spencer agreed with a quick nod. “I’m here for something else.”

His hands quickly found the edge of my long shirt and removed it, leaving me bare in front of him. Spencer quickly kissed me again and I wrapped my arms around his neck, leading him to my bedroom.

I couldn’t care less about talking that night.

As we walked to my bedroom, my feet were colder than usual against the hard flood - definitely an unusual sign, but I didn’t pay too much attention to it. All I could focus on were the skilled hands of the man pressed against me that slid my panties down my thighs, undressing me completely.

His hungry eyes roamed all over my body and I gasped when Spencer pushed me onto the bed. His attitude was completely different from the one he usually had in the office, but again, we were not at work at that moment.

“A sight to die for.”

I scoffed, propping myself up on the pillows. “Oh, shut up.”

Spencer crawled on top of me, still completely dressed, and nipped at my bottom lip while both his hands dipped on each side of my head. He smelled like vanilla, a different scent than usual - weird, but again, I couldn’t care less about it.

“We have all night.”

“To sleep?” I asked.

Spencer hummed, running his right hand across my bare chest. “Also that.”

“We have work in the morning.” - I responded - “We have to rest.”

“Yeah, whatever. Later.”

Again, it was a weird thing to say for Spencer. I didn’t think too much of it, enjoying the way his lips devoured mine in a kiss. All I could think about was the way his toned body, still completely dressed, was towering on top of mine. He kissed me hard, reminding myself that he could easily control me.

The desire I felt for him was overwhelming: it made my hands itch, my thighs tremble, my mind going completely empty. There was nothing else in the world I needed more than Spencer at that moment. I needed to feel his weight on my body, his lips on my neck, his hands on my thighs, his cock inside of me and his semen drip between my thighs at the very end.

I just needed him to consume me, to make me nothing but his whore.

Spencer pulled away from me and he ran his fingers through his hair, staring down at me. I was pretty sure that I looked wild: my hair was already a mess, my cheeks were burning hot and I was naked. Spencer instead looked beautiful: his hair a mess like mine, his jaw tensed, his eyes with lust flashing behind them.

“Look at you… so pretty.”

I whined, grabbing Spencer’s hand and bringing it to my chest. “Thank you, but I don’t need compliments right now.”

“And what else do you need? Do tell.” - he responded, the gleam in his eyes making me whine - “Oh, don’t be embarrassed. You can tell me anything.”

Shaking my head, I pushed his hand down to reach my breast. Spencer palmed it lightly, still staring at me and waiting for an answer. Despite the obvious aching between my thighs and my desire for him, I was not exactly able to explain to him all the things I had wished he’d do to me. My mind was blank because of him.

“Your cock.”

It was the only thing that I could come up with and the answer seemed to have pleased Spencer as he laid on top of me again. He had removed his shirt and his belt, leaving everything on the floor, but I was still bothered by his trousers. I needed to see every inch of his body.

Spencer nipped at my bottom lip, then moved down. His tongue caressed the skin of my throat, travelling down to reach the curve between my breasts.

“Ah, straight to the point.” - Spencer whispered - “I’ll give it to you, my sweet girl.”

Sweet girl. He never called me like that, but I enjoyed the way it rolled off his tongue.

His tongue moved across my breasts as Spencer’s eyes focused on my face the whole time. I had never felt this good before, pulling on his curls and moaning his name when his tongue flitted over my right nipple. Spencer was gone the moment he saw my boobs.

His left hand groped my other breast, leaving red marks all across my skin. I arched my back in response to his ministrations, whining with my eyes closed. Spencer was so good to me, but the strong vanilla scent was overwhelming. He wasn’t a fan of vanilla, so why did he smell like that?

I forced myself not to think about it, but it was hard.

Spencer closed his mouth around my right nipple and my thoughts disappeared from my head, leaving me crying out a chorus of ‘yes’. He silenced me with a bruising kiss, rolling his hips to grind against mine.

“Shh, no need to be so loud. Wouldn’t want to wake up all the neighbours.”

I moaned on his lips, nodding my head in agreement. In truth, I couldn’t care less about my neighbours at that moment: I just needed Spencer to own me, to make me feel good with any part of his body - whichever he preferred.

Spencer’s body was flushed to mine and I felt his hard cock against my inner thigh. I gasped and clung to his shoulders, following the rhythm of his hips to feel more and more of him. With his right hand, he yanked my panties down my thighs and threw them somewhere behind him.

“Spread your legs for me, sweet girl.”

I obeyed with no hesitation, opening my legs right in front of him. His eyes followed me down where I needed him to be and he immediately cupped my cunt with the palm of his hand, his middle finger brushing through my folds.

“So wet I could just slip my cock inside of you.”

I bit my bottom lip, focusing my eyes on his face the whole time. The lustful desire burning behind his eyes made my knees tremble. I swore I saw the shadow of a smirk appear on his lips: one of those dark, wicked smirks that turned me on more than anything in the world.

Spencer lowered his head to your chest and nipped at the soft skin right below my nipple, making me shiver. How could he be so addicting? How could he just bring me to the edge of pleasure with a simple bite?

“Or do you want my fingers first, sweet girl?” Spencer asked

I sighed, glancing at his right hand travelling from my throat down to my hip. His fingers are caressing me gently, sending shivers down my spine, and I looked up at him. I wanted whatever he was willing to give me - I truly did not care at all. I just wanted him to find his pleasure within me.

“Yes. No. I don’t know.” I responded

Spencer’s lips curled into a smile. “First thought, best thought.”

He slowly trailed his index finger across my wet folds before pushing it inside of me, slipping it to the knuckle. A quiet gasp fell from my lips and I found myself closing my eyes, relaxing. Spencer used his hand to cup my cunt and pressed his palm against it, massaging my clit with his movements.

God, he was so fucking skilled and I had no idea. Was he truly like that or was it just another wet dream I was having?

The answer did not matter. The pleasure did.

“Look at me.” - Spencer warned me - “Keep your eyes open, sweet girl.”

I struggled to obey him, but I did. I opened my eyes and stared at him with my mouth wide open, giving in to the pleasure he brought me. Spencer slipped another finger inside of me and I moaned again, bracing myself to his taut body with both my hands.

My fingers dug into his forearm and Spencer whimpered in pain. I didn’t mean to scratch him, I didn't mean to hurt him but in that moment I was so caught up in my own pleasure, in my own desire for the man above me that I could not care any less. Spencer was able to make me forget my neighbours, my inexperience and everything that made me insecure.

And when I tried to speak, the pleasure crashed through me. I felt like all the air had been sucked out of my body and the only sound I could hear was the echo of my own pathetic cries as I reached my peak. Spencer allowed me to ride the waves of my orgasm with his mouth peppering kisses all over me and his fingers pumping rapidly, and yet… All I could think about was the smug smirk on his lips.

God, did it feel good to make him happy.

“That’s it. You did so well, my sweet girl. So proud of you.”

Spencer slowly removed his fingers from my cunt and brought them up to his mouth, tasting me. His eyes were still on my face, but mine were down to his body - where his cock was standing, hard and aching.

The sight was so erotic it brought me to pull him closer to my body by closing my thighs around his waist. I couldn’t wait any longer. I cradled his face in the palm of my hands and I kissed him hard: I tasted myself on his lips and the fire burned even brighter inside of me. Spencer did not hesitate to grab his cock and push it right inside of me, surprising me. I thought that he’d wait a moment, that he’d enjoy my mouth on his but apparently he was just as desperate as I was.

The delicious stretch of my body to adjust to his made me whine against his lips, but I never stopped kissing him. Everything that I felt seemed heightened, as if it wasn’t even real - I could not believe it was real.

“Oh, fuck. I did not know you felt this good around my cock.” Spencer whispered

I felt the pool of heat spread between my thighs as I clung to his body, whining and panting his name over and over like a sacrilegious prayer. Everything felt too good all at once and I did not have the time to register that pleasure because Spencer pulled out of me. The loss made me gasp.

“Fuck! No, no. Please.”

I could feel his eyes burning into my skin. “Don’t worry, sweet girl. I’ve got you.”

Spencer somehow got even closer to me: his knees pressed to my thighs as his cock pushed inside of me again, finally filling me up to the brim. The pleasure quickly returned to pinch at my belly and I felt overwhelmed.

The way Spencer looked, the desperate sounds he made, the beads of sweat across his forehead, the strength of his arms, the violent grip his fingers had on my thighs… There wasn’t a single detail of Spencer’s skills and beauty that did not go overlooked. God, he was fucking ethereal and all mine for the night.

Spencer leaned forward, his lips brushing over my right earlobe. “You take me so well. I might keep you around forever.”

His hands caressed my shins and then Spencer forced my legs upon his shoulders. Surprise was written all over my face, but so were pleasure and a delicious hint of pain that made everything even better. I was caged between his body and the soft mattress underneath me: a position that I did not want to escape from.

Spencer was so deep inside of me that I felt him everywhere. I couldn’t even describe the intensity of the pleasure that spread through every inch of my body: it was intoxicating and I never wanted the moment to end.

He could keep me like that for as long as he pleased.

His eyes never leave my face. Spencer wanted to see me break down because of him, because of the pleasure that only he could bring to me. And I let him, allowing his fingers to dig into my skin to the point I felt it break.

I rested my hands behind his neck, gripping his curls as I let him take all of the pleasure that he could from my body. Thrust after thrust, I felt the tension slowly come to the tipping point.

“Spencer, please. Please, please.”

All we could hear in my bedroom was the pathetic chant of his name falling from my lips and the snapping thrusts that he gave to me. My fingers scratched his neck and I knew that it must’ve hurt him, but I was glad he didn’t say anything. Maybe he was too focused on fucking me to care about the drops of blood running down of his back.

“Are you going to come for me, sweet girl? Clench your cunt around my cock?”

His dirty words weren’t helping me. The pleasure was almost too much for me to bear and so was the tension that finally exploded. My orgasm rolled in waves through my body, making me arch my back as I whispered his name.

Over and over, again, Spencer kissed me as he nursed the second orgasm out of my body with that smug smirk over his lips. He was well aware of the power that he had over me and somehow, he took advantage of it. And, God, did it feel so fucking good to be in his skilled hands.

The pleasure never seemed to end.

I was still there in that delicious limbo that made my thighs tremble, but Spencer’s thrusts became sloppy and I could feel him get close to the edge as well. He was whimpering, whispering my name against my lips and his hands were trembling.

“Can’t.. I need.. Inside of you.”

I mindlessly nodded my head. “Yes. Inside. Please.”

Spencer came inside of me hard, his fingers gripping my thighs so hard that the pain cut through the intense pleasure I was experiencing. His body pressed down against mine, forcing me to take every drop of his essence inside of me like the good girl I was for him.

My thighs were still closed around his waist, hoping that he could not pull away and he did not. He didn’t want to, he wanted to give me everything that he could. And he did.

Spencer kissed me again, but it was a messy and sloppy kiss. My body was so exhausted and aching, but somehow my brain was begging for more. I knew it was the beginning of the end, that Spencer was going to leave soon but I didn’t want him to.

I needed more.

Spencer pulled out of my aching body and watched the mess pool down between my thighs, staining the bedsheets underneath me. His lips were still curved into that stupid, smug smirk and I found myself falling for it even harder. How could he be so fucking gorgeous even after fucking me so hard to the point I forgot my own name?

“So pretty. You did so well for me, sweet girl.”

His praise suddenly soothed the aches in my thighs. “For you, always.”

Spencer reached out his hand between my thighs and his index collected some of the liquid spilling out from me, a mix of our orgasms. He did not waste any time and he cleaned up his digit.

“Sweet.”

I shook my head, covering my face with both hands. “God, Spencer…”

“Stop acting as if you don’t like this dirty side of me.” - he teased me, leaving a tentative kiss on my ankle - “I know you love it.”

I didn’t respond to him.

“Now sleep, sweet girl. I’ll wake you up in the morning.”

The silence took over the room as Spencer cleaned me up with his fingers and a warm washcloth, a quick reminder that he was still a gentleman. He might’ve fucked me like a whore in the middle of the night, but he was going to treat me like a princess in the morning.

Or so I thought.

I must’ve fallen asleep in the blink of an eye because when I woke up, the curtains inside my bedroom were slightly opened and a single ray of sun filtered through. It was morning, very early morning.

However, everything happened so quickly.

I found myself nestled beneath my warm blanket, completely dressed, and the low sound of music coming from my phone. Confused, I pushed down my own blanket and looked around the room.

Spencer was not there like he promised me he’d be.

What the fuck?

Even more confused than before, I sat up on my bed and looked down. I was still wearing my pyjamas and my underwear; none of the items were broken or ruined by Spencer’s eager fingers to have me. There were no bruises on my thighs, nothing on my neck or my chest either.

What the fuck has happened?

My head hurt as I got up from my bed, trying to understand what had happened the night before. I couldn’t recall Spencer ringing the bell of my apartment, but I remembered vividly the way he pressed me down onto the bed and fucked into me like a mad man.

It couldn’t have just been a dream. Could it?

Sighing, I took my time in the shower. The memories in my mind were simply a dream; a manifestation of the desire I felt for Spencer and that I was yet to confront. But how could I prove that? I couldn’t just call Spencer and ask him about the previous night. I didn’t want him to think I was weird.

And then, my heart dropped. How in the world was I going to face him at work?

However, I needed to. It wasn’t professional to call my boss and ask them to give me a day off just because I had a wet dream about a colleague. So, I put on my best smile and got ready for the day.

As I went up in the elevator, I kept checking my neck for bruises or bite marks. Spencer bit me and grabbed my flesh hard, violently, possessively. It was impossible that my skin wasn’t hurt or didn’t have some kind of mark. However, there was nothing. As if nothing happened the previous night. Maybe it was all a fucking dream.

A good dream, at least.

I just needed to get over it.

It wasn’t the first time that I had a wet dream, but it certainly was the first time that I remembered it so vividly and left me questioning my reality. Also, it was the first wet dream about a colleague which made it even weirder.

“Good morning everyone!”

Spencer’s familiar voice almost made me collapse down on my knees. I saw him walking inside the office with that usual adorable smile on his face and a familiar pink box in his hands. He brought everyone breakfast. It wasn’t unusual for him, but that smile… and the look on his face made me think that something might’ve happened to him.

He was unusually chirpy. And most importantly, he wasn’t drinking coffee.

“Hi Spencer.” I managed to say

Spencer walked past me. His smile turned into a smirk.

“Good morning, sweet girl.”

Oh, fuck.

Remember that if you asked to be on my taglist, you can easily help me gain visibility with a like, a comment or a simple reblog. If you don’t, you’re asking me to include you while getting nothing in return. If you want to be removed from the taglist, just dm me. Taglist: @reidselle @alelaeljfj @blvebanisters @Koukatsuki @donttrustlove @moesdraft @r-3dlips @alicentswife @singinghamtaro-blog @Florebore @Topguncultleader @frutilooplupin @mags11 @myoui-me @iluvreid @slaygirl466 @Kikista @icarusgold @pleasantwitchgarden @ohdearlordspencerreid @cherrqblssms @lover-of-books-and-tea @elizabethmidnight2017 @spencerssoup @emmy-reid2627 @winkev1 @benji-screem

#spencer reid #spencer reid smut #spencer reid smut fanfic #spencer reid smut fic #spencer reid x fem!reader #spencer reid x female reader #spencer reid x fem!reader smut #spencer reid x you #spencer reid fanfic

1K notes · View notes

bamsara · 1 month

Note

Hello! I was wondering what company you use for your sticker sheets? I bough one from your Ko-Fi shop and really like the quality, and the pricing you were able to sell at is waaaaaay more reasonable compared to any of the companies I've seen and used myself. Is it a POD company, or a mass purchase of them to sell on your own?

Thank you for your time if you're able to respond!

I'm really glad you like the quality, because I actually make them by hand at home! (Please forgive the lighting, my bedroom is my office lmao.)

I don't use a company (and Idk what a POD company is sorry!) but making them at home gives a lot more freedom of stock, just be wary it can be very time consuming depending on how many you need to make.

I've had other people ask before, so here's a rundown of how I make my stickers at home: At most you'll need:

Printer

Sticker paper (this is the type that I use)

Laminator and lamination paper (the lamination paper that I use.) You can also use adhesive non-heat lamination paper if you don't have a laminator, gives you the same result, just be careful of bubbles. You will get double your worth out of a pack because we are splitting the pouches to cover two sticker sheets.

Your choice of a sticker cutting machine or just using scissors.

First, I use Cricut's software to print out the sticker sheet with the guidelines around the corners so the machine can read it. If you do NOT have a Cricut machine, open up your art program, make a canvas of 2550x3300 and fill it up with your sticker design with some cutting space between them. This the 8.5x11 size for the sticker page.

I usually have bleed selected so the cut comes out cleaner. Tip for non-Cricut users below: Increase the border around your sticker design to fake the 'bleed' effect for a cleaner cut.

These are the print settings I use for my printer. I use the 'use system dialogue' to make sure I can adjust the settings otherwise it prints out low quality by default. Make sure if you're using the above paper that you have 'matte' selected, and 'best quality' selected, these aren't usually selected by default.

So you have your sticker sheet printed! Next is the lamination part. I use a hot laminator that was gifted to me, but there is no-heat types of lamination you can peel and stick on yourself if that's not an option.

(This is for protection and makes the colors pop, but if you prefer your stickers matte, you can skip to the cutting process.)

Important for Cricut users or those planning to get a Cricut: You're going to cut the lamination page to cover the stickers while also not covering the guidelines in the corners. First, take your lamination page and lay it over the sheet, take marker/pen and mark were the edges of your stickers are, and cut off the excess:

(I save the scrap to use for smaller stickers or bonuses later on)

After you've cut out your lamination rectangle, separate the two layers and lay one down on your sticker sheet over your stickers with matte side down, shiny side up. (Save the other sheet for another sticker page)

The gloss of the lamination will prevent the machine from reading the guidelines, so be careful not to lay it over them. It also helps to cut the corners afterwards to prevent accidentally interfering with the guidelines.

Now put that bad boy in the laminator! (Or self seal if you are using non-heat adhesive lamination)

Congrats! You now have a laminated page full of stickers.

For non-cricut/folks cutting them out by hand: this is the part where you start going ham on the page with scisscors. Have fun~

Cutting machine: I put the page on a cutting mat and keep it aligned in the corner, and feed it into the machine. For laminated pages I go between 'cardstock' and 'poster board' so that it cuts all the way through without any issues, but for non-laminated pages or thinner pages, I stick for 'vinyl' and 'light card stock'. Kinda test around.

Now I smash that go button:

You have a sticker now!

The pros of making stickers at home is that you save some cost, and you have more control of your stock and how soon you can make new designs. (I can't really afford to factory produce my stickers anyway)

However, this can be a very time consuming, tedious process especially if you have to make a lot of them. There is also a LOT chance for some errors (misprints, miscuts, lamination bubbles, ect) that will leave you with B-grade or otherwise not-so-perfect or damaged stickers. (Little note, if you have page mess up in printing and can't be fed into the cricut machine, you can still laminate it and cut it out by hand too.)

I have to do a lot of sticker cutting by hand, so if you don't have a cricut don't stress too much about it. I have an entire drawer filled to the top of miscuts/misprints. I keep them because I don't want to be wasteful, so maybe one day they'll find another home. Sucks for my hand though.

But yeah! This is how I make my stickers at home! Hope this is helpful to anyone curious

#sticker making #stickers #sticker tutorial #sorry for the long post

1K notes · View notes

auragasmics · 2 months

Note

onlyfans creator!toji meeting fan!reader but getting so drunk off of them that he keeps bringing them back & eventually only makes vids with them… *heh*

CAMERA ROLL LOOKIN’ LIKE ONLY FANS!

synopsis! he knows better than to get involved with fans. But upon meeting you, Toji’s found himself in a world where he can only have you—and you alone.

pairings! fan!fem!reader x onlyfans creator!toji fushiguro

cw!3.5k words, pwp, dubcon(?), consensual filming, pussydrunk!toji, doggy style, mean!toji, cunninlingus

mwuahaha, i loved this thirst sm! i couldn’t stop thinking about it!

have a thirsty thought? read my guidelines and start sending them in!

In truth, Toji knew better. While unspoken and better left assumed, it’s still the number one rule amongst fans and creators alike.

The golden rule of never, ever hooking up with a fan. Toji’s all too aware of this, but he’s no saint to abide by the rules. It didn’t help that it was all his friends were recently raving about, claiming that it would boost views—and sales for those with even the slightest glimmer of naive hope in their eyes.

And when a thought replays like a broken record, it’s only a matter of time before one succumbs to incessant influence—and Toji’s no better. He had it figured out; announce his little plan to all his cock-hungry fans, run their users through an online random generator, and whoever’s name pops up on his screen is his lucky vixen for the night.

But the generator just had to pick you.

He was blind—or better yet, naive, to the possibilities that could arise from his little adventure with danger. It never crosses his mind that maybe he’d regret the choice of taking down a fan—or maybe he’d fall in love with the idea and add it to his usual lineup.

But that didn’t stop him from sending you that message and bringing you into his humble abode of a high-rise apartment. That didn’t stop him from fawning over your pretty face and kind attitude, as if you both had forgotten what was to follow through the night.

He was simply so blind to it all that Toji had written off the slim chance of him getting addicted to you.

Until he was.

Why the memory of Toji slipping just the tip of his cock inside you still lays fresh on his mind and vigorous to his nerves. He remembers how cocky he was, thinking that he’d be the best you ever had, how no one could ever come close to how he imagined fucking you.

But the gummy halo of your cunt enveloped his blushing pink head with a sopping wet kiss, condemning the poor forsaken man down the path of egotistical demise.

Toji, the Toji Fushiguro was victim to a state that he’d never ventured into before; suddenly his mind was shot blank, his eyes threatening to rest into the dark abyss of his skull and the brawny chest he worked so hard for was rigged with shuddering breaths.

Within a matter of minutes, Toji was out of his body, out of control, and without a single means of putting up a fight.

If your pussy claimed his resolve, your body claimed his soul. Every arch, squirm, and jolt gave way to Toji’s heart. He’d even found a serenade within your outpouring moans, every hymn motivating him to his newly found goal. For in that moment, the unmoved Toji was concerned with something he never allowed to faze him—his ability to please.

Toji knew one thing; he utterly had to please you, to bring your mind, body, and spirit to the sheer face of ecstasy. He was always so sure of himself thanks to his past of collaborations, but not a single woman of his past could compare to you. Because, unlike those past collaborations for work purposes, everything that night was genuine.

The way you whimpered whenever he leaned over for a kiss was real, how your hands clung to every inch of his misted skin was bonded behind the truth, down to the orgasm he had no choice but to sit through because of the suffocating clench your walls bestowed around him.

The last thing he remembers from that night is the words he drunkenly allowed to fall from his lips, almost begging you to come back. When waking the next morning and found you gone, Toji realised he had to work to earn both you and your trust.

From that day on, something in Toji has him running ragged on your behalf. All of a sudden, he’s caught up with buying you lingerie he can’t wait to rip off of you, he’s sitting through hours of research to buy the best camera to catch every single moment of filth amidst you two. Why, he’s even gotten into the habit of calling you every morning and every night just to give you a glimpse of the real him.

A month’s swept by since that momentous night, and within those four weeks—Toji’s reserved at least fifteen of those nights just for you and him. Just this week alone, he “needed” you twice, and tonight would make it thrice.

The third time of making you cum off his tongue alone before he had the privilege of fucking you raw beneath the starry sky. And each time he does indulge in you, he can’t silence the raging urge to leave your pussy plump and dribbling with his thick white cum.

But he holds back, it’s already an honor to have you raw and he’d hate for something as minuscule as natural instinct to ruin a good thing.

Though it’s that same natural instinct that had him calling you just under two hours ago—and waiting by the door like a new puppy waiting for its owner to return. His friends call him pussywhipped, so immersed in you these days that it’s all he talks about, his newest tease with a pussy that gets so sloppy for him.

Toji could fight back, but he isn’t one to play delusional. Pussy-whipped, that’s exactly who he is and who he’s become. And somewhere deep, deep down in his subconscious, he’s found satisfaction in that. Just a puppy with a—

“Toji! It’s me!”

The pretty croon of your muffled voice has Toji springing off the black leather couch and onto his feet. He looks down at himself—nothing could be more apparent than opening the door and revealing him to wear nothing but black sweatpants.

It’s too late to apply any effort, Toji thought as he twisted the door handle open, yanking the door to greet you.

“Hey Gorgeous, come in,” he hums, his arm racing to lace around the waist of your black leggings. “Hope you didn’t wait too long~maybe I should give you a key soon…”

Returning his regards, You give in to Toji with a swift embrace, linking around his bare waist. “No, I didn’t wait at all. It was like you were waiting—”

“I see you didn’t bring a bag. Why don’t you stay the night…you never do,” Toji interjects as he leans back to close the door. His eyes fall matched to your own, wide and glimmering but afraid to step any further than what’s been established.

Your shoulders give into a heartless shrug, your chin whipping away from his sight as you utter plainly to Toji.

“Oh, I didn’t think you wanted me to, and I honestly don’t care to sleep over either. But I guess if there’s a next time, I will.”

That’s something you really shouldn’t have said. Toji can’t pinpoint where it hurts, but he knows it does. If there’s a next time? Didn’t his constant calls, random splurge days, and his mere insisting presence give way to his budding sentiments—there’s always going to be a next time.

“C’mon, don’t be like that! I know it takes a lot of effort to leave afterwards. And you don’t even kiss me goodbye…so cold…but I like it.”

You know the strategy by know as his hands work to court your body to his touch. He’s dangerously close to the thick globes of your ass, the tips of his fingers delicately tracing the outline of your thong.

Toji’s smooth, that’s exactly why you followed him in the first place, and it’s what got you laid beneath him that first night all the same. Like the best charades, his suave whims soon grew weary and transparent, but it’s his confidence that keeps you around.

And just how easy it is to tease him.

Taking a finger to Toji’s chest, you decide to spur him on, to paint an image of what lies just beneath your attire. “I’m wearing the set we got last week…in case you’re wondering.”

His once heavy eyelids shoot wide apart, forcing Toji to dumb gawk at you. “The…red one with the…cutouts?”

“Mhm,” you nod coyly, “But the thong is just so thin and so easy to rip too. Guess the quality wasn’t all that good.”

Toji darts his eyes over your face, his sly azure hues taking in your faux act of innocence. He knows it’s all just to tease him, but with the slightest chance that some kind of truth stands behind your words, he can’t forfeit his chances of making an advance.

“Okay, then let’s make a deal. Stay over tonight and tomorrow, we‘ll go out and buy the best lingerie that money can buy. How’s that?”

A sheepish scoff rings from your barred lips as you stroll away from Toji, leaving him to stare at your wading presence. “Let me think about it.”

“Oh, but you won’t have time to think…not after I’m done with you,” he adds with haste behind you.

Your hand settles upon the cold silver door knob of Toji’s bedroom, revealing the sacred altar within a mere glance. Not much has changed since the first night he brought you over—a king size bed that stands in the room’s centre, tall windows with black curtains, a desk in the corner with a computer, and of course, a shelf against the wall that holds Toji’s vast array of sex toys, photos and even a few awards he’s won from the platform.

But as the days passed, the raunchy nature of his bedroom died out when small potted plants replaced the sex toys and trophies. The thick black curtains were traded for white gossamer, and the typical red blanket set was nowhere to be seen in the face of red silk sheets and pillowcases to match.

It’s a heavy claim to say that you’ve played a hand in his transformation, however, considering that you told Toji how nursing plants are a hobby of yours, you prefer more natural light to enter rooms, and that sleeping on silk simply has its benefits—one could safely make that assumption.

All your observations fall short the moment you sit on the edge of the bed, the mattress graciously dipping beneath your curves.

“Yeah, yeah, so what do you have planned for tonight?”

Toji takes his time to reply, setting his heavy hands to brace the waistband of his black sweatpants as he stands before you. “Oh I was thinking maybe some POV shots, I haven’t done those in a long time. Think I should bring them back more often now.”

Musing him, you tilt your head at Toji, a faded smile playing on your lips. “Is that right?

“You know the deal. I’m not gonna start recording until you say so. Why, maybe tonight we don’t even have to get it on film. Can’t we just…fuck around and see where that gets us?”

“That’s a new attitude, what’s wrong?”

“Nothing, honest!” Toji flusteredly fumbles out. He didn’t think he’d have to explain it, but some words are better said than just acted upon. And what’s on his chest is heavier than what gravity supplies Mother Earth.

He’s been given the slim window to confess what he wants from you, a question you’ve plagued him with since the second night he called you over.

He sends a hand to the nape of his neck, mindlessly pinching at the sparse hairs as his frazzled brian searches for the best words to explain his story. “ I just…really like having you to myself. A lot, actually. And it has me thinking…would you be open to being my…partner? C-Content wise, of course.”

“Oh…sure, we can do that! I thought you were gonna–oh!”

The brash clash of Toji’s lips steals the very words from your mouth and pins you underneath him. He more than happily donning the lead of setting the rhythm, painting his kiss against your lips as tenderly as he can.

Just like that, Toji’s gotten his burning wish within a matter of seconds—and what’s a better way to celebrate than by making his favorite girl cum all throughout the night?

The excitement has Toji running on salacious fumes, his eager hands surging across your body. First he’s tugging off your brown hoodie, pulling the soft knitted cotton over your head on and off onto the floor.

Your leggings follow swiftly behind that, and before Toji can even breathe, he’s got you pinned under him with the lingerie you’ve hinted at earlier with his sweats and briefs joining the array of discarded clothes.

The very set he plucked out just days before with the lacy red bra that barely leaves anything to imagination. He’s already inclined on tending to your pebbling nipples plowing against the fabric. He’s drawn right back to your lips, using his wandering hands to trek across your physique.

Upon his travels, Toji brushes against the panties you mentioned before, so frail that he could tug on them right now and free you from their rein. Rather, he relies on a mere pinch to inch the seam of your panties to sit within the plushy crease of your thigh.

“Mm, Toji?” you huff out between a kiss, “Let’s start, okay?”

Frantically shaking his head, Toji aimlessly reaches out to prowl along the top of his bedside dresser until he’s met with the familiar structure of his camera.

Slotting himself between your thighs, Toji points the keen lens to capture the timeless scene of him between your legs with a single hand. Clicking the camera on, Toji’s granted a clear sight of your bare pussy caught within the camera’s eye.

“ ‘Kay, camera’s on. Don’t you dare change a thing!

He isn't hesitant to begin, leaving you with a final request to hold your legs back before he’s pressing lazy kisses to the supple mounds of your cunt.

It’s that first breathless gasp of yours that throws Toji down a spiral of his own arousal. He’s already a throbbing mess, dripping all that precum into the silk sheets, but he doesn’t care. Not when his tongue is tasked with the honor of tracing along the pulsing canal of your glossy folds, just for his greedy ambitions pitting him to suck at the swollen pulse.

“Such a pretty pussy, Gorgeous,” he’s mumbling to himself as blown eyes scale up and down the sinful display.

He wants the camera to catch everything—from the way your fat lips split around his worked tongue to the very twitch that rattles your clit. He carefully shadows the camera over your cunt, his thick digits spreading you apart.

“Fuck, look at that, so soft ‘nd smooth…so wet for me too.”

His thumb rests against the cute pink bulb of your clit, the sullied pad sketching slow, tight circles over the bundle of nerves.

“Mmm-oh shit!…Toj—fuck, that’s so good!”

“That’s it, say my name Baby, c’mon!” He cheers along your twitching bulb. His name’s just sitting on the tip of your weak tongue, so desperate to break through the air. As its bearer, Toji’s waiting to hear it, the magic word set to pull him underneath your spell.

His hand’s encroach along your supple sides, softly squeezing at whatever fits within his grip. “I know that look, gonna cum on my tongue just how I like it, right?”

“Mhm,” you frantically affirm with nods, “…it’s right…it’s right there, Toji!”

You don’t have to pay him a teary-eyed glance to know that Toji’s hiding that sinister grin amongst the fat plush of your folds. That same smile that blossoms into a pout as he guides your poor clit to dance with his tongue.

Every which way, he’s swiveling your spry mound, All those lazy flicks, pedaling that soft curve of his slicked muscle around your stiffening bud. He’s even placed his hand right beneath your navel, using a soft grip to pull the stubborn hood of your clit back, leaving you open and raw for his selfish amusement.

Your hands race to tug at the noir crown of Toji’s head, keeping his head still while your trembling hips rock against his lush pout. “Fuh– yesyesyes! Toji please! Please make me cum, ‘m so close!”

Toji’s too far gone to keep up with you, his trained hand trembling to find a steady frame of the homemade film. Your nectar’s seeping into his senses, blinding Toji from the surrounding world.

All he can think about is you, all he can taste is that sweet essence spilling from his lips and down his chin. It’s all just a mess he's made out of both you and himself, but when he finally catches wind of your crashing orgasm, Toji’s beaming with the glow of achievement.

Your thighs snap around his head as the weight of your high wrecks through your body in perilous tremors. Your hips drive up against Toji’s gape, stuffing his mouth full with your cunt once more. His greedy forte settles over you again, suckling the chubby swell of your clit against his hollowed cheeks.

Breaking away from your cunt, Toji pans the camera down to your folds, his fingers gently tapping along your pillowy lips. “That’s my girl! Look so pretty like that, c’mon, we gotta keep you going now. Turn around and give me a nice arch, okay?”

You’re more than willing to comply with Toji’s request, slamming your weak legs shut as he rests on his knees. It takes all the energy ebbing from your body to secure a strong arch, one that has your hips tilted and your ass parading about in the air.

“How’s that, Toji?”

“Just beautiful. Stay still and let me do all that hard work, yeah?” he hums softly.

Toji watches as the lens focuses on the sight between your bodies. His hand braces around his shaft, giving his aching cock one firm squeeze before tapping the head of his cock along your slit.

“I know you can take it, but what do you think?” Toji hints as he gently nudges himself against you.

You look back at Toji with a proud smile, “I can take it!”

“That’s my girl! Just relax and let me…oh..fuck, that’s the good shit!”

By the rushed dip of his hips, Toji’s subdued by the velvety warmth of your walls, the slickened heat coddling his cock with wet kisses. It’s just like he remembers, tight, warm, and carved out to home all the ridges, the veins and the throbbing underside of his length.

“Look at the mess we’re making,” Toji gloats as he shifts the camera around your sputtering pussy, “And I’ve barely even give you those deep strokes you love so much!”

Those very deep strokes that he’s so fond of too. It grants him the very bliss he can’t get with anyone but you. He’s learning all about how sensitive you are, the pace you, how many times you can cum before you’re fucked dumb, all these things Toji’s taken account for.

As for tonight, he just wants you feel good, his precious girl. That’s why he’s so kind to feed your walls short drives of his cock as you adjust to his size. You’re taking him better these days, your pussy greedily nursing all nine inches of Toji’s length.

He’s got such a fat girth too, so thick that you’re left to squirm beneath the burning stretch. It’s pain that gives way to pleasure all too quickly as Toji reels his hips barely a few inches away from you.

“Aww, tell me, baby…You like this dick, don’t you? Like how it stretches this cunt to my size, how I’m always hitting that spot, go on, tell me.”

“Mmm…it’s alright,” you attempt to tease, but the stillness in the air carries about a warning with no way of guaranteeing caution.

Toji fists the fragile trims of your thong in his hand, yanking the fabric taunt in his grasp. “Oh…that’s how we’re gonna play?”

In one harsh tug, he’s dragging you against his burly thighs with nowhere else to run from the brutal onslaught of his crashing hips. All the kindness he had for you runs out, leaving Toji on a hellbent venture of proving his words true. His unruly drive has you thrashing straight into the pillow headfirst, pitting your limp body to rock along to all his ministrations without prevail.

It’s a rolling barrage, one hard drive after the other. The lewd orchestra Toji’s conducting has the clash of skin breaking about the room, using the meld of your voices charred by vengeful bliss as vocals.

But he isn’t lying; even through his rage, Toji’s still tending to you. By sending the thick bulb of his cock to smother your sweet spot in kisses, each one messier than the last, the coil deep within your core bubbles with another budding orgasm. How could something so mean, so harsh, feel so good? So much that your eyes drift back into your head, your and the veil of pleasure dresses your body like the finest silk.

All just because you jokingly bruised Toji’s ego. Either way, the fact remains that he’s thoroughly aggravated, and his angered spiel falls on deaf ears.

“Stop lying to me!” He grunts out with a smirk, “ W-We both know you do! Why else would your pussy get so messy fr’ me? M-Making such a mess on the bed. ‘M splitting her open and you say you–”

“T-Toji wait! O-Okay, okay, I do! “ Your whimpering admittance of defeat breaks into the air, earning nothing more than the chime of Toji kissing his teeth.

“C’mere,” he huffs out, pulling your limp body up against his own. His chest carves out your arch like a sculpture, leaving no crevice nor crease hidden from his frame. The grip he has upon you shifts above to the slacked curve of your jaw, leaving Toji’s thumb to strum along your bottom lip.

His hazy stare catches wind of your misty doe eyes, coaxing a lump to build within Toji’s throat.

As an act of sympathy, litters of kisses melt against your skin, his unruly trail leading him straight to your dribbling lips.

“Don’t look at me like that,” Toji whispers against your lips, “Y’know I like you, baby. Don’t go being too mean to me or else someone isn’t cumming tonight.”

“O…okay! I’m sorry Toji, ‘m really sorry!” you sob, your hand racing to brace the thick of his forearm.

Your apology chants in his ear like a mantra, coaxing a crooked grin to shine inside the dark room.

“Now…” Toji giggles, his hazy eyes flickering towards the fixed lens of the camera. “‘m taking a picture for the thumbnail…smile for the camera!”

1K notes · View notes

hedgehog-moss · 3 months

Text

I was talking with a friend the other day about how I was fascinated with American school life when I was a teen because it seemed so different from how things are in my country (I knew about US high schools thanks to Hollywood, an accurate and trustworthy source) and we talked about which aspects of US schools felt foreign or strange to us and one thing I brought up was, how American teens only seemed to have like 15min for lunch (I had 1h30 here in France), as evidenced by the cafeteria scenes (no one seemed to eat a proper four-course meal? I definitely never saw a separate cheese course), and I was like, I envied a lot of stuff about US schools but not this

... and I went looking in my old diaries to see if I ever wrote about this, and you know what? I was wrong. I did envy their school lunches which, like almost everything about US schools, felt intriguing and different and cool. The reason middle school-me thought American school lunches were superior to French ones is because, since American teens in TV shows only seemed to get like 4 chicken nuggets and a milk carton for lunch, their lunch tray was very light and they could hold it with one hand under it, the other hand in their pocket or holding their bag strap on their shoulder all casual-like. Sometimes there was no tray, even!

I envied these American teenagers for their lunchtime nonchalance. I would have liked to handle lunch in this cool-cat way but my French lunch tray being loaded with 4 different heavy and breakable plates, I had to hold it carefully with both hands. In my view this was unfair as the hindrance of governmental nutrition guidelines made French students look like uptight nerds, unable to strut around the cafeteria with one hand in our pocket like we didn’t care. Same for the absence of lockers in our schools, we had to carry all our books on our back all day like studious turtles whilst the beautiful 25 year old American teens on my television casually leant against their lockers chatting with friends then strolled around school with just a couple of books tucked under their arm like they were in Dead Poets Society. Thank god there was an ocean between us, imagine a French kid entering a US school cafeteria carrying 3 binders and 5 textbooks in their big rucksack and holding their tray with two hands like a complete loser

Note that these comparisons are quite worthless since I don't know what US school life / food is like in the real world (I imagine it varies a lot!)—I just find it funny to re-read old diaries and discover what was important to kid-me. Discussing these little cultural differences gleaned from US TV series, adult!me is like "yeah I remember being intrigued & envious about a lot of things! Not their school lunches though, they didn't look balanced and nutritious"—meanwhile middle school-me, focused on what mattered, was like, imagine what we could be... imagine being able to hold your lunch tray with 1 hand instead of 2 thus accessing a realm of coolness unfathomable to us in our backward country

#i'm glad i used to spend hours writing diaries... as a kid i never thought i'd enjoy re-reading them later i thought it'd be too mortifying #but no. i'm glad i wrote down for posterity the 4-page-long detailed account of how i embarrassed myself in front of my crush in 2005 #crucial historical document. to me

1K notes · View notes

hellsitegenetics · 7 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

#hellsitegenetics #faq #intro post #plants #flowers #snake gourd flower #requests #asks #remember to keep checking back!

2K notes · View notes

celestie0 · 7 months

Text

gojo satoru x reader | college au [18+]

kickoff ch.8 a little cottage on the countryside

ᰔ pairing. college au - soccer player! gojo x film major! reader

ᰔ summary. gojo satoru is the most popular guy on your college campus. he's tall, funny, hot, not to mention he's the most talented soccer forward the school has seen in years. but he's also a frat dude, which puts him in a world very different from your own, as he spends most of his nights partying & drinking while you spend most of yours working on your annoying film major assignments. but when he reaches out to you for a favor, you realize that helping him out might have something in it for you too.

ᰔ warnings/tags. 18+, fem reader, fluff, angst, smut, college au, fraternities, sororities, partying, drinking/alcohol, mentions of weed, romance, jealousy, pining, slow burn, opposites to lovers, friends to lovers, she falls first he falls harder, gojo being an idiot

ᰔ chapter. 8/x (probably 12)

ᰔ words. 13.5k (...i'm gonna go take a nap lol)

a/n. hello hellooo my dear kickoff readers, hope you're having a nice day so far! this is the longest chapter yet, so i hope you enjoy <3 it's also got one of my favorite tropes everrr hehehehe you could probs guess what it is halfway through. see you at the bottom and happy reading! sorry if there are typos i didn't proofread this one as much as the others haha

nav. masterlist

☾·̩͙꙳ moodboard no.1

♬.*ﾟplaylist

You don’t cry much these days, but when you do, it’s usually out of nowhere.

Like now, as you stand in the school’s photo lab, developing the shots that you took for UTokyo’s game against Osaka last week, and you have to swipe at the tears on your cheek threatening to fall all over the captured images of grass, benches, nets, banners, stands, and him.

One of the photographs catches your eye, and you pick it up from the table. It’s a candid moment you took of Gojo on the field right before you confessed to him. You had spotted him first while the team was doing their warm-up, and you thought he looked nice from the way he had that concentrated look on his face that you’ve learned to love. But right before you clicked the shutter, he had turned away, chasing after the ball, and so all you could capture was his back facing you as he looked off ahead into the distance. You wondered if that was how it’s always been this whole time–with you looking at him while he’s looking off at something else. It was a depressing thought, but your mind had a tendency for sadness since that day.

The sound of the photo lab door opening jolts you back to reality, and you quickly straighten your posture and wipe your cheek with your sleeve, trying to sniffle as discreetly as possible, then set the picture down. Your fellow film major greets you quietly, asking if you’re still using the developer liquid, to which you say no, then hand it over to them. You stuff your photographs into a folder and head out the door.

You make it across campus to the Film & Media Studies building, then up to the third floor where your professor's office is. His door was ajar, but you still knocked before entering.

He looks up from the photographs he was grading. “Oh, y/n, hello. How are you?”

“I’m well, thank you, yourself?” you ask, taking a seat on the chair that was fixed to face his desk. You pull your tote bag into your lap.

“Great, thanks. How can I help you?”

You slide the folder to him over the scraped, worn burgundy wood of his desk. “I still had to turn in my photos for the assignment due last week. I appreciate the extension.”

“Ah, right,” he says, taking the folder from you. “I’ll get around to grading them. I’m curious, what did you end up choosing for your subject matter?” He tucks the folder underneath the pile that was to his side.

“I took photos of the soccer team’s game against Osaka Uni on Thursday last week,” you tell him.

He frowns at you. “Film cameras don’t have that level of zoom, though. I do hope you followed the rubric guidelines for central object to frame ratio, otherwise I’ll have to take off points.”

“Oh– I did. I took the photos from the sidelines,” you tell him, panicking already.

His eyes widened. “From the sidelines? On the field?”

You nod at him, fidgeting with your bag in your lap.

“Wow, I can’t say I’ve ever had a student take photos like that before. That’s pretty challenging to pull off, though,” he says, sitting up straighter, “...you mind if I take a look at them right now?”

You shake your head. “Oh, no. Not at all.”

He pulls your folder out from the bottom of the pile, then gently slips the photos out of them, rearranging them all across his desk. He leans down closer to study some of them, tilting his head curiously at others, furrowing his brow in concentration to a select few. “These are incredible.”

You take in a deep breath. “Thank you, professor.”

He nods at you with acknowledgement, and you watch him as he studies the images quietly for another minute, then looks up at you. “Is there anything else I can help you with?” he asks when he notices you’re still seated.

“Ah…yes, there was something I wanted to ask you.”

“What is it?” He taps his pen on the desk.

“I was wondering if you could write me a letter of recommendation for the film graduate program.”

He nods, like he was expecting the question. “Yeah, of course. Just send me your resume and portfolio.” He taps eagerly on one of your images. “Please send me digitals for these, too.”

You let out a relieved exhale. “Yes, I will. Thank you so much, professor, I really appreciate it.”

You left the building feeling extremely relieved about your professor agreeing to write your recommendation, but also feeling sad because you couldn’t tell Gojo about it, since this was the full-circle moment for the little arrangement the two of you had. There’s a thought that considers texting him, and you take out your phone then go to his name, but your thumbs just can’t bring yourself to send him a message.

The days of the week go by in a blur, and between every single little moment in life, your mind always wanders to him. It’s hard to get over someone when you’re surrounded by them. Like late at night while you’re editing the digitals of the game last week to send to your professor, and you find yourself staring at the pictures you’ve taken of him. It’s hard to get over him when the school worships the soccer team and you’re forced to see promotional banners and posters all over campus with his stupidly beautiful face in them. You didn’t have the heart to block him on Instagram, because you remember that time he teased you about how you didn’t follow him back, and you wonder if it would make him sad if you blocked him, so you just resorted to deleting the app instead. And although you were the one that asked for space from him, you were growing increasingly annoyed at how good he seemed to be at keeping it.

The library wasn’t even much of a safe space either, since you overheard a group of girls the other day at a table arguing about which of the players on the team is the hottest, and so you find yourself doing your homework on a lovely Wednesday morning at your apartment instead.

You lean back in your chair and look up at the ceiling, and then jump when you hear your phone ring, quickly turning it over to read the caller ID. Nobara. You accept the call, placing her on speaker, then set your phone back down on your desk.

“Hey, Nobie, what’s up?”

“Hey, nothing much. Just wanted to ask if you wanted to hang out,” she says.

“Oh, I would love to, but I’m working on homework right now. It’s due in a couple of hours,” you sigh.

“Boo, you whore. For what class?”

“My stats 130 elective,” you say. “I’m a film major, why do I need to know statistics?” You tap your pen to your chin. “Actually, it might be valid.”

“Is that the class with the creepy professor?” she asks. “The one that got caught with a PornHub tab open while he was presenting his lecture slides.”

“Yeah.”

“I took his class last semester! I still have all my homework for it,” she exclaims on the other end, “do you want me to send it over?”

“Yes, omg, I could kiss you right now,” you groan, resting your head on your arm sprawled across your desk in exhaustion.

“So definite no to hang out?”

“Sorry, I’ll reach out later though,” you sigh, “also, my car is still in repair…apparently something came up with the engine. So we can’t go far unless we invite Mina.”

“That’s fine, I’m sure she’ll be thrilled to come if we invite her just to chauffeur,” she says sarcastically. “By the way, how’d the pictures come along? For the newsletter?”

You lift your head up off of the desk in a panic. Shit. You were so focused on turning in your digitals of the game to your professor that you totally forgot you were supposed to send them to Utahime as well. “Oh my god, I forgot. When do they finalize the release again?”

“Isn’t it today at noon? I sent over film club’s photos this morning,” she says.

You glance at the time. 11:56am.

“Nobara, I’ve gotta go. I need to call Utahime, sorry,” you say. She acknowledges you, telling you to hurry, and then you hang up.

You call Utahime and scribble down on a sticky note to paste on your wall as a reminder to buy her a loving gift basket one of these days because of course she extends the release deadline just for you. You finish touching up the digitals and then send them to her via email, and after you finish your statistics homework, she calls you again to meet up somewhere nearby.

“Thanks so much for coming here,” Utahime says as she sits across from you at one of the local cafes you frequent. “Also, this chai latte is so good, I’m honestly surprised.”

You nod at her. “This place has great drinks.” You slide a folder across the table to her and she sets her drink down to accept it.

“Sorry if it was a hassle, but I just had to ask for physicals of these photos,” she sighs as she pulls them out. “They’re amazing, seriously, I gasped when I saw them. I’m used to sifting through a lot of professional sports photos for the newsletter, for all of the teams on campus, but I’ve never seen photos as charming as these. It could be the film photography aspect, since most of the ones I see are digital, but I’m seriously shocked you could capture shots like this at a rowdy men’s soccer match.”

You’re shaking your head at her. “Please don’t compliment me so much, I’ll cry. And it’s no issue, I had a spare set of physicals from when I developed them. You can keep them.”

She smiles at you. “Okay, well then, I think it goes without saying that I’ll definitely be including them for the sports recap this week. I’ll send you the money soon, too.”

You clap your hands together and interlock your fingers. “I’m. So. Grateful. For. You.”

She laughs across from you and takes another sip of her latte before sitting back slightly, glancing at the photos spread across the table. “Hm…how busy are you for the rest of the semester?”

You tilt your head at her and bring your coffee to your lips, taking a sip before setting it back down. “Not terribly busy, I quit my job last month so I’m just taking my assignments as they come and go.”

Utahime nods at you, a thoughtful expression on her face, and she smooths down the fabric of her shirt. “Okay, well, I got an email from the school this morning that one of the newsletter photographers for the men’s soccer team is moving to a different city, so they’re looking to fill in the position as soon as possible and they asked if I knew anyone,” she mentions, resting her elbow on the table and then placing her hand on her cheek. “They usually only hire professionals, but if I put a word in for you, they’d probably offer it to you.”

Your eyes widen at her from across the table, heart beating a bit faster in your chest.

“They pay really well for a part-time job. It’s essentially full-time pay for part-time hours,” she continues, “but it’s probably because you’ll have to travel with the team to their away games, including unofficial matches and conferences. If you’re not that busy for the next two months, then I think it’d be a good opportunity for you to build experience.”

You purse your lips together, considering her words. Although it’s a bit different from your long-term career plans, it was still a great way to get experience before graduate school. And besides, you needed the money, considering you quit your job last month and your savings were starting to run thin–never mind the fact that your car repair bill went from a few thousand yen to somewhere in the tens-of-thousands. And you would prefer to still be able to afford rent. Oh, and eat. Possibly still pay for Netflix.

But then there was the fact that having that kind of job meant that you would be spending a lot of time with the soccer team, and therefore increases the chances of running into Gojo. And you’re supposed to be staying away from him to get over your feelings.

“It sounds like an amazing opportunity, really,” you start, “...but I can’t.”

Utahime frowns at you and sits up straight. “Really? I thought you’d be excited. Why not?”

You sigh. “It’s complicated.”

“y/n…” Utahime starts, “I don’t really know what’s going on in your head right now, but isn’t this your dream? For your work to reach people? I know it’s only a stepping stone, believe me I know very well the path to becoming any sort of artist is an uphill battle of hell, but I’ve known you for a while now. And I know how much your dreams mean to you, and how hard you’re willing to work for them.”

Your heart swells in our chest at Utahime’s words. She was right, and you were starting to get really sick of letting your fears hold you back from what you really wanted in life. “...you’re right, I’m sorry. I’d love to be considered for the position, if you could recommend me.”

She smiles and nods at you. “Will do.”

–

The email for the job offer comes surprisingly fast, and you quickly read through it before accepting. It wasn’t a horrible time commitment, given you’d only have to take pictures during active play during matches, give or take a couple hours before, and the photographers rotate between who takes up each of the conferences so the work was split up. You were able to meet a few of the newsletter photographers & journalists during the game last week, so you already knew some of them. The offer letter came attached with a full calendar of the soccer team’s practice schedule, official match schedule, unofficial match schedule, conference schedule, and other publicity schedule, and you’re shocked at how busy all the players must be. The fact that they still have time to be students–and for most of them, active participants in fraternities–was honestly beyond you.

It seemed like they only had four more official matches left, two being away matches, along with a couple of unofficial matches that they may or may not participate in depending on how the season goes for them.

Their next game was on Friday against Kyoto university, and you were scheduled to shoot for their sports conference the day following as well. So you find yourself on a train embarked for the countryside, and you peer out of the window with a nervous feeling in your stomach. The sparkling skyscrapers and bustling crowds of Tokyo gradually started to give way into sights of expansive lush greenery, picturesque and charming towns, and winding rivers surrounded by trees. The closer you got to Kyoto, the sky became more gray until a steady drizzle began to fall against the train window. When you reached the final station, the rain had dissipated, and the taxi ride to the hotel was only about fifteen minutes. The journey felt exhausting, and you were so incredibly ready to pass out in a comfy bed.

You stood underneath a small sidewalk roof near the vending machines lining the outside of the hotel, trying to keep your bag and suitcase with all your equipment in it dry from the remnant soft mist of rain still lingering in the air.

“Hey, Utahime, sorry to bother you so late,” you say, holding your phone between your shoulder and ear, “but is it the Hilton on 3rd street? Or on Main? Because if it’s the one on Main, then I may have messed up-”

You stop speaking when you hear a masculine voice down the road towards the left, echoing off of the lined up small shops along the sidewalk, and your heart could have recognized the sound anywhere. You’re swift to turn and face that direction, almost dropping your phone in the process, and you see him– the object of all your suffering lately.

Gojo stood there, wide-eyed and stopped completely in his tracks as the recognition of you under the dim street lighting flashes across his face. He’s in pajamas– a red long-sleeve cotton shirt that looks so stupidly soft and comfortable it almost makes you emotional, with some matching checkered red pants. It was the most casual clothing you’ve ever seen him in. His hair appears damp, slightly tousled, from what you could assume was an effort to dry it off fast. And he had crocs on. In sports mode. You make a mental note to ask him about his charms and if he’s willing to trade any of them with you. But maybe some other day. When it doesn’t hurt to think about him.

“y/n?” he calls your name out, astonished. He’s looking at you like he’s just seen a ghost but in the best way possible.

You blink at him, heart skipping a beat just from the mere sight of him, and when you hear Utahime’s voice on the line you’re shaken out of your trance. “Oh, sorry, I’m still here. I…I think I just had my question answered. Thank you, have a good night.” You pull your phone down, gaze lingering on your screen for way too long because you can’t brave yourself to look over at the man to your left, and you end the call.

There’s the sound of remnant puddles of water splashing as he takes a few steps closer to you, and you can see his reflection in the water of the one in front of you. The expression on his face matches the one that was there when you last saw him outside of the UTokyo stadium at the west side exit. It’s an expression you could still see every time you close your eyes.

Finally turning to face him, you purse your lips together. “Hi.”

“Hey, what are you doing here?” he asks, voice laced with confusion and you see him take in your appearance with eager flicks of his gaze all around, like he couldn’t believe you were standing in front of him right now.

“Satoru!” another familiar voice calls out. “Did you get the orange-flavored ones too? Choso’s a fucking idiot and got the grape ones instead. I hate those. They taste like medicine. And ass. Not that I would know what–” You see Geto emerge from the darkness to Gojo’s side, and now he’s looking at you with a surprised look too. “Oh, it’s y/n. What are you doing here?”

“Hey, you two,” you chirp, trying to act as if an entire world of awkwardness wasn’t being exchanged between you and Gojo right now, for the sake of hoping that Geto wasn’t a very good judge of energy. “I’m here to take pictures of the soccer team.”

Your eyes flicker to Gojo, who is still looking at you like he’s never seen a person before.

“Oh, is it for another one of your assignments?” Geto asks.

“No, it’s not. It’s for the newsletter,” you explain to him, “I guess it’s my job now.”

There are a few more distant footsteps that follow behind the two of them, with the crinkling noises of plastic bags hitting against thighs echoing through the streets, and eventually they catch up. You see Nanami and the UTokyo team’s goalie, you believe his name is Choso, arrive at this little gathering that was taking place outside of the hotel.

“That’s awesome!” Geto exclaims. “I’m sure the newsletter will lead to a lot of exposure.”

“Who reads the newsletter?” Choso asks.

Geto nudges him with his elbow. “Dude.”

“What?”

He then fills Choso in on the conversation, “Oh, my bad.”

“Don’t worry, y/n, I read the newsletter,” Geto says, “I read it like the morning paper.”

“It only comes out once a week, but nice try,” you respond, giving him a weary look.

Nanami crosses his arms. “I actually do happen to read it,” he says, “although I refrain from the soccer section. Feels rather egotistic to read it. I find the campus politics section to be enjoyable, though.”

The rest of you exchange annoyed glances at that.

“Satoru reads the soccer section,” Geto says, slinging an arm around him, “‘cause he’s full of himself.”

For a moment, Gojo remains silent, while his teammates, who had been observing him with amused expressions, gradually shift to awkward blinking, like they were expecting him to complain, or say something sarcastic, or joke around by now.

“I do read it,” he says, eyes locked on yours. “I saw the release from yesterday. Your pictures were stunning.”

You’re flustered from the way he’s looking at you. “Thanks.”

Choso opens the plastic bag he was holding, peering down into it. “Shit. Ice cream’s melting, guys.”

“Yeah, we should probably head back to the rooms,” Geto looks at you, “do you want any snacks?”

“Oh, no. I’m good. I was just about to go check-in,” you say to them.

The boys politely say bye to you, and Gojo mentions something about staying back for a bit and hands Nanami the plastic bag he was carrying before they head back into the hotel. And then the two of you are alone under this roof, drops of water falling from it in between the two of you. He takes a step towards you, and you instantly stiffen. He seems to notice because he sighs and then walks past you to the vending machine that was next to you, pulling out some spare change from his pocket and inputting it into the machine.

“Do you want anything to drink?” The machine feeds him something, and he crouches down to pick it up before standing up again.

“No, I’m good, thanks,” you say, hand clutching the handle of your suitcase.

He cracks the can of his soda open. “So, you’re going to be traveling with us for the newsletter now?” he asks, so concisely, like he felt that every word comes with a tax.

“Yeah.”

“We don’t have to act like we’re strangers.”

You turn to face him. “What should we act like then?”

There’s a hesitant look in his expression as he looks down at his feet and then back up at you. “Can’t we at least be friends?”

The question softens you at your core, the tone of his voice sounding genuine. Being friends with him sounds so nice, and you kind of wish that’s what you two always were. Just friends. Maybe it would have avoided all of this heartache. But deep inside you knew that just being friends with him wasn’t an option anymore, at least not for now. “No, sorry. That’s just a recipe for disaster. I have to go check-in now.”

You grab your tote bag from the bench, grip tight onto your suitcase handle and make your way splashing across the shallow puddles then through the hotel’s automatic doors into the warmth of the lobby.

The lighting inside was warm and there were moderately high ceilings adorned with vintage-looking chandeliers. Around the perimeter, there were amenities including a cozy lounge with a fireplace, a small bar serving cocktails, as well as a business lounge with booths and multiple TVs mounted to the walls playing the local news. It made you feel like you were on vacation, and getting to a hotel at this hour while on vacation always meant that you were about ready to pass out on some freshly washed and tucked white linen sheets after taking a nice warm shower with a lavender-scented mini soap bar.

Making your way through the maze of plush seating areas, you get to the concierge desk to check-in. There was a professionally-dressed woman with a slicked-back bun standing there behind the counter, her eyes scanning the computer screen in front of her, and a big, burly man that stood behind her wearing all black that appeared to be security.

“Hello, I’m here to check-in,” you say, placing your forearm on the cold black counter.

The lady doesn’t look up from the computer screen. You clear your throat.

“Oh, hello. Name on the reservation?” she asks you.

You take a look down at your phone screen. The reservation was still under the name of the person that had recently quit the job. “Yui Ishikawa.”

The lady behind the counter hums to herself, obnoxiously tapping at the keyboard with only one of her index fingers. She was chewing gum. “Hm. Don’t see that name here.”

“What?” You squint at your phone and refresh the page, then turn it to face her. “But it’s on your official booking site. There was email confirmation too.”

She glances at your phone screen then taps at the keyboard again, still obnoxiously loud, but she uses her other index finger this time. “Yeah, still nothing.”

“This has to be some kind of mistake,” you say to her.

She looks up at you with an annoyed expression. “Do you want to take a look at the screen? See for yourself.” She turns the monitor to face you.

You don’t even work here, but you could see clear as day on their interface software that there was a reservation for this Yui Ishikawa woman at this time tonight. You point at it. “It’s right there. The reservation is literally right there.”

She turns the screen back to herself and squints at it. “Oh. Well, unfortunately, we already gave that room to someone else. Since it wasn’t there on our system a half hour ago.”

“What? How is that fair?” You were starting to get seriously annoyed. That refreshing shower you were dreaming of was starting to sound more of a need than a want with every passing minute. “Can you give me another room?”

“No, sorry, we’re all booked for tonight,” she tells you, without offering any additional help.

You look at her baffled. The big burly man behind her has now taken an interest in the conversation as well. “Okay…can you tell me if there are any hotels nearby that I could stay at?”

“Look. This is the countryside, ma’am, there are only a handful of hotels in this area that aren’t tourist accommodations. It’s also the night before a men’s college soccer match, and there seems to be some business seminar taking place nearby too. You can call and check, but the closest hotel this large is about an hour away,” she tells you.

“What? An hour away? I can’t afford a cab ride like that,” you tell her.

“Unfortunately, that isn’t really my problem,” she says.

You blink at her. “Are you being serious? This is ridiculous.”

“Ma’am, we’re going to have to ask you to leave if you can’t comply with our booking rules,” she declares.

“Leave?! You’re the ones that messed up the booking!” You’re yelling now, a few heads turning from the bar at the back. Exhaustion was pulsing through your veins and your filter was slipping. “Do you have any idea how to do your damn job?”

The woman guffaws at you. “Alright, that’s it.” She snaps her fingers, and you watch as the big, burly man walks around the counter of the concierge desk to make his way to you.

You take a step back, watching in horror as he towers over you and grabs onto your arm. “Let’s leave without any issues, miss,” he says in a deep voice.

“What?! But– hey, that’s my suitcase! Don’t– wait–”

“Woah, woah, woah,” you hear a familiar voice call out from the left. “What’s going on here?”

The three of you turn your heads in the direction of the voice, and you see Gojo, still clad in those ridiculously soft-looking pajamas, doing a light jog up to the counter.

The woman at the reception desk straightens herself up immediately, and she pets down on her dress and fixes her hair at the mere sight of him. You resist the urge to roll your eyes. “Nothing to see here, sir! Just a crazy woman that can’t comprehend hotel establishment rules.”

“That crazy woman just so happens to be my wife,” he says, pulling the big burly man’s hand off of your arm.

All three of you look at him dumbfounded.

“Y-Your wife?” the woman asks, sounding equally surprised and disappointed. “But she’s complaining about the fact that she doesn’t have a room.”

“I know, she does that all the time,” he sighs, “she’s got–...early-onset…dementia. Sweetheart, what did I tell you about packing up all your things and leaving the room when I’m not watching you?”

You give him a what the fuck look. He scowls at you to just play along.

“So…she’s with you?” the woman asks.

Gojo nods. “She always forgets that we’ve already booked a room together. Just a silly little sickly lady. Isn’t that right, honey?” He’s holding your shoulders and making you face the concierge woman.

“Y-Yes…” you say awkwardly, trying to put on a smile.

“So, if you could forgive her behavior,” he says with a super pleading voice, pulling you into him so your back is flush against his front side. “I’ll keep her in check from now on.”

The woman lets out a scoff in disbelief. “Alright…just don’t let her out again.” You send her a nasty look. The big burly man lets out a hmph and steps away from you.

“Sure thing. Let’s go, honey,” Gojo says, grabbing the handle of your suitcase in one hand and your upper arm in his other, dragging you with him across the lobby to the elevators. It isn’t until he’s pressed the up button and you finally gain your footing again after stumbling a few steps that you yank away from his grip.

“What are you doing?” you hiss at him, feeling embarrassed.

He looks down at you with a raise of his eyebrow. “Saving you from getting kicked out of the only decent hotel within a thirty-mile radius?”

“I didn’t need your help, I had the situation under control,” you mumble, smoothing out the layers of your clothing.

“Yes. That’s exactly what that looked like,” he muses as the elevator door opens and he steps inside, taking your suitcase with him as hostage. You panic at the sight and step inside with him, the door closing behind you.

“Where are we going?” you ask.

“To my room,” he says, pressing a button on the control pad, “you couldn’t get one, right?”

Your eyes widen. “No…I couldn’t.”

Gojo’s room is on the fourth floor, eleven units down to the right, and you follow him with dragging feet all the way down. Once he makes it in front of the door and takes the keycard out of his pocket, he pauses and looks over at you. “Waiting for you to thank me.”

You narrow your eyes at him. “For what?”

He’s waving the card in the air tauntingly. “You look exhausted as hell right now. I’m the one with the access to a nice hotel vanity and a soft, warm bed,” he practically purrs the words.

You’re instantly folding. “Thank you.”

“You’re welcome, honey,” he chimes, pressing the card to the reader.

“Stop calling me that,” you grumble as he opens the door for you.

You step into the room, rolling your suitcase inside with you, and take a look around. There was a single bed with the headboard up against the left-side wall, a nightstand on both sides and a desk where you noticed Gojo had his laptop open and a few books out. The bathroom was to the right, and there was a long table that had a coffee machine as well as the TV on top of it.

You place your suitcase against the wall then turn around, standing only a few feet from the entrance of the room, to find Gojo still standing outside in the hallway.

“Do you have to go somewhere?” you ask him. “Why are you just standing there?”

“Oh, I don’t need any of my other stuff,” he says to you, tapping at his pocket where you can see the imprint of his wallet, “room’s all yours.”

Your eyes widen at him. “Wait…are you going to sleep somewhere else?”

He tilts his head at you, as if that was obvious. “Yeah, I was going to go crash on the couch in Suguru’s room or something.”

“But–” you start, stopping yourself.

He’s waiting for you to speak, but you can’t.

“Well…good night, then,” he says and he turns to the side, about to walk down the hall, when you reach out and grab the sleeve of his shirt, stopping him in his tracks.

This was a bad idea. You’re supposed to be putting distance between the two of you right now, so that you can get over him. This was a man that very clearly said he didn’t have feelings for you. But honestly, you missed him. You missed him so damn much this past week, and you can only be strong for so long.

“You have an important match tomorrow,” you say quietly, “you should be getting a good night’s rest. We’ll share the bed.”

He turns to face you, looking down at where you were pinching the fabric of his shirt, which was just as soft as you had imagined, and he glances up to meet your gaze once again. “I’m…really confused right now.”

“What if you guys lose and are booted from the competition, and I have to spend the rest of my life regretting the fact that the reason the school lost a 12-year championship streak is all because I made you sleep on a couch?” you ask him.

He takes a step towards you. “You really want me to stay?” His voice was low.

“Yes,” you say. “We’re mature adults. Despite everything, we can just…share a bed for one night, right?”

He’s silent for a moment. “I think you trust me a little too much.”

Your face felt hot. “Are you telling me that I shouldn’t?”

“I’m telling you that you should really think this through,” he says.

“Just stay. Please.” The tone to your voice came off much more desperate than you would’ve liked.

He looks at you like the last thing in the world he could say right now was no. “You’re sure?”

“Yes.”

“Positive?”

“Satoru.”

“Okay,” he says, walking past you into the room, like he wasn’t really in the mood to argue about it anymore.

You sigh, sulking your shoulders a little bit, and watch as he takes a seat at the desk and continues to click through things on his laptop, occasionally sipping on the cup of coffee he had made for himself, as if your presence here was no unnatural thing.

This all felt so domestic for you. This feels like the most intimate the two of you have been with one another, despite the fact he’s literally made you cum with his tongue before.

“Who drinks coffee at this hour?” you ask, crouching down to unzip your suitcase, opening it up to find your cosmetics bag and a fresh pair of clothes to change into.

“Caffeine doesn’t really affect me anymore.” His eyes were still stuck on his laptop screen.

“You sound dead inside,” you comment, standing back up straight. You step over your suitcase that was on the floor and head into the bathroom, about to close the door but you open it enough to peer over at him from inside. “I’m going to take a shower,” you announce.

You see him poke his tongue to his cheek, leg bouncing up and down underneath the desk, and he squints at his laptop screen like there’s something so damn important that he must concentrate on or else the entire universe would collapse inside of a black hole. “Cool. Have fun.”

“I will.”

“I’m glad.”

“No peeping.”

“There’s a lock on the bathroom door. Feel free to use it.”

“That’s rich, coming from you.” And then you’re shutting the door.

It felt nice to freshen up, especially after that long journey, and then you’re doing your skincare in the mirror while you’re wrapped in a towel, trying to forget the fact that the man you quite seriously have immense feelings for is somewhere outside that door just a few feet away in this small hotel room. You spray a spritz of your perfume onto your skin, something there’s literally no point in doing before bedtime, but you still do it…for no particular reason at all, obviously.

When you step back out into the room, Gojo’s eyes are instantly on you from where he stood near the closet. He takes in your appearance and lets out a laugh, looking at you with amusement.

“What?” you ask.

“You look so cute,” he says, “with your little sloth pajamas.”

You’re fully blushing as you make your way over to the armchair in the room to set your cosmetics bag down on it to sort through the mess you’ve just made of it. “Don’t call me cute,” you scold, searching for your lip balm.

You could feel his frown from behind you. “You don’t like it?”

“No. I love it.”

“I’m not following.”

You turn around to face him. “Satoru. You promised me you wouldn’t lead me on anymore. That includes teasing me or complimenting me.”

He looks at you incredulously. “What? I can’t even call you cute? This fucking sucks.”

“Your problem,” you say.

“So you’re cool with sharing a bed, but you’re not cool with me complimenting you,” he lays it out.

“We’re sharing this bed out of the kindness of my own heart,” you say to him, “because I care oh-so-very-much about your soccer career, and understand how important good sleep is for an athlete’s performance. I’m just that considerate of a person.” You point a strict finger at him. “But for your information, if you touch me while we’re in bed, I’ll kill you.”

“Hm. Not sure if I feel threatened or turned on right now,” he says.

You roll your eyes and finally zip up your cosmetics bag, set it on the table then make your way to the left side of the bed. When you glance at the nightstand, you notice Gojo has his wallet, his phone and his charger all situated there.

“Why’s your stuff here?” you ask him.

“Huh? Oh, I was going to sleep on that side,” he says to you.

“I usually sleep on the left side,” you tell him.

“But I usually sleep on the left side.”

You blink at him.

“I–…I’ll sleep on the right side,” he suggests, shoulders tense and on edge.

“Okay,” you shrug, and move his stuff.

Gojo spends some time freshening up in the bathroom too, and when he comes out he looks like he’s actually tired, and you feel like it’s the first time you’ve seen him look as worn out as he probably should be for someone as busy as him. You’re already settled under the sheets, the duvet pulled all the way up to your chin as you lay on your back. He comes up to the right side of the bed, checking his phone for a few minutes while standing and rubbing at the back of his neck, then plugs his phone into the charger. He grabs the sheets, about to pull them back, when he pauses and looks at you.

“Are you su-”

“If you ask me if I’m sure about this one more time, I will no longer feel sorry for you, and will make you go sleep on the love-stained couch,” you threaten him.

He grimaces at your choice of words and pulls the sheets back, slipping himself into bed. “Why do you have to put it like that? You’re gross. Also, I’m pretty sure this bed has seen less-than-holy things too.”

The only lighting in the room came from the warm, dim bulb of the night lamp at Gojo’s nightstand. An incredibly awkward silence settles between the two of you. Or maybe it’s just awkward for you, because he seems fine. He’s on his back too, looking up at the ceiling, practically motionless but there’s the faintest sound of his breathing every once in a while and it’s a sound you’ve never heard in such detail before.

He turns his head to you, but you don’t meet his gaze just yet. You shuffle a little bit, hip bumping against his side, elbow hitting his arm. He’s masculine next to you, shoulders hard, muscles heavy, but when you finally turn your head to glance at him and see the expression on his face, you realize that everything about him was rigid—except for the way he was looking at you.

“When did you sneak it in?” he asks.

“Sneak what in?”

“The can of strawberry vanilla soda. Into my bag.”

You swear your heart stills a little in your chest.

“Before,” is all you say to him.

He sighs. “y/n…”

“It’s okay, you don’t have to feel bad for me. I wanted you to have it, regardless of how I thought my confession would go,” you assure.

It’s hard to read his expression from the side while he’s looking up at the ceiling, but it’s softer than it was a second ago. The need to change the subject consumes you.

“Why do you have calluses on your fingertips?” you ask him. “You’re a soccer player, you don’t use your hands for anything.”

“I play the guitar,” he replies simply.

You perch yourself up on an elbow, looking down at him with interest. His eyes flicker to your face. “Really?”

“No. I was just kidding. Hate the way you got excited though. I might have to pick up a guitar now.”

“Can you just answer me?” you sigh, flopping down onto your back again.

He laughs a little, a sound you feel like you could get drunk on at this point. He lifts his head up off the pillow enough to tuck his right hand underneath it, then rests it back down. You wish there was a mirror on the ceiling so you could see the flex of his arm. “Coach has us do the rock climbing wall at the gym at least once a week for practice. He thinks it’s a good workout. Causes a hell of a lot of skin tear though.”

“That’s it? That’s the reason?”

“Mhm.”

You shake your head, “You should learn how to play the guitar, because that’s a lame reason to have calluses.”

He lifts his head up off the pillow again and brings the hand that was tucked under his nape to in front of his face and he just looks at it. You look at it too. “Why are you so obsessed with the state of my hands?"

“A girl can’t be curious?” you ask.

“They’re not that bad.” You wonder if you’ve made him self-conscious.

You watch the way he flexes his fingers open and then closed. He turns it around, and you can see the veins trailing down from the valleys of his knuckles, disappearing into the fabric of his long sleeve. You remember that party, the two of you in that bathroom, when his hands were all over you, and it’s suddenly a little hard to breathe. He turns his hand again so the palm faces him, but now it’s also slightly turned towards you too.

“They’re bad here,” you say, pointing to his ring finger where you see slight peeling at the tip. The padded skin of your finger touches his skin. “A little bad here, too.” You point to his index finger, careless enough to allow all of your fingers to brush against his this time.

He watches you. “Your hands are really small,” he comments, like it was a marvel to him.

You look over at him briefly, and there’s not a single sign of tension in his face as he observes the image of your hand next to his hand in the air above him. He looked like he was at peace.

“Yours are just big,” you tell him.

He knows he’s not supposed to, and you really shouldn’t have let him, but he interlocks his fingers with yours regardless, holding onto your hand. You feel the roughness of those calluses all across your soft skin. His thumb runs over the curve of your knuckle, almost in a soothing way, like he was trying to apologize to you for something. And this was the only way he knew how.

Something sobers him up, because he suddenly pulls his fingers from yours and drops his hand to the duvet. Your hand lingers in the air for a few seconds before you do the same. And now you’re both awkwardly staring up at the ceiling again.

“Sorry,” he says, barely above a whisper.

“It’s okay,” you whisper too.

The silence settles for longer.

He sighs. “It’s not you, it’s me,” he says out of nowhere.

“Huh?” you turned your body a little to face him, and he was looking up at the ceiling as if there was something across the texture that he was trying to decipher.

“I don’t want you thinking that the reason I can’t-,” he pauses, to think carefully about his words, “...that the reason I can’t return your feelings is because of you, or anything you��ve done. It’s been a while since I’ve liked anyone to be honest, and I’m just really not looking to date right now.”

You’re hurt by his words. Because even if he didn’t want to date anyone, you thought that he would’ve at least tried to for you. You thought that he had at least some feelings that the two of you could’ve worked off of. “Why don’t you want to date anyone?”

“Reasons.”

“Obviously. What reasons?” you prod. When he doesn’t respond, you sigh. “If it’s something traumatic, I get it. My hamster died in the fourth grade,” you say, “I’ve never known peace since.”

He turns onto his side to face you with a soft and amused smile on his face. “Sorry to hear that. What was your hamster’s name?”

You try not to feel hot from the burn of his gaze and you turn onto your back to look up at the ceiling again. “Mr. Guilmon,” you say.

“Like…guilmon from digimon?

“Mhm.”

“You like digimon?”

“Oh yeah, I used to watch it all the time when I was a kid. My mom wanted to name my hamster ‘Scout’ but I refused,” you tell him, blinking a few times as the memories from your childhood come back to you. A small smile makes its way onto your face.

“I love digimon,” he says, fast, like he couldn’t contain it.

“Really?” you give him a sidewards glance, a little surprised.

He hesitates slightly before sighing, turning over in the opposite direction to reach for his wallet on his nightstand. You feel the fabric of the duvet stretch across you from the movement, and you remember just how intimate this all felt. He’s laying on his back again, holding his wallet up in the air with both hands as he flips it open, then slides his credit card up out of the slot, and shows it to you. Digimon themed. You have to purse your lips together to hold back your laughter.

He turns his head to look at you when you can’t help but let a little noise escape your mouth, and you can see through the laughter-induced sheen of tears in your eyes that he’s frowning.

“Hey–”

“I’m sorry–” you're fully laughing at this point, hand over your mouth to try to contain yourself, “it’s just– oh my god— you’re the last person I would’ve expected to have been such a nerd.”

“I’m not a nerd–” he tries to argue but you snatch the card out of his hand to study it closer, and also to memorize the numbers on the back.

“Popular soccer boy Gojo Satoru,” you’re giggling, “has a custom Digimon credit card.”

When he tries to reach for it, you stretch your arm off to the left. His weight leans on you, chest pressing against the curve of your shoulder, arm extending across you as he tries to grab his card back. “Quit it,” he mutters.

“No,” you say, holding it further to your left, weakly trying to push him away from you.

“Quit it,” he repeats, face scowling now with what looks like embarrassment, and he holds his upper body up by the elbow, leaning over you even more to reclaim it, “or else.”

“Or else, what?” you say through wheezes, and it seems like something in him snaps because suddenly he grabs your wrist, hard, pinning it down onto the mattress, holding it there next to your head, and his entire upper body is towering over you. Shocked, you’re breathing fast, your eyes darting across his face, and he’s looking at you with a furrowed brow and a tense jaw.

“Or else I won’t keep my promise,” he says through a harsh breath, his voice low and rough.

You’re stunned underneath him. “What promise?” you ask, breathlessly.

He leans down closer, to the point where the fringe of his hair brushes against your forehead. “My promise to hold myself back from you.”

You swallow hard, chest heaving. You feel the heat of his hand on your wrist burning through to your veins. You try to squirm slightly in his grip, but he just presses your wrist down further into the mattress.

He glances at your lips, eyes dilated and stern, and leans down even closer to you. “Do you have any idea how bad I’ve been wanting to punish you for leaving me in that bathroom by myself?” he says in a voice so husky you feel the arousal build at your center the second your head registers it.

You can’t find your words. He keeps his eyes locked on yours, as if to make sure yours stay on his too, and you’re docile under him until he’s distracted you enough to pinch his credit card between two of his fingers and discretely pull it out from your grip. He then lets go of your wrist and disappears out of your line of sight when he flops back down onto the mattress next to you, tucking his card back into his wallet.

“But I won’t. Because I’m a nice person, and will respect your space. Or whatever.”

You don’t know what to say, your hand finding a place over your heart as you try to take deep breaths to calm yourself down.

“We should probably go to sleep,” he sighs after a minute, tossing his wallet back onto the nightstand and reaching over to turn off the light.

It’s dark now in the room, the only light coming from through the layered fabrics of the curtains. It's a cold light, possibly from the moon and maybe some dim neighboring white street lights, but it’s enough to where you could still see the slight texture of the ceiling, and maybe his face.

You both spend a few minutes trying to get comfortable. You try not to bump your butt against him, or brush your chest against his arm, but it happens a couple times anyway, and you mentally curse yourself for it. The rise of the duvet fabric from his chest becomes shallow with his breathing, and you think he’s fallen asleep, but then the two of you turn over at the exact same time, facing each other, eyes flying open and gazes meeting. It startles the both of you, but neither of you look away or say a word. The two of you just sit in the moment for what feels like hours, and very could’ve easily been.

You’re the first to break the silence. “You know, there was a time where I thought that you weren’t even real.” You’re speaking hushed, like you’re afraid someone will hear, even though there’s only two souls in this room right now.

“What?” he asks, a slight raise to his eyebrow. “...why.”

“I don’t know. You’re like this urban legend around campus. You probably don’t know it, since you’re in it, but the world you’re in is very different from the world the rest of us students are in.”

He’s silent for a moment, his face being briefly illuminated by the reflection of a car’s headlights on the windows of the surrounding building. “I think I know what you mean.”

You blink at him. “I thought you would have a few more follow-up questions to that, but I guess you’re surprisingly self-aware.”

He hums to himself. “I think I can just put it into perspective.”

“Perspective?” you ask. You’re hanging onto every single one of his words tonight. You don’t want a single one of them slipping through you, not understood.

“Yeah,” he says, “there are moments where I feel like I’m not in that world anymore. And it feels nice. To get out of it.”

You want to ask him when those moments are, but he’s quick to speak again.

“I guess that means I’m aware of the moments where I am in it, so I know that it exists, if that makes sense? I don’t know.” He looks down at your pajamas, at the dancing sloth at the front, and the crease to his brow relaxes slightly.

“Mhm, makes sense.”

His eyes are back on you, studying. There’s a strange look on his face that you can’t really comprehend. “I want to know about your world,” he says.

You breathe in deep, and exhale shallow. “My world is simple. I want to be a filmmaker and then live in a little cottage.”

He smiles at you. “A little cottage?”

“Yeah,” you say, “maybe in the countryside. The Italian countryside. With my own garden in the backyard so I can use fresh zucchini in my salads.”

“Any animals? Pets?” he asks, like he’s envisioning it all in his head too.

“Maybe some chickens,” you say, “I promised Mr. Guilmon I’d name another one of my pets after him someday. I have to keep my promise.”

He nods. “You do.”

There’s another silence, but it doesn’t feel awkward this time.

“Did you turn your photos in to your professor?” he asks.

“Yeah, I did,” you tell him. “Earlier this week.”

“Nice. What about your reference for grad school?”

“I asked him for it.”

“Oh?” His eyebrows raise. “How’d it go?”

“Mm…I was really nervous, but it went well. He said he’d do it.”

There’s such a tenderness to his expression that you feel so compelled to kiss him right now. “That’s awesome. I’m proud of you. That’s one step closer to your dream.”

You purse your lips together from his words, sitting with the warm feeling in your chest. You want to thank him again, but instead all you say is “we’re even now.”

He lets out a small chuckle. It comes from his throat. “You’ve said that so many times.”

“I know.” Because you can’t believe it’s all over. This little arrangement between the two of you. You don’t want it to be over. “I can’t remember when the first time I said it was.”

“That night,” he answers you fast and with certainty, like it was at the forefront of his mind, “when you drove over rocks. And we sat together on the curb. And I realized how badly you take care of your car. You don’t need thousands of chain restaurant napkins in your glovebox, by the way. No matter how much you might think you do.”

“Wow. I was almost romanced by you for a second, but you ruined it,” you mumble.

You’re instantly taken back to that night. You remember the gentle quality in his eyes as he stared up at the stars, and you can still see the reflection of that sky in his eyes right now with the way he’s looking at you.

“I really liked you that night,” you whisper, “I wish you were like that all the time.”

“Am I not like that all the time?” he asks, voice soft to match yours.

“No,” you say, “sometimes you’re mean.”

His eyes on you are gentle, somewhat careful. “I’m sorry for being mean.”

You wonder if you can change his mind. If you can will him to like you back, if you can will him into wanting a relationship with you. You want to be his exception, not his rule.

“It’s okay. I’m mean sometimes, too,” you say, “mean to myself for sharing a bed with a guy that doesn’t like me.” He’s looking at your lips as you speak. “I’m bad like that.”

“You’re not bad,” is all he says.

“I am,” you say, and you inch closer to him, until there’s hardly any space between the two of you. You look up at him, faces inches away. You feel so safe with him, and yet you also feel scared, because you like him so much that you would let him ruin you if he wanted to. You press a flat palm to his shirt, searching for his heart, and you find that it’s beating fast in his chest. “I’m a bad woman, Satoru.”

“y/n,” he says, like a warning.

“I mean it,” you whisper.

“You said you’d kill me if I touch you,” he reminds you, sounding a little breathless.

“I can’t kill you, you’re way stronger than me,” you whisper, “so touch me.” Your hand is gripping onto the fabric of his shirt now, tight, with desire. He’s looking at you with a whole lot of desire too, but there was something else there as well. “Please.”

He wraps his hand around your wrist–the heat of his touch that you so badly wanted, craved, finally on you–but it’s to pull you away from him. Your grasp on his shirt releases and he brings your hand to the front of your chest, laying it down gently before letting it go. Your wrist lays limp there, missing his touch. Limp in front of your beating heart.

“Let’s just go to sleep, okay?” he says softly.

Your eyes widen when you look at him, and you couldn’t even hide the hurt that settled across your face if you tried. Gaze dropping to his chest, you see the way it was rising with every breath he took, and for the second time in this life, you’ve felt so utterly rejected by him. You give him a compliant nod, and scootch back away from him before turning away. He stays as he is, watching your back, and you can feel his gaze on the nape of your neck.

Counting the minutes to fall asleep felt exhausting, but the last thing you remember before you closed your eyes was the feeling of a tear trickling down onto your pillow, wet and cold against your cheek.

–

You wake up the next morning to an empty bed, and an even emptier feeling heart. There’s also this weird feeling of disappointment within you, and you don’t really know why.

Grabbing your phone on the nightstand, you quickly search for the email with the men’s soccer team practice schedule, and you see that they had a sharp 8am practice this morning before the game in the afternoon. The time reads 6:37am, and you’re wondering where Gojo went so early in the morning before heading off to the practice field.

You went back to sleep for a couple hours, and then woke up again. By the time you took a shower, got dressed, and went downstairs to the hotel lobby to eat breakfast, it was already 10:00am and it was time to make it to the field so you could set up and calibrate your camera prior to taking photos for the match. Following Utahime’s gameday instructions, you took a cab to the location with all of your gear.

The Kyoto soccer stadium was less of a stadium and more of an extremely large and open expanse of grass that had enormous silver metal stands stretching across the perimeter. It was something you would expect of an area in the countryside, but security was still somehow tight across the fenced off area.

It was still a couple hours before the game, so the field was bustling with pre-game set-ups and the stands were empty. There were a few sports canopies being put up, as well as a small truck with workers that were working to stock up the hydration stations. A few men in suits were seated at tables with notepads and clipboards, looking busy in conversation and on what sounded like business calls. As you walk down the sidelines, you notice a few other people checking the distances between the goals and the chalk markings across the field. The stands were extremely close to all of the action, and when you look to the right, you see a couple of familiar faces there.

“Ah, y/n! We’re over here.”

You approach the group of three people, all seated on the lowest metal bench of one of the spectator sections. There were a bunch of tripods, cameras, cases, and laptops sprawled across in front of them. You recognize Hana and Minato, but you don’t recognize the other man sitting with them. You had met Hana and Minato at the game against Osaka last week, they were both professional photographers for the newsletter.

Hana hops off the bench and comes up to you. “It’s seriously so cool you’re here with us and that Utahime got you this gig,” she says to you with a smile. “Make sure your schedule is free on nights after matches, all us photographers usually get dinner together afterwards. You’re the baby out of us, so we’ll pay for you.”

You return her smile with one of your own. “That’s sweet, and sure I’ll try to.”

You glance at the man whose name you didn’t know, your gaze meeting his, and soon enough he’s jumping up onto his feet too and making his way over to you.

“Ah, this is Kaito. Kai for short,” Hana says, gesturing to the man, and then to you.

Kai extends his hand out for you to shake. He’s tall and a bit lean. His style is really boyish—totally nailing the street photographer outfit with the white shirt underneath a flannel one, and some Carhartt pants paired with some Vans. You reach out to shake his hand, and he holds onto it for a second longer than you would’ve expected.

“Hi,” you greet him and tell him your name.

“That’s a nice name,” he says with a smile.

Hana claps her hands together. “Okay! We all know each other now, that’s great. We should get started prepping before the players get here, I believe they’re scheduled to be here in an hour.” She walks over to the benches and picks up her digital camera. Minato grabs his as well as his tripod, then walks over to Hana’s side. “The way we usually do it is to split the field into corners, and each of us works that perimeter. The videographers are here too, so just make sure you don’t accidentally knock over or stand in front of one of their cameras.”

All three of you nod at her and you unzip your case to take your film camera out. Kai is next to you, looking at the device in your hands curiously.

“Kai, you can work with y/n for today since it’s her first day. Split up those two corners over there,” Hana says, pointing to the other end of the field. You and Kai look in that direction. “Minato and I will take the other short end.”

With a few more discussions and detailed instructions, the four of you disperse to your assigned locations. You’re a step ahead of Kai, although he should really be the one leading your stride since you’re the new one here, but he soon enough catches up to you.

“Is that a Canon AE-1?” he asks you, pointing to your camera.

You look at him a little surprised. “Yeah, it is. As vintage as they get.”

“Sweet, I used to shoot on film too. Second-hand?”

“No, third. Still cost me an arm and a leg, though,” you sigh.

He laughs. “They’re not that expensive.”

“I’m a broke college student. I sometimes have to choose between paying rent and eating food,” you say to him.

He kicks at a random can on the grass, sending it flying forward, instead of picking it up. “Yeah, definitely don’t miss those days.”

“When did you graduate?” you ask.

“From UTokyo two years ago,” he says.

You bend over to pick up the can he kicked and jog a little to the trashcan nearby, tossing it in, then jog back to him. “That’s nice. You’ve been doing this for two years?”

“Yup,” he says to you as the two of you reach the corner of the field outlined by freshly drawn chalk. He kneels down on the grass, sets his camera case down, and opens it up. Your jaw drops.

“Is that a—Leica camera?” you ask him, shocked.

He smirks up at you. “Sure is.”

“Oh, so you’re just rich, then,” you sit down on the grass to look at it with interest, marveling at its condition.

“Nope. I’ll bet I got it for cheaper than your Canon there,” he points to the camera hung at your neck.

You meet his gaze. “No way.”

“Way,” he says, pulling out the attachable lens before wiping at it with a microfiber cloth, “I know a guy. He sells used cameras. The only issue is you’ve gotta refurbish them yourself.”

You sigh. “Wonderful. Because I would know how to do that.”

He lets out a half-laugh, and you glance up briefly to look at his expression. He was amused. “It’s pretty easy, just gotta do it once. And then you’ll have a used Leica that works brand-new, all for just under a hundred-thousand yen.”

You’re looking at him with surprise again. “That cheap?”

“Yup.”

“Wow…” Your finger plays with the lens cap on your camera.

“If you want, I can send you his info. But if you want to meet up with him, it’ll probably have to be facilitated through me,” Kai says, “He takes clients by recommendation. No use in selling a used camera to an idiot that doesn’t know how to refurbish it. He’s looking for niche photographers that have the interest.”

You press your lips together, considering it. “Sure.”

He hands his phone to you. “Alright, gimme your number.”

You hesitate for a second before typing your number into his contacts then hand it back and watch as he saves it in his phone. “Canon girl. Won’t forget ya.”

The two of you make work for a second, eyeing the field and mapping out angles of where to get the best shots during play. Kai gives you some pointers and you’re marveling at how good they are.

“Not really used to shooting on film anymore,” he mumbles, peering through the hole on your camera when you handed it over to him, “but usually a one over five-hundred shutter speed works well for sports. I’d switch between that and over two-fifty though, to avoid a blurry finish.”

“Thanks,” you say to him, wanting to write all this down to not forget it. “Wish I knew this last week.”

“Why shoot on film?” he asks out of nowhere, handing your camera back to you. “Why not digital?”

“Oh, it’s a personal interest,” you say to him, adjusting your shutter speed as he suggested, “I think there’s a charm to it. I want to be a movie maker, and shoot on film medium.”

He frowns at you. “How are you going to do that?”

You tilt your head at him, shuffling on the grass. “I’m going to apply to the film graduate program at UTokyo to start.”

He laughs at that from where he’s seated across from you. “Really? That’s a waste of your time.”

Your heart sinks a little in your chest from his tone. “Why would it be a waste of my time?”

He turns to face you more directly. “y/n, trust me, I know this career path. Been there, done that. Millions of film majors like yourself always have these big-ass dreams like ‘I want to become a director, I want to do screenplay’ etc., but only one or two of them actually succeed.”

Your shoulders sulk. It’s not the first time you’ve heard those words from someone—your own parents practically recited them word-for-word before you headed off to college—but you had been doing really well all of senior year to ignore that nagging little voice in your head. It was honestly quite triggering to hear it all again right now. “Well, I think I can do it.”

He lets out a short scoff. “You sound real convincing there.” When he catches sight of your upset expression, he straightens his back a little. “My bad. Just trying to look out for you. I’m your senior in this industry. I know my way around these things. Trust me.”

You nod slowly. “I know. Thanks.” Part of you wonders if he’s just projecting.

“Well anyway,” he shrugs, “I think you should just focus on photography for now. It’s the safest career option for you to do.”

“I guess you’re right,” you say, wanting to diffuse the conversation.

The two of you disperse to your assigned corners once the stands start to fill with spectators. Shortly after, the players make their introductions onto the field, and you can see Gojo across the field. He’s too far to read his expression, but for some reason when you look at him, that disappointed feeling from this morning comes back to you. You try to push it down and just focus on your task at hand.

UTokyo does well during the match, and Gojo seems to be playing much better than the Osaka game last week, scoring two goals within the first half. There were a couple of times where there were throw-ins near your corner, and you made eye contact with him as he’s breathing heavily, wiping the sweat off his face with his jersey, and every time you look at him, that melancholic feeling washes over you again. UTokyo wins 3-2, the crowd evidently disappointed as they were rooting for their home team, and by the time the disgruntled fans started to clear the stands, the sun was setting over the horizon and the sky was a golden color.

The referees on the field begin to oversee the post-match proceedings with the players. Kai comes around to meet you at your corner, and Hana and Minato arrive there too.

“Hey team! How’d it go?” Hana asks, a little out of breath from her journey over here.

“Went fine,” Kai responds.

“It was a little tricky,” you comment, “but I think my photos came out well.”

Hana nods. “Alright, sounds good. Are we still on for dinner tonight?”

Kai and Minato nod, and then all three sets of eyes are on you. You hesitate for a moment, and look off past them to where you see the group of soccer players in conversations with the coaches and referees. You see Gojo standing there, his hands on his hips as he peered across the field, tilting his neck to the side repeatedly, and you realize he had been doing that all match long. That unsettling feeling within you starts to brew once again. “Uh, I’m really sorry, but I’m not feeling very well. I think I might just head back to the hotel.”

Hana and Minato nod at you with a concerned expression, while Kai just looks disappointed.

“Okay, well, I hope you feel better,” she says.

You end up taking an Uber back to the hotel in haste, not wanting to run into Gojo or any of the other soccer players after their match, and make it to the room, using the key card that Gojo gave you to get inside. You take a shower to freshen up, and by the time it’s 7pm, you’re starving. You put on a simple outfit and make it downstairs into the lobby of the hotel, about to go peruse the nearby dining options, but right when you step out of the elevator, you run into Gojo.

There’s a look of pleasant surprise on his face and you take in his appearance. He was still wearing his soccer jersey, covered in grass and dirt stains, and his face was slightly flushed from exertion. You figured he just came back from the field.

“Hey,” he says, “sorry, I was just about to head over there.” He jerks his head off towards the lobby, and you glance in that direction. There was a group of maybe thirty people gathered around the lounging areas and high-tables over at the business suite, and you recognize them as UTokyo’s soccer players, along with Coach Yaga and other team staff. The players were still all clad in their uniforms, carrying all their stuff, and there were plays of today’s game rerunning across the TV screens. You realize they’re probably prepping for interview questions for tomorrow’s conference.

“Oh, please, go ahead,” you say to him.

He tilts his head at you. “Are you doing alright?”

You were aware that things might feel awkward after last night, and that your cheeks would probably feel hot like they do now the next time you had to talk to him. Your mind takes you back to the memories, when you think about how badly you wanted him to stay with you in the room because of that hollow feeling in your chest from missing him, despite how you knew it was bad for you. Because this man standing in front of you doesn’t like you in the way that you like him.

And then it clicks. The reason for that feeling of disappointment you’ve had since the moment you woke up today.

When you glance up at Gojo this time, you see him differently than you had from a second ago. You finally notice the slight dark circles under his eyes, and figure out that the reason he’s been tilting his neck to the side all day was because he was trying to stretch out a kink. You vaguely recall that moment you woke up in the middle of the night, and your sleepy brain registered that there was no longer the dip of him in the mattress next to you.

“When did you leave the room?” you ask him. You know your voice is quiet when he has to lean down a bit to hear you.

He takes his time answering, indulging in a few breaths. “What do you mean?”

“You know what I mean,” you say, starting to sound hostile, “you left during the night, didn’t you?”

He doesn’t deny it.

“You left once I fell asleep,” you say, eyes widening with realization.

He sighs. “Yes.”

“Where did you go to sleep?” you ask, trying to keep your tone level.

“Suguru’s room had an extra couch. I pushed them together.”

You felt sick and sad, feeling something worse than rejection right now. There was a part of you that still thought that all of this from him was just a joke. A prank. That he was finally going to say just kidding, I like you too. The reason you’ve been so disappointed since the minute you woke up today was because there was a part of you that thought you were going to wake up this morning with his arms wrapped around you, back pressed tight to his chest while he whispers sweet nothings in your ear of how much he likes you, of how much he wants you, of how much he wants to be with you.

“Why? Even after I said I didn’t want you to have bad sleep?” Your voice was laced with hurt. You didn’t even know how to explain to him why it upset you, because deep down you’re scared it isn’t even valid.

“It’s fine,” he says, “I played fine today. And we won.”

“You could’ve stayed. Do you really hate me that much?” Your words are shooting to kill now. “So I’m good enough to finger in a bathroom at a frat party, but not good enough to sleep next to?”

He furrows his brow. “I don’t understand why we’re arguing about this,” he says, tone starting to match yours, “you’re the one that wanted space. I was just trying to respect that.”

“If you really wanted to respect my space, you wouldn’t have agreed to share the bed with me in the first place.”

“y/n,” he says, “that’s not fair.”

“You should’ve known better.” You’re breathing fast, tone searingly accusive. “You know that I’m trying to get over you, and that I’m vulnerable, and that I’m probably confused about a lot of things right now.”

“I ask if we could at least be friends, you say no because it’d be some recipe for disaster, then you practically beg me to stay with you and tell me to touch you while we’re laying down together. You don’t think that’s confusing for me too?” he counters.

Your cheeks flush with embarrassment at the memory of your desperate actions last night, and he instantly looks apologetic. You feel like you’re being unfair, but you feel like he’s being unfair too.

“I’m the one with feelings,” is all you say in your defense.

He swipes at his chin roughly with the back of his hand, smudging the dirt up to his cheek, and then closes his eyes for a second, like the weight of today has finally hit him all at once. He looks exhausted. “Right,” he says, softly, “I’m sorry.”

“Yo, Satoru!” one of his teammates yells from the center of the lobby. “Coach needs you, man.”

He rubs a hand down his tired face then throws a haphazard glance over his shoulder. “Yeah, I’ll be there in a sec,” he calls out and then looks back at you. You can’t make eye contact with him, and just stare at the print on his jersey instead. “I’ll sleep in Suguru’s again tonight. The room is yours.”

There’s a lump in your throat and you feel like you’re about to cry. “Okay.”

He reaches into his shorts pocket and gives you a room card. “Here’s the spare. I don’t need to come grab my stuff for the night, so don’t worry.”

“Okay.”

He sounds like he wants to say more, and you see him take a small step towards you, hand reaching out for you, but this time Coach Yaga’s stern voice is calling out to him too. He sighs. “Good night.”

“Mhm. Thanks.”

He hesitates before he turns on his heel and you watch his back, with that signature #10 stretched across the fabric of his uniforn, as he jogs through the hotel lobby to his teammates.

The walk back to the hotel room is depressing, and you find yourself dragging your feet all the way there. Once you make your way inside, you look around at the room and see some of Gojo’s belongings scattered around, but it didn’t seem like there were any of his essentials. You look down at the spare key card in your hand–a promise from him that he won’t try to upset you anymore tonight–and that lump in your throat from earlier comes back.

You hated fighting with him. You hated being away from him. Those feelings that you thought would go away just as fast as they came still sat so stubbornly within your heart, and it was becoming impossible to bear.

You wonder if meeting him was all just some horrible, twisted mistake.

Before you have time to dwell on that sad sentiment, your phone screen lights up with a message.

|| 7:52pm unknown number: kinda sucks you’re not here with us. was looking forward to showing you more of my camera

|| 7:53pm unknown number: this is kai by the way

The features of your face feel heavy as you look down at your phone screen. You don’t even notice your eyes are teary until you realize the blur of your vision makes it hard to see the letters as you type out a response.

You just wanted a distraction from all this pain.

|| 7:54pm you: can you send me the address? i wanna be there

a/n. grrrr i love a one-bed trope so much grrrrrrrrr it's gonna do it for me every damn time lol. thanks a bunch for reading!! there's still so much that i've got planned for the series haha i think the second half is gonna be a lot crazier than the first. super excited to write it though.

➸ take me to chapter nine!

taglist: @who-can-touch-my-boob @therealestpussyeater @lost-resonance @hojoslutoru @foulprincesscycle @luniunia @alekssashka7 @bsdicinindirdim @tsukikourito @getitsatoru @slut-4-gojo @cactisjuice @kissofife @tiredflame132 @cliosunshine @ethereally-lyann @btszn @prince-wyiilder @semra4 @gojosimp26 @drthymby @ninitoru @bbyxxm @fvsm4x @sadmonke @zoinks1010 @bakuhoethotski @horisdope @sykostyles @aquaberrydolphin @colouringfrogssittinginleaves @ri-sa20 @purplehallow11 @mwtsxri @ritsatoru @bxddiebloss @chwesuh-imnida @mo0nforme @viware @still-fking-single @megumisthirdog @gintokhi @karvokr @cierocanteat @imjustaweirdnerd (hope i didn't miss anyone thank u all sm!!)

2K notes · View notes

prollywolly · 1 month

Note

hiii I was wondering if you could write how the jjk men would be in the shower with you?👀

Showers with the JJK Men

summary: what taking a shower with the jjk men would be like [includes: gojo satoru, kento nanami, choso, suguru geto, ryomen sukuna]

warnings: mdni! mentions of shower sex, obviously being in the nude, language, fluff, 18+, smut (lots of dirty words lolol), and fluff!

word count: 2k

a/n: hooray for my first request!! i absolutely loved writing this and i hope everyone can see this in their heads the way i did when i was thinking of what they would all be like! Remember that my requests are open and you’re more than welcome to ask anything that’s within the guidelines posted on my page! i hope you all enjoy, thank you for reading!! <3

✧･ﾟ: ✧･ﾟ:✧･ﾟ: ✧･ﾟ:

gojo:

showers with gojo are 50/50

they’re either very sensual and domestic, filled with nothing more than whispering sweet nothings into each others ears while you let the warm water wash the suds off your bodies

or they’re absolutely filthy and make you feel like you need another shower by the time he’s done with you.

gojo can be easy to read when he comes home only because of how clingy he is with you

it’s always been pretty easy to read him in your relationship because he makes it known how much he loves being babied by you and/or taking care of you

on a night where he’s exhausted and really just needs you to wash his hair for him and kiss the boo boos away, he’ll be more than happy to tell you.

“such a long day baby… i’m too lazyyyyyy to shower.”

you’re already getting the warm water going.

he’s like putty in your hands the second that your nails start to lather up that shampoo onto his scalp.

he’s fallen asleep a couple times sitting on the floor of the shower while you just finish rinsing his hair and body off.

he loves when you use your body wash on his skin because he loves curling up in bed knowing that he smells like you.

“thank you baby, what would i do without you?”

he really doesn’t wanna think about the answer to that question.

then, there’s the days where satoru can’t keep his hands off you from the moment he steps through the door.

“c’mere baby, missed you s’much,”

he then proceeds to fuck you against the glass door of your shower and it’s so obscene it looks like it’s straight out of a porno

the warm water splashes onto the glass and cascades down with each flick of his hips

you always have to brace yourself on the glass and end up unconsciously creating that all-too-familiar steamy handprint that ends up staying on the glass even after the steam from the water clears

shower sex with gojo is always so rough only because he’s pent up from everything that happened during the day and it’s the first time he gets to release everything

“y’feel good pretty girl? tell me how it feels, yeah?”

y’all waste so much water, the water bill looks CRAZY every month

nanami:

HUSBANDDDDD UGHHHHHH

we all know how hard working and dedicated kento is

although he does love showering with you when you guys need to get ready quickly for your day…

he much prefers to take long soaks with you in your bathtub to wind down after a long day much more.

you guys have so many scented bubble bath solutions, vanilla and coconut scented body washes that you like to caress into each others skin, it’s truly so raw and vulnerable

kento will never turn down bath time.

there’s been days where he works himself to the bone and is so exhausted, but knowing that you’ll have the bath ready for him when he comes home is the only thing that seems to make him push even further

as a gag gift one christmas, you got kento a small removable table to hook onto each side of the porcelain that had small sections for your laptop, some snacks, and his occasional glass of wine

he genuinely uses it every time and will never let you live down the “best gift he’s ever received”

on the most trying of days, he loves having you on top of him, letting yourself slowly sink onto his cock and just bury your face into his neck

your insides feel just as warm as the bubbly water you two are surrounded in and he finds solace in the jolts of pleasure he gets whenever he slightly adjusts himself in the tub

riding him softly in the tub is his guilty pleasure

he loves the domesticity and vulnerability of fucking his lover while you share a bath

he’s a family man through and through

the sorcerer job and corporate job are endured, to be able to provide for a family in the future, but for now?

everything is for you. He loves coming home to you every single day and being able to see you waiting for him so eagerly <3

choso:

choso works so hard to be the best brother and family member that he can be

family-oriented was invented after examining his dynamic and his role in his family

but even the strongest need their time to wind down.

which is exactly what showers are for.

being a curse, choso finds domesticity and humanity in the intimate things he shares with you

showers are his times to just turn off his brain and let you work your magic

you take such good care of him, he doesn’t know what he would do without you

the way you tenderly lather his scalp with the shampoo and conditioner, the way you take your time to wash his body and massage his aches from the day

sometimes he thinks about the family he wants to create with you in those moments, and those are the moments where he wakes up from his trance and pounces on you.

one second you’re washing the suds off his body, the next you’re pressed up against the shower wall as he viciously pounds you from behind.

he’ll turn you around to face him while he fucks you only because he can see the future of his bloodline in your eyes

you take him so well, never ever complain about how full he stuffs you of himself

“takin’ me so well, love… gonna fuck a pretty baby into you, hm?”

he’ll grit his teeth and hiss as he pumps his cum inside of you, watching some of it trickle down your inner thighs as they quiver and buckle from the loss of his cock

and then he’ll go right back to wanting to be babied

as you get out of the shower, the two of you will get dressed and he’ll throw himself on top of you

you’ll caress his freshly washed hair and he relishes in the scent of the body wash you use, fully aware that not even two minutes ago you were taking his dick like a slut

he’s so ready to start a family with you, and to still share moments like these even when you’re old and gray.

suguru:

showers with suguru are a taste of the finer things in life

he’s so gentle with you once you’re both under the water

his long locks will cascade down his shoulders, dripping as he caresses your arms and shoulders

“‘ts okay darling, i’m here.”

he loves to run his fingers through your hair after he applies the conditioner

his fingers just slide through so effortlessly and he obsesses over the soft sighs that fall from those pretty candied lips of yours

nonetheless, the appreciation for running fingers through hair goes both ways

washing suguru’s hair for the first time made you fall in love with him all over again

he’ll shut his eyes and throw his head back as you gently lather the products into his hair

he has a pine scented shampoo and conditioner scent that give him such a manly, musky scent

it’s intoxicating

suguru is always so tense, always overthinking about everything from the day

showers used to be a privilege with you two

now?

they’re daily requirements.

he’s always visibly more relaxed after a nice shower, throwing his long hair into an easy bun as he cuddles up with you in bed

it always leads to soft sex

he affirms his love with each calculated stroke, making sure to dig his hips into you just so you can feel how much he yearns to be inside you; to love you.

you’ll brush the stray hairs that fall from his bun and he’ll press his lips to yours and swallow your gorgeous moans, drinking them like the finest wine money can buy

suguru will never be able to shower without you

and you’re both more than okay with that.

sukuna:

showers with sukuna used to be unheard of

keyword: used.

the first time you showered with sukuna was very much like walking on eggshells

you weren’t afraid of him, per say, but more afraid to do something that he wouldn’t like.

his stoic personality was still mighty as ever, a permanent smirk resting on his face as he watched you begin to wash yourself

it started with you gently tracing the black markings on his back with your index finger

he was turned to face the water, washing the shampoo out of his hair when he felt the small tickle of your fingernails tracing his skin

goosebumps rose on his skin despite the piping hot water that fell over the both of you

he stood up taller and you were sure that you had fucked up

you remained silent and went back to washing yourself, but sukuna was never going to let himself admit that he missed your touch

he prayed and prayed to himself that you’d test your luck again, pretending to wash some soap out of his eye nearly six times before he’d finally gotten fed up

“can you just hurry up and do it again?!”

you’ve never been more confused in your life.

“d-do what ‘kuna?”

sukuna grumbled to himself before grabbing your hand and placing it firmly on the black ink sprawled across his chest

you looked up at him and couldn’t quite make out the look he was giving you, but you knew exactly what he wanted from you

once more, your finger danced over the ink softly and left sukuna sighing with relief

“...feels good.”

little by little, you made your way up to being able to wash his hair and body, through trial and error of course

but sukuna will never ever get over the way you touch him so benign. he’s the king of curses, a mass murderer, yet here he was crumbling beneath your touch like a weakling

“if you’re gonna do it, do it right,”

he’s just a spoiled brat underneath that harsh exterior, but you knew how to crack him

#x reader #jjk x reader #gojo x reader #gojo satoru x reader #nanami x reader #nanami kento x reader #choso x reader #suguru x reader #geto suguru x reader #sukuna x reader #sukuna ryomen x reader #gojo satoru #nanmi kento #choso #geto suguru #sukuna ryomen #jujutsu kaisen x reader

814 notes · View notes

baby-yongbok · 1 year

Text

𝚂𝚝𝚛𝚊𝚢 𝙺𝚒𝚍𝚜 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

Welcome to my masterlist! I hope that you enjoy 💕 I write a bit of everything and all of the readers in my work are people of color and/or chubby or plus size. I think it's important to provide this representation for my community! Of course everyone is welcome to read my work but I just wanted to note how I view the reader when I write my work! Thank you ☆*: .｡. o(≧▽≦)o .｡.:*☆

Follow my back-up acct. @minniee-verse !

Also Here are my request/ ask guideline! → Guidelines

Sparkle Banner by @anitalenia

Legend:

🔥Smut - MDNI - Explicit Sexual Content

⚠️Angst - MDNI - Emotionally Strong and/or Graphic Content

☁️Fluff - Sweet and Sugary Content

♾️Fluff, Angst and Smut - A bit of everything [The most dominant theme will be next to the infinity]

✧Please pay attention to the warnings for each story! ✧

𝐖𝐡𝐚𝐭 𝐰𝐢𝐥𝐥 𝐲𝐨𝐮𝐫 𝐥𝐮𝐜𝐤 𝐛𝐞 𝐭𝐨𝐝𝐚𝐲?

𝙱𝚊𝚗𝚐 𝙲𝚑𝚊𝚗 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙻𝚎𝚎 𝙺𝚗𝚘𝚠 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙲𝚑𝚊𝚗𝚐𝚋𝚒𝚗 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙷𝚢𝚞𝚗𝚓𝚒𝚗 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙷𝚊𝚗 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙵𝚎𝚕𝚒𝚡 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝚂𝚎𝚞𝚗𝚐𝚖𝚒𝚗 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙸.𝙽 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

𝙾𝚃8 𝙼𝚊𝚜𝚝𝚎𝚛𝚕𝚒𝚜𝚝

2K notes · View notes

jjunberry · 2 months

Note

Heyy love your writing, first time requesting.

Could you please do casual dominance with Mingyu and Wonwoo (separately) with reader? Like guiding the reader nonsexually, a hand on the reader's neck when whispering in their ear, helping choose dresses?

Thank you in advance!

casual dominance ⟆ mingyu & wonwoo

mingyu loved helping you pick out clothing. from dresses to lingerie he was always there to offer his opinion and credit card. he stands behind you one hand on the back of your neck the other one zipping up your dress. his mouth dangerously close to your neck, “this looks stunning on you baby,” a shiver rolled down your spine. “thank you gyu, but it’s too much money.” you pouted. his hand snaked around to grip the front of your throat. “now baby, a gentleman never makes his girl pay,” he left an open mouth kiss on your neck and left you alone to go pick out more lingerie. your whole body felt hot after his searing touches.

wonwoo’s favorite pastime was helping his girl pick out lingerie. he didn’t do it to be sexual no, he did it because he loved seeing you feel confident and beautiful. wonwoo’s fingers carefully clipped the bra in place, his hands then taking their place on your shoulders. he leaned down resting his chin on top of your head. “see baby, now doesn’t that look gorgeous?” he grinned seeing your cheeks heat up. “we’re getting it,” he left a kiss on your neck and no room to argue.

🗒️: thinking of requesting? read my guidelines.

author’s note: need them both sooooo badly 😫

love, echo ☁️⋅♡𓂃 ࣪

777 notes · View notes

pumpkinbxtch · 5 months

Note

Hi!! Idk if this is against ur guidelines but would you be okay with doing hcs for aftercare w Jason Grace? I love your writing sm and I love my heroes of olympus boys 😔🙏❤️

ᬊ jason grace | aftercare headcanons

☆ radiostar is playin': my girl by the temptations...!

warnings: sexual references, aged up (as everything in my writings) a/n: Heyyy, YES. this kind of content is accepted in my rules, which you can read here — rules. thank you sm for your cutie words 🥹🫶🏻 and thanks for passing by my blog! — kisses from Jupiter 💙

Jason is one of the best at aftercare because he's an amazing lover and boyfriend, no more to argue about.

Whatever position you end up in, he carefully slides out of you, not wanting to hurt you.

He's probably feeling a bit too much, just like you, so the first thing he does is ask if you're okay, without hugging you yet to avoid overwhelming you.

It's only when he sees that you're fine that he cuddles with you for a few moments while your breaths regulate and your hearts stop threatening to burst out of your chests.

And as soon as he feels a bit better, he'll be checking on you. He'll run his fingers through the hair on your neck and give you sweet kisses. "Are you okay?" he asks in his husky voice while stroking your bare shoulder.

It's so cute because he treats you like a delicate piece of glass after nearly breaking you in two and just telling you the dirtiest things, but you live for those two sides of him because damn, he's hot, right?

Jason always thinks about the type of aftercare you'll need depending on how you're feeling afterward. Some days he knows you need some time alone after reaching your orgasm and coming back to yourself, while other times you need to cuddle with him until you both fall asleep.

Jason has many things planned; for example, he'll have supplies ready, so after kissing your cheek, he'll put on his boxers and go get water or snacks for you. He helps you sit up in bed and brushes your hair away from your face.

He loves seeing your sleepy face and the sleepiness in it, as well as how flushed is.

He can't help but give you delicate kisses, trying not to overstimulate you again.

He also shows his concern in words, asking or saying sweet things like "Is my girl tired?" "You're so cute" "Come on, honey, drink some water."

He'll also ask if he crossed any boundaries with you. "Was I too rough?" You just shake your head, and he smiles.

"Come on, let's clean you up," and he carries you to the bathroom when you're feeling better. Literally like a feather, no matter how heavy you think you are, he can carry you.

Some days you both shower together, and other times he waits outside the bathroom while you shower. Maybe he'll be changing the sheets and tidying up the bed so you can rest better afterward.

You have your clothes in his place for moments like this, but still, Jason always prefers to give you one of his sweaters; he loves seeing you in them.

That man will cook for you and bring it to bed.

Once you're both changed, clean, and you've eaten something, you can finally cuddle up and enjoy the rest of the afternoon.

Kisses and caresses.

Him humming while he strokes your hair.

You resting your head on his chest and him holding you tight.

Small "I love yous" whispered in your ear and hugs.

Until you both fall asleep.

This sometimes changes, but it's always Jason paying attention to your needs at that moment, because for him, you're his whole world.

#maría's shared dreams☆｡ﾟ✧#jason grace #jason grace x y/n #jason grace x you #jason grace x reader #jason grace headcanons #jason grace fluff #jason grace smut #jason grace fic #jason grace blurbs #pjo hoo toa #heroes of olympus #pjo #percy jackson and the heroes of olympus

566 notes · View notes

sinfulspencer · 1 month

Text

Safe place

Prompt: After working on a hard case, Spencer takes comfort in your body.

Pairing: Spencer Reid x Fem!Reader

Rating: angst, mature (18+, minors DNI)

Warnings: friends with benefits dynamic, dom/sub dynamic, Sub!Spencer, Domme!Reader, dirty talking, praise kink, light hair pulling, titty sucking, breast play, oral sex (fem!receiving, male!receiving), fingerfucking, rough sex as a coping mechanism, breeding kink, unprotected sex, creampie

Words: 4.6k

A.N.: Is it obvious that I have a thing for Sub Spencer? Also, a massive thank you to my friend @snixkers for beta reading this for me. This was written for @imagining-in-the-margins's FWB challenge.

MY MASTERLIST. MY GUIDELINES. SEND A REQUEST. MY TAGLIST.

I wasn’t surprised to find Spencer on the doorstep at midnight.

He was drenched in water and the look he had on his face was obvious: he needed something to ease his mind, to focus on someone else for a few hours. His mind was a whirlwind of something that he wasn’t going to explain to me and he needed a distraction; a good one, at last.

“Everything okay?” I dared to ask

Spencer shrugged and stepped inside, closing the door behind his back. “Not really, but I don’t want to talk.”

I knew exactly why he came to me, his eyes immediately shifting on what he wanted. His gaze was focused on my chest and I nodded my head: fooling around with Spencer didn't seem such a bad idea. I had an intense day as well, and an orgasm or two would’ve definitely helped me ease the tension clearly clinging to my bones and my joints.

Spencer took off his coat and hung it behind the main door, then he followed me in the living room. I was wearing a boring pyjama but Spencer didn’t seem to mind, he needed something else that required no clothes on. Despite our agreement to have a close friendship with benefits, sometimes we didn’t really need the friendship part - like that night. We didn’t need to talk, we just needed physical comfort.

And I was happy to provide that for Spencer, especially if it involved his mouth all over my neck and my breasts to ease the tension in my own body.

“Do you want me to…”

I pulled the small ribbon on my chest and Spencer nodded his head, helping me remove my shirt without speaking. I knew what he wanted, but I needed to know that he was ready for it and most importantly, he truly wanted it.

Spencer caressed my shoulders with both hands, kneeling on the floor between my thighs as I sat down on the couch but close to the edge. My chest was pressed to his and Spencer was happy to feel my breasts against his body, his mouth already nipping and licking the bruises he had left a few days before on my throat.

The love bites all over my skin were fading, but Spencer could still see them and create new ones that he’d dream about for the rest of week.

“Do you want to do it in this position?” I asked

Spencer shrugged, his hands now moving down to my exposed chest. I couldn’t care less about wearing a bra because I was not supposed to have guests, but Spencer appreciated my bare breasts. He didn’t want to waste time struggling to open up a bra.

Sighing, I brought both my hands behind his neck. Spencer was beautiful, I had no reason to deny that, but he was also so troubled, so upset; I didn’t blame him. His job was awful and he was constantly bombarded with horrific videos, images and information about the worst crimes that humanity could commit.

And somehow, he chose me as his safe place.

Spencer decided to come and find me each time he didn’t feel good, each time he felt too good, each time he just needed someone to be there for him - whether in a physical or emotional way.

“Bedroom.” Spencer whispered

Following him where he wanted to spend the rest of the night, I laid down on the bed and it didn’t take long for Spencer to lay on top of me. He had undressed so quickly I barely registered it. And once he was on top of me, he left kisses all over my collarbones, nipping at my throat once again while his hands caressed my waist and then the outside of my thighs.

His fingers were gentle across my skin, just like his lips - feverish kisses were peppered down my chest. Spence had his eyes open the whole time and I could see the desire flash behind them when I placed my right hand behind his head. My fingers snuck through his soft hair and I tugged on it, forcing him to look back at him. .

The lustful gaze he gave me was enough to bring a smirk over my lips.

His body reacted to my harsh tug easily: his cock hardened against my inner thigh, and I moved my leg to give him some friction. Spencer bit his bottom lip and his grip on my thighs became tighter, as he dug his fingers into my skin.

“Go on, sweet boy. Do whatever you want.”

Spencer stared at me and nodded his head. “Can I?”

I hummed, pulling on his hair again. “I said that you can do whatever you want. Go on.”

A soft whimper fell from his lips, a sound that I play in my head over and over when I pleasure myself all alone. There was nothing better than to hear Spencer whimper, moan and whine because of me, of my hands, of my mouth, of my cunt, of my body. It was enchanting to see how his body reacted to anything I gave him.

Propping myself on the plush pillows of my bed, I closed my eyes while Spencer struggled to set between my legs. He hooked his right arm underneath my waist to push my body against his. Spencer nuzzled his face against my chest and I ran my fingers through his curls, not wanting to hurt him any further.

He deserved a motherly touch that night, a gentle caress on his face as he worshipped my chest with his mouth and his tongue. Spencer’s face was pressed to my chest and I bit my bottom lip when I felt his teeth sink into the soft skin between my breasts, leaving the first mark of the night.

“You’ve been so stressed lately, sweet boy.” - I whispered, - “But now you’re safe with me in my arms, in my bed.”

Spencer dragged his tongue from the bruise forming on my skin down to my right breast and I hummed softly, moving my eyes down to his face. He knew that I enjoyed having my breasts played with and what was better than giving someone physical pleasure while, in return, receiving both physical and emotional pleasure?

Spencer was a whore for my touch, but also from my voice and the honey-coated words that fell from my lips each time we were together. He loved when I sweet-talk to him after a tough case and that was exactly what I was going to do.

“I have missed you so much today.” - I added, - “I’ve thought about you all day, how tired you must’ve been but now you’re with me. And that makes me so happy, sweet boy.”

The sound of my voice seemed to soothe Spencer, though the lust was clear in his actions.

“Did you miss me, Spencer? Did you think about me?” I asked

Spencer nodded his head, his lips never leaving my skin. “All the time. Think about you, your tits, your cunt, how good you taste.”

It wasn’t strange to hear him use bad words, but it was endearing. Spencer was always so sensible, so delicate in the way he spoke but with me he just couldn’t care less. He was direct, dirty, disgustingly exciting and that turned me on more than I could explain.

“Oh, so desperate for me, sweet boy.”

Spencer smiled against my skin. “You know it.”

I fixed his hair when a curl attempted to fall down on his forehead and I sighed, waiting for Spencer to give in to his own desire. He was always careful when it came to me, terrified that he’d go too far and I appreciated that. When I opened my eyes, however, I saw an eagerness that almost left me breathless.

Spencer was burning with a flaming desire.

“What’s wrong, sweet boy?”

His lips quivered. “Can you.. please..”

Spencer pawed at my left hand and placed it upon my own breast. He was eager to have me in his mouth, but I had to offer myself to him and not the other way around. Spencer liked the image of me offering my body to him and I wasn’t going to complain; that image was exciting for me, too.

Pressing my left hand underneath my right breast, I offered my chest to Spencer’s and his lips quickly closed around my nipple. His tongue rolled all over it, focusing on the tip before he started to suck on it slowly, lazily, gently. His face was pressed to your chest and his other hand was clinging to your waist now, still digging his fingers into your skin.

He was clinging to your body like it was an anchor and he was lost at sea.

“There you go, sweet boy. You always make me feel so good.” I reminded him

Spencer glanced up at me, but didn’t answer. He didn’t want to because that meant his mouth would’ve pulled away from where it was and he couldn’t have that. Oh no. Soft whimpers came from him as I closed my eyes again, enjoying the warmth of his tongue now pressing against my nipple.

The pleasure was slowly biting me from the insides, but I stayed quiet. It was a struggle to focus on his own desire, but I made it happen. I wanted Spencer to enjoy himself before ordering him to fuck me however he pleased to forget the miserable days we both had.

Spencer rolled his hips against my leg and I felt his cock pressing to my inner thigh, leaving a trail of wetness across my skin.

“Are you happy now, sweet boy?”

Spencer mumbled something. “Missed your tits.”

I chuckled, running my fingers through his curls again. “Hm, I can feel that.”

He went quiet again after that to focus on the pleasure that sucking my tits and touching me all over gave him. Spencer used his other hand to massage my other breast and I moaned softly, guiding his mouth exactly where I wanted him to be.

“Nobody can do this better than me, sweet boy. You know that.” I whispered

Spencer nodded his head, sucking on my right nipple before he pulled away and went to give his attention to the other one. A string of spit snapped back on his chin and he looked up at me, his cheeks bright red.

“I wouldn’t want anybody else.” he replied

With his free hand, Spencer started to play with my right nipple while his mouth closed around my left one. His tongue began its torture, while his thumb and his index rolled and pinched my right nipple.

“I know, I’m the only one who can take good care of you.” - I responded, struggling to hold back a moan when Spencer softly bit my nipple, - “Ah, ah. Careful.”

He nodded his head and gave me an apologetic look, before sucking on my nipple. Saliva was dripping down his chin and staining my chest, but I didn’t really care. All that mattered was that Spencer was happy, satisfied and horny.

His tongue lapped my nipple over and over, before Spencer shifted to the other one. And again, he started his torture: he sucked, nipped, bit my nipple and caressed it with his tongue ‘til it was hard in his mouth. And it felt good, but it was also pure torture.

“Nobody knows you the way I do, my sweet boy. So strong, so powerful, so smart outside but here in my bedroom…” - I smiled down at him, - “Here you are my helpless, eager to please and always needy for me sweet boy.”

Spencer whined and looked up at me, nodding eagerly - his eyes were full of lust and I knew that he was done with my breasts. He proved my point so easily as he pushed his body against mine again, his cock achingly pressing to my inner thigh.

“Let me take care of you.” - I stated, earning a positive response from him in the form of a moan, - “Lay back down for me, sweet boy.”

Rolling on top of him, Spencer laid down on the bed with his hands now clinging to my waist but his grip quickly slipped when I settled between his thighs. I needed to give him something more, I needed to pleasure him and also give pleasure to myself and I knew exactly how to do it.

From between Spencer’s thighs, I saw him close his eyes as he waited for whatever I was willing to give him. He was always so patient with him, so excited for a single touch from him.

His naked body was glorious to look at and I felt blessed every single time he allowed me to see it. My hands travelled down his chest and they settled on his hips, while I admired his cock twitch under my gaze. It was hard and leaking, which prompted me to lean forward and take the tip in my mouth.

Spencer hissed at the sensation and his eyes fluttered: he stared at me with his lips slightly parted and I smiled at him.

“What, sweet boy? Do you see something that you like?”

Spencer groaned in pleasure and fell back on the bed, his eyes now closed.. My fingers wrapped around the base of his cock and slowly I started to jerk him off while my tongue lavishly lapped at the tip. I was still resting back on my heels and focused my gaze on Spencer’s face, sucking his cock like I was meant to be doing.

There was nothing better than to please Spencer because the sounds he made just sent pleasure jolts straight between my thighs. It was enchanting to see Spencer react to the pleasure that I was bringing him with my mouth, with my touch, with my body.

I flattened my tongue underneath the tip of his cock before I slowly pushed him inside of my mouth - inch after inch, I took him with the tears pricking in my eyes. Spencer released a strangled moan when he hit the back of my throat, feeling my cheeks close around his cock. Engulfed in the warmth of my mouth, Spencer snuck his fingers through my hair and pulled it so harshly that I almost cried.

That felt so fucking good.

Pulling away from his cock, spit coated my chin and I brushed the back of my hands on my cheeks to wipe the tears away.

“Did that feel good, sweet boy?” - I asked, my voice filled with delirious lust for him - “Did you like it when I took your pretty cock into my mouth?”

Spencer frantically nodded his head. “Hm, yes. Yes.”

He was staring at me with his lips parted and I gave him a small smile, before returning to focus all my attention on the most precious part of his body. His cock slid on my tongue and I sucked on it lightly, moaning softly when Spencer’s hand gripped my hair again. He didn’t pull my hair, but he was anchored to me as I moved my mouth up and down his shaft to slick it with my own spit.

Spencer was a panting mess and I fucking loved it because it was all my fault. After all, he came to me for some comfort and I was bringing him more than that.

“Stop, stop. Please.”

His voice caught me off guard and I quickly pulled away from him. My chin was covered in spit and my lips were red, bruised.

“Everything okay?”

Spencer nodded, breathing hard. “Need your cunt. Now. Please.”

Struggling to hold back a laugh, I nodded my head and moved to Spencer’s side. It was endearing to see Spencer completely out of his mind with lust - his hands roamed all over my body as soon as I was laying down on the bed and he could get on top of me, again. His mouth found its way to my neck and soon, his teeth sunk into my skin to leave marks that were making my knees tremble.

“Of course you need my cunt, sweet boy, but you have to prepare me first.”

Spencer didn’t waste any and he spat right between my thighs, on my cunt. It made me giggle: that was pure desperation to have me. Usually he took his time to finger me, to eat me out but that night he was just desperate to be inside of me. Collecting his own spit and the essence of my pleasure, he sunk two fingers inside of me and slowly scissored them to stretch me. It felt good, but what I needed the most was his cock - I was just as desperate as him.

His mouth quickly attached to my nipple again and I gripped the bed sheets, whimpering.

“Fuck, Spencer.”

Spencer curled his fingers inside of me as he sucked on my nipple, torturing it with his warm tongue. I knew I was going to have little bite marks all around my nipples, but they were so worth it.

My breath was rugged and I felt my chest tighten, a sign of my impending orgasm that I struggled to hold back. I placed my hand on his forearm and whispered to him to stop, which he immediately did. I didn’t want to come on his fingers, I didn’t want my pleasure to end there.

I just wanted Spencer inside of me before I lost my mind.

When Spencer pulled his hand away from my cunt, he used his fingers to smear my own wetness all over his cock. The sight was so erotic and dirty that I could’ve come if I wasn’t so desperate for Spencer’s cock. I needed someone to paint that scene for me so that I could hang it on the bedroom door.

“Can I spend the night here?” Spencer asked

I nodded, not really wanting to kick him out after a good fuck. “Yes, of course.”

His lips twitched into a smile as he forced me to lay back down on the bed. His hands were gentle on my shoulders and when he leaned closer to my face, I was hoping that he’d kiss me but he didn’t.

Another stupid rule that we set when we decided to become friends with benefits.

I was starting to hate that fucking rule because Spencer’s lips were too pretty not to be kissed, nipped and sucked on. However, a kiss was definitely too intimate for me - especially if given during missionary or something.

Weird, given the fact that I was allowing Spencer to be inside of me as deeply as he could, but that’s how we both felt with kisses.

“Good. Then, I’ll wake you up with my tongue.”

Giggling, I wrapped my arms around his neck to pull him closer. “Oh, don’t threaten me with a good time sweet boy.”

Spencer positioned on top of me and with no hesitation, he slid his cock up and down my folds to gather more of my essence. I bit my tongue and stared at Spencer the whole time, admiring him - and he did the same.

It felt like time had stopped every single time that our eyes met.

But I couldn’t let myself go in such a way, so I forced myself to roll my hips and lift it high enough for Spencer to sink into me with no resistance. However, Spencer took his time to thrust inside - slowly, painfully slowly. Inch by inch, he filled me and I saw stars exploding right behind my eyes.

Goosebumps rippled all over my arms and I released a strangled moan, throwing my head back when Spencer finally bottomed out.

“I’ve missed your cunt, oh God.” Spencer whispered to me

Our lips were so close and I had to physically restrain myself from kissing him by scratching his back. My nails draw lines all over his skin and I didn’t really care if I made him bleed. I needed to calm down, to focus on the pleasure rather than the intimacy of the moment.

I hated how each time we seemed to grow close to one another because feelings were extremely scary for both of us. I didn’t need to get caught up with them again.

Spencer melted against my body and he hid his face in the crook of my neck, slowly rutting inside of me. I closed my thighs around his waist and moaned softly, allowing Spencer to get all the pleasure that he could while also giving it to me - it felt wonderful to feel his teeth nipping at my throat and his curls tickling my skin.

Despite his mouth pressed to my chest, I could still hear the low groans and grunts that came from Spencer. They were music to my ears.

Spencer pressed me down onto the bed as he thrusted in and out of me, picking up his own pace. The position I was in, with my hips up in the air and Spencer kneeling between my thighs, was perfect - it had me tethering on the edge of pleasure and pain, a delicious limbo that I have learned to love with Spencer.

“God, sweet boy.. so good.” I whimpered

Spencer pulled away from my chest, leaving a trail of saliva between my breasts. He looked down at me as he kept thrusting in and out of me - a brutal, rapid pace that almost didn’t allow me to breathe right. I didn’t want to if it meant that Spencer was feeling all the pleasure that he could take from me.

“You were made for me.”

I didn’t know if he was being serious or if it was just the haze of passion that blinded Spencer and made him dizzy, but it didn’t matter. His words were enough to bring me closer to the edge. Deep down, I was just like him - I basked in his praise, in the knowledge of my body being what gives Spencer pleasure.

My whole body erupted with goosebumps and I dug my fingers into his back, whining his name over and over. Spencer had his right hand between my thighs, massaging my clit with the tip of his thumb, and his other hand on my knee. He was keeping me in place, watching me as I came undone underneath him.

My orgasm hit me harder than I expected.

“Let me prove that to you, sweet boy.” I whispered in return to his words

Spencer knew exactly what I meant by that and his breath became uneven, his thrusts even harsher and violent. I didn’t want him to stop: the pleasure soon morphed into pain and I begged him for more. I started to roll my hips to match his rhythm, not caring that my whole body was shuddering with pain and pleasure at the same time.

Every sensation was heightened, the pain was so strong that it quickly morphed again into a stinging pleasure that made it difficult for me to breathe right.

“Come inside of me. Please.” I mumbled

Spencer groaned at my words and soon, he was fucking me harder and harder into the mattress. His body towered on top of mine as he pushed down, almost crashing me against the soft mattress of my own bed. Spencer was hunched over me, his lips a little too close to mine as more moans and grunts fell from his mouth.

I closed my thighs again around his waist, earning another whimper from him. He loved when I’d cage him against him, forcing him to fuck into me without pulling out - not even for a moment, not even for a second. Spencer kept whispering to me that he missed me, that he wanted to be with me every single night, that he couldn’t wait to come home and fuck me - and God, did that feel fucking amazing to hear.

And when Spencer finally reached his release, I felt his warmth spill deep inside of me. I clung to his body with all the strength that remained in me and Spencer hid his face in the crook of my neck, again.

His hot breath caressed my skin as he came down from his high, slowly rutting into me to feel all the pleasure that he could. His body was warm on top of mine as I released my grip from him.

I was trembling, still hazy from my own orgasm. It was always a struggle to come down from mine and Spencer’s activity. I barely realised that he walked out of my bedroom to grab something to clean me up.

“Are you sure I can stay here for the night?”

Spencer handed me a warm washcloth and I cleaned myself up as best as I could.

“Yes. Why wouldn’t you?”

He hesitated and I knew what was going through his mind, because it was the same thought that appeared in mine. I knew we had our agreement and the nights we spent in the same bed could be counted on a single hand, but still.

“I don’t know. Maybe things can get… weird.”

“They’ll get weird if we let them get weird.” I responded

Spencer nodded, running his fingers through his curls all messy. “Right.”

I decided to change the topic. “I hope you feel better now.”

“Much better. I needed this. I needed you tonight.” - Spencer said with a smile, standing next to my bed, - “I think our agreement might be the best I’ve ever made with someone.”

Chuckling, I got out of bed. “Hm, good. I’m glad you think so.”

Spencer followed me to the bathroom and we prepared for bed, though I felt his eyes burning on my skin the whole time. Exhaustion was written on both our faces and I craved my warm and bouncy mattress. I needed to lay down and rest my legs, my arms, every inch of my body.

We returned to my bedroom and we laid together in silence. I didn’t want to break the quiet bubble between us, I was constantly worried of always saying the wrong thing - I didn’t want to scare Spencer off. I was staring at the ceiling when he grabbed my hand and brought it up to his mouth, leaving kisses all over my knuckles.

“You’ve been strangely sweet today.”

“Is that so weird?” Spencer asked

I chuckled, turning to the side to face him. “Oh no, it’s not weird. I just wonder why.”

He pulled me closer to his body. “I just missed you, that’s all.”

“Remember that you can always come here when you need me.” - I reminded him, laying my head on his chest, - “It’s a safe space.”

Spencer pressed a kiss on top of my head. “Your cunt is my safe space.”

I went quiet for a moment, not knowing if I could laugh. Spencer was dead serious, or at least his tone was. And when I look up at him, he had that usual annoying smug smirk that made my knees tremble every fucking time.

I bursted out laughing. “You’re disgusting.”

Spencer rolled his eyes. “Well…”

“But you’re a good fuck so you’re excused.” I added

I leaned my head back on his chest and took a deep breath, enjoying the warmth of his body flushed to mine. Spencer ran his fingers through my hair and soon enough, I drifted off to sleep.

Spencer considered my body his safe space, but he was mine as well.

Remember that if you asked to be on my taglist, you can easily help me gain visibility with a like, a comment or a simple reblog. If you don't, you're asking me to include you while getting nothing in return. If you want to be removed from the taglist, just dm me. Taglist: @reidselle @alelaeljfj @blvebanisters @Koukatsuki @donttrustlove @moesdraft @r-3dlips @alicentswife @singinghamtaro-blog @Florebore @Topguncultleader @frutilooplupin @mags11 @myoui-me @iluvreid @slaygirl466 @Kikista @icarusgold @pleasantwitchgarden @ohdearlordspencerreid @cherrqblssms @lover-of-books-and-tea @elizabethmidnight2017 @spencerssoup @emmy-reid2627 @winkev1 @benji-screem

#spencer reid #spencer reid fic #spencer reid smut #spencer reid nsft #spencer reid smut fic #spencer reid x fem!reader #spencer reid x female reader #spencer reid x you #spencer reid x fem!reader smut #doctor spencer reid fic #doctor spencer reid smut #doctor spencer reid smut fic

547 notes · View notes