#not yours :) lucky you

[dateamonster]

"top ten movies about Girlhood" whose girlhood? whose girlhood? what kind of girl are these movies about? answer quickly.

[mythicalcoolkid]

You don't wish your disability was worse or more visible, you wish your disability was taken seriously. Please stop confusing the two, I guarantee you would not get the support you need JUST by being more severe or more visible. Please listen to visibly disabled people when we tell you it isn't better on our side

[mobius-m-mobius]

#there are two types of actors 😂💖

[uncanny-tranny]

The leftism/anticapitalism leaving people's bodies the zeptosecond you imply that disabled people who aren't "productive" still matter in society and need to be treated like intrinsic equals who have a place in this world:

[biggest-gaudiest-patronuses]

i am thinking how much poorer, how much less colorful the world would be if art was only made by "professionals." if all the music, all the stories, all the sketches & paintings & craftwork of the world was created only by the small category of people able to make a decent living from their art. imagine if the only people allowed to create were the experts & the renowned & those aspiring to the top. what a grey world that would be. how much joy would be bleached away! i love you people who create for the sake of creating, i love you artists who do art for tiny audiences, i love you people who make things even just for one person, even just for themselves, even if no one's watching, thank you thank you thank you for decorating the world in which we all exist

[skateboardtotheheart]

there is just something about the difference between edwin's love interests and having the cat king's reaction to edwin in hell being "i'll be waiting when he gets back" vs charles "no version of this where i don't come get you" rowland convincing a powerful trans-dimensional being to open a door to hell just so he could get him back

i am insane

[petricorah]

scenes i loved from Real Enough to Get Me Through by @marriedzukka <333 [ids in alt]

[bixels]

Why the hell, shit, you damned bastard son of a bitch

[thehappyvet]

Where do people get this misconception that every single wildlife case at a vet clinic is euthanased so it's better to not take them in even if they're obviously hurt or sick and in need of treatment?!?!

Friendly reminder that a member of the public should not be able to easily pick up or catch a wild animal. We are not in a disney movie. If you can pick it up*, 80% of the time its extremely hurt or sick.

Wildlife, and most animals for that matter, do not show pain as humans do. That does not mean they are not in pain and suffering.

Veterinarians only euthanase wild animals that are suffering from extreme injury or illness, or animals that would stress themselves to death in a hospital setting that cannot be released and survive in the wild with their issue.

We do euthanase some animals, but that's because it's the best welfare decision for that animal and its specific problem.

Maybe trust the professionals trained in providing treatment to animals instead of some Karen on Facebook who demonises vets because she can't understand a bird with multiple wing and shoulder fractures is very unlikely to regain flight and return to the wild and her plan of keeping it means it will live a life of chronic pain and suffering.

*Disclaimer: If you live in a country where diseases such as rabies are endemic, you should not handle wildlife at all if you are not trained or vaccinated. This post is not recommending members of the public handle wildlife in any country.

[despazito]

First day of act normal lessons

[kimtaegis]

FRI(END)S for @thv-hyung ♡

[sharkylad]

Thinking about the fact that Mabel and Dipper didn't know they had two great uncles.

Yeah they are 12 and at 12 I had a shotty understanding of my family tree- But really? Nobody brought up their great uncle? Stanley? Especially since they'll be staying with his twin brother, Stanford?

Shermie never went to Stan's fake funeral, which to me means the twos relationship was strained on some level. If Shermie is older that means his view of Stan was poisoned in some way, that even as kids they weren't close. If the Shermie is younger then he never even got to meet Stan and all he knew about him was how he failed his family. Hell, people probably barely mentioned Stanley TO Shermie.

The fact that Stan had become a black stain upon the Pines family name makes me so vividly upset. Stanley faked his death and the family just- seemingly decided to strike him from the record. To pretend he didn't existed to spare themselves the sadness and shame.

Stanford and Shermie Pines. The only children worth mentioning of Filbrick and Caryn Pines.

It was never Stanford that was lost to the world. It was Stanley, ever since he had to leave New Jersy- it was always him that had to be struck from the record. Change his name, change his state, change his affiliations, destroy the remains of ghost that was Stanley Pines. Kill him so the family doesn't bring him up, doesn't ask questions, stops asking "Stanford" about his twin.

I just keep thinking about the fact that since the day he made one single mistake all the way up until Ford walks out of that machine- Stanley Pines was killed and did not exist. And Stan himself had no one to blame, he had to play the part in his own demise- He is the only one who ever knew Stanley was alive and has been for decades.

He lives in the multitudes of every personality he's ever taken, all in the hope that he himself can stop being Stanley Pines.

[yrsonpurpose]

"They [Casey] were commenting on all the little idiosyncratic things that Alex does, his little "isms". I had never heard anyone talk about it and I was so grateful that they had said something, because I did re-read the book and try so hard to find those little specific things that Alex would do." — Taylor Zakhar Perez

[poorly-drawn-mdzs]

Happy Year of the Dragon!

[hellsitegenetics]

hello!

i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).

i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.

my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.

bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.

okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt

Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)

[ckducky]

Fallen Angel Carmilla Carmine