Strange Snacks
"okay but hear me out!"
"no! that sounds disgusting."
you tried not to but a laugh bubbled out of your throat, causing you to roll onto your side a bit. your head was placed in his lap as you laid on the couch. you two had been talking like that for over an hour now.
conversation had started talking about each other's days and shifted from topic to topic until you were telling him about your latest weird food combination. he *had* been playing with you hair but that stopped a few seconds ago when you'd said it for the first time.
now he sat with his hands in the air, as if he were surrendering.
"i refuse to believe that that's good at all." he chuckled too as you rolled back into place, looking up at him with a cheeky grin. "there's no way you actually like that."
"i do!" you said. "it's my new obsession snack!"
"you're so gross sometimes. i've really kissed that mouth?"
"hey!" you slapped his chest and he started laughing, finally giving in to the whole body guffaws.
"i can't believe i've kissed you after you ate that."
"hey." your voice got softer as you began to pout. "why are you so mean?"
"because i love you." his hand went back to petting your hair as his other set itself on your stomach. you, however, crossed your arms and turned away, still pouting. "aw i'm sorry, baby, i didn't mean it. you know i didn't."
"....so you're willing to try it?"
"okay i never said *that*-" he cut himself off when you turned back to him with that pout he found oh so endearing. "okay okay, *fine*."
"i love you, jaime." your smile was bright enough that he couldn't even regret his decision. as much as he wanted to.
"i love you, too, x." he kissed the tip of your nose.
"c'mon, only my nose?"
"not after i learned what nonsense you eat and are making me try."
you huff. "you suck."
63 notes
·
View notes
He's in the mood the lick someone for the salt on their skin.
10 notes
·
View notes
(same anon as yesterday) ah ok
I wanna see logicality + trans!logan. idk what prompt tho, can’t decide. just wanna see logan w/a cute round baby bump
Tw: feeling sick, eating non-food items
This kept trying to be angsty but this version finally wasn’t, not a lot of baby bump as I wanted to add :(
Logan hadn’t been feeling well, the last few weeks he would wake with strong nausea keeping him in the bathroom until the others were awake. Virgil had been worried and Janus was checking in on him more than ever, Patton was growing extra protective and territorial of him. It wasn’t until his stomach started to grow that he connected the dots, morning sickness. He was pregnant.
They didn’t think it was possible for sides to become pregnant so he and Patton hadn’t been careful, the others hadn’t either but Logan was the only side that was originally formed in a way that humans would call AFAB. He was scared but he couldn’t find himself being mad about it, there was a new life growing inside him and as much as this was an unknown it was also a new learning experience. And he wasn’t alone, Patton was a great partner and had always wanted to be a father, both Virgil and Janus would look out for him…the twins would try their best of course. His family was going to help him handle this.
“Why can’t I stop eating? Nothing is satisfying and I’m not even hungry anymore!” Logan cries out, the jar of peanut butter he had opened only has a single small scoop out of it before being left on the table. He leaves the kitchen, waddling to where Remus was sitting in the living room watching a grim-dark d&d podcast, “This is not at all rational!” He complains, sitting next to the dark twin and trying to distract himself with the campaign. Remus makes an agreeing grunt, having a craving for something you can’t place is a pain he’s had to deal with too. Patton and Janus had both been trying to cook or bake everything they could think of with no results, Logan was still miserable.
Speaking of, Logan reached mindlessly into the bowl Remus was holding and popped a ball of the dough into his mouth before he could be stopped. Remus was already summoning Pat when Logan ceased chewing, “Shit shit, I di-“ “Remus, what is this?” The look that he pins Remus with has the creativity hiding behind daddy-dearest, “Cl-clay?” The answer seems to be sufficient enough because Logan swallows, “Can you make me more?”
In their now shared room Logan has a little bowl nestled on top of his baby bump, eating bits of red and white clay. “Virgil says that dirt and clay are not too uncommon for humans to crave during pregnancies, he says that it’s normally caused by minerals missing in a person’s diet!” Patton giggles as he retells the story, “We don’t actually get vitamins or minerals from eating but you still got a craving for it, maybe humans just need to feel grounded sometimes.” Logan flicks a ball of the soft clay at Patton, “That was terrible, absolutely terrible.” He still smiles, rubbing the bump before closing the lid on the bowl. “But it is a fascinating theory, tell me more about what you and Virgil found.”
6 notes
·
View notes
May I bite into you?
0 notes
*Travels back to 2015 for this ice cream*
0 notes
Is it just me or does anyone else have the craving of biting into a cold wet basement prick edge and taste that good basement out of it like imagine the crunch
1 note
·
View note
idk id be weird abt touching someone for the first time in a millennia too
2K notes
·
View notes
Eating Beads
If she lacked any sense,
She'd probably be in the ER
And in an awkward position
Explaining how she ended up there
She was a at store
A store with beads
So many beads
And several looked edible
She knew they weren't
But she still had a compulsion to eat them
Only being held back by
Having more sense
Years ago, she did eat beads
For reasons that she couldn't identify
But she was a child then
(A lot feels "right" when you're a child)
Perhaps, it was just cravings for sweets
And a lot the beads looked very much like sweets
Still, she hadn't the inclinations
For an ER trip and an explanation
Still, if she had lacked any sense,
Her compulsion to eat beads would land her there.
0 notes
hello!
i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).
i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.
my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.
bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.
okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)
String identified:
cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt
Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39
Common name: Marsh pennywort
(image source)
571 notes
·
View notes
Today I missed twitter for half a second because I want to @ wendy’s and complain that I can’t get their breakfast potatoes all day, because I dreamed about eating those potatoes and spicy nuggets.
0 notes
Me: Knows absolutely nothing about ice hockey or figure skating.
Also me: Weirdly tempted to wrote a "gold medalist, retired early" figure-skater Merlin who is simply *magic* on the ice getting roped in to playing Ice Hockey with Team Excalibur (and falling desperately in love with Arthur, of course)
182 notes
·
View notes
pregnancy freak satoru not letting you lift a finger let alone carry stuff, be it your purse even, bc you are with his child now and you are to sit back and let him take care of everything. the way he is so overprotective is very endearing really but gets a bit out of hand at some point when he offers to hand feed you during mealtimes so you don’t have to bother with the utensils. you want to teach him a lesson, hoping he’d read the room and stop treating you like you’re on your deathbed—you refuse to hold his cock, saying it’s too heavy. but instead you give him a boner and an ego boost. now he holds it for you whenever you suck him off….
277 notes
·
View notes
I’m at the gym right now and craving 5 Guys and I’m not talking about the restaurant. -👀
160 notes
·
View notes
How would each of the lads react to reader being heavily pregnant with their child?
i want to say with a boner but i feel like that’s not the answer you’re looking for 😔
116 notes
·
View notes
lord help me i have fallen into the Noise and Noisette kiddos rabbithole (in part thanks to @abbyroseflame24 and @klownkoster ehehehehehe)
behold...... THEM. came up with the names Poppy and Mustard because they sounded cute 🤗
dunno what i'm gonna do with these babies yet, but take them. take my very good children. i love them very much.
198 notes
·
View notes