Tumgik
#otherwise i am here 8>
feldsparite · 2 months
Text
Tumblr media
forgor how to draw him but that's not important. what's important is that pokemon go fest is mean and evil
13 notes · View notes
Note
Tarantulas (Earthspark) for the character ask game
one aspect about them i love
His eloquence ✨
one aspect i wish more people understood about them
He is not IDW or BW Tarantulas and may never be. Comparing him to his IDW and BW counterparts may turn out to be like comparing Cyberverse Soundwave to every other Soundwave. Right now, they’re just too different. And I like it that way.
one (or more) headcanon(s) i have about this character
I’m laughing as I write this, but I really think Tara would have a Tumblr. It’s one of several ways he learns about humans, which has hilarious and potentially disastrous implications. xD
Tara uses the rubber ducky debugging method. A lot. He has a whole collection of little animal statues from god-knows-where, and he talks to them when he needs to work out an issue in his work. They’re an excellent audience.
one character i love seeing them interact with
Nightshade. No explanation needed.
one character i wish they would interact with/ interact with more
Besides Nightshade, it’s too soon to say for sure. I can’t think of any other character either of a similar caliber or who has complimentary traits. Tara would be bored with all of them.
one (or more) headcanon(s) i have that involve them and one other character
Before I share, here’s a song to go with it: Between the Lines by Felix Räuber (Spotify | YouTube) - For the full effect, I highly recommend listening as you read. Then after you finish reading, listen to the rest of the song and let it take you wherever it dares.
Okay, so this isn’t related to him and any character in particular, but I’m putting it here anyway for the irony factor. He speaks to very few, yet attempts to speak to many:
Tarantulas is a poet of sorts. For personal writings, he prefers the “primitive” method of writing things by hand as opposed to typing things into a datapad.
He takes something akin to a laser-engraving pen and writes his words on buildings that catch his eye, landmarks he likes, or other interesting places, not caring about so-called “property damage.”
He leaves his engraved notes and poems alongside a custom seal he came up with—sometimes left in places that can be seen, but often in places that are out of the way. In addition, all of his writings are in his native Cybertronian dialect, which is long-forgotten by most…
The humans and Cybertronians who come across his writings are intrigued by the mystery of the lone, wandering poet, but no one is able to translate more than a few words.
It’s like the very existence of the strange engravings communicates an internal conflict with loneliness—a silent cry to be seen, but also a desire to remain hidden.
Inspired by one of my favorite quotes:
"Artists are people driven by the tension between the desire to communicate and the desire to hide." (Donald Winnicott)
25 notes · View notes
radlegowaffle · 5 months
Text
Tumblr media
love bluh bluh bluh
3 notes · View notes
magnifiico · 9 months
Note
❝ What's your wish? ❞
It's such a simple question, and yet, Leon is stunned he took so long to think of it. He's overwhelmed, he supposes; there's so many new sights and sounds and experiences to take in here, and there's only so much his multitasking can manage at once.
❝ I've heard it said that you grant the kingdom's - and that's admirable, truly! I'm sure Rosas is very grateful for your generosity. But have you granted your own? ❞
@danderosa || welcomes this lovely boy into our arms ;v;
“Oh my. That might be a new record, actually.”
For as stunned as the prince may be toward his own delayed inquiry, King Magnifico has half a mind to begin timing this sort of thing: just how long it takes someone in his company to broach that burning question. And certainly—yes!—it's admittedly a valid curiosity, far from a point of interest to be at all peeved about (honestly, he's impressed by those who choose not to ask), but the expectation breeds an almost... bitter amusement.
Something, however, the king is well-practiced to not show. As he turns then to face his guest, his smile is benign. His posture remains relaxed. Patience swaths every inch of his demeanor, and he breathes out a fluttery laugh before saying more.
Tumblr media
“The, ah... Well.” He hesitates, contemplating the most efficient method of explaining. “Perfecting the magic of wish-granting was a long and arduous process. By the time I had mastered it, any wish of mine was beside the point. That is to say...” A shrug rolls through his shoulders. “I wanted nothing more than to provide hope for my people; that has been my guiding principle and desire for as long as I can remember, and while Rosas prospers... I suppose—for the sake of this line of inquiry—that'd make the wish 'granted,' in its own way.”
2 notes · View notes
mielgf · 1 year
Text
guys how do i come out to my two christian roommates as an atheist please help
7 notes · View notes
d0d0-b0i · 1 year
Text
i am an nnd shipper not out of desire but out of /necessity/. if i think about them too much my brain starts overheating in agony over whether the writers knew what they were doing or not
7 notes · View notes
gottagobuycheese · 2 years
Text
genuinely truly wholeheartedly cannot fathom people who go running before work. what do you mean you don’t get out of bed 10-15 minutes before you need to be fully dressed, breakfasted, equipped, and out the door? why would you voluntarily wake up SEVERAL hours early and go get sweaty in the dark and cold and then have a shower in the MORNING only to go to work all day?? incomprehensible.
#context: my housemate and I went for a run/walk this evening and we remarked on how nice it was and how we should do it more often#but realistically the only way we'd be able to do it during the weekdays is before work#which like. lmao.#I'm sorry but your insomnia and my insomnia do not line up enough for this#the only person who comes to mind that I actually know does this is my high school ap chem teacher#but she also got her phd at 25 so she doesn't count#I do like running in the mornings the few times I've done it!#but the only way we'd be able to get it done before work here is well before sunrise#which I am intrinsically opposed to#and also if I have work right after I can't just come back home and go back to sleep or slouch on the couch for 3 hours straight#I was going to say something but there was this HUGE gust of wind and rain and other noises lashing my window and I forgot what it was#anyways in summary I still don't want to go to work tomorrow#and I'm rrrreeeaaaaallllyyyy hoping that the ‘don't want to be here’ energy of Friday carries over to today#phenomenal job on Friday 6 out of 8 of my co-worker's people didn't show up#I yearn for that sort of attendance#please. please give me nothing to do. let me catch up on my other stuff. you do not need to come in for this. this can be an email.#(to be fair I would also hate it if it were an email sdkjfhskfjh)#(...yeah actually maybe don't make it an email)#(but please please PLEASE no more backstories tragic or otherwise)#(please let it just be simple and straightforward enough to finish all my notes as they come)#(I still have to do Friday's because I slept like all of Saturday and half of today)#ah shoot and I still need to study...#you know what. I'm gonna have to say it: I miss December#Cheese's personal molasses#Cheese evaporates about...job??#okay I should go to sleep now and stop fantasizing about a tree missing everything but landing exactly across our driveway#rendering it impossible for us to go to work#OKAY STOP WHINING#IF WE MAKE IT THROUGH TOMORROW I'LL LET YOU DO SOMETHING ART RELATED A N D EAT SOME COOKIE DOUGH HOW'S THAT
8 notes · View notes
mrfoox · 2 years
Text
Uh, I got asked to 'rank' my life/how I feel about it and I... Am suprised I gave it an 7/10 without much thought. I'm one who usually rank anything like that 4/10 at best
2 notes · View notes
skrunksthatwunk · 1 year
Text
why'd they give the IT help desk guy at [university] the same mics they use at drive thrus 💀💀💀
1 note · View note
none-asked · 2 years
Text
Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media Tumblr media
The cats are named Luna, Harry, and Roman. They are all special and stupid and I love them.
4 notes · View notes
galacticlamps · 4 months
Text
no idea why but for some reason i feel like the next episode of dr who's gonna be one i'll especially want to be caught up for? again no clue why i feel that way since i'm currently behind - it's not even like i've seen the teaser for it yet or anything - but fwiw the last time i had that feeling was before fugitive of the judoon, and love or hate that episode i'd say i was right about needing to experience it in real time. i've never been one to care about spoilers much but i do very clearly remember making a point of staying off dr who related internet spaces until i got home from work the day that one dropped (and having any feelings that remind me of pre-pandemic 2020 is already a trip in itself wow) & i kinda think im about to wind up doing the same this weekend (since i already know im not gonna be able to watch it right away)
#i will however try to catch up now so im at the right point to watch it soon as i do get a chance (& thus return here)#oh & i should state for the record i am not one of the people who thinks jonathan groff is gonna be playing jack somehow#(i realize that could sound like the implication given the otherwise very random comparison i just made. trust me i meant it to be random)#to be honest i would love to see his character be something like the one jamie parker voiced in plight of the pimpernel#(i mean if it has to be like anything we've seen before that is. which of course it doesnt)#again i have zero reasoning for this#i mean aside from simply having enjoyed that audio#but who knows perhaps once i catch up to where rogue actually falls in the season i'll have taken that back#it was a rather dark twist i could easily see it not being appropriate to drop in the middle of just any old season#depending on what the vibes of the surrounding episodes are i mean#i get the sense the most recent one was about racism no?#so for all i know maybe now is actually the time for a lighter one#still cant believe how far into this season we are#then again i cant get used to these short seasons anyway & i dont intend to either#8 episodes is honestly disgraceful it does NOT get credit just for being longer than flux#at least that had an excuse#anyway on the off chance anyone's been wondering - this is why i've not been posting much about current who lately#i've been too busy to keep up but hopefully that changes this week#the david tennant specials i also watched far after the fact & never bothered to formally comment on them#i think i may have thoughts on the first & last ones typed up in my drafts somewhere but im p sure we're done discoursing about those#so i was planning on just letting it go for now anyway#we'll see
1 note · View note
aw-bean-s · 11 months
Text
National just won the nz election and will most likely be forming a coalition with ACT. This country is fucked.
0 notes
deadsetobsessions · 6 months
Text
Sea Cryptic! Danny AU- Pt. 5
[Pt.1] [Pt.2] [Pt.3] [Pt.4] [Pt.6] [Pt.7] [Pt.8] [Pt.9] [Pt.10]
“So you’re that dead kid everyone’s talking about.”
Danny smacked a trash bag into the purple clad vigilante. “You can pick up the glass.”
“Wait, I’m just here to-”
“Bother me when I’m working? At least the litterer brings me cash. You can help clean or you can leave. Plastics go over there.”
Danny pointed at a pile of plastics, ignoring Spoiler’s bemused look. Hard to tell, really, considering her mask.
“I’ll help clean if you answer some questions!” Spoiler chirped, already moving to pick out the glass in the general trash pile Danny’s managed to gather. He nodded.
“Alright. At least you’re helping. The other one just bothers me and leaves his stuff on the beach.”
Spoiler snorted. “I’m Spoiler. Is the litterer Batman?”
“Sure. I don’t really care what his name is,” which was a complete lie, Danny was a fan. It’s just that messing with Batman (especially after he couldn’t clean up after himself, honestly!) overrode his fan behavior. “But if I catch him leaving shit in the waters again…”
Danny frowned, eyes glowing. He could feel- even with his partial tangibility, the muck of Gotham's waters seeping into his boots. It was not giving 'Live, Laugh, Love' to Danny, and he needed it gone.
“Whatever. They dropped a lot of guns down here. You can deal with those too, yeah?”
“I'm pretty sure that's evidence?!”
“If you could call it that.” Danny plucked away the Styrofoam and the hazardous (more than regular, anyways) materials away from the trash pile so Spoiler could dig through with her gloves without contracting sixteen different sorts of illnesses.
“So, what brings you to Gotham?”
Danny pointed at the water. “Came for school. Stayed because you losers polluted the water with dead bodies and gross chemicals.”
“You go to school?”
“Hey, that’s discriminatory.”
“Oops! No, sorry! I meant-”
Danny waved her off, irritably separating a bottle cap from the crushed bottle. Seriously, what’s the point of putting the cap back on if you were going to throw it in the bay anyways?
“It’s fine. How else am I supposed to learn about the advancements made in the scientific industry otherwise?”
Even if Danny wasn’t too sure that science could sure stupidity, but a halfa could dream, right?
"So... do you just... listen in on lectures?"
Danny stared at her. "What else would I do in a class??"
"Oh. I just thought since you're dead and all, you'd do something more... fun?"
"I mean, I could terrorize the local villains for kicks, if that's what you meant."
Spoiler brightened. "Actually, yeah! That would be helpful! If Mr. Freeze keeps bringing the cold during my latte Thursdays, I'm gonna snap and wring his cold little chicken neck."
Danny snorted. "Alright. I will keep an eye out for this Mr. Freeze." Danny paused. "Hey, tell your friend to come down and help us."
"What- oh. Black Bat!" Stephanie waved her partner down. Black Bat gracefully slipped down towards the bay, casually knocking out two goons gunning for Spoiler.
'Careful,' Black Bat signed.
"Thanks!" Spoiler bounced on the heels of her feet. She swept an arm out. "Wanna help?"
Black Bat tilted her head and, after placing Danny under quick but thorough scrutiny, nodded.
'You can get the salvageable stuff. Anything you can't lift, leave to me.' Danny signed clumsily, placing emphasis on can't.
"You know sign language?"
"I'm not too good at it, I just learned this version."
He knew ghost-sign first, after all.
"Chop, chop. I don't have all night."
----
Danny learned that Black Bat had the skill to knock cans into their designated piles if he threw them in the air so she could kick at them.
"You two can come back anytime."
Spoiler whooped while Black Bat leaned back, smug.
"Wait, tell the litterer he owes me $200. He was short last time."
"...Are you telling me Batman owes you money?"
"Yeah. He might be in financial straights, so I gave him some lee-way."
Black Bat and Spoiler looked at each other.
----
"Hey, so guess what I learned about sea boy!"
Bruce's head swiveled to her with startling intensity. The rest of the clan tuned in.
"He knows sign language! Maybe he even knows ancient sign language! And goes to school, but since he's like, dead, he could only listen to the lectures."
"Bruce, Bruce, do not start a ghost-education plan. Stop. We don't even know if he even-" Dick tackled Bruce, who was already writing a petition as Bruce Wayne to give partial credit to students that diligently goes to class.
"Oh, yeah!" Stephanie shouted over the unraveling chaos. "He promised to fuck with our Rogues for a bit so we can get a break! And we also got a bunch of guns!"
"Where? Gimme!" Jason demanded.
"Do not give Todd more firearms!" Damian cut in.
"Also!" Stephanie grinned as Cass shook with laughter. "Batman's a debtor! He owes Phantom $200!"
"Ain't no fucking way." Tim cackled. "Hear that Bruce? That's karma! For not defending me when he called me broke!"
3K notes · View notes
luvt0kki · 6 months
Text
training wheels | k.h.j
Tumblr media Tumblr media Tumblr media Tumblr media
pairing : Professor!Hongjoong x innocent!reader ft!Wooyoung
♡₊˚( wrote this listening to ‘training wheels’ by Melanie Martinez)
summary: Too innocent for your own good, your professor's little hidden crush only grows the more he could spend time with you. You were so pure before his eyes. A sweet young woman who deserves the sweetest kind of love but still had trouble in paradise with her boyfriend…but he’ll be there for you. After all, he only wants what’s best for you and to protect you.
wc: 10.7k
cw: University AU, smut, coquette-ish fem!innocent reader, virgin reader, slightly older Hongjoong, manipulation, obsessive stalker-ish behavior, yandere behavior, corruption kink, cheating , frat boy behavior from Maknae line, oral!male receiving, there'll be more spice in the next part
REMINDER : my works do not represent the irl members in any way, this is purely a work of FICTION.
a/n: hello so it’s been awhile and this has been cooling in my drafts for so long. Special thanks to @songmingisthighs for helping me whenever I’m stuck with writing and for being one of my favourite persons on this app 😭i wanted to write something that isn’t apart of the Sway With Me universe just for a change and a breather ( I hope you guys don’t mind that). I just wanted to write.
- this is will be a two part series!
READ CONTENT WARNING BEFORE READING!
DO NOT REPOST, TRANSLATE, PLAGIARISE, OR OTHERWISE REPURPOSE ANY OF MY WORK HERE. I DO NOT NOR WILL ALLOW IT.
Tumblr media
Note: Hongjoong is a couple years older but he’s still young for a professor. Maknae Line is in their last year of Uni and is part of the University’s Varsity baseball team.Y /N is innocent ( smh). Kinda coquettish vibes but yuh, sweet girl.
The rain storming outside made anxiety bubble in your chest as you clutched your laptop bag and books tight. You glanced at your phone, the bright red bar of the little battery icon glaring at you. That just made your situation even worse and it didn’t help that the last message you saw was the reason you were stranded here in the first place.
“I’m so sorry sweetheart. The team meeting is going overtime tonight. Get home safe. Please message me when you’re home.”
You waited for him. You should be angry at him but instead, you were only heartbroken and sad that he didn’t keep his word. You were frustrated that you couldn’t even hate him the slightest bit for forgetting to pick you up and the sudden downpour was just the cherry on top.
“Ms. L/N, is that you?”
That voice. That familiar tone that you heard every Monday and Wednesday from 8 am til 10 am. The voice that made your Art Appreciation lecture so interesting that you’re excited to come early every morning to learn sounded from behind you.
You turned around and quickly bowed your head in his direction out of respect.
“Mr.Kim.”
The young professor frowned at your presence.
“It is you. What are you still doing here?” He asked, extending his arm a bit to glance at his silver watch. “It’s almost 11 pm.”
“I-It started raining…” was all you could say. You couldn’t nor want to admit to your university professor the real reason why you were stranded on campus.
“Indeed…,” he gently grasped your arm and pulled you into the covered shade of the hall. “Do you need a ride home, Ms. L/N? I was just about to leave and go home but I can drop you off at the nearest bus stop or if you’d like, your home.”
His offer made your heart melt. Mr. Kim Hongjoong has always been so kind and sweet to his students. He has always shown such care and patience to their studies and well-being, and as the many girls in your classroom would whisper amongst each other, he was also very handsome. Which was a fact everyone in the whole campus knew.
“I don’t want to be of a hassle to you, Sir. I can wait for the rain to stop.” You tried to kindly turn down his offer, not wanting to bother him but also you felt it was inappropriate for a student to be in any proximity to a professor alone.
“Ms. L/N, it’s late and the rain doesn’t look like it’s going to stop anytime soon. I assure you it is not a bother to take you home. I’ll be worried if I just left you here.”
He was right. Both about the rain and the time, and you’re never out this late. Well at least not alone and it made you antsy. Mr. Kim looked at you with so much care in dark brown eyes that it felt impossible to say no to his kind offer.
“O-okay.”
And that’s how you found yourself in the passenger seat of your professor's fancy car.
You looked around subtly observing the luxurious interior of the vehicle. It smelled like new leather and Mr. Kim’s cologne. Your phone buzzed breaking your little observation as Mr. Kim typed in the location of your apartment into his phone GPS.
“Baby? Are you home? Please let me know.” The text message notification shone brightly.
You let out a little sigh.
Hongjoong couldn’t help but notice your rather wilted demeanor. He looked over you in the corner of his eye as he started the car. Little did you know, he was admiring your look today. You didn’t have class with him on Fridays so seeing today was rather…refreshing. Baby pink always looked so pretty on you, he thought to himself. Your blouse almost had a ballet-like aesthetic to it, it wrapped around your torso so elegantly and gently accentuated your curves. It was matched with a very pretty flowy white skirt that wasn’t too short nor too long, and there was a thin pink ribbon in your hair, the finishing touch to your very sweet ensemble. You always dressed so cute.
“Are you okay, Ms. L/N?” He asked his voice so calm and gentle that it calmed your silent frustration.
“Not really…” you muttered your gaze down at the hem of your skirt, your books, and your laptop sleeve on your lap.
The defeated expression you wore made the older man’s heartache for you. He didn’t like to see you like this. You were like a ray of gentle sunshine whenever you entered his classroom, a doe in a beautiful blooming field of flowers that radiated warmth that made anyone and everyone around you comfortable and calm. It was odd to see you like this.
“If you want to talk about it I’m all ears,” he offered with a smile, reaching behind the head of your passenger seat and glancing behind as he reversed up his car from the parking lot.
Your heart raced at the gesture. You didn’t know what about it was making you feel all flustered and small. His kind words and warm tone made it hard to keep your emotions in. Maybe you can just tell him…a little bit.
“I waited for my boyfriend to pick me up…but he didn’t come.” You murmured, heart aching as you said those words.
Hongjoong’s heart dropped, and he raised a brow at what you just said. Your boyfriend didn’t show up?
“I know I shouldn’t be so upset…it’s just he promised. I understand he has obligations to his team…I just feel like he forgot about me.”
Your sweet voice was so small. Hongjoong wanted nothing more than to soothe you and reassure you. Underneath all of that, he was bubbling with irritation. He kept a softened and caring expression on his face as he listened to you, gripping the stirring wheel to hide his annoyance.
“I-I’m sorry to hear that,” he said so sympathetically. “You’re such a sweet girl to be so understanding of your boyfriend. If I remember correctly your boyfriend is…”
“Wooyoung.” You whispered his name, your lips between your teeth as you tried to hold back your disappointed tears and hurt.
Hongjoong’s jaw tightened.
Right.
Jung Wooyoung.
“Ah…yes. The university’s baseball star.” He was also a student in one of his classes. A heartthrob along with his best friend and Baseball Vice Captain, Choi San.
“I’ll feel better when I get home and sleep it off.” You didn’t want to talk about him forgetting to pick you up any longer.
“If you don’t mind me asking, Ms. L/N, how long have you been together?” He asked, hoping his question was not so out of the blue as he continued to drive.
“Almost three months now, Mr. Kim.” You replied, the idea of being with Wooyoung for so long making you a little happy despite tonight’s disappointment.
Lucky bastard. “Oh, that’s very recent.”
“I know…but he’s very sweet to me. He takes care of me and he really makes me happy.” You listed the good things that always made your heart flutter. Your sweet loving boyfriend who had pursued you and never pushed for anything you weren’t ready for. If you were to describe your relationship with Wooyoung, it was like the love you see in the movies.
“That’s good to hear. You’re one of my sweetest students and I’d be worried if you weren’t happy,” Hongjoong smiled, earning the reaction he wanted and expected from someone as innocent as you.
Your pretty eyes widened at his words and you looked even shyer. He wondered if that’s why your boyfriend was attracted to you.
You didn’t know what to say but there was a small smile on your face when he called you one of his sweetest students.
“Thank you, sir.”
Sir.
Hongjoong’s night was getting better than he could ever imagine. First, the surprise of seeing you still on campus alone as he left, then you accepting his offer to drive you home, and now, Sir? For a long time, he loved how that name slipped from your pretty glossed lips.
“I’m sure your boyfriend feels really guilty about not having shown up. Sometimes these things happen.” Hongjoong tried to reassure you, not really wanting to defend the University senior you were seeing but he needed to say what you wanted or needed to hear.
You take his words as it is. He was older than you so he knew about these things more than you. He was wiser. He was right, these things do happen. Wooyoung did apologize too. So maybe it’s not as bad as you were making it out to be.
Hongjoong noticed how you sat up a little, no longer sulking so cutely in the passenger seat. He smirked a little to himself, his eyes on the road. Did you trust his words that much? Was that how much power he had over you?
You were too innocent it concerned him.
You were truly a doe in a field of flowers. So pretty and so completely oblivious to the wolves hiding in the tall grass. He was sure your boyfriend was one of them and that he too had a deep dark desire for your innocence.
“Is this your place?” He pulled up outside an apartment complex, people passing by in the street as he looked up at the building observing it.
“Yes, it is!” You chirped, happy that you were able to get home safely and it was all thanks to your kind and sweet professor. “Thank you so much, Mr. Kim. I really appreciate it. I really cannot thank you enough…and talking to you made me feel better. I’m really lucky that you were here tonight.”
Hongjoong smiled, holding back from reaching over to tuck a strand of your hair behind your ear. He didn’t want to scare you away.
“If you ever find yourself in any kind of trouble, Ms. L/N, you can come to me okay? Here,” he reached into his pocket, getting his card but writing down his personal phone number in the back of it before holding it your way.
Like he expected you didn’t think much of it, what a sweet girl.
“Mr. Kim you’re so kind.” You took the pretty name card with his phone number in the back. “I don’t get into trouble but I appreciate this. Thank you.”
“Let me help you get inside, okay?” He got out of his car with an umbrella, going over to your side to open the passenger seat door and to hold the umbrella over you and him so that he could escort you to your apartment lobby.
You stepped out of the car and blushed when you felt his arm wrap around your shoulders to gently guide you to the sidewalk and your apartment lobby. He made sure you were dry and safe and also took note of how an access card is needed to get in. He was glad you lived somewhere so safe.
You thanked him again, unable to look him in the eyes because the warm smile on his face was making your heart flutter.
“Now I can go home without worrying if you got back safe,” he lightheartedly teased, making you giggle. He was such a kind person. “Take care of yourself, Ms. L/N. I’ll see you on Monday.”
“Enjoy your weekend, Sir.” You bowed your head respectfully, appreciating how handsome he was in his coat and suit. It made him look like a character from the dramas you see on television.
Tumblr media
Monday rolled around quicker than you thought while Hongjoong found the weekend went by agonizingly slow. As he set up his laptop in the lecture hall as other students filed in, he couldn’t help but anticipate your arrival. He kindly smiled and greeted the students who had the energy to wish him a good morning, he even kept glancing at your seat that was still empty.
Were you not well? Did you catch a cold over the weekend from the rain on Friday night?
“You really didn’t have to walk me, Woo.”
Your gentle soft voice made the professor perk up and his heart race a little. Subtly, he glanced at the door, more students entering but behind them in the hall was you.
“Hey, I still feel guilty about not having picked you up on Friday. I’m gonna make it up to you.” Wooyoung placed his hand on your waist, feeling the soft fabric of your skirt. “You’re too nice if you’re just gonna let me off the hook. I’m gonna be extra attentive, okay baby?”
Hongjoong narrowed his eyes at the young dark-haired boy, his varsity jacket telling everyone that passed who he was and the status he had in the university. He zeroed in on the hand on your waist, Wooyoung’s thumb caressing you gently and his fingers even playing with the cute ribbons on your skirt.
“O-okay,” you blushed, trying to fight back the giddy smile that was forming on your face.
Wooyoung grinned at your response and glanced left and right before pulling you closer til you were pressed against him. Your wide eyes looked up at him in surprise and you got your body tingling when both his hands rested on your waist.
Your fluster only made your handsome boyfriend grin even more with that twinkle in his eyes that always made you feel special.
“You have a nice day, okay?” He whispered and before you could respond, without a care in the world and with no shame if any other student passing would see, he leaned down and kissed your glossed lips.
Heat bloomed in your cheeks. This was different from the soft pecks and quick kisses he’d give, these were the kisses you liked from him. The deep ones that made your head feel all hazy. The one that made heat pool in your lower belly.
Wooyoung pulled back and pressed another kiss on your forehead. “I’ll see you for lunch.”
“O-okay.” You murmured, feeling everyone’s curious eyes on both of you and wanting to remain hidden by Wooyoung’s form.
Wooyoung smiled and then licked his lips. “Oh? Strawberry?”
The mention of your flavored lip gloss made you look up at him, a cheeky smile plastered on his face.
“You’re gonna have me craving you all morning, baby.” He dramatically placed a hand over his chest. “How will I ever survive? One more.” He tried to go for another kiss and you squealed as he pulled you back.
“Woo, I have class!”
“But strawberry!” He pouted as he kept you in his embrace, some students rolling their eyes at the two of you and some finding the two of you cute and amusing. Wooyoung’s teammates from down the hall caught wind of the two of you and hooted.
“Sorry to interrupt but I’ll be starting my lecture soon.”
The voice of Mr. Kim made your eyes widen as embarrassment made you want to hide from his gaze.
“Oh, Mr. Kim,” Wooyoung spoke his professor's name with no shame of getting caught being affectionate with his girlfriend. “Morning!”
Hongjoong could only manage a nod to his greeting before turning to you, still in your boyfriend’s hold and unable to look him in the eyes.
“Ms. L/N, class starts in five minutes.” He spoke sternly, his tone making your lips form a small pout.
The way you reacted to him made the older man before you swoon. God, you were too cute.
“Yes, sir.”
There it was again. The way you said ‘sir’ all defeated and cute.
“Sorry, Mr. Kim.” Wooyoung apologized. “My bad.” He removed his varsity jacket and draped it over your shoulders before kissing your cheek. “I’ll see you at lunch, baby.”
Then Wooyoung sauntered away with a swing in his step and his bag over one shoulder, on his way to his respective class.
“Sorry, Mr. Kim.” You murmured, keeping your gaze down and hugging your books to your chest as you went inside the room along with the last few students who arrived.
Hongjoong watched as you made your way to your seat. Your pretty skirt swayed with each step and he wondered if skirts made up most of your wardrobe. It must be such a delight for your boyfriend.
Loosening the grip he had on his pen as he watched the whole interaction between you and Wooyoung, he smiled at his students. What mattered the most to him was you were safe. You were here and you were safe and well. Never mind the fact that you and your boyfriend easily made up from Friday night’s incident.
You were here.
The lecture was an enjoyable one not only for the students but him as well. As he discussed the significance of art during the Roman Empire, his students were all hooked in with his explanations and discussions, and even he got carried away excitedly with every question and topic.
“Mr. Kim is so hot.” A classmate beside you, Jennie, whispered to her friend, the two of them giggling as your professor shared his knowledge with the class.
“And he’s so nice too. You think he’s a virgin?” Minsol whispered back and you felt your heart grow hot listening to them.
You fidgeted in your seat and tried to block them out, focusing on Professor Kim.
“He’s so young to be a professor. Maybe he spent all that time studying to the max, you know! Maybe he is!”
“He’s so cute.” Minsol chuckled. “But then he’s so sexy when he pushes his hair back.”
And almost as if on cue, Mr. Kim ran his fingers through his dark brown locks, pushing them back as he smiled at his students in awe at the discussion.
He was handsome. You admitted that a long time ago. Attractive? Yes. But he was your professor. It was wrong to think of him the way Jennie and Minsol were.
Til now, their voices couldn’t be blocked out completely.
“I’d gladly blow him for a good grade,” Jennie whispered, her eyes looking Hongjoong up and down.
“Jennie!” Minsol playfully smacked her friend, her voice still hushed.
“What? Just think of it. Goody two shoes Mr.Kim so kind and worried that your grades are slipping, and then you tell him you’d do anything to raise your grade.” Jennie described the scenario so vividly. “No one needs to know what goes on behind closed doors.”
Your heart was racing in your chest as you listened to the fantasy. It didn’t help that Mr. Kim was right there before your eyes as Jennie’s voice whispered discreetly to her friend such a scandalous scenario.
“But it won’t stop there.”
That piqued your interest and you felt ashamed to have been so curious.
“He has a nice car too. Imagine fucking in the backseat of that luxury car way past campus hours in secret.”
Your heart thumped strongly at the mention of his car. You had been in his car and the dirty thought of Mr. Kim being all over your body and kissing you in the spacious backseat crossed your mind.
You couldn’t help but rub your thighs together.
Hongjoong’s eyes scanned all his students, happy that they were enjoying the class but paused when he saw you. Your body was swallowed by your boyfriend’s big varsity jacket and you looked flustered, even biting your glossed lips, fidgeting in your seat.
Then he saw the two girls next to you giggling and gossiping. What were they talking about that was making you blush so much? Briefly, your eyes moved from your notebook and locked with his but you immediately looked down when you saw that he had been looking your way.
Hongjoong could only assume they were talking about him. In what way? He wasn’t sure but it was a way that was making you look even shyer and could he dare say, hot and bothered?
Then the bell rang.
“Alright, we’ll continue the discussion on Wednesday and I’ll hand you all your Renaissance art period essays that I already graded then. Have a nice day.” Hongjoong’s elegant and calm voice echoed in the lecture hall, as he made his way behind his desk, sitting out the papers.
A chorus of thanks was sent his way as the students little by little exited the lecture hall. He looked your way, watching as you packed your things and gathered your books.
“Hey, Y/N!” Jennie turned to you. “How are you and your stud of a boyfriend?”
“Oh, m-me and Woo?” Your lashes fluttered so prettily as Hongjoong pretended he couldn’t hear you and the girls.
“Yeah! We saw you two being all cute and kissy out in the hall.” Minsol chuckled as she touched up her makeup with powder.
“We’re great.” You couldn’t stop the happy smile on your face as you thought of your boyfriend.
“He’s your first boyfriend, right? Have you two…you know….”
Your brows furrowed. “Have we what?”
Hongjoong fought his sigh at how oblivious you were.
Minsol’s eyes widened as she snapped her compact closed and leaned over. “You guys haven’t?”
“What are you two talking about?” You tilted your head like a puppy.
The two girls exchanged looks of shock.
“Y/N…” Jennie leaned closer, lowering her voice even further but Hongjoong’s ears were sharp. “Are you a virgin?”
Immediately, your face was burning as you hugged your books to your chest, wanting to cover your face with Wooyoung’s jacket.
“Holy shit!” Minsol exclaimed then realized she had been loud. She looked towards the whiteboard and saw Mr. Kim looking at the three of you questioningly. “Uh…sorry Mr. Kim!”
Hongjoong only smiled and he shook his head, returning to his papers and was glad that he was sitting behind his desk as the idea of you never being touched morphed from shock and into desire. He kind of guessed you were…but dating the star athlete and heartthrob of the campus made him second guess that you were.
“Girl, you need to come with us!” Jennie hooked her arm with yours and Minsol on the other as the two of you made your way out of the lecture hall.
“Bye, Mr. Kim!” They chimed as they dragged you out with them.
“B-bye, sir.” Your little voice reached his ears as the three of you finally left him alone in the empty hall.
Hongjoong hunched over, crossing his arms on his desk as he groaned.
You were driving him insane.
What’s worse was that you didn’t even intend to do so.
He wanted you.
He needed you.
Tumblr media
As the afternoon passed, Hongjoong made his way to his office. The hall was empty as students were in their classes or their club activities. It was peaceful til he heard hushed whispers ahead from an empty classroom, the door only slightly ajar.
The professor frowned. Were there students doing another weed deal on campus? Before concluding, through the very small gap of the wooden double doors, he took a peek.
“S-someone could walk in.”
Was that his sweet Y/N’s voice? Hongjoong’s heart began to race.
“Baby, I promise no one is. This room is always vacant at this hour.” Wooyoung reassured you, kissing your neck as his hands roamed your body, specifically caressing your thighs that were parted as he stood between them.
Hongjoong swallowed the lump in his throat.
Perched on the large mahogany desk, was you. Your skirt was hiked up higher as your boyfriend pressed against you, his paws all over your soft body, feeling you through your clothes.
“You look so sexy in my jacket,” Wooyoung whispered in your ear, his hand moving lower til they were under your skirt. “I couldn’t stop thinking of how good you looked during lunch.”
You softly yelped when his fingers pressed against your core through your cotton panties. “W-woo!”
“Awe, baby, are you getting wet? All for me?”
“W-woo,” you whimpered when he traced his fingers along your slit, embarrassed at the dirty talk.
“Fuck, you’re soaking through your panties, baby. Tell me you want me to touch you. Ask me and I’ll make you feel good, baby.”
You wanted him to keep touching you but you felt a little guilty. You had started to feel hot way earlier than your boyfriend knew. Jennie and Minsol’s hushed whispering from class about Mr. Kim…ashamedly had made you ache.
“M-make me feel good, Woo.”
Your boyfriend groaned against your neck, rubbing you through your panties. “My pretty baby. You deserve so much.”
Your back arched when he applied more pressure to your clit.
“I’ll make you feel good, baby. I promise…. but I won’t make your first time here in a classroom.” He kissed your neck messily, licking your skin.
“But Youngie…” you didn’t want him to stop touching you. He has touched you like this many times before when he came over but it never went past that. He didn’t want to force you into something you weren’t ready for but as time passed and the more you fell for him, you’ve been wanting to go all the way with him.
“Don’t worry, baby. I’ll make you cum. I’ll be a good boyfriend and let my pretty girlfriend cum.” He kissed your forehead, slipping his hand under your panties to truly feel you. “You’re so wet, baby.” He moaned, collecting your slick and spreading it all over your pussy.
“Youngie,” you whimpered, gripping his shirt as your thighs trembled at the delicious friction.
“I love it when you call me that,” he sighed, repressing the urge that he indeed in fact wanted to ruin his pretty untouched girlfriend. He loved you and he wanted to treat you right as best as he could. You weren’t like the other girls he’s been with. He liked how you looked at him with stars in your eyes.
Your thighs squeezed at his sides unable to close as he continued to play with your pussy, touching you heavily and the way you liked. You couldn’t help but softly moan and pant at the intoxicating pleasure.
Hongjoong was burning with jealousy. A part of him wanted to disrupt the two of you and scold the two of you for misconduct as he had every right as a professor to do so. But…you looked so pretty falling apart for your boyfriend. Brows furrowed as your lips part and sigh, the setting sun hitting your skin in such a way that the lewd imagery before him was like a movie. He could feel his desire straining in his trousers. He wanted to watch.
“Youngie,” you whimpered so prettily.
Hongjoong took note of how your back arched when Wooyoung nibbled and kissed at a spot on your neck. You must be extra sensitive there. He also imagined how soft your breasts would be if he was the one cupping them through your cute blouse.
“You close baby?” Wooyoung rasped against your ear, rubbing your clit faster, making you lean your head forward to rest on his chest.
“Nuh-uh,” Wooyoung clicked his tongue, his right hand leaving your breast to grab you by the chin, making you look at him. “Let me see your pretty face, baby.” He swiped his thumb over your lower lip and bit his lip when you suddenly took his digit into your mouth, softly sucking on it. Where the fuck did you learn to do that? “C’mon, baby. Cum. Cum for me.”
You released his thumb with a soft pop, your lips even glossier from your gloss and saliva. You were panting and moaning so cutely, Wooyoung felt he was going to cum in his pants just at the sight of you getting off his fingers. He massaged your clit faster, watching the way your lids began to droop as you blinked up at him hazily and your lips part in a cute little ‘o’.
“Youngie!” You cried out, back arching and thighs trembling as you reached your high, your pussy dripping more arousal all over your boyfriend’s fingers.
“That’s it, baby. Such a pretty baby.” Wooyoung cooed, enjoying your fucked out expression. It was addicting really. His sweet innocent girlfriend falling apart for him. If you were this fucked out by just fingers, he can’t imagine how fucking delectable you looked when he finally fucked you.
Hongjoong bit his lip as he watched you come down from your high. How your arms wrapped around your boyfriend as he slowed his circles on your clit. He wished he could see how your pussy looked, how wet it was, and how sweet the nectar it produced.
Wooyoung took his hand from your panties and brought his fingers to his lips, your eyes widening. His hand left its grip on your face.
“W-woo!”
That didn’t stop him from letting his tongue dart out to lick his digits. “You taste so sweet, baby. Maybe I’ll come up tonight once I drop you off and really have a good taste of you.”
You blushed at his words and felt heat spark in your lower belly at what he hinted. Did he mean that he was going to kiss and taste you down there? With his tongue? The idea made your cheeks grow hot but that only made your boyfriend grin.
“Oh? You’re not opposed to it?” He teased, enjoying the way you only huffed and pouted your pretty lips. “Here, baby. Taste yourself.”
Hongjoong watched as you wearily, so curiously, poked out your cute tongue to lick your boyfriend’s fingers. How did you taste? Did you like it? You batted your lashes up at your boyfriend who awaited your verdict.
“So? How do you taste?” He took your hand in his other one, just relishing the moment you two had in the orange sunset-lit classroom.
“G-good.”
“Atta, girl.” Wooyoung grinned, taking you into his embrace and kissing you again.
Hongjoong felt his head pound from how hard he was in his pants. He wanted a taste. He needed a taste.
How was he going to get close to you when you and your boyfriend were all fine and dandy again?
“What do you say, baby? Friday night? I’ll come over and we’ll watch a movie. I’ll bring your favorite strawberries coated in chocolate. Then maybe…” he caressed your cheek. “We could go all the way?”
“W-won’t it hurt?”
Wooyoung and Hongjoong’s hearts ached at your sweetness.
“Well, when Friday rolls around, and you’re not up for it. It’s okay. We’ll just have a cozy little date and make out. I’ll wait for you when you’re ready. Okay?”
His gentle voice along with his care for you made your stomach flutter. “O-okay.” You leaned your cheek into his palm. “I love you, Woo.”
“I love you too, baby.”
While you and Wooyoung basked in the moment you two found yourselves in, Hongjoong made a beeline to his office and locked the door. He glanced down and saw the bulge of his cock poking through his tailored trousers. He threw his head back, slamming it against the door as he groaned.
He was going to have to take care of it himself cause it wasn’t going to go away til he did.
Tumblr media
He didn’t know when the stalking— okay, in his defense, following and keeping an eye on you, started.
All Hongjoong knew was, he needed to get to know you. He needed to get closer somehow, be a friend. Someone you could turn to and cry to. Plus, you lived alone, away from your parents. You needed someone to protect you.
From all the wolves that surrounded you, including that boyfriend of yours.
As he passed the baseball field from where he parked his car, he couldn’t help but overhear a group of young wolf pups gathered and talking beneath the morning sun. They all wore the same varsity jacket, making Hongjoong’s pack of wolves analogy even truer.
“So? Did you and Y/N go all the way yet?” The Vice Captain of the team asked, the young and handsome Mr. Choi.
The rest of the boys began to nudge and tease their Captain who had been tossing the baseball in his hand nonchalantly.
“Yeah, have you and little Miss all prim and proper done more than just second base?” The tallest of them, Song Mingi, joined in the teasing, the boys all grinning and tossing oo’s and ah’s. “Your girl has a nice ass.”
“Hey,” Wooyoung harshly hissed at his teammate. “Yeah, and that’s my girl you’re talking about.”
“Can’t blame Mingi. You’re with the campus’s dream girl.” Jongho added, running his fingers through his brown hair.
“Dream girl?” Wooyoung’s brows furrowed.
“Yeah! Sure she’s lowkey and literally the nicest person on campus. Hell, she even helped me with calculus. I even thought of asking her out on a date.” San chirped. “But you got to her first. Anyway, that’s beside the point, did you guys finally do it? Friday night?”
Hongjoong remained hidden behind the shadows of the bleachers, needing to know the answer to San’s question.
“We didn’t. She got nervous and you know, I have to be a good boyfriend and wait. I don’t want to pressure her. She’s a nice girl.” Wooyoung finally responded, his answer earning a groan from his friends.
Mingi stared at him for a moment. “You should be a saint. That amount of self-control is crazy.”
“Well, good things come to those who wait, Mingi.” Wooyoung grinned. “I’m a hundred percent sure my girl is worth the wait and more.”
“You’re really down bad for her, huh?” Jongho laughed softly, actually admiring the fact that Wooyoung was becoming a better guy with you.
“Y-yeah…she is. I really love her.”
“I just can’t believe she fell for you. After all the girls you slept with in the past and the parties. She still fell for Jung Wooyoung. Anyways,” Jongho clapped Wooyoung on the back. “I hope you get some soon.”
San wouldn’t relent though.
“Has she at least been…you know….giving? I know you worship the fuck out of her in different ways but has the pretty princess given back?”
Hongjoong should head back to his office before he’s caught but…he needed to know the details.
“San, she doesn’t know how.”
Wooyoung’s response made San groan and Hongjoong fought back his own.
“She’s a fucking angel your girlfriend.” San huffed his crush on you not concerning Wooyoung as he knew San would never cross the line.
“Dude, when you get to teach her, it’s gonna be so fucking hot.” Mingi sighed, thinking of who to contact for his next hookup. He needed to fuck.
Hongjoong couldn’t help but agree. To teach someone as beautiful and pretty as you, how to use your cute mouth and delicate hands…the fantasy of you between his legs while he sits on his office couch…guiding you while you look up at him for him to lead you…the young pups have a point.
“Okay, can you guys chill and not talk about my girlfriend like that?” Wooyoung lightly scolded his friends. “Anyways, you guys better be on your best behavior for tonight’s practice. I'm driving Y/N home for our date and I really don’t want to have to bail again because Coach isn’t happy with our performance.”
“We’ll do our best,” San spoke for them, sending a pointed glare to Mingi and Jongho, they’re bickering always getting their Coach to overtime their practices. “But coach hasn’t been in a good mood as far as I know.”
Wooyoung swore under his breath, worry bubbling in his chest when he imagined your disappointment and the way your eyes become glassy as you fight back tears. He really didn’t want to make you feel like he didn’t care about you again…he knew you understood his obligations to his team. He just hoped he wouldn’t forget to update you this time and keep you waiting for him.
Hongjoong didn’t stay long after that. He went off his merry way back to his office, wondering if tonight would be another chance to have some time with you again. Be your knight in shining armor if your boyfriend doesn’t pick you up again.
All he needed to do was stay in your good graces.
After all, he just wanted to take care of you…
It began with longer conversations after class, asking how you were doing and if you understood the lecture or not. Then when midterms started to round the corner he would casually stay past campus hours just so that he could ‘by chance’ be finishing up late at the same time you were finished up studying in the library.
But this time, when he found you, the sun was beginning to set and you were in one of the library aisles, in the sections students don’t frequent, on the floor hugging your knees to your chest. Your back was against the tall wooden bookshelf and you were by the window, your head below the window pane as you softly sniffled.
Hongjoong felt his stomach twist. What did your boyfriend do?
“Ms. L/N?” As softly as he could, he called out to you and he saw you visibly stiffen.
“M-Mr. Kim?” You kept your head down, too embarrassed to look up at him because he would see the tears and puffiness in your eyes.
“Are you okay, Ms. L/N?” He slowly approached, observing your body language if you would shrink away from him. He kneeled before you. “Did something happen? Why are you crying?”
You bit your lip, fighting back the way it quivered as you wanted to tell him exactly what happened but you were crying over something so silly.
A gentle warm hand softly patted your head, your heart stopping at the touch. Maybe you could tell him everything. Besides…he has been so kind to you and only ever wanted to make sure you were okay. When the two of you spent time together and talked, you would sometimes forget he was your professor and not just a friend.
And yet, your heart couldn’t help but want to be in the palm of his hand, knowing he’d be gentle with it.
When you lifted your head to look at him, the tears in your eyes had Hongjoong almost falling to his knees and wanting to embrace you right then and there. “I’ll take you to my office okay?” He offered, taking out his handkerchief and putting it in your trembling hands.
“O-okay.” You murmured.
With a guiding arm around your shoulders and making sure no wandering eyes would see the two of you, the likelihood being low since it was past class hours, the varsity teams were training and it was a Friday, he led you to his office.
You stood awkwardly in the middle of his office, clutching his handkerchief in your hand, a part of your brain contemplating the idea of being vulnerable in your professor's office. It was highly inappropriate. Should anyone find out—
You were torn from your thoughts when a pair of warm arms wrapped around you so gently. You blinked a couple of times unable to process what was happening and the beating of your heart. Hongjoong cradled the back of your head as he held you close to him, your cheek brushing against his neck.
“It hurts to see you cry.” He whispered, unable to hold himself back from soothing you then he pulled away and led you to the leather couch in his office.
You sat on one end while he was on the other, the gap between you reminding you of the intrusive thought of the distance you and Wooyoung might have soon…
“What’s wrong, darling? You can tell me, you know. I’m always here to lend an ear. Whatever it is I won’t judge you, especially when it hurts you this deeply.”
Hongjoong tried to meet your eyes that were cast down on your fingers on your lap, fiddling with his handkerchief. Was it your boyfriend? He swore if it was Jung Wooyoung he was going to teach that boy a lesson.
Hesitantly, you allowed yourself to speak freely to him.
A moment of weakness?
“I-I overheard Youngie’s friends when I was in the library…they were about to leave for practice and…” you felt that lump in your throat creep up higher, making you want to sob again as you remembered what they said. “They said that they felt b-bad for him.”
Bad for him?
“It’s a bit…tmi…sir. I’m sorry it’s hard to speak about it.” You stared at the edge of your skirt, feeling the shame and embarrassment you had felt earlier crawling on your skin.
“Ah? TMI.” Hongjoong crossed his arms over his chest, trying to play it off as if it’s nothing to make it comfortable for you to tell him. “Well, Ms. L/N, we are two adults, aren’t we not? Plus, it’s after university hours. I’m here for you right now as a friend and I’d like to help soothe your troubles if you would let me.”
It was almost too easy the way you caved into his words. Jung Wooyoung did not deserve a sweet girl like you.
“Youngie’s teammates…said they feel bad for him because I haven’t…” you paused, heat blooming in your tear-stained cheeks. “I haven’t slept with him.” Then you felt that ache in your heart return. “I don’t want to lose him, Mr. Kim. I love him so much. I-I want to be a good girlfriend.”
Hongjoong’s heart broke. His beautiful wilted rose. How dare those dumb boys speak so ill of you?
“You’re a good girlfriend I’m sure, Ms. L/N.” He reassured you with such calmness, his words made you perk up a little. “You didn’t hear these words from Wooyoung himself right?”
You nodded.
“But even though…I still want to make him feel good. He always makes me feel…” you trailed off, realizing that you were talking about the intimate things you and your boyfriend do. “It’s not that I don’t want to be with Wooyoung like that…I just…I don’t want to disappoint him.”
“Disappoint him how?”
“Wooyoung has been with girls…with experience. He’s my first boyfriend and he’s the first man to ever touch m-me…kiss me…”
Hongjoong was fighting back the attraction grew the more you spoke about your lack of experience. He couldn’t believe those boys had you questioning your worth all because you were scared to go all the way with your boyfriend.
“I-I even tried watching…videos…on how I can do things for Wooyoung…but I just am too scared to initiate it. What if I do something wrong and it goes horribly?”
“You shouldn’t need to worry about that. I’m sure your…” Hongjoong held himself back from saying what he said with jealousy. “…boyfriend would be more than happy to teach you. Has he offered to?”
You shook your head.
“Ah…I see.” Hongjoong sat back, trying to think of what to say next. “I’m pretty sure what you lack is practice…” he trod carefully, gauging your expression with each word he was choosing. “You’ll never know til you give it a try. With everything in life, you learn as you go.”
He watched as you took each word seriously, a rather sweet pensive look on your face as you nodded at his advice. Hongjoong hoped he didn’t cross the line by saying that and made things awkward between the two of you.
“If I may speak as another human being helping another,” Hongjoong continued, hoping to calm your stormy mind. “I just hope you don’t feel pressured to do anything with your boyfriend or anyone. It’s very sweet of you to want to do something this intimate with someone you desire but I’d rather you won’t do anything you’re not comfortable with.”
You fiddled with the hem of your skirt, going over all the caring and sweet affirmations Mr. Kim was giving you. How was it you felt so safe with him? He was too kind to you…yet you enjoyed the company he gave.
When Wooyoung wasn’t able to take you home from extended practices and last minute cancellations and texts, Professor Kim was always there to somehow salvage the day. To stop the breaking of your heart with his warm smile and effort to get to know you and make conversation.
“M-Mr. Kim…”
You finally spoke. Hongjoong smiled warmly at the call of his name. He observed how your cheeks began to flush. Your teeth sink into your lower lip as you hesitate to continue. You suck in a shaky breath, forcing yourself to be brave and look him in the eye.
“Could you guide me?”
Nothing but your voice rang in his ears at this moment. Hongjoong was shocked by the question. Was it a question? With the way your eyes were bleary and glossy, how your lips were trembling, and how flustered you appeared. It was a plea.
“Ms.L/N….” He tried to resist as much as he could, knowing that if he were to cross the line, he wouldn’t be able to go back. You were his forbidden desire. If he were to take a bite, he would want nothing more than to consume you.
You knew what you asked was silly and inappropriate, and a part of you regretted asking but if you were to leave this room right now, all you would be able to think about was how Wooyoung’s friends talked about you and wonder how much Wooyoung shared to his friends about yours and his relationship.
Mr.Kim looked speechless and flustered from what you asked of him. Maybe you shouldn’t have asked.
“Mr.Kim, I-I’m so sorry,” you quickly blurted out, trying to salvage the odd atmosphere. “Please forget everything I said. Thank you so much for comforting me—
"Are you sure you want me to help, Ms. L/N?” Hongjoong stopped your rambling, taking your hand that you hadn’t realized was trembling from nerves but the moment he spoke and he touched you, your body found a sense of calm. “I just don’t want to make you do anything you’ll regret.”
Oh, he wanted to help.
“I-I wouldn’t have asked anyone else but you...I feel safe with you.” You mumbled shyly, staring at his pretty hand holding yours, his thumb rubbing soothingly over your knuckles.
“Your trust in me is something I shall cherish and I wouldn’t dare break it.” He looked you in the eyes as he said that, the warmth and intensity of them made your heart flutter. “I promise I’ll keep it strictly professional and I’ll make sure to put your comfort first.”
Your heart fluttered again. “O-okay.”
“How would you like this to go?”
“I-I’m not sure…Wooyoung usually takes the lead whenever we do anything more than kissing…” you were speaking so softly, it was pulling at Hongjoong’s heartstrings. You were so precious. “I wouldn’t mind you taking the lead…teach me how to make Wooyoung feel good.” You squeezed his hand nervously and he kept his soft smile on his face, hiding his excitement.
You’ll let him take the lead?
“Okay, sweetheart. I promise I won’t do anything you’re not comfortable with okay?” He caressed your cheek fondly, forcing himself to not brush your lips with his thumb. “Tell me to stop when it gets too much.”
“Thank you, sir.” You whispered, feeling all tense as he got closer.
Sir? Were you trying to kill him? He scooted closer, your knees touching his own. “Do I have permission to touch you, darling?”
The pet name made you feel just a little bit more hotter. The way he said it, his voice a low purr, made you feel things you thought you’d only feel with Wooyoung.
“Y-yes, sir.”
Experimentally, he slowly glided his hand up the side of your thigh, the sweet gasp falling from your lips making him smirk against your neck. He brushed his lips against your neck, before whispering in your ear. “You’ve watched videos as research, correct?”
You stuttered out your response, feeling your body grow warm with the way his hand smoothed up and down your thigh, never going higher than where your skirt stopped. “I did…” Was it wrong that you wanted his hand to move higher?
Hongjoong held back from kissing your neck, testing the waters of what exactly he could do to you. His hand moved to your waist now, caressing the curve of your side then stopping so that his thumb was just below the underside of your bra covered chest.
“Why don’t you show me what you learned, hm? Then I’ll guide you along the way.” He suggested, his tone going just a little lower than usual.
And that’s how you found yourself on your knees, between your professor's trousered thighs, your eyes looking at him with such uncertainty and the willingness to learn.
“Don’t be shy. I’m sure you won't disappoint,” Hongjoong reassured you, petting your head lovingly while his thoughts were going wild at the mere sight of you all cute and demure between his legs.
“O-okay.”
As you had watched and observed, you placed your hands on his thighs. They trembled a little. What if you messed up here too? You shook the thought away. Professor Kim was going to guide you. You’ll be okay and then you’ll be able to make Wooyoung feel good too.
All of this was for Wooyoung.
You slowly slid your hands up his thighs feeling the smooth fabric of his trousers as you recounted the videos you had seen. You remembered how the woman in the video would trace her fingers over the man’s groin…but was Hongjoong even…turned on?
You remember how stiff Wooyoung would get when you were on his lap as you two made out, his hands running up and down your sides then over the curve of your ass, squeezing it.
Do you need to kiss Mr. Kim too?
Before asking, you experimentally softly placed your palm against his groin, blushing to find that he was hot and rather stiff through his pants. A shaky breath escaped him and you retracted your hand.
“W-was that not okay?”
“It was fine,” he managed a smile for you, getting hard at just how shy and sweet you were. “You’re doing fine.”
“O-okay,” you swallowed the lump in your throat, gliding your palm over his clothed groin before sliding higher, your other hand joining to unbuckle his belt.
Each gentle and inexperienced touch or ghost of your fingers over his crotch was making his cock twitch to life. It was so easy for him to be turned on…well…because it was you. It was endearing how focused yet nervous you were and once you tugged his briefs down low enough for his cock to spring up, your eyes stared at his length.
From his reclined position on the couch, his legs spread to accommodate you, he was able to notice the way your thighs squeezed to tether at the sight of him.
Your face was hot as your eyes took in the sight of his cock. It was way more intimidating to see one in person than on a screen…was it odd for you to think it was rather pretty? The head was a soft pink and it glistened with something that made your tongue somehow itch to want to try and wrap your mouth around him. Would he fit in your mouth? Would he fit in— you stopped yourself from thinking that. You can’t go all the way with Mr. Kim, you were going to do that with Wooyoung.
Feeling his warm gaze on you, you gently wrapped your hand around his length. The feeling of him hot and heavy in your palm, the girth of him, made your core pulse.
Hongjoong bit his lip at the gentle touch, the smoothness of your palm, and the dainty way you held him making him sensitive to whatever you were doing. He knew it wasn’t on purpose that you were prolonging any sort of movement, you weren’t sure what to do next.
“Tell me what you learned,” he managed to speak calmly. “Or what you observed.”
Squeezing your thighs together and inching closer to get into a comfortable position, you thought of what to answer. “In the videos…the girls take their partner in their mouth…and some just move their hand…I'm not sure what to do next, I’m sorry.” You looked away, embarrassed.
This was exactly why you never initiated it with Wooyoung. If you did and you messed up or did not even follow through, he would’ve mentioned it to his friends somehow in their talks.
Hongjoong saw how nervous you were and tried to suppress the desire to command you what to do and how you should do it, he placed his hand over yours that was softly holding his cock. He couldn’t be mean to you…as much as he wanted to completely control you and make you feel pleasure that would have you falling apart for him, he wanted to be gentle with you.
“I’ll guide you, okay?” His other hand petted the top of your head, making the nerves yo I had been feeling dwindle. You nodded.
“You have to spit on it first, sweetheart.”
His words made your eyes widen. The dirty notion was embellished with a sweet term of endearment. Hearing it from him, from the mouth where only kindness, care and knowledge was all you heard come out of it, made you feel warm.
“Spit on it?”
“I know it sounds odd but it’ll help. I’ll guide you on how to use your hand first. Don’t be shy, darling.”
His encouragement only made you want to do as he says. You told yourself it only feels weird because you’ve never done it before and Mr. Kim was kind enough to help you be more confident when the time comes for you to do it with your boyfriend.
Leaning over, you collected your saliva and spat softly. Hongjoong bit back any sound that dared escape him at the moment not ready to break the promise of being professional for your sake but the warmth of your spit and how shyly you did it turned him on even more.
“Now,” he guided your hand. “Spread it around with my precum like this.” He loosely moved your hand, letting your dainty fingers be covered by the mix of your spit and his precum. “It’ll be easier to move your hand this way, it’ll feel good.”
You nodded, feeling the slickness against your palm and how it now easily glided along his length with his hand still over yours.
“You have to hold it just a little tighter.” He closed his hand over yours a little tighter but not too tight but just enough to tell you how much pressure you should be applying.
“L-like this?” You adjusted your grip and slowly while your hand moved in slow up and down motions, he removed his hand and a deep sigh of bliss left him.
“Just like that, sweetheart…just like that.” His voice dipped lower and his head rolled back a little, giving you the perfect view of his sharp jawline and pink lips.
Your eyes kept shifting from his face and to his cock in your hand, entranced somehow by the idea of how he was feeling good by just your hand. Watching a video was completely different from actually doing it. You recalled the way a girl in a video would twist her hand as she glided her hand up and down, and you decided to try the motion.
Hongjoong hissed out a curse at the new movement. “That feels good.” His hips bucked up a little, pushing his cock up in your hand.
Feeling a little braver, you leaned forward to press your lips on the head of his cock, kissing it and feeling heat surge to your core at how warm the tip was against your lips.
Hongjoong lifted his head from its thrown back position to look at you, the sudden sensation of your soft lips on his cock turning him on further.
“You want to try that already?” He asked, his hand gripping the armrest of the couch when your doe eyes looked up at him so innocently, your lips wrapped around the head of his cock, and nodded, it was driving him crazy. It was getting harder and harder to retain any sense of composure. “Go ahead, sweetheart. Show me what you learned. You’re already doing so well. You look so cute like this too.”
His words of praise and compliments made both your heart and core throb. It made you try even harder to please him. You wondered if it was okay that you were getting wet. You could feel your slick sticking to the gusset of your panties and against the lips of your pussy.
Hongjoong moaned softly when he felt your hot tongue swirling around his cock head. He twitched within your hand continued their rhythmic twisting and up and down rhythm. He watched as you tasted him. He could see the way your brows furrowed at the taste and when he felt you take more of him in your mouth and suckle at the sensitive tip of his cock, you were making it harder for him to not buck his hips up into your pretty mouth.
“You doing okay?” He asked, gently placing his hand behind the back of your head, caressing you.
You nodded, humming, the vibrations of your sound adding some extra pleasure to the way you were giving him head.
“F-fuck, you’re doing so good, sweetheart. Such a good girl.”
The way he said that made your pussy clench. Why did that have some effect on you? It sounded so hot coming from him and it made you want to please him even more.
Eventually, you took what you could of him in your mouth, fighting back your gag reflex and bobbing your head shallowly along his cock. Your hand continued to jerk what you couldn’t fit of his length in your little mouth. You were aching so bad, you couldn’t help but let your free hand slide between your thighs to find your pussy, surprised at how wet you were. It was easy to spread your arousal all over your cunt and begin massaging your clit the way you liked, settling for the friction of your fingers.
Hongjoong noticed your dainty hand between your legs. The sight of you suckling and bobbing your cute head up and down along his cock, and touching yourself was sending him to the edge. Plus your lips tinted with pink gloss were mixing with your saliva as you continued to suck him off. You were so fucking cute.
“I’m close darling. You’re doing so well. You had nothing to be so nervous about. F-fuck.” He shuddered when he felt the head of his cock hit the back of your throat and you squeaked so adorably, the sound muffled. What a cute little slut you were touching yourself as you stuffed your little mouth with his cock. Though he was saying such sweet praises, deep down he wanted to fuck his cock into your mouth and watch you cry from taking him. He was betting you’d look up at him with wide pleading eyes with tears as you let him use you as his personal cock sleeve.
The mere thought of that sent him over the edge and without warning, he came. A small squeak left you as sudden hot spurts of cum spilled into your mouth. You latched off of him in surprise, your hand still pumping him as he came. His moans and the way his head was thrown back, made you stop touching yourself so you could focus fully on the way he climaxed all over your face.
“Fuck!” He groaned as his hand that was cradling your head gripped your hair and his hips bucked up into your hand, riding out his high. You whimpered as he tugged at your hair, the sensation making your clit throb. Why did that feel good? Why did having his release on your cheeks and in your mouth, turned you on?
“Open up, darling. Let me see.” Hongjoong tugged your hair back almost forcibly, his gaze almost predatory, it scared you a bit. You’ve never seen such a dark, menacing yet charming expression on your sweet and kind professor.
You parted your lips and he smirked.
He wondered if you knew just how cute and ruined your look right now. Pink gloss smeared over your lips and your cheeks flushed and stained with his white sticky cum, and the best of all, his seed was on your tongue.
He wished he could take a picture.
You didn’t realize you were breathing slowly as your heart was racing and he stared down at you with a glint in his eye that you couldn’t quite place.
“You look so pretty like this, darling.” His grip on your hair loosened and his hand moved to cup your cheek, his thumb dipping into your mouth as you still obediently kept your lips parted for him. He smeared more of his cum all over your lips and chin, finding the idea of him on your skin so hot…it’s like he marked you. “Such a good girl.” He cooed and you didn’t know why you did what you did but you swallowed his salty release, and his reaction made it all worth it. “What a perfect girl you are.”
His praise only made your heart flutter, his words only feeding that part of you that wanted to please him…to please Wooyoung.
“D-do you think Woo will like it?” You asked, your voice a little hoarse as you sat there on your knees, looking up at him so sweetly.
Hongjoong held back from rolling his eyes at the mention of the boy who didn’t deserve you. He masked his annoyance with a smile. “He’ll like it, darling. You did really well. I mean it.” He took his handkerchief and began to clean you up, gently dabbing your cheek.
Despite the ache between your thighs, you couldn’t stop the way a smile grew on your face at the approval from your most trusted mentor.
“Thank you so much, Mr. Kim—
“Hongjoong.” He cut you off with a gentle smile, looking at you lovingly.
“What?” You stuttered that same feeling you felt earlier, the confusion of the same way he made your heart flutter like Wooyoung does.
“You can call me Hongjoong when it’s just the two of us, darling. I think with how close we’ve gotten…I’d like you to call me by my name. Don’t you think we’re rather close?”
There was something about his eyes that captivated you. It was so magnetic it was hard to not be completely wonderstruck and in control of that powerful gaze.
All you could do was nod.
“That’s a good girl…” he cooed, smiling warmly. “Perhaps, you need more guidance. You want to be a good girlfriend for your Wooyoung right?”
You did, you wanted to be the best girlfriend for him.
“I do…”
“Sometimes what you see online is not entirely reliable. I’m offering you…private lessons…doesn’t that sound good for you?”
You nodded, letting him pull you up on and onto his lap, gasping when your core pressed against his thigh.
“I’ll teach you all there is to know. I want what's best for you and for you to know exactly what you’re getting into.” He ran his hand up and down your thigh, slowly. “You don’t want to disappoint Wooyoung, right?”
“I don’t Sir…” you said so quickly.
So innocent. So naive. So dumb. So perfect for him to ruin.
He never thought he’d get to this point.
All this time, he has only ever admired you and desired you from afar. He kept his reputation as a well-loved and kind professor so that no one and you, especially you, would ever question his motives.
“Now, I think we should try this again. You did really well but I can teach you a little extra something that will make your boyfriend so, so, so happy.”
Tumblr media
feel free to scream in my askbox about the fic I will gladly fangirl with you and I love feedback. It keeps me writing.
special tags : @khjcs @skteezcursed @caityelise99
2K notes · View notes
demigodofhoolemere · 2 years
Text
Got a handful of CDs from Big Finish because there were good deals for things I’ve wanted and apparently the combined price in the end was big enough to make them think someone else was using my card, because initially it declined the transaction and I got a text from my bank warning of potential fraud on the order. It was me, I swear, I just like audios. Don’t look at me, bank. 😫
1 note · View note
hellsitegenetics · 7 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: according to democracy, yes
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
Tumblr media
2K notes · View notes