asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
January: Polls, Bug Race, Tumblr Sexyman Round 2, No Fly List Leak
February: Vanilla Extract, Tumblr Sexywoman Polls, Homestuck Fandom Commiting Voter Fraud, Miette decimating Todoroki in Blorbo Polls, Just so many polls
March: Dean Winchester and his Time Traveling Impala in The Winchesters, Celebrating Ides of March a week early, March 14th: The Day Krabs Fries, Ides of March, Autism Swag Poll, Ultimate Cat Girl (Gender Neutral) Poll, Putin having a warrent for his arrest, The Bots returned with a vengance
April: April Fools Day, Sonic the Hedgehog died, Trumps arrest, Barbie Arresting Trump, Everyone getting a Barbie description, Poll with Nina Tucker and Alexander needs them to tie to move on together, hyperspecific polls, Misha Collins assigned Bisexual by the WB, Elon Musk being the victim of Murphy's Law, It's gonna be May
May: Dracula Daily cast is stuck in a time loop, Trigun stan causes book: This Is How You Lose the Time War to become a bestseller, whatever the fuck happened with Eurovision, TOTK releases and gave us our feral Link back, Barbie and Ken arrested template.
June: Pride month, Across the Spiderverse... just all of it, trump getting arrested...again, The Great Reddit Migration & r/196, Horse Race, Meows Morales, The week long Titanic Oceangate Iron Lung Clusterfuck, Destial 'i love you' news meme trends at least 4 different times for different reasons, Papyrus says fuck day
July: Twitter post rationing causing Tumblr Migration 2: Electric Boogaloo, ao3 went down for 2 days, ao3 readers debating on going back to wattpad/ff.net, Barbieheimer double feature, Tree Law invoked, Elon renamed Twitter to X
August: Tiktok trying and failing to make their own Goncharov: Zepotha, Destiel confirmed canon again by not-so-rouge translator, Riverdale polycule finale, Trump mugshot, One Piece Live Action Pirate-Clown annoys Tumblr users
September: Mole Interest, Ice King became a Tumblr Sexyman again, 21st of September.
October: Spooky month, Merlin Twitter updates for first time in years to show streaming options confusing fans, The Amazing Digital Circus and Nerdy Prudes Must Die both trend for a week straight, trying to insert Markipler into the FNAF Movie
November: Nov. 5th 3rd year anniversary, Zach and Cody get their dinner reservation after 15 years. Goncharovs 1st 50th anniversary.
December: Gavle Goat being devoured by Jackdaws, Hbomberguy lives up to his name and nukes James Somerton's plagerism ridden channel, Its Dec 10th, We're gonna have to kill this guy template, almost Christmas, one more sleep til Christmas (screams internally), Halloween trends on Christmas Eve
— you and camp counselor!ethan gets lost in the woods.
𝐰𝐚𝐫𝐧𝐢𝐧𝐠𝐬 | kissing, lil rough, doggy, fucked over table, begging, ethan’s pull out game being strong, oral (f), enemies to lovers
audio link
the sounds of cricket and owls fills your ear as you and ethan walk around the wood, branches cracking with each step. “I’m pretty sure we’re going in circles.” ethan huffed. “why do you say that?” you asked, following close behind him. “uh because we passed this tree like three time already.” he replied with an attitude.
you had first met ethan when you were interviewing for the open camp counselor position, you hadn’t got accepted to any colleges after high school and you needed a job so a camp counselor was like your last resort. ethan was smart enough for college but needed a job to pay for books and stuff. at first ethan wasn’t all that bad but he slowly became a dick.
“I thought you said you ‘knew’ where we were going.” he said with air quotes, glancing angrily at you. “I know where we’re going… maybe.” you told him with a nervous smile. “maybe? dude we’re lost and it’s your fault.” ethan says, shaking his head in disbelief. “oh my god, calm you whiny ass down.” you said making him even more angry. “oh I’m sorry your highness but do you know where the fuck we are right now?” he says with sarcasm. i mean at least you guys had flashlights.
“from now on we listen to me, not your shitty directional skills.” you fought the urge to beat his ass right then and there. “who pissed in your cereal this morning?” you said, rolling your eyes. ethan didn’t reply and just kept walking. “answer me, landry. what the fuck is your problem.” you said, pushing his shoulder. ethan sharply turned around. “my problem is obviously you, ever since I started working here you’ve been giving me shit for no reason.” ethan says and started walking again.
you shook your head. “no I haven’t.” you replied, furrowing your eyebrows. “ouu denial, I love it.” he says, sarcastically. “oh fuck off, landry.” ethan chuckled in reply making you blood boil. “you seriously have a complaining problem.” you mumbled but he obviously heard you. “I’ll complain if I want to, it’s better than hearing you talk.” he replied. you scoffed and kept walking.
“whatever, are we even going the right way dickface?” you asked with a smug look on your face. ethan just pointed somewhere so you pointed your flashlight to where he pointed to reveal a sign saying camping grounds
with a arrow pointing to the right. “trust me now?” ethan says, not earning a reply from you, you began walking in front of him. “holy shit.” ethan gasped, looking at your leg. “ethan don’t fuck with me right now.” you said, standing still in fear. “you have a medium sized cut on the back of your leg.” ethan told you. you turn your body to see behind you leg and lord behold there was blood running down your leg and onto your sock. “you must’ve done that when we went through the bushes, how did you not feel that?” he says, looking closely at the cut.
suddenly Ethan starts to walk towards you with his arms out. “whoa what are you doing.” you say, stepping back from him. “come on, I’ll carry you to the camping grounds and get my first aid kit.” he says, walking towards you again only for you to back up again. “don’t put your filthy hands on me, landry.” you warned knowing damn well you wanted the opposite. “stop being a brat and come on.” he huffed in annoyance but you finally gave in, letting him pick you up in bridal style and carry you towards the camp.
-
once he reached the camping grounds with you in his arms, he walks into the wooden room and sits you down on a table with your flashlight beside you. “I’ll go get the first aid kit.” ethan says before walking away into another little room. when he came back, he had the kit in his hand. he opened it, taking out two alcohol pads and a bandage. “this is gonna hurt.” he muttered as he opened a alcohol pad.
“fuck.” you hissed, grabbing ethan’s hand in reflex as ethan placed the alcohol pad on your wound. once ethan was done cleaning the wound he placed a bandage on it. once he looked up at you to see you looking at him with smug look. “what? you want me to kiss your boo boo?” he cooed, teasingly. ethan didn’t earn a reply from you so he leaned down and kissed your leg making you hiss. “you kissed it too hard landry.” you complained. even if you “hated” ethan, the kiss made your heart flutter a bit lot.
“thanks.” you said, lowy. ethan looked at you teasingly with his hand behind his ear, “what? say that again.” he says, acting like he couldn’t hear you. you rolled your eyes before speaking again, “I said thank you, landry.” you huffed.
ethan smiled, knowing he had won. “no problem, I told you I can be nice.” he chuckled.
you scoffed. “could’ve fooled me.” you grinned. ethan then looks down at his hand, noticing you still holding it. “ah you’re still holding my hand.” he says shyly. you muttered a sorry and looked down at your lap. “no it’s okay.” ethan whispered as he got closer to you. you didn’t noticed how close he was until you lifted your head back up to look at him, you could feel his breathing on you face. “look I’m sorry for being a asshole.” he look genuine and apologetic, you couldn’t be mad at that. “it’s okay, I was a bit of an asshole too.” you replied. ethan’s face started to get hot at the closeness between you two. “i-i don’t think I’ve ever been this close to you.” ethan whispered.
you couldn’t take it anymore and leaned forward to capture his lips on your. ethan’s hand comes up to rest on you waist as your hand come up to his hair, raking through it. “fuck.” ethan groaned when he pulls away. “since day one I’ve had a crush on you.” he confesses and you look at him surprisingly.
“I’ve tried to hide it but I can’t get enough of you.” he didn’t even give you time to respond when he smashes his lips against yours with a moan. he then pulls away again to say something else, “and I’m sorry about that time with the volleyball and I’m also sorry about the time I-”
“- just kiss me, landry.” you cut him off with a lustful kiss. you run your fingers through his hair, earning the sinful sounds from him. while you were in the kiss, you trail your other hand to the flashlights that was next you and turned them off so no one could see you two were in there. the kiss started to get steamy as ethan started touching you more. “mm wait ethan, m’all sweaty.” you whined as ethan started to kiss down your neck. “I don’t care.” he says into your neck.
after a little while, you push him back to discard your shirt. “cute bra, but we won’t be needing it.” ethan says. you then unclip the back of your bra, throwing it somewhere in the room. “there, happy?” you smirked at the look on ethan’s face, he looked like a kid in a candy store. “very.” he says before bringing his hands to your tits, massaging them. your head threw back in ecstasy. he then decided to take it up a notch and started sucking on your nipples, earning more sounds from you.
“fuck landry, i guess you could do more things with that mouth than talk sh-” he cuts you off, biting down in your nipple which made you squeal. “take your shorts off, y/n.” he says seriously. you were amused by his tone. “hmm no.” you smirked. ethan scoffed, knowing what you wanted. “you’re really going to make me beg?” you nodded with a smile.
“please y/n, please take off your shorts.” you let out an satisfied hum, lifting your hips to take off your shorts. ethan sucked in his breath when he saw your black lacy underwear. “take that off too.” he groaned when you hooked your finger under the band, pulling them down. ethan then pulls your legs apart to rest onto the table. you gasp when you feel his tongue run across your slit, sliding the flat of it over your clit before swirling around it. you try to do something with your thighs but he has you pinned.
“fucking hell, landry.” you whisper, not wanting to be too loud. your head shoots back as the coil in your stomach starts to get intense. you place your fingers through ethan’s hair, pulling it before he moans into your cunt. he pays extra attention to your clit, sucking and swirling on it. ethan then pulls away, not taking it anymore. “shit bend over.” ethan whines. you do what he says, hoping off the table and bending over it. you hear a buckle rattling as ethan takes off the dumb khakis they made the boys wear. you felt the head of his cock slip through you slit and into your cunt, stretching you out.
“shit landry, you never gave off big dick vibes but i stand corrected.” you moaned as ethan started thrusting at a good pace. he hiked your right leg on the table, making him go deeper. the coil in your stomach started to progressively increase as ethan’s speed increased. “shit.” he grit, clawing at your hips. ethan’s head leaned back with his eyes closed, he was in heaven. “fuck landry, m’gonna cum.” you warned before he increased his thrust, helping you get there. with a couple of fuckfuckfuck’s you came around him, breathing heavily. ethan was right behind you, thrusting like his life depended on it. “holy fuck.” he pulls out, cumming all over your back.
ethan helped you get off the table and kisses you, passionately. “maybe we should sneak out often and have some fun.” you smirked at him, batting your eyelashes. as ethan gets his clothes back on he replies with a nods then leaves to find something to clean the cum off your back.
I'm mostly curious, so you can write this as whatever but how does Sage do with an affectionate reader? We know he laps up all the attention Reader generously gives but like, is he generally rigid at giving or receiving? Or is he the softest man alive haha
Not well. Affection does not compute with this poor guy-
@lovanmari I think these may be more of what you were looking for?
Anyway, Sage is TotK Link!
In face, have some headcanons on this-
・❥・Sage. My precious baby boy. How I love and cherish you, you little rat bastard.
・❥・So, we've established he's got some trust issues. Can you blame him?
・❥・He's just so, so tired. He just wants to rest. But he can't. He feels he's the punchline to one of Hylia's jokes. And it eats at him.
・❥・So when you, perfect, adorable you, come in with your sunshine and rainbows ass, he's just...like frustratingly confused.
・❥・What about life is so great? Hm? What about it makes you want to go around, hugging and kissing the others around him? Hm? What makes them so special? Hm?
・❥・Why do you feel the need to do the same to him?
・❥・At first, Sage doesn't trust the affection at all.
・❥・He's convinced you're buttering him up for some sort of secret attack. Like he'll lower his guard to accept one of the cuddles you bestow upon him and you'll stab him in the back-- literally.
・❥・But the others just seem to...accept this?
・❥・The bird hero (Sky) seems to downright preen whenever you gently press a kiss to his cheek.
・❥・The smithy with a height problem always looks so at ease whenever you settle next to him, laying his cheek on your shoulder.
・❥・Even the ever stoic Ocarina player looks more...relaxed when you come up to him, demanding a piggy back across the swampy bog. Little you demanding something from Time sparks something in Sage.
・❥・He knew that Time was just as scarred as he was when it came to trusting people. He had been burned in the same way, hand scorned when offered too many times.
・❥・That's part of what gets him to settle just a bit.
・❥・He doesn't start any cuddle parties, don't get it twisted, but if you wanna sit next to him while he's restringing a bow, he won't say no.
・❥・But start slow. He's like an easily startled deer in this situation. Only you never know if the deer is gonna buck and curse you out, stomping away, or if it's going to simply turn on its heel and reinstate the original distance he kept between the two of you.
・❥・But once you've gotten past the initial stage where he's simply scared of getting hurt again, Sage has an absolute heart of pure mush for you And you alone.
・❥・You see, once you've proven that you're hard to get rid of, he takes it as a sign. Especially if you've spent quite a bit of time together.
・❥・ He'll start slow. Sitting next to you while he fiddles with his Purah pad, or setting his bed mat closer to yours than before, but when you accept these without question, or, goddess forbid, encourage them- oh ho ho-
・❥・He is the clingiest bastard. Like, you will have no time alone.
・❥・(Forgot this was a yandere blog, did ya? Well I'm here to remedy that! >:))
・❥・He is constantly hovering over your every move. You wanna sit under a tree and read? He's laying his head on your lap, expecting head scratches the entire time and loudly complaining if you don't give them. You wanna go for a swim in a nearby lake? He's joining you in the water, no questions asked, making sure you don't drown, even if you're a great swimmer. He's got that Zora armor, and even if he doesn't wear it, he's spent enough time with Sidon to become a great swimmer. You wanna take a freaking nap in a tree?...Are you nuts? Sage would never let you nap in a tree, are you kidding? He has a much comfier lap with arms wide open for you to crawl into.
・❥・You fool.
・❥・Once he's established that you're not going anywhere, not for a while at least, he is all over you.
・❥・Like, this man, who's used to traveling along? He's switching up everything. Extra shields for you (Because he is not giving you any weapons. At all), extra potions, carrying snacks in his Purah pad, extra bed mats and blankets, extra armor and gear (Like snowquill jackets and fire breaker sets).
・❥・He's a secret mother hen he just hides it.
・❥・When you guys are traveling, he's in your presence constantly. Like never out of arm's reach. He has in fact bitten someone for trying to fight him for his spot (Rip Wars).
・❥・He will in fact do it again because when he's in arms length he has so many possibilities. Like you are right there.
・❥・He's pressing swift kisses to your temples, cheeks, even your lips when he gets cheeky enough, before moving on like nothing happened.
・❥・He's walking with your fingers knotted with his own, rubbing his thumb along your skin.
・❥・He's not only moving his sleeping mat beside yours, oh no, they are touching they're so close and he's clinging to you in his sleep.
・❥・And he is heavy. Like he is clinging to you like a Koala bear in his sleep.
・❥・You are not safe. He snores and drools and you're just gonna have to put up with that. Sorry not sorry. He just sleeps so well when he's with you! He can't help it!
・❥・It burns the other Links, but there's not much they can do because, let's be honest, you like having Sage's attention.
・❥・It's something well earned and you deserve to enjoy it.
・❥・Just don't let him get used to it. Who knows what he would do if that happened?
・❥・Unrelated, but how do you feel about, say, Tarrey Town?
Warnings: Angst, fluff, soft and domestic, suggestive themes
Authors note: I was too excited to not post this lmao :3c
Time seemed to stop, and you didn’t mean by the Old Man.
Time literally seemed to halt. You stared at Rusl, trying to find any signs of lying or amusement in his eyes, as if this was some joke. A cruel, twisted joke.
“W-what?” you asked, the only word you could muster. You could feel your fingers shake on the table. You didn’t want to believe what Rusl said, or did you? You weren’t sure.
You weren’t sure if you’d accepted the fact on whether or not you were coming home ever again, but you didn’t think it would happen now, or so soon. Maybe Hylia wanted to see how your head would react. A twisted game for her, like it always is.
“Are you sure that’s what she said? Maybe she meant something else-"I know what she said. I may be old, but I saw what she wrote clear as day. There’s another mirror.”
Before anyone could say anything else, you stormed out of the cottage, the door squeaking on it hinges as you storm out.
“Y/n! Wait!!” Hyrule yells after you.
Before you could stop yourself to calm down, you break into a spring, heading straight towards the forest. You needed to run. Run. RUN.
This couldn’t be happening. You researched and combed through Hyrule Castle’s archives to find any sliver of hope that you’d be able to come home. Even if it said it was impossible, you never found anything to begin with. You had no answers.
You don't know when you stopped running, you panted as you sat up against a tree, silent tears running down your cheeks and down your neck. Breathing was so difficult, you began hiccuping and hyperventilating, gripping onto your hair for any kind of grounding back into reality. That’s when you felt something wet on your forehead.
Looking up, you were relieved for it to just be Wolfie, or Twilight.
“Twilight you shouldn’t have followed me.” you whispered into his fur.
Twilight turned back into his Hylian form, your face still in his pelt.
“I needed to make sure you were okay. Can’t leave you alone, especially in Faron Woods. Who knows what’s still out here,” he murmured into your hair, combing through your sweaty locks. He kissed the top of your forehead, hesitating before pulling back.
“It’s gonna be okay, Y/n. I promise. We’ll be with you, every step of the way, ok? We’re gonna find you a way to go home. Whether it be this lead or if we find something else.”
You sighed. Twilight was always the more outwardly calm person in the chain, alongside Time and Warriors.
“Twilight that’s the thing… I’m not even sure if I want to go home. It’s probably been years back home, hell I don’t even know if I have my apartment or my friends or… But its not like I don’t want you, y’know? I’ve been dreaming of going home since I first came here, I’d been up for nights at a time just researching in the underground library archives. I-I don’t know what to do or think, Twi.” you rambled, voice breaking at the end, letting more tears slip out.
“Although I don’t know exactly what you’re feelin’, I’m here for you, whatever it is that happens. We’re all here for you.”
He takes a breath.
“Speaking of the others, we should head back to the village, the others are probably worried sick about you.”
You nodded without a word, getting up and making back to Ordon Village together, Twilight wrapping his pelt around your shoulders. It smelled like him, you thought.
~
Twilight never gives anyone his pelt, its the one thing he sees as his. So why’d he give it to you? He has no idea. Instinct, he thinks. It’s cold, you needed it more than him. He looks down at you, your pink cheeks and wet lashes making you look more fragile and doll-like. Your cute nose sniffing every few seconds, breathing in the cold air. Your ears were so small, littered with at least 3 or 4 piercings, one of which was a triforce.
Twilight smiles slightly. He always liked the little pieces of “memorabilia” you had of them. It was incredibly strange and unsettling when they first found out, but he sees it more as like your belonging to them admiration of them.
Twilight’s train of thought stopped for a moment.
Where the hell did that thought come from?
Before he could ruminate on his psyche, he’s shaken out of his thoughts by Wind yelling “Oh thank fucking Hylia!”
~
You came back into Twilight’s treehouse, heading toward the bathroom to take a warm bath. You noticed that the tub was already filled, hot steam coming off the surface of the water. You’d have to thank whoever drew you the bath.
Stripping your clothes, you set them in a pile near the door. You step into the tub, wincing slightly at the hot water making contact with your skin. It was a bit too hot for you, but you knew the water will cool off fast enough, so you powered through it.
You sighed. This was nice. Even with the chaotic stream of thoughts coursing through your head, the bath seemed to dull it, even for just a moment. You grab your hair and start combing through it, no doubt getting knots from running through the woods earlier. You look at the necklace Four made for you a few months ago. It was to commemorate a year being with the Chain, which in retrospect should’ve made you sad, but it made you extremely happy and grateful for everyone in the group
You knew it was much easier to come across rarer metals and jewels here than back home, but you were still just as in shock when you realized what it was made of. You remember sobbing from joy when you received it, as you never held something so expensive and meaningful in your entire life.
The necklace was made of metal sourced from Death Mountain but you had no clue what the gem in the triangle shaped cavity was. It looked like emerald, but the boys said it wasn’t that, and that they won't tell you. They were so petty at times.
You were startled out of your thoughts when there was a knock at the door.
“I brought you some fresh clothes, Dove.” Ah Sky, honestly you were a little relieved it wasn’t Legend or Wars, knowing they’d say something snarky or suggestive.
“Come in Sky.”
You could hear the cogs turning in his head for a moment before he entered, red in the face. You almost laughed at what you were seeing.
Sky turned his head away from you and covered his eyes, just to spare you some dignity.
“I-uh gave you one of my older shirts since you don’t have any other clean ones and its thicker, so it’ll help keep you warm and it has-”
“Sky, for the love of god you’re making this more awkward than it has to be. You’re sweet for being so thoughtful, but we’re both adults Pumpkin.” you mused, chuckling a bit.
Sky finally made eye contact with you, but still avoided your eyes for the most part.
“Right. Um, well, I’ll just leave these on the chair then.”
Sky then stared at you. Not in a creepy way, just in admiration and awe. Luckily, the rest of your body was hidden under the bubbles of the soap in the water, so its not like he could see anything anyway.
He then walked up to you and sat down outside of the tub, still gazing at you.
“I was so worried about you earlier, Songbird. Are you alright now?” he asked, worry crossing his face.
You sighed. Ever the most thoughtful. Bringing your hands from under the water, you cup his cheeks looking right into his eyes.
“Don’t worry so much about me, Sky. I’m fine now. Twilight calmed me down a bit, but you know how shocking such information can be. I just need a bit to process, y’know? I’ll be fine though.”
You gave him a small smile, trying to read the thoughts behind his eyes. He just kept looking at you. You swear he looked at your lips a few times. Biting his lip, he asked “Can I wash your hair for you? No offense at all, I just wanted to offer because you never know when the next time we’ll get to be clean again.”
You nodded with a smile, sitting back against the porcelain tub, handing Sky the glass bottle of soap. As soon as he lathered his hands, he started massaging your scalp, a feeling you’ve missed so much.
“Fuck, Sky, that feels so good.” you said, not realizing the tone or implication you said it in.
Sky’s breath hitched, but you didn’t catch it, too busy on the sensations on your scalp.
“Yeah?” he whispered, looking at your bare shoulders that were littered with scars from your journey with them, wishing he could wash them away. He felt his ears get hot from your soft sounds, happy that you felt so comfortable and wishing you’d make those sounds more often domestic with him.
Suddenly the movement stops. Opening your eyes, you turn your head over your shoulder, almost jumping at how close his face is. Your gaze flickered to his lips, almost as if it was instinct.
“Sky… I-” “I’ll let you finish up.” And with that, he left, softly shutting the door behind him.
~
What the HELL is he thinking???
Sky gripped his hair, walking down the hallway, panting slightly.
He was so… close to you. He could smell the soap on your skin. He could see the different colors in your eyes. He felt strange. He knew he liked you… and not just as companions or friends… he wanted more. He felt happier, lighter since you came around. He genuinely laughed for the first time in ages.
It seemed like there was a spark of sorts between the two of you, but he didn’t want to assume or jump into anything… yet, at least. He needed a minute to calm down.
Trans!Simon "Ghost" Riley x Male Reader
Summary: I saw this tweet (nsfw link/art) on twitter and yeah, couldn't stop thinking about it.
Warnings: NSFW, 18+ Only. Smut, top!reader. Riding, creampies, overstimulation.
You're too distracted to care if the bed squeaking and scraping gives away what you're both doing, the thwap, thwap, thwap against the wall. Even if someone walked in you don't think you could stop; the way Simon's pussy sucks you in and spasms around you, the deep, guttural growls and moans that fill the air as he takes what he wants from you, bouncing and grinding in whatever rhythm he pleases.
His body is thick with muscle, tree trunk thighs keeping you pinned underneath him as he mutters filthy praises in your ear. “Fuck, you fill me so well.” When your cock twitches inside him in response he laughs, dropping so your cock sits fully in him as he lazily grinds forward, watching you through the holes in his mask with eyes blown with lust. He turns teasing, “Oh, did you like that?” He questions, your body answering for you as your hips attempt to jerk, your grip on his waist tightening as you try to urge him to move.
He pins you with a stare, waiting for an answer - he likes the praise as much as you do. You exhale a pleased sigh, "Shit, yeah I do. You feel fucking amazing." He clenches around you at that, a grunt punching its way out of your chest in response. Simon starts riding you again, eliciting moans as he lifts himself up until just the head of your cock is in him and then sinks back down all the way, folds parting easily with how wet he is.
You mutter curses under your breath as Simon begins to rock faster backwards and forwards, his breathing becoming heavier as his pleasure surges, pace growing uneven and random as he focuses on angling his hips when he bounces down so you hit the sweet spot inside him. He clenches around you wildly, and when he orgasms you feel it immediately - the convulsions of his cunt around your cock almost sends you over the edge as he moans deeply, thighs quaking as he drags out his orgasm, slowing his pace to where he gently rocks above you.
You’re entranced watching the waves of pleasure crash through his body, your cock jumping for more as he comes down from his high. Once he’s recovered Simon immediately begins bouncing at a fast pace, hungry for more. With the added lubrication from his orgasm your cock slides through his pussy with little resistance, his hot walls clinging to your cock and quickly hurtling you towards orgasm.
Holding onto his hips you’re torn between slowing him down or making him go faster, stuttering, “Shi- shit, I’m cl-close…” This only encourages him to go faster, taking you as deep as you can go.
“Yeah? You gonna cum in me?” He husks, shivers sparking through your spine as you nod, fingers grasping at the skin of his hips.
“Mhm,” is all you can manage, words fleeing your brain as you climb closer and closer to your peak, your nerves alight.
Simon chuckles in response, sensing how desperate you were with how much you were twitching inside him. “Yeah you are.” He wraps his arms around your neck bringing you chest to chest as he grinds forward, your cock nestled deep inside. “So do it then.”
It’s all you need to be pushed past the point of no return, mind going blank as your cock pulses inside his cunt, streams of white erupting and coating his insides as he continues rocking forward, milking you for everything you have as you adjust your arms to around the middle of his back, holding him close as you empty yourself.
He groans at the feeling of being filled while your balls twitch and release everything they have, a long, drawn-out groan escaping your mouth.
You both stay like that for what seems like eternity, twitching around each other until your cock finally dribbles out its last remnants, your bodies finally ceasing their movements as your senses return to you.
When they finally do, Simon is looking down at you, a pleased glint in his eye that makes you laugh as you rest your head back against the headboard, chest rapidly rising and falling as you catch your breath. He lets out a pleased hum, hips rocking forward as he grinds against you. Your head shoots up in response, but Simon pauses for a moment before rolling off and lying next to you, opening his legs as your release slowly trickles out of him.
Your mind churns and cock twitches when he turns to face you as gathers up your release with two of his fingers and pushes it back inside, the air catching in your throat. With a grunt you change positions, kneeling between his legs and grabbing your cock, stroking your length a few times before you pull his fingers out the way, sinking back in with a pleased sigh.
Simon hums in response, sinking into the bed as you play right into his hand. He knows you can never resist him for long, and he was ready for more.
You didn’t realize two days had passed. It all just seemed like one long day where you spent most of it preparing for the war that was to come between the Na’vi and the Sky People.
Jake had left to gather the rest of the clans to join the battle as the new Toruk Makto. Which led you to get to work yourself. Right after his speech, you had left your avatar body just a few miles away from the Tree of Souls and woke up back at the camper when the morning came. Carefully, you climbed out of the link bed. You hadn’t realized that even in your human form there were dry tears on your cheeks and your chest felt hollow just as it did in your avatar body.
For a moment, you sat there and really thought about everything that had happened in the past few hours. You were tired and you were numb. There really wasn’t any time, you never really had time. It felt like it was always slipping from your fingers. Really, you should’ve expected this from the beginning. You should’ve expected that you had very little time left with Grace, that you wouldn’t have much time with Jake, you should’ve cherished each moment you had with them more. You should’ve…
Outside the foggy window in front of you, you caught sight of the ship that you, Jake, Norm, and Grace arrived in. Furrowing your brows, you grabbed your mask and walked outside to get a better look at the ship. You searched around for its pilot.
“Trudy?” You called, glancing around.
“Here!” Trudy popped out of the pilot’s seat with a radio tucked under her arm as she jogged over toward you.
To say you were surprised was an understatement, “I thought you left…”
“Yeah well, I wanted to stay, just in case there’s a plan I need to know about.” Trudy grinned and held up the radio, “Been listening to this all day. It doesn’t seem like Quaritch is striking any time soon but he’s definitely planning on it. So whatever Jake’s plannin’ he needs to hurry.”
You nodded absentmindedly, “Jake knows what he’s doing. He’s gathering the other clans so that our side would be greater in numbers, I believe.” You weren’t really there in the conversation, instead your mind was swimming and your feet were moving on their own as you went back into the camper.
Trudy had followed you inside, “Okay, that’s great and all…But what are you doing here, Doc? Why aren’t you with Jake and Norm? And why do I feel like you have some type of solo mission plan that you got on the side and no one knows about?”
An unamused smirk tugged at your lips, “Then you’d probably be right.” You stopped at a desk and pulled open one of the drawers. Thankfully, the little map you had made was still there. Trudy appeared next to you, looking down at the handmade map you were unrolling.
“Okay…what is that?”
“A map obviously.”
“No shit, Doc. I mean what is it for?”
You shrugged, tucking the map into your pants pocket and then grabbing a duffel bag from under the table, “That depends. Are you willing to help me find them all?”
Trudy frowned, “Find what?”
You walked out of the camper, “My bombs.”
As you kept walking you heard a muttered “holy shit” before Trudy trailed after you. “Where the hell did you get bombs?”
“I made them.”
“Of course you did.” Trudy shook her head, tucking her radio away in her back pocket. “When did you have time to make them? Wait—how many are there? What are they for?”
“How many questions are you gonna keep asking me before we actually focus on finding them?”
“Sorry if I’m a bit troubled that my friend had made bombs and I don’t know what for….” The sudden dawn of realization finally crossed her. “Shit, Hell’s Gate. You’re planning to blow up Hell’s Gate aren’t you?”
You shrugged, leaping over a fallen tree, “If it goes well, then yeah, Hell’s Gate will be up in flames.”
Trudy frowned at you, “Did something happen while you were gone? What happened with Grace….?” By the look of your face, by the way your attitude had changed compared to the last few hours, by the sudden reveal of your secret plans that you had been working on for two years, Trudy knew without you having to say anything. “Damn it, Doc, I’m so—”
“Don’t say you're sorry.” You shook your head, scowling. You stopped next to a tree and a deformed rock. “The only people you get to pay for all of this is Quaritch and the fucking RDA. I’m done sitting by and letting them destroy shit, and continue to destroy everything that is good. Grace was good.” Trudy remained quiet, taken aback by the fierceness in your words and the steel in your eyes. “I won’t let them take more from me, Trudy, I won’t. Not anymore. Not when I can do something about it.”
You turned away from Trudy and knelt down beside the deformed rock and began moving the bushes around it before you found your first bomb. “So you can either help me or stay out of my way.”
Carefully, you dug the bomb out of the ground and placed it in your duffel bag. They were small enough for all of them to fit in the bag together. You had planned this out ever since you built your prototype, drafted many plans until you had one solid idea. Executing it was the one part you were focused on the most.
“Fuck it, yeah I’m in.” Trudy finally said. “Where’s the next one?”
For the next few hours, almost half the day, you and Trudy had spent finding the rest of the bombs. You remembered you had placed them sporadically around the forest in case if someone did discover your plans, they wouldn’t know where to look for them. And the map would have been burned easily.
You were never worried about them going off in the forest or a Na’vi accidently setting one off. There were physical switches or buttons on them, instead you had built a remote—which you called the Key—that released a kinetic wave that set off all the bombs simultaneously. There was no countdown, no time to get out. Just explosions. All you needed to do was place them in the places worth hitting. Then afterwards…
By the time you found the eighth and last bomb, night had come and both you and Trudy had headed back to the camper to get some rest.
The next morning, you had spent time communicating with Max Patel, updating you on what had been going on back at Hell’s Gate. Quaritch knew about Jake gathering the other clans as they’ve been surveying them for a while. Fortunately for them, they didn’t know about Trudy betraying them or had a clue about your bombs, frankly neither did Max.
“They’re most likely to attack tomorrow.” Max informed you with a grave expression on his face. “Maybe sooner once he’s gathered the fleet together.
You were quietly thinking as Trudy continued to ask him more questions. Once she ended the call with Max, you spoke, “Trudy, I need to be at Hell’s Gate with the bombs.”
She looked at you, furrowing her brows, “Okay…how are you gonna get there?”
“Take me there tonight and maybe I’ll hide there until all the forces, including Quaritch leave for the battle.”
“You don’t think you’ll get caught?”
“They’re too worried about what Jake Sully’s doing to worry about me. Hell, they haven’t even realized they have two traitors on the inside yet.”
“Touché.” Trudy sighed and leaned back in her seat, “Then I’ll take you tonight and blend in with the rest of the pilots.” You nodded and the both of you sat there for a long quiet while. In the corner of your eye, you noticed Trudy was glancing toward the two closed link beds that had both Jake and Norm inside. “Does Jake know about any of this?”
“No.”
“Do you plan on tellin’ him?”
You didn’t respond.
“…Am I the only one that knows about this?”
You shook your head and said quietly, “Grace did.”
“Oh.”
When the evening came, you spotted the toruk flying past in the sky, which told you that Jake had returned and so did the rest of the Omatikaya and the other clans. The battle was drawing near and for the first time in the last couple of hours, your heart was heavy with dread and anticipation.
You had turned to Trudy before leaving, “Wait for me at the ship. I’ll be right back.”
“So you’re going to see Sully then?” Trudy asked, putting on her mask with a small smirk. “One final goodbye kiss?”
A noise that sounded similar to a snort left your lips, “Fuck off, Chacon.”
You got into your link bed and Trudy stood next to your bed, ready to set it up. Once the lid was closed and the world had gone dark around you…
The forest was there to greet you. And no matter which body you were in, the exhaustion was still there. The hollowness was still there. But you pushed yourself to your feet, staring up toward the darkening sky as the many ikrans flew above your head.
As you followed where they flew to—mostly toward the Tree of Souls—one of them landed next to you.
“Tsmuke!”
You looked up to find Tsu’tey was on the ikran and slid off to approach you. “Shouldn’t you be preparing for a war, oh great warrior?”
“I should ask you the same question.” He tilted his head, looking at you curiously. “Do you not plan to fight, dreamwalker?”
You frowned, remembering your plan, remembering Grace’s last words to you. “I am. Just not in the skies.”
Tsu’tey snorted, “Are you not Sky People?”
“I have fallen from the sky long ago and have been on land ever since.”
He considered you for a long moment before he said, “You are not one of them. Not anymore. It took me too long to realize that….” The both of you stopped on a smaller cliff that overlooked the Tree of Souls a distant away. “Sylwanin believed it too.”
You were startled. It had been years since you heard her name, much less from Tsu’tey’s mouth. Never in your life did you think the two of you would ever talk about her, a part of you thought that he believed her death was your fault. Because you were one of them. The Sky People.
“I’m not sure I am deserving of it.” Was your response but Tsu’tey shook his head.
“She believed you were always one of us. You and your sa’nok, Grace Augustine. You’ve always been on of The People.” Tsu’tey nodded contently. He placed a hand on your heart as you stared at him in stunned silence. “As the Olo’eyktan. As your friend. As your brother. I see you, sister.”
With glassy eyes, you placed your hand on his heart as well, “I see you, brother.”
Tsu’tey smiled and despite your sadness, despite the graveness of the war falling onto your shoulders, you returned his smile with a shaky one. “I will see you when the war is laid to rest, tsmuke.”
You chuckled, “Promise?”
Neither of you could make such a promise.
He tapped your heart, “Two hearts.”
You did the same, “One beat.”
Tsu’tey nodded to you. Eventually, you let each other go and you watched him hoist himself back on his ikran. He called to you as he took off, “You fight well, tsmuke! Fight well!”
As you watched him soar away, you thought about his words. His acceptance of you. God, you wished you could take a moment and bask in it, take a moment and appreciate the change in your relationship with him, to take a moment and realize that he thought of you as one of The People. Even if you were so undeserving of such a title.
With a quiet sigh you mumble, “Eywa help me.”
When you got to the Tree of Souls, Jake and Neytiri were about to leave it. Neytiri walked by you, squeezing your shoulder and nodding to you. A part of you wished you had more time to form a relationship with her like you had done with her late sister. You wondered if you would ever get the chance.
Jake approached you next and you found yourself smiling a little at him, “Look at you. Mighty Toruk Makto. Perhaps you aren’t much of a puppet anymore.”
He pulled you into him, his strong arms wrapping around you tightly, so tight as if you’d disappear. When the both of you pulled away, he cupped your face in his hands, “After all of this, when we take down the RDA, I need more time with you.” He chuckled at himself. “It sounds so stupid—”
“It doesn’t.” You reassured him, squeezing both his wrists. “Out of all the stupid shit you’ve said to me, this was quite tame.”
His white smile made your heart flutter. How he had this effect on you, you never knew.
If only you had known what type of effect you had on him.
If only you had enough time to know. But he had a way of making you know in his own way. The way he held you whenever you had a chanced moment alone with him, the way he leaned down—even now—to find and capture your lips with his. As gentle as he always did. His warmth, his lips, his hold, you wanted to stay in this forever, you wanted this to be forever.
You both broke away from the kiss for air but he never let you go. Jake buried his face into your neck and wrapped your arms around him, one of your hands finding his hair and running your fingers through it.
Then your eyes found the Tree of Souls. It glowed heavenly in the night and the base of the tree was empty. Grace’s body was nowhere in sight. You pulled away slightly from Jake but grasped his hand as you pulled him toward the tree, eyes never leaving it.
When you got closer and gently, your other hand grazed one of the stems, as you asked, “Do you think she can see us now?”
“Eywa?”
You shook your head, “Grace.”
He squeezed your hand before wrapping it around your waist, pulling you close to his side, “I know she would never abandon you. It’s the last thing she’d want to do.”
You knelt down in the spot where her body had been, your hands running through the dirt and the tree bark. “She didn’t abandon me.” She was taken from you. Stolen. Stealing wasn’t anything new to the RDA.
Jake didn’t have to hear your thoughts to know what you meant, “They won’t take anything ever again. Not from the people. And not from you.” His voice was hard and sure which, in a way you admired and loved about him. “I’ll make sure of it.”
You smiled up at him sadly. Jake knelt down beside, tilting his head at you as he observed you closely. “Will you fight? When they do come?”
He didn’t need to know about Project Pandora. He didn’t need to know about your plans to leave for Hell’s Gate tonight. So you just nod.
But Jake didn’t look too happy about it. He didn’t have to voice it, his face already told you he did not want you to fight. “Be smart.” Jake said, pressing his forehead against yours gently, his hands finding the sides of your neck. “Don’t do anything impulsive. And be a little selfish if you have to, okay?”
You didn’t say anything, you didn’t promise anything. All you did was nod. With another long kiss, this time almost desperate, Jake stood and looked at you to follow.
“I’m just going to stay here for a little while longer.” You tell him. “I won’t be long.”
Jake nodded as he slowly backed away whilst looking reluctant to do so at the same time, “Don’t be down here too long, okay?”
Once he was gone, you were left alone. With no one but the spirits.
There was a part of you that wanted to try and see if Grace could hear you, to try and tell her that you tried her way and that you were left with no option left. You wanted to say you would try not to die but really, who could really guarantee that?
You’ve always known, ever since you were young, that the war was unkind. It was unkind to your father, even when he survived it. It would not change now. The war would always be cruel. Unkind. A demon.
For now you found comfort under the tree. And you stayed there until you decided to leave your avatar body lying there, under the tree.
You didn’t know when you would be able to return to your avatar when you woke up back at the camper with Trudy waiting. You didn’t know whether you’d see Jake again as you stopped next to his link bed before leaving.
There were a lot of things you didn’t know when you boarded the ship with the duffel bag at your side.
All you did know was that the RDA wouldn’t hurt anyone else again.
!! These will contain personal headcanons I have for the cast, little fun facts, and also spoilers for Friendlocke Violet (for both the edited vids and the streams) This also contains a small amount of blood on one of the images!!
@saltydkart-reblogs
And that’s pretty much it, designs under the cut!
JOE:
The reason Joe dislikes most bird pokemon such as fletchling is because they're always stealing and pecking at the olives he... or well more specifically his company grows.
Speaking of which, they own a large plot of land which is used specifically to grow olive trees, which of course are used to make the olive oil he sells. What? Did you think that the olives come from Joe themselves? Of course not silly, welcome to capitalism.
That being said, Joe DOES know how to garden. When they first started their olive oil company they had to grow their own olive trees. Nowadays, in their spare time, they'll sometimes be found tending to the olive trees in their company's garden.
His crown is personally tailored for Joe and Joe ONLY. Crafted with the shiniest gold and the richest olives, all fit for a king! Somehow it never falls of his head. (Fun fact: the points are made to look like olive oil bottles)
Joe needs glasses but usually wears contacts when in public. Not that they look bad with glasses, it's just a personal choice.
Joe LOVES being involved in... well, anything! As long as it's not weird or sexual or illegal (that last one counts UNLESS it involves scamming others into buying his oil products), he is more than happy to invite himself into whatever is going on around him. What are you going to do? Stop him? Oh please!
HANNAH Ü:
At the start of her career, she would spend her days doing her own one-man (or.. well... woman) shows at subway stations, telling stories and entertaining other pokemon and people alike while they waited for the next train to arrive.
Her hat and cape are made entirely of salt! She is able to transform her cape and hat into different shapes and usually used this ability of hers to make stuff such as accessories, hats, and props that fit the role she's donning at the time.
Hannah LOVES collecting stickers and often wears them proudly on her body (in her poke form ofc ofc). However, she usually has to get someone else to stick them onto her bc of her lack of actual hands.
Some of her improv roles are inspired by the people she meets while others are inspired by pieces of media she's interested in at the moment.
Will ABSOLUTELY learn a new language if she needs to for a role. Duolingo speedrun world record
MYKYIE:
As stated previously, Mykyie used to be a circus performer before he quit to pursue his dreams. His most popular act involved him spinning plates on a stick while standing on a ball.
^^^ Because of this, he also has really, REALLY good balance.
Mykyie always keeps his Miku glowsticks on him, even when not attending any of her concerts.
"Anger Point" is basically an uncontrollable form of last resort whenever Mykyie is close to death but can still fight, it usually leads to him attacking whoever or whatever caused him great harm (In the instance of Lark, it was when he crit Mykyie and the ladder's health was extremely low.)
The Miku tattoo on Mykyie's arm was designed by Mykyie himself! However, it was drawn on him by an anonymous underground artist who went by many names to hide his true identity. The name that the artist went by at the time Mykyie got his tattoo was "Cl@ir33"
The cuffs and cape that he wears are... well, WERE, red. An unknown force seems to be slowly turning them into a shade of blue.
And that's all the HCs for now! Next Gijinka batch will consist of GrAce, Braidy, and Christene's
Also here's the posterless version of Joe's Gijinka bio before I go
I read the lyrics of Wife and they're even worse than Queencard. I'm too afraid to listen to it, I can only hope that the rest of the album isn't like this nonsense. I miss their old music and lyrics, it was poetry in comparison to whatever they're doing now :(
Anon i wonder if you arrived at this blog in the past five minutes bc i have not been silent about wife. You’re barking at the wrong tree here.
I will always defend someone’s right to not vibe with the style of the song bc that’s personal taste. But if you say Wife has gibberish lyrics I’m assuming you rely very superficially on only English translations because KBS has deemed the song too sexual for broadcast, so it’s definitely not “nonsense”. It isn’t in English either. The mv, the styling, the lyrics, they’re all full of metaphor and satire (detailed here and here and here).
I don’t think you’ll like when you listen to the song because your mind seems already set. Honestly I don’t think you’ll like anything they put out because as you say, you miss their old sound and music, whatever you think that means. Nxde was just a comeback ago. Senorita and dumdi dumdi were terribly unserious. I don’t think latata and uh oh were that groundbreaking either. I do wonder if you’re the same anon I answered a while ago?
If you’re using pre and post Soojin as old and new I just think you need to be more honest with yourself about why you don’t like their new songs anymore. For the reasons stated above, I think it’s way beyond what you deem sensical lyrics and good music. Gidle has a wide range, they’re versatile and always with a new concept, to the point I’ve seen people calling them inconsistent. So if none of their very different to each other comebacks has been appealing to you, there can be other reasons than the ones you’re trying to rationalize. Soyeon will not produce gidle as it is now the same way she would as it were then. And I will miss Soojin in the group until I perish but it will never be because I want them to return to their old “better style”. I’d kill to see Soojin tomboying and queencarding.
I love the fun they bring to kpop. I love to see them act confidently “silly”. Even the silliness is debatable, as it is intentional, as it’s not mindless, because they ARE making statements, whether you recognize it or not, and also regardless if you approve of the way it is made. Gidle is thriving with a method a lot of groups can’t afford to. They’re grown women doing grown women business, they’re self made and self produced and paraphrasing one of the videos linked above, they’re not gonna say something unless they have something to say. They’re always innovating, they never follow a formula, there’s barely a pattern between comebacks except for the fact that it’s always them. It’s who they are and what they want to show. That’s what I love about them, that’s what makes every comeback interesting. And this has not changed, not even once.
𝐋𝐀𝐓𝐄 𝐍𝐈𝐆𝐇𝐓 𝐓𝐇𝐎𝐓𝐒. ̨ ✩°̥࿐ just thinking about the obvious crush you have on Six, but he’s too stubborn to give into it.
pairing: Sierra Six x fem!Reader
authors note: tbh, I liked this too much to just leave it as a drabble. I’ll probably make this into a full fic eventually, so I guess you can consider this a teaser 😭 I thought I’d at least post it and see how it goes. it’s probably not that eventful but whateva.
LINKS ੈ♡˳·˖✶ masterlist | time stamps | taglist
YOU COULDN’T HELP BUT STARE at the way his muscles flexed under his suit jacket; a steely gray that complimented the olive undertones of his skin.
Six barley turned his head, managing to look at you from the corner of his eye. Subtle enough to see the way you looked at him as more than a… whatever he was. Bodyguard. It brought a small smirk to his face as he opened up his jacket and pulled out a piece of gum from his inner coat pocket.
He’d offer you one, but he liked it better when you thought he was oblivious.
You watched as he threw the stick of pink gum into his mouth, bubblicious no doubt. Or watermelon, another one of his favorites. You stared at the way his jaw clenched as he chewed on it, shoving the tiny wrapper into his pocket. You watched as he slowly stalked around the wall length windows, resuming his casual pace, examining the yard like something was going to pop out at any second.
All you could do was watch. Watch him, watch him walk, watch him stare out at nothing. It must’ve been a boring job; just staring, walking, waiting. Waiting for something to happen, daring someone to come.
You cocked your head at him, your eyes running down from the tip of his neat blonde hair, to the strong side profile of his muscular body and jaw, to the big thighs stuck in those gray slacks, to the glossy sheen of his black shoes.
He was so fine and he knew it. He had to of, otherwise why would he tramp around in those suits of his, with his stupid hair gelled back, with his stupid blue eyes, and his stupid big hands, and his stupid broad chest, and his stupid pink gum. You narrowed your eyes at him, frustrated with the longing you had for him like it was his fault. Well it really was honesty, he was the one that looked like that.
Six could feel your stare burning into him, the buzzing silence between you two thick with… something. He could feel it thrumming under his skin, but he couldn’t quite put his finger on it. He looked out at the trees, then glanced at you, then back to the trees with an amused barely-there smile. He wondered what you were thinking about, if you were thinking about him, if you were thinking about him like he was thinking about you.
He put his hands in his pant pockets, wondering how long you were gonna keep up your little staring contest. He didn’t mind it; he enjoyed being gawked at by you actually. Made him feel like less of an asset and more of a person. Even then, you were a pretty girl. Who didn’t like being looked at by pretty girls?
You yourself wondered why Six hadn’t said anything to you yet. He must’ve caught your staring by now, you weren’t exactly subtle. Maybe he was purposefully ignoring you, making it a point to look at anything but you. Whatever the reason, you decided you wanted to hear him, hear his voice one last time before you had to go take a shower.
Honestly, you just needed to get out of the living room before you jumped him like a cat in heat.
“So, anything interesting outside?” You asked stupidly, just wanting to hear that deep voice of his instead of an actual answer; hear that sarcastic clip you knew he’d have with you. Something about the undertones of condescension in his words really made your skin tingle, especially when he looked directly at you when he said them. You tightened your thighs together as he turned his head towards you, the sun shining down on him from the window like he was an Angel descending down the clouds, being hand delivered to only you.
Six felt a chuckle tickle his throat as he turned his head at you, his eyes catching the way your legs closed up when he caught your eye. He licked his lips, quickly, sucking in a calming breath of air as he felt the tantalizing urge to just walk over to you and take you on that couch come over him like a dark cloud of sin.
“Uh, no. No there isn’t, actually. Just those little flowers over there… Tulips, huh? I didn’t take you for a tulip kinda girl.” Six pointed out to the flower patch over to the side of the yard, then put his hand back in his pocket and sauntered over to you with a divert little smile. You noticed it, and it made your skin purr.
You gazed up at him almost lustfully as he looked at you with those steely blue eyes, swirling with amusement and beguiled charm. You let out a soft chuckle at that, blatantly staring at his lips.
“Oh yeah? What kind of girl do you take me for then?” You teased almost too carelessly, cocking your head at him as your thighs pulsed with want straight to your throbbing pussy, thinking more with your salacious desires than your brain. You couldn’t help it. He was so pretty, so strong, so big. Your mind conjured up all the positions he could take you in, bent over this couch, over the coffee table, on the floor, on the window overlooking those damned tulips.
Six could see that you were out of it, your eyes dark with want and your thighs squeezed together so tight. You were just staring at him, entranced, stuck in your own little head. He was able to pick up on those things, you know. Especially after being with you for these past few months he’s come to learn how you operate, what your mannerisms were, what your expressions meant. He knew you inside and out, knew you better than you knew yourself. He knows when your sad, when your happy, when your angry… even when your horny.
He could feel that tantalizing pull within himself as he looked down at you, thinking how to answer your question without saying too much about what he really thought. What kind of girl do you take me for then? Oh he knew what kind of girl you were. What kind of girl he could make you be for him.
He just smiled, shaking his head to try and lighten the tension between you. I mean, god, he could practically feel the pheromones emanating from you.
“I’m gonna go check the perimeter. Don’t go anywhere until I’m back, alright? I shouldn’t be too long.” Six mumbled, taking his hands out of his pocket as he went to check the watch on his wrist. He had to get out of there, and he knew he shouldn’t leave you alone like this but it was an, thankfully, uneventful afternoon, and he figured he could spare a few minutes. He just had to leave, let you sort yourself out. No matter what he may feel, or what he might tell himself, at the end of the day he had a job to do, and no matter what he wanted he couldn’t cross that boundary. He knew that the moment he had a taste of you, the moment he felt your soft skin under his calloused hands, that the moment he gave in to his primal desires… god, just the thought… he’s really just digging up his own grave at this point.
You couldn’t help but feel dejected, slumping down in your seat and letting out a tense breath.
“Oh, okay. That’s fine. I’ll just… watch tv or something.” You rubbed your thighs nervously, suddenly embarrassed, feeling like you ruined the moment with something you did. Did you? Oh well, even if you didn’t, you still felt responsible for the sudden drop in intimacy as Six resumed his blank expression and walked out of the room, the imprint of two guns around his waist as he went.
You stared as he left, your skin hot and your stomach churning. That’s all you could do was watch. Watch him walk away, watch him bid you goodbye. It was a boring job you had. Staring, waiting. Waiting for him to do something. Waiting for yourself to gain the courage you needed.
You grabbed the remote next to you with a frown, staring at the tv with a pit of shame sitting heavy in your stomach, wishing you were watching something else instead.
Six walked out of the room with his cock semi-hard in his pants, his fists clenched in his pockets. It felt like he was trudging through mud the farther he walked away, but he knew it was for the best. It was just…
It was just getting harder and harder to deny you…
There was… yeah. There was something on the ceiling in the attic. Something big and moving.
Sonic couldn’t make out what it was. The attic was dark and there was a glare across the window pane. He twisted his head. Took a few steps to the side. The glare resolved somewhat as the tree in the front yard blocked out the light. His view was clearer, but whatever it was stayed in the shadows. It was way too big to be a raccoon or possum. And it was definitely crawling along the ceiling. He watched it pause and rock in place slightly before it scuttled forward and started to rock again.
“Sonic?” He tore his gaze away from The Thing to his Mom. “You gonna help carry groceries?”
A slow grin spread across Sonic’s face. “I see dead people!
Author: ME! (sendatsu)
Word Count: 11,405
Chapters: 1/1
Fic: https://archiveofourown.org/works/53803225 (only posting the link instead of the whole thing because it's so long!)
synopsis: a vision has multiple uses, it isn’t just a way to boost your fighting skills. so how do these vision-bearers use them with you, the one they love the most?
characters: kazuha, jean, itto, ningguang, ei, childe, yelan, diluc, kaeya, and ganyu
deets: gn! reader, some have established relationships while others don’t, some of them is up for you to decide
notes: me and my bestie were talking about this like months ago and i finally wrote them out! (hc format, but whatevs!) some of them are way shorter than others so, uh, damn 😭 not the most proud of kazuha tbh, i think the scenario i paired with him wasn’t a good match :p but also… teasing kazuha •/////•
i think one of my followers is a ganyu fan so i hope they enjoy her part! (。•̀ᴗ-)✧
kazuha
❀ a sudden strong breeze is a simple and effective way to get you to huddle closer to the man—and he takes advantage of this a lot
❀ kazuha tends to spend his time outside and likes to bring you along with him. a walk through a forest, sitting beneath a tree, tracing shapes in the sand on the beach, it doesn’t matter what the two of you are doing; he just likes to spend time with you
❀ while he is someone that speaks his mind he likes to have his fun, too. why ask you outright for some cuddles when he can be a little cheeky and change up the weather a bit >:3
❀ the two of you will be walking down a narrow dirt path when *gasp*! the wind starts to get too strong! oh, dear :( you two should stick close to each other just to be safe—here, grab his hand!
❀ once you notice the wind suddenly stopped you make a move to release his hand, to only have it kick back up again. well isn’t that such a coincidence?!
❀ even the colder days still play towards kazuha’s favor—it’s actually much better in his opinion. he just needs to do a little work and ta dah! you’re shivering! wait, no, don’t be happy—act concerned, kazu!!
❀ the reason why kazuha favors the cold days more than sunny ones is because he’s able to actually hold you. pretty boy is secretly so ecstatic about this!! sure, holding his hand is nice, but so is wrapping an arm around your shoulder and pulling you into his side 🥰
jean
❀ visions tend to be linked towards the bearer’s emotions and you learned this one day while accidentally startling jean awake. you weren’t the one who needed it, but that sudden burst of wind certainly woke you up
❀ there’s papers littered all over the desk and floor now, but the blonde’s attention is more focused on you, who has messy hair and clothes. oh, dear… please! let the acting grandmaster fix it for you!
❀ it may sound strange, but she gets slightly addicted to fixing you up. running her fingers through your hair, helping you adjust any clothes that got messed up from the surprise gust, she wants to keep doing it again and again so badly, but as direct as jean can get she’s rather shy when it comes to something like this so she resorts to using her vision
❀ she’s usually cooped up in her office so she tends to pretend to get startled by something, usually by you shaking her awake, as an excuse for the sudden wind
❀ outside, she doesn’t need to pretend as much. it’s outside, so obviously there’s bound to be a change in the weather, certainly not something caused by an anemo user, no
itto
❀ this one is gonna be structured differently because i think it’s better conveyed through bullet points 😓 but picture itto running up to you after meeting zhongli, who taught him a new trick
❀ itto: babe! check this out!!
❀ itto: *stomps on the floor* *summons a stone pillar right underneath you, tossing you into the air*
❀ don’t worry, he catches you :)
❀ if you’re cool with it, the two of you try to figure out just how high up the oni can send you
❀ the first time was more of an accident, but after learning that he gets to hold you after he catches you it’s now used as an excuse to do just that
❀ (bonus: he uses this new trick to vandalize the statue of the raiden shogun—y’all know what he’s gonna do >:))
ningguang
❀ the jade screen that she can summon works very well for soundproofing. standing behind one can muffle the noise on the other side so if you were completely surrounded? total silence. sometimes the stress of ningguang’s work can get to her and she just needs a moment of silence alone, but she doesn’t just use it for herself
❀ whenever you’re feeling awful or ningguang thinks you need to relax she’ll summon those screens right away, gently asking if everything’s ok
❀ the screens are rather thin to the point of having easy access to go through and to see on the other side, but with just a bit of tweaking and alterations, ningguang makes the walls surrounding you thick and non-clear to give you privacy
❀ if you wanted to be left alone she makes sure to make some sort of door before leaving so that you can get out once you’re feeling better. make sure to go find her when you’re out, she’s prepared you a nice cup of tea :)
(surprise!: y’all know those scenes/moments/tropes of running away from your crush to only wind up being cornered by them and pinned against a wall? yeah, my brain is becoming mush at the idea of zhongli summoning his pillar and doing that (//▽//))
ei
❀ thunder is a common fear among many; sometimes it’s the loud noise and rumble that make them tremble or the bright, sudden flashes from lightning that strikes fear. let’s say for one example you were part of this group
❀ you mention this to ei at one point and she remembers this detail for, like, ever. how could she not? she’s literally the archon of electro, but she doesn’t take offense to hearing this, she just remembers it easily because she wants to know everything about you
❀ one day you start to excuse yourself from your hangout, saying you should get home before it’s too late and ei, who remembered your fear of thunder, decided to do something just a little mischievous
*bam!*
❀ omg (first name)! are you ok?! just listen to that thunder :(( well you must stay with her and wait for the thunder to pass! and just in case it goes on all night, here; she’ll prepare a bed for you to spend the night in (aka, make more space on her bed and make it more comfy)
❀ of course, not everyone is scared of thunder, but no one is immune to the dangers of it. so if you were someone that wasn’t scared of it ei doesn’t mind, she can still use her ability and pass it off by saying that you should spend the night with her just to be safe
childe
❀ tfw you stole this from kokomi but don’t know jack shit about her so you gotta downgrade to him 🙃 /hj
❀ “the power of water is its ability to take any shape” - the hydro oceanid, i think. i’ve been avoiding her cause god i hate her fight
❀ anyways—getting back on track: with the wise words from the oceanid many hydro wielders use their ability to create something pleasing to look at. for some, they use it in battle, for others, it’s to entertain the crowd, for childe, it’s to give you a little smooch <3
❀ childe likes to make a little fishie to hover around you, swirling around your head before diving in to give you a peck on the face. cheek, nose, forehead, eye—doesn’t matter, if it can reach it, it’ll kiss there
❀ when the contact is made childe makes a little kissy face as if he were actually kissing you (´ε` )♡
❀ if he’s feeling a little cheeky, the harbinger makes the fish splash onto your face, spreading water all over it rather than leaving behind a wet spot. don’t worry! he’ll help clean it off!! as long you give him a kiss in return, that is (。•̀ᴗ-)✧
yelan
❀ do you guys remember that one episode in spongebob where he and patrick would whisper something into a bubble so that when it would pop it’d repeat what was said into it? yeah, yelan does that :)
❀ it happens not too often, but it’s always a pleasure because the woman always has something sweet to say about you. there are some days where you’re chased after the bubbles, hearing whispers from her one after another. there’s just so much she has to tell you! how beautiful your outfit is, how amazing your hair looks today, how pretty your smile is—she can go on and on!
❀ when she can’t settle on what to say first she’ll roll a dice to figure out and say whatever the number lands on
❀ extra: it’s a great way to warn you about something without alerting anyone—if someone was following you yelan would whisper this into the bubble and give instructions on how to get away before dealing with the person herself
diluc
❀ i think it’s a universal agreement that having a pyro vision means you’re naturally warm and diluc’s fucking hot so it’s always a pleasure to stand near him
❀ and isn’t it such a coincidence that wherever you went with him it was always a little chilly?
❀ no, seriously! even beneath the warm sun in the city of mondstadt there’s still a nip in the air that makes you huddle close to the man. and that breeze blowing by was certainly not helping (¬ ¬ ) (haha, what? noooo, it was definitely not venti changing the airflow because diluc offered free drinks if he did it. haha, what are you saying?)
❀ as lovely as it is to spend time with you during the daytime diluc has a bit of a preference for the nighttime (mainly because he doesn’t need to ask a certain bard for help and deal with his teasings the next day) but just like with the vision, the night has multiple perks
❀ for example: enemies are more prone to coming out and attacking any unsuspecting people walking home so diluc can protect you! oh, and, uh make sure to stick by him just to be safe… please? 👉👈
❀ it’s also naturally cold at night so diluc doesn’t have to rely on any tricks to hold you close while walking you home. maybe one day he’ll stop being so shy and be able to ask you outright to hold you
(surprise!: albedo may not be a pyro user, but klee is! i love the idea of klee knowing her brother’s crush on you and trying to play matchmaker soooo… hear me out: klee blowing things up while right next to you so that her brother comes running and starts a conversation with you since you’re right there. hehe, now isn’t she so smart?! wait, shit, that’s jean coming—uh oh! run, klee!!)
kaeya
❀ like his brother, he manipulates the temperature as a way to get you closer without having to ask. unlike his brother, he doesn’t have to ask others to help, he can just do it himself with his cryo vision
❀ the air starts to become cold and gets colder the longer you stay away from the knight so you should hurry over to him before the town freezes over!
❀ this mf teases you for wanting to huddle up next to him as if he had nothing to do with it 🙄
❀ absolutely, 100% does this in bed, but why should you complain? you get to cover up with as many blankets as you want and be held by your boyfriend, who doesn’t want that?!
(surprise!: ayaka does the same thing, but she doesn’t use her vision to tease you like kaeya does. she’s a little more on the shy side and struggles a bit to say that she wants to cuddle with you and finds it easier to just make the air a little chilly before asking if you needed help to warm up. her face is still red regardless of creating an excuse ( ´ ▽ ` ).。o♡)
ganyu
❀ i like to think that ganyu is a little talented when trying to calm other people down. she may not be the best with herself, but she knows just what to say or do to make others relax. for you, she creates little ice figurines :)
❀ your personal favorite (and hers) is when she creates a little snow globe that holds some sort or ice figure inside. it takes her some practice to be able to master it, but for you, she’s willing to learn anything
❀ it would start off as something small—like a simple flower or a snowflake that twirls around inside the icy walls—then she gradually works her way up to create something bigger and better—something more suited for someone as wonderful as you
❀ spoiler: it’s gonna be an ice sculpture of you and her together heheh
❀ she won’t tell you, but with whatever free time she has available she uses it to learn how to make something new
❀ even if you weren’t in need of some cheering up, ganyu still shows off what she can do. she just likes seeing your smile
Question the person that was driving MileApo after the event was done …..was it mile’s mom ? And if so… was Apo with them at dinner 🤔….bc ppl were saying they heard Apo laughing in the background of his moms ig post ………
It’s a question I wasn’t quite sure if I was following what the ppl were saying on TW 😅😅😅
me, staring at the ceiling muttering myself about how I'm going to do this. i am a clown and i am going to clown town in my clown car
OK so. Yesterday, Mile and Apo left the Srichand event together.
Neither of them were driving and the driver of the video is unknown. But P'Gift and Mile's mom have very similar haircuts, and were speculating between P'Gift and Mama Nathanee.
Mile later went out to dinner with his family to celebrate his mother's birthday. I can only post one video per post, so I'll gif this one, but Mile posted an IG story of him feeding his mom a fry and there was no sound. The link has the full 13 second video posted by Bee.
Today, Mama Romsaithong posted this video with audio to her TikTok. At around 10 seconds into the video, Mile makes a bad joke and then looks across the table and you can hear someone who laughs a lot like Apo's dolphin laugh
Here's the joke:
💚what are u eating krub?
🍒i'm eating cow's cheek
💚do u wanna eat Chuang's cheek?
🍒I don't eat Chuang's cheek because i like to eat firm cheek, don't like to eat saggy one (looks across the table and you can hear giggling)
💚you~let's see your cheek, come on~ let me see it
🍒i'm joking (2x)
💚 so bold of u~
🍒today i'm eating Italian food
💚Italian food?
🍒that's right kub~
💚then how does it taste like?
🍒it's delicious
💚delicious,, if it's delicious,,how do u do it?
🍒it's delicious *with a pose
💚okay~~
(translated by strawberry milk)
Mile's face... 🙃
Then around 0:17, people (*ahem* NOT ME BECAUSE I AM NOT PUBLICLY CLAIMING ANYTHING) say they can hear Apo talking. It's his little ducky voice, around when the camera is zooming into the dish and it's under Mama Rom's voice.
A fan was also at the restaurant and managed this beautiful shot of the decor that ~happened~ 😗😗😗 to have Mile in it and Mile's guest discretely hidden behind the impressive lemon tree* (@moerusai mentioned those are too big to be lemons, they might be pomelos WHATEVER ARE WE REALLY GOING TO ARGUE ABOUT THIS)
Which of course prompted The Jokes. You can see Papa Romsaithong to what would be Mama's left and either P'Man or some people say another cousin who also attended the Srichand event to support Mile.
Mile's dinner partner, sitting across from him in the white shirt, is hidden.
I'm-- I'm just gonna say this: the Thai fans protect them, individually and together, a lot. Don't think they're stupid. Whoever took the photo intentionally positioned the camera so their guest was hidden.
I'm not implying anything, I'm just letting you know for a fact they know a lot more than they share with international fans who can be very cruel and drama-mongering for no reason, and talk in spaces international fans can't get to easily (their own closed FB groups, Line/chat groups, etc. etc.)
As always, just collecting what people are saying about the photos, videos, etc. Make your own judgment about these things.
thanks to @lorddio and @moerusai for helping me collect 🙃 evidence. If we're going to call it that.
Summary: When you are unable to visit Gio for Christmas, you decide to spend it together in an unconventional way.
Warnings: lots of fluff
WC: 1.4K
A/N: 🎶 On the first day of Ficmas my writer gave to me, some fluff with Giovanni 🎶 Hi everyone and welcome to Ficmas! I thought I'd start it off with someone I've written for before, Gio Reyna! This fic is inspired by "Minecraft Christmas" by Area 11 ft Simon. This song is fire no I will not apologize for using it lol. I hope you guys like it, and I hope you stick around for the rest of Ficmas!
Link for the Song: Minecraft Christmas
"Cause it's a Minecraft Christmas time
Chilling with my buddies everyone is online
There's a whole world of joy and cheer
That's a very very very nice Christmas you're having-
A very, very, very nice Christmas (Woo-ooh)
A very, very, very nice Christmas we're having this year."
~~~
"No baby, get away! Don't look it's not time!" your boyfriend said, punching the air around you in an attempt to get you away from his house.
"But Gio, I'm impatient!" you whined. "I wanna see it now!"
"Babe, it's a Christmas surprise. You have 10 minutes left. All you gotta do is wait 10 minutes!" he said, punching holes in the ground right below you.
"Okay, okay! Stop trying to hit me I got diamonds on me, my guy!" you grumbled, turning back to your house as Gio punched the air triumphantly.
Christmas had been your favorite time of year since you were a kid. Something about the atmosphere just brought life and joy into your life. And Christmas with your boyfriend was even more magical than you could've dreamed of. Your families grew up in neighboring towns coincidentally, so once the two of you began dating, you always spent it together. And if Gio wasn't able to go home, you'd travel to him instead, celebrating the holidays in whatever city he was playing in at the time. You'd decorate his home with stockings, Christmas lights, and of course, a tree with whatever quirky ornaments you'd collected over the years. When it snowed enough, you'd have snowman building competitions followed by snowball fights of epic proportions. Gio was the perfect addition to a holiday you already treasured, making it all the more special to you.
Unfortunately, this year you weren't able to spend Christmas together. You tried your hardest to align his schedule with yours, but your job was horrendously understaffed and couldn't afford to have you off for the last few weeks of the year. It was aggravating considering how much extra work you'd been putting in specifically for the holiday off, but your manager just wouldn't budge. However, Gio was more than understanding, especially considering how much you traveled to be able to see him.
So instead of allowing this to dampen your Christmas spirit, the two of you were playing on a Minecraft server together. It was a pastime the two of you often indulged in as a way to combat the time zones and do fun things together. With a controller in your hand, headphones over your ears, and his face appearing on videochat on your PC, it was an unconventional yet fun way for you to spend Christmas together.
"If you blow up my house again, I'm gonna kill you," you grumbled, spinning in circles to kill the time.
"I wouldn't do that for Christmas. Maybe New Year's. You know, for fireworks or something," He retorted, making your jaw drop.
"That's so rude!" you said offended.
He shrugged his shoulders. "You call it rude, I call it festive."
You pinched the bridge of your nose. "What am I gonna do with him?" you muttered to yourself.
"Hey, your life would be much more boring without me in it," he said nonchalantly.
You rolled your eyes, but you knew he was right. It had been a few years since you'd caught Gio's eye at a US friendly. He found you so breathtaking he literally fell for you, accidentally tripping over his own feet in front of the whole stadium. Despite the embarrassment he felt, it was worth the moment Gio saw the bright smile on your face. He was the cause of it, and he wanted to be the cause of it for the rest of your lives. He tossed you his jersey at the end of the game, along with his number, and the rest was history.
"Please," you scoffed, "you're the one who fell for me, not the other way around."
"We said we wouldnt bring it up anymore!" he whined, making you giggle. "It's Christmas, baby, you can't be doing this to me!"
"Technically, we have 2 minutes until Christmas," you smirked, making him pout on your screen.
"I spent all this time on your surprise and this is the thanks I get."
"And I'm the dramatic one he says," you rolled your eyes.
"Oh baby, you can come back now! We have one minute left!" Gio said excitedly.
You traveled the short distance, passing through the rainy area of the island you lived on and entering the snowy one of your boyfriend's. It was fitting considering it was Christmas Eve.
"How come your side gets snow and mine gets rain?" you asked him, making your way to his house. "That's so unfair."
"You're the one who decided to build aaaall the way over there, dude," you shrugged. "I told you to build right next to me but noooooo, you 'needed space.' Why do you need space?"
"Because you'd probably create a huge ass system to blow up my house every day, Giovanni," you said flatly, arriving in front of him. "I know you too well."
"Okay, I need you to start that Christmas playlist now." You rolled your eyes but complied, the music playing through the speakers for the both of you to hear. "Are you ready for this?"
"Give me all you got," you answered.
Gio checked the clock, beginning his countdown. "Three, two, one, Merry Christmas! Welcome to my humble abode!" He said proudly, opening the door to his home.
To say you were stunned was an understatement. Gio had really gone all out despite it only being a video game. His entire house was decorated as best it could with Christmas decorations: stockings on his little fireplace, Christmas light arrangements, dinner set on the table. He even went out of his way to make a Christmas tree. Just the way that he knew you loved to decorate your house.
"Wh-what is this?" you asked in shock, a smile forming on your face.
"It's a Minecraft Christmas!" he exclaimed, loving how happy you looked.
"When did you find all the time to do all of this?" you asked again, spinning around to really take in his work.
"I made time," he smiled. "I figured that if we can't spend Christmas together in person, at least we can do it in our house here. It's not the same, but the spirit is here all the same!"
You stared at him through the screen of your computer, touched that he went through the effort of doing all of this just to simulate Christmas together.
"Oh, I even got you a present! Open the chest!" he said excitedly.
You opened the chest to see a full set of armor, weapons, and he even went as far as making plenty of potions for your monster hunting and mining adventures, something the two of you frequented quite often.
"And I did it all myself. No creative mode necessary," he bragged.
"No way! This chest is full, G. This must've taken you weeks to get all the supplies!" you said in disbelief.
You could see him shaking his head. "Yep. I grinded for weeks to get all this stuff. But I don't care about that. I only get the best for my girl. It doesn't matter whether it's a present in Minecraft or the present I sent to your house. You deserve it all, baby."
Your eyes widened as you understood what he just said. "You sent a present to my house?! I thought you said you wanted to give me my present in person once I went to Germany again!"
Even through your phone screen, you could see Gio's eyes twinkling with excitement, just like a little kid opening his presents.
"Oh, you're still getting that present when you come back. But I saw this one and I knew I had to send it to you. It was meant to be here by tonight, but you know how shipping can be sometimes," he explained. "Either way, I'm glad I had this ready for you. I know how much you love seeing the house decorated. I even have snow blocks to build snowmen together in case it didn't end up snowing so we can still have our snowman friends!"
Christmas was indeed your favorite season. And having Gio was truly the best present that you could possibly ask for. He went above and beyond for you despite it only being in a video game, and it just showed how lucky you were to have him.
"Thank you for all of this. I love you, G," you said sweetly, smiling brightly at him.
"I love you too, Y/N. Merry Christmas," he replied, returning your smile. "Now let's eat this cake. I gotta regenerate my health before we fight off these creepers tonight!"
"What have we said about explosions on Christmas?!"