hello!
i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).
i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.
my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.
bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.
okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)
String identified:
cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt
Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39
Common name: Marsh pennywort
(image source)
571 notes
·
View notes
Parallels and contrasts between Stan and Bill in the new book and website
Aka miscellaneous thoughts that I'm too lazy to condense into something comprehensible– what you see is what you get folks! (Book stuff, DVD commentaries! The website that came out when I was trying to write this out and is now making me pull my hair out! But in like a good way? That god damn poem!)
not necessarily same coin stuff but I sure am thinking about it.
It’s been said that a large part of Ford’s relationships with Bill, Fiddleford and Dipper was him trying to fill a hole that his estrangement with Stan had left, with none of them clicking in that same way. Dipper was directly compared to Fiddleford as someone who was completely charmed by Ford but is ultimately too anxious of a person to properly deal with the life he's offering nor pull him back when he starts going too far. Meanwhile, Bill is more analogous to Stan but to the extreme with all the doubts that Ford had been fed about Stan (that he was using him, he never grew up, he betrayed him, sabotaged the machine on purpose) turning out to be exactly true with Bill.
The book has Bill saying flat out that Ford wanted the charisma Bill had and then shows that at the peak of Ford's loneliness he was being envious of Stan's charisma, social skills and hands.
[STANLEY COULD HAVE MADE HER LAUGH]
(There’s an irony that Stan always thought that Ford was the popular twin even after doing embarrassing stuff like the kissing machine – if you haven’t seen the Swine Before Time Stan commentary get going, it’s great)
Then Bill swoops in with jokes and endless encouragement and the nickname only Stan used for him, all this in a way tailored for Ford to immediately like him while also reminding him of Stan but "better."
(The show rarely used it but Bill’s use of Sixer is extremely frequent in Journal 3 alone but the comics solidify it as being a pretty personal childhood nickname that kid!Stan used as his default way to call Ford.)
And then you see all of this working because Ford straight up writes Bill’s words using Stan's handwriting (and it turns out that Ford’s capital letter ‘for emphasis/angry’ font in general is the same as Stan’s handwriting too)
(It’s important to note that this is different from all the fonts that Bill uses for himself!)
All of this leads to the deja vu of Ford getting stabbed in the back by someone he was codependent on over a machine he thought was going to change his life for the better
Other things in the book that I’ve seen others point out and noticed myself:
Bill trying to reinforce that Ford would be alone without him, and threatening to tell Stan that Ford never loved him but the first thing Stan does in his letter is tell Ford that he loves him with their childhood code
Stan also only uses ‘Sixer’ in his letter when he normally tends to use a mix of nicknames post-Weirdmaggedon (sure it’s only twice but idk I find it noticeable)
Stan ripped a dollar in half when Bill taunted the reader earlier about how they wouldn’t do that
The promo photo vs the one in the book, Ford’s face being untouched vs Stan’s. While I initially interpreted this as “Bill’s book being a way to torment Ford” and then “him ending up having a meltdown at the thought of Stan”, the new poem kinda gives off an ominous vibe of "him moving on to focus on Stan instead whether he wants to or not"
Ford writing “miss you” in the bro code soon after arriving at Backupsmore which is shown in the Fiddleford photo, then Bill taunting Ford that he misses him
Bill and Stan now have another parallel of losing everything because of a genuine mistake but only Stan was willing to work to make up for it while Bill doubled down and became far far worse
The utter hatred Bill has for Stan being able to win in the end and get back his family
Both of them being institutionalized, with Stan’s mentioned in Guide to Mystery and Nonstop Fun (which has references to Bill liking Mabel for her chaos, silly straws, etc. Also Dipper basically came up with the Author theory but slightly wrong from theorising about the ink blot like a year before the Ford reveal)
(saturn devouring his son perfectly depicts my emotions when reaching this part of the book)
(EDIT: I was thinking about how Bill giving Ford three days to open the portal striked me as odd for some reason... and then I remembered;
Stan gave Mabel 3 days for their bet as well. Both of them specifically say 72 hours too.)
And now for the stuff we know from the website:
Bill having severe family issues with daddy issues implied since only his mum is mentioned directly with her trying to comfort him as a kid vs Stan having severe family issues with a definite focus on his dad while his mum was the only one to ask about Stan during that meeting with the principal and her being the only one to show up to his funeral
Both of them wear their dad’s hat despite of all of this
Bill starting a billion cults and has a lawyer called Multilevel Mark, Stan having his Scientology-esque cult being shot down by irl Disney and as a kid having his “technically a pyramid scheme” comic being shot down by a publisher
(I doubt that Stanentology would’ve gotten far but also you can see that a trend that the main way Bill gathers followers is by reading minds and revealing secrets only the victim would know, so let's hope that Disney-let-him-start-a-cult AU Stan never gets mind reading abilities)
Despite how we know how Stan is traumatised as hell from losing Ford, it’s noticeably isn’t referred directly in the Wheel of Shame (like you can’t tell me that the time between pushing Ford into the portal and starting the Shack isn’t as rock bottom as it gets, Bill literally recognises Stan in the first place by thinking about his brand). This probably is because Bill knows that they managed to repair their relationship and he’s fucking pissed about it.
There's further parallels between Stanley and Bill in poem; with lies and redemption and home, and further association with fire for the both of them
“Saw his own dimension burn.
Misses home and can't return.”
“Always dragged his family down.
One mistake, disowned, denied,
Only thing to do was hide.”
“One way out: the open road.
Reinvent, retry, reload.
A girdle, eyepatch, fathers fez,
"I'm a new man!" so he says”
“One way to absolve his crime.
A different form, a different time”
“His big break, it finally came,
Redemption from a life of shame.”
“Says he's happy. He's a liar.”
“Truth is just whatever sells.
When you've lost track of your lies,”
“Lie until you aren’t lying anymore”
Bill in a rotting corpse of a snake oil salesman
This triangle can fit so much self-loathing projection while being a hater
(Also it's funny that Bill is so insistent that Ford had to be the one who came up with the plan
Like look at this
See ‘em cogs turning in Stan’s head while Ford has clearly given up hope)
“How dare he dress up fancy when his jokes suck!!”
There's a parallel of Ford projecting onto Dipper in a way that makes him feel like kindred spirits with his nephew but Stan projects on Dipper in a way that causes him to be more harsh even if he has good intentions. Meanwhile Bill projects onto Ford in a more positive light in comparison to Stan, who in this case Bill wants to rip him and himself into shreds whenever he thinks of the guy. Bill’s shared love for fun/chaos with Mabel (despite them being so different at their core) is why he likes her the most out of all the Pines but that doesn’t stop him from trying to murder her (although I think most folks don’t know about that interview where Alex was like “yeah, I think Bill would’ve burnt Ford alive the moment he got the equation, he’s done playing with his toys at that point”)
Other tidbits:
I find it interesting that the full version of the Wheel of Shame has blue sparks and fades to grey scale (which automatically reminded me of his mindscape)
Stan signing off as Stanley in the book – this ain’t anything huge to chew on I'm just very over emotional about this… but also there’s Bill being called Billy by his family/in the codes
Ford thinking of Stan as childish/someone who never grew up and then we get hit by “yeah Ford always had some part of himself stuck at 18” oof
Ford underestimating Stan’s control over the mindscape, not knowing that he’s able to hide memories in Dreamscaperers, manipulate the layout of his mindscape enough to trick Bill and memory!Stan telling Dipper how to use the mindscape which Bill was genuinely surprised by
I'm headcanoning that Stan doing so bad at that history test is due to some latent bs from what Bill knows which is all crazy conspiracy level stuff
I think it's also intensely funny that all of the Pines promise that they'll murder Bill if they ever see him again and then they immediately turn to Stan and go “now it's your turn to write a letter! :D!!”
(I feel like the main requirement that the Theraprism has for Bill before he can reincarnate is mainly acknowledging his family idk which honestly would fit even better if his soul becomes Stan’s)
EDIT: I FORGOT TO MENTION THE OUROBOROS PASSWORD (or... uh oroborous which is a typo when theres a suspicious amount on the site which may mean somethng but i digress) anyway that leads to the Shack Axolotl lore where it bluntly states that Ford released it despite it showing up 30 years later anyway
and theres....
412 notes
·
View notes
A tidbit about Stan's handwriting in the Book of Bill
(I added random color coded underlines for ease of comparing letters but idk if it helps)
The moment I first saw Stan's letter, I realised that Lost-Pages!Ford had been using Stan's handwriting to specifically quote Bill
And in fact, its the same font Ford himself uses for his alt CAPITAL LETTERS FOR EMPHASIS font.
(Even if you're skeptical of the lost journal pages, I think it's safe to assume that the Pines family letters to the reader are as reliable as it gets and we have the second Ford letter using that font)
So after seeing this, I went "my god! Ford was writing in Stan's handwriting all this time!"
...or so I thought until I skimmed through my copy of Journal 3 and it turns out Ford used this more ominous font instead.
So. Okay. Then I assumed they simply switched it after creating Stan's handwriting for the new book. The old font was probably retconned and is unused-- but that's also wrong! It's right here in the first Ford letter!
Interestingly enough, this is how Bill's words were quoted in Journal 3 and the font's eeriness is pretty suitable.
--But giant tangent aside, I feel like its significant that Stan's handwriting is used this way when it's pretty distinct!!!
Stan's round handwriting tonally makes sense for early Lost Journal entries when Bill is tricking Ford, but it's almost jarring once we get to the betrayal section.
Bonus: Also here's 3 different capital letter fonts in one pic cos yeesh Ford keeps switching it up, what a drama queen, and yes the new book adds even more
Interestingly, BoB changes Ford's signature from cursive
to this
with the latter reminding me of
80 notes
·
View notes