Tumgik
#back to paradise
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
the-sp0tless-mind · 7 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
2K notes · View notes
hellcifrogs · 3 months
Text
Tumblr media
Yes, all the girls are amazing, look amazing, do amazing things... But Ino with short hair is just the cherry on top for me!
769 notes · View notes
cr33py-crawli3 · 3 months
Text
Tumblr media
HOW TO END THE CYCLE
647 notes · View notes
thestarofcottonland · 7 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
Cosmetic Paradise and its sequels ~ 2007
235 notes · View notes
favvn · 12 days
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
Idk. Just. Jim Kirk, death, and life after Tarsus IV.
86 notes · View notes
muzzleroars · 1 month
Text
Tumblr media
favorite scene in paradise lost where lucifer and gabriel insult each other back and forth until god breaks it up using astrology
138 notes · View notes
tinartss · 6 months
Text
Tumblr media
on moving out
293 notes · View notes
cant-get-no-worse · 16 days
Text
Tumblr media Tumblr media
76 notes · View notes
mangaparadise · 7 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
362 notes · View notes
the-sp0tless-mind · 7 months
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
281 notes · View notes
palahnyook · 2 months
Text
Tumblr media
But my dreams are full of apples, and in the dark my body slowly transforms into fruit: tonsils shrinking to seeds and lungs to cores. I dream of white flowers blossoming under my nails, as if under ice. Then my nails break, open up like clams, and in the finger flesh there are little sticky fruit pearls.
— Paradise Rot, Jenny Hval
I will travel far beyond the path of reason Take me back to Eden, take me back to Eden
— Sleep Token, Take me back to Eden
114 notes · View notes
vdearest · 8 months
Text
Tumblr media
275 notes · View notes
lunarharp · 23 days
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
I wish things were easy
60 notes · View notes
wordswithloveee · 1 month
Text
Tumblr media
54 notes · View notes
katkeyboardmastah · 3 months
Text
Tumblr media
My 20+ page lore doc that explores the continuity between SoP, DFF & FFI is FINALLY done‼️
65 notes · View notes