#transphobes can die

[felixcloud6288]

"Basic Biology" Transphobic rhetoric is so stupid and so frustrating to listen to for someone like me going into a genomics field.

To begin, the default human sex is female. So there's no point in even arguing about whether or not someone is a woman on any biological level. That's the default state.

Meanwhile, the binary nature of their mindset causes everything to essentially boils down to whether or not your genetic code contains a roughly 840-base pair length gene sequence called the SRY gene. This gene makes up roughly 0.00000028% of the human genome.

SRY is an ON switch. It activates various male-coding genes, WHICH ARE IN DIFFERENT CHROMOSOMES. Which means that everyone has the genetic material to become male, it's just a question of if the activation switch was properly installed.

But it's possible to have the gene and it fails to be expressed, causing you to become an XY female. It's possible as you get older for the Y-chromosome, and subsequently the SRY gene, to get deleted from your DNA. It's possible for the SRY gene to end up in an X chromosome and have an XX male. It's possible for the fetus to develop both male and female sex organs.

Meanwhile Transphobes are like "Ignore all that. Ignore how hormone regulation is done by different genes. Ignore that human bodies produce estrogen and testosterone naturally. Ignore that our bodies are actively receptive to estrogen and testosterone. Ignore that the SRY gene is a one-time gene that doesn't do anything after to the point you can remove it and it won't change anything. Ignore that the actual argument is completely cultural in nature and we're using FALSE arguments about biology to justify our bigotry and hatred."

Transphobes will look at this and say "Behold a man!":

AGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA

And they'll ignore the remaining 0.99999972% of us that truly decides who we are.

[spleentheween]

HAPPY TRANS VISIBILITY DAY YIPPE!! ⚧️🏳️‍⚧️✨

[springle-sprongle]

god i feel so bad but i absolutely despise one of my closest friend’s boyfriend. and its not even just something i can ignore and get over. He has been extra transphobic to me and made me cry multiple times. He never apologized and just tried to justify his actions when i called him out in a group chat. My friend knows this and even defended me from him in the past. and ik i should be happy for her but its so hard to when now that they’re dating he is trying to be all buddy buddy with me. i hate him so much but i feel bad for hating him cus he’s dating my friend.

[glitched-out-mess]

same header!!

eyyyyyyyy!!

[bunnygirl-titties]

Everyone point and laugh at the terf/radfem

[lopashes]

is it okay for trans girls to reblog your art?

lmao yeah obvs ✌️💖💙

[1000dactyls]

I wanna know if you have any thoughts on Valka and Sroicks parenting and how that affects hiccup? Because I'm loving so much of your content rn, especially your drawings!! But when I see stuff like Tgirl Hiccup while I think they would be supportive, I don't think they would be ... the best because their not really the best. Like ofc they tried even Val when she came back, but it doesn't and won't ever make up for everything else it's so complicated, and nuisanced would love to hear your thoughts!!

Im going to break this post into addressing stoick and valka separately because valka is such a non-entity in hiccup and stoick’s familial life. valka’s section will be underneath the ‘read more’

But I definitely agree! Unfortunately for Hiccup (and also not to project ijbol), it’s so hard because stoick’s best isn’t enough. Oh, stoick tries! He tries so hard — between the movies and the shows, he so clearly cares for his son. But he can never be just Hiccup’s dad; Stoick is the Chief of Berk before he’s Hiccup’s father, and both he and Hiccup know that. Hiccup grows up self sufficient and is used to a lonely home. The kind of free reign that he gets (and the resulting knee-jerk reaction he has to any kind of responsibility after 15 years of said free reign) doesn’t make for great conditions to cultivate a healthy, loving, traditional parental relationship

Still — i think stoick is more supportive than we give him credit for, at least going off the RoB/DoB characterizations. (Again, I haven’t finished watching RTTE, so Im not gonna speak for anything there.) When Hiccup makes moves for more freedom and responsibility, even as early as s01e01 “How to Start a Dragon Academy”, Stoick works with Hiccup to grant him that freedom. He makes attempts to connect to his son, albeit misguided and inevitably circling back to his own interests/role as the chief of Berk and not just Hiccup’s dad. For example, s01e07 “How to Pick your Dragon” shows Stoick ending up listening to Hiccup about getting a dragon, even though he mostly gets a dragon because it further suits his interests as a chief, which he realizes on the flight Toothless and Hiccup take him on. Which also leads to the core conflict of the episode! Because Stoick’s attempts to understand Hiccup are ultimately rooted in his own narrow perception of the world, that there is a Right way and Wrong way to do things, and Hiccup’s way is most definitely not the right way.

But Stoick listens. Over time, he picks up the signs when his child is frustrated and genuinely asks how he can help (s02e15 “A Tale of Two Dragons” 3 options talk). And after the events of the first movie, Stoick makes more attempts to involve Hiccup in his going-ons, such as the portrait of the chief’s family or contacting Johann to find a beloved childhood plushie. So i think stoick tries, and his best isn’t enough, so thank god hiccup isn’t dependent on only stoick and the both of them know this. And just because the both of them know this doesn’t mean that stoick doesn’t try to improve their relationship at all. In the end, he’s just really set in his own ways and his own traditions.

So in a world where Hiccup is trans, I do think Stoick is supportive no matter what direction Hiccup ends up going. Is he confused? Yes, always, because there isn’t a very established tradition even if Berk does have a history of trans folk. I think stoick has to try really really hard, and he messes up a lot in the beginning. Like, you know when your parents are trans affirming in a really weird and even insulting way? That happens a lot for Hiccup and Stoick. But they work together and Stoick works to try and get on Hiccup’s level, whether that means sending terror-mail to Johann to inquire about trans literature or gender-affirming clothes or dialing Gothi to move Hiccup’s t/e prescription to the front of the line.

……..argh, Valka.

Of course Valka tried when she came back, but the conscious decision to stay away for twenty years and miss some of the most important milestones in your child’s life says a lot, and I think Hiccup also knows that. Especially because of how similar they are, even though Valka would immediately accept and adore and absolutely love Hiccup and all his Hiccup-ness right off the bat… I think he’s aware of how different and better his life could’ve been with Valka’s understanding presence. In the end, one parent stayed and tried their best. And one didn’t really try at all, not until they reconnected again.

And like! I dont think Valka and Hiccup would ever be as close as Stoick and Hiccup were. Like it is one thing to idolize your parent in absentia and build up this idealistic wholesome perfect image of who they are, getting your characterization from their partner who never got over them even after 20 years. And it is another thing to meet that parent and realize… wow! They also don’t measure up to what I needed them to be as a child.

And so for all of Valka’s understanding, for all of the easiness it is for Valka to understand Hiccup, especially in a world where Hiccup is trans — it’s not Valka who had to deal with the bureaucracy of Hiccup’s gender change, nor aided in the social transition for people Hiccup has spent his entire life with. It’s not Valka who asked uncertain, blunt and somewhat invasive questions about Hiccup’s new identity, or found weird and strange ways to support it. It’s not Valka who would’ve gotten an entirely new wardrobe commissioned or talked to Gothi about medical transition.

Like, I think Valka tries, and it’s easy for her to understand the idea and support Hiccup. But i dont think she’d ever be Hiccup’s first choice when it comes to questions about who s/he is, not when there are people who stayed and tried much harder than her, and know far more about Hiccup than she ever did and maybe will.

[sinistersuns]

I hope more people who feel they’re leftists begin to realize that genuinely hating men AND/OR immediately assuming a man (or someone you perceive as a man) you don’t know is out to harm you is t3rf behavior. This belief will not keep you safe, it’s meant to isolate you and put the marginalized men around you in danger. Hating men will not do shit to the bigoted cishet white men in power, but it’ll tell the marginalized men around you that they aren’t welcome around you. This extends to anyone who looks like cis society’s idea of a man, but isn’t actually one, too - do y’all really think trans people of ANY gender say “okay I’m x gender now” and are immediately treated like that gender by society as a whole? Do you think your fear of anyone with facial hair and a deep voice will stop at dangerous cis men, and that only dangerous cis men have those traits? And I’m specifying DANGEROUS cis men because cis men as a group aren’t inherently dangerous. The way someone looks or identifies says nothing about whether they’re “safe” or not! I thought we fucking learned this!!

[zerodaryls]

it's so funny (read: sad) that if bigoted fuckheads didn't insist i was a woman simply by virtue of my body at birth, i'd probably be chill with she/her pronouns in addition to he/they. if my mom didn't insist i was her daughter, i'd probably let her call me that, and we could still have a relationship.

i'm nonbinary and 'gendered' words are hypothetically meaningless, but because there are so many people who are more interested in telling me who i am rather than lovingly and curiously letting me express my own sense of self, those words carry trauma.

there's no reason a nonbinary person like myself can't be a son and a child and a daughter. there's no reason a nonbinary person like me can't go by he, they, and she.

'she' is not a slur. 'daughter' is not derogatory. 'beautiful' 'pretty' 'gorgeous' 'feminine' are not insults.

to the contrary, they're parts of language that express certain facets of a multi-faceted human existence, like mine.

and i have this sad, mournful feeling that if it weren't for unloving, condescending people, i'd probably be down to be called any of those things alongside my usual masculine/neutral terminology.

but i'd rather die than let anyone tell me what i have to be called.

[picspammer]

"I'd love to hear about Jesus. What's he up to now?" Black Books Season 1 Episode 1: Cooking the Books

[cyra-kingg]

on one hand very cool tumblr thanks but on the other ive got people coming at me in every possible direction for the way i drew gwen pleaseee please be normal for once i am so tired

[9x07]

how many times do we need to learn as people that irony and hyperbole can be harmful because 'jokes' aren't easily distinguished from genuine thoughts and feelings until we stop rewarding people for speaking or posting about violence

like even if you're joking/don't actually believe that/think whoever you are insulting is bad/immoral/fictional therefore deserves it - ad hominem attacks always do more harm to the people who share those characteristic then the individual you intend to cause harm to or discredit

[saltymcsaltything]

BTW, Matt Mullenweg is still a rancid bigot

@staff has done nothing to address the harassment and unjustified banning of trans women and @photomatt is quietly pretending he didn't abuse his position in his reaction to predstrogen's banning, DM critics to argue with them, and commit privacy violations *on another platform*

Don't let Matt hide behind his "principles" when his actions are so deeply counter to his words. He has failed to demonstrate a shred of empathy for the people he has hurt and continues to hurt. He is an ableist and a transphobe who has friendly discussions about white supremacy with Elon, another unabashed transphobic bigot who uses his platform to do immeasurable harm.

[supersecretnerd]

Ok so these designs are cute as hell, the Internet is just mean

I have too many thoughts about a game I still need to watch

[nairdde32]

Local person decides to put themselves at significant risk and fake extremely complicated trauma-based disorder for minimal online clout, according to fucking idiots

[comas-are-for-sleeping]

its so mindboggling that people can go “how can you say free palestine if you’re queer” as if the opinions a person has changes the validity of their life??? yall sound real similar to the people saying trans people are a danger to society