#list 3 diseases caused by bacteria

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

[macgyvermedical]

Incubation Periods List

Hi all!

The following is a list of incubation periods for various infectious diseases for all your writing needs. An incubation period is the amount of time between exposure to an infectious agent (bacteria, virus, protozoa or prion) and the person having the first symptoms of the resulting illness. Knowing this is helpful in creating a timeline for your story.

Anthrax: Incubation period of 1-60 days

Avian Flu: Incubation period 3-9 days

Botulism: Incubation period 12-72 hours

Chikungunya: Incubation period 3-7 days

Chlamydia: incubation period 7-21 days

COVID-19: Incubation period 5-10 days

Creutzfeldt-Jacob Disease: Incubation period 10-20 years

Dengue: Incubation period 5-7 days

Diphtheria: Incubation period 2-5 days

Ebola: Incubation period 2-21 days

Hantavirus: incubation period 1-8 weeks

Hepatitis A: incubation period about 28 days

Herpes: Incubation period 2-12 days

Herpes Zoster/Varicella (Chickenpox): Incubation period 14-16 days

Herpes Zoster (Shingles): Incubation period- technically none, as this is a reactivation of the virus that causes chickenpox

HIB: Incubation period 2-10 days

HIV: Incubation period 1-6 weeks to prodrome, approximately 10 years to AIDS

Influenza: Incubation period 1-4 days

Legionnaires Disease: Incubation period 5-6 days

Leprosy: Incubation period 9 months to 20 years

Lyme Disease: Incubation period 3-30 days

Malaria: Incubation period 7-30 days

Measles: Incubation period 10-12 days

Meningitis, Bacterial: Incubation period 2-10 days

Meningitis, Viral: Incubation period 3-10 days

Monkeypox: Incubation period 1-2 weeks

Mumps: Incubation period 16-18 days

Norovirus: Incubation period 12-48 hours

Pertussis: Incubation period 7-10 days

Plague: Incubation period 2-8 days

Pneumococcal Pneumonia: Incubation period 1-3 days

Polio: Incubation period 7-10 days

Q-Fever: Incubation period 2-3 weeks

Rabies: Incubation period 20-90 days

RSV: Incubation period 4-6 days

Smallpox: Incubation period 7-17 days

Syphilis: Incubation period 10-90 days

Tetanus: Incubation period 3-21 days

Tuberculosis: Incubation period 2-10 days

Typhoid: Incubation period 6-30 days

Typhus: Incubation period 1-2 weeks

West Nile Virus: Incubation period 2-6 days

Yellow Fever: Incubation period 3-6 days

Zika: Incubation period 3-14 days

[eddies-house]

Ch. 1 | Ch. 2 | Ch. 3 | Ch. 4 | Ch. 5 | Ch. 6 | Ch. 7 | Ch. 8 | Ch. 9 | Ch. 10 | Ch. 11 | Ch. 12 | Ch. 13 | Ch. 14 |

Smoke Signals

Chapter Two - Dainty

W/C: 4.6K

Eddie x Fem reader - Grumpy!Bartender!Eddie x Shy!Reader

You need a job, The Bourbon needs a server. The math is there but the owner won't acknowledge it. How will you win over such a crabby man that only sees you as a gnat forcing its way into his space?

A/N: The response I received on the first part fic was so unexpected but I'm so glad everyone liked it!! I can't wait to get deeper into this story

Masterlist

Prev | Next

I’m sorry for running out so fast yesterday.

No.  Too forward.

I think we got off on the wrong foot, by we I mean me.

No, not sincere enough.

I just wanted to apologize for leaving so abruptly—

“Excuse me, dear?”

Your train of thought was dissolved within seconds as you turned your focus to the older gentleman that had called for your attention.  A hum in place of an answer as your brows raised expectantly but ever so friendly awaited his follow up question.

“Can I just squeeze past you to grab that jar of peaches?”  He asks, wrinkles around his eyes upturned in perfect harmony with his smile.

“Of course.  Yes!”  Panicked, you rush to the other side of the aisle, the older man waving you off, insisting that it was ‘quite alright’ while he reached for his beloved peaches.

You’d been bouncing back and forth, up and down between several opening statements to provide Donnie, a sour taste left in your own mouth at the way you left her hanging the day before when she was merely being kind to you.  It was something you couldn’t stop, the anxiety eating away at your flesh like bacteria from the fact that you could’ve caused someone to be less than satisfied with their interaction with you, as if you were some kind of service.  People pleasing was a disease.

Sometimes the affected party was blind to its symptoms, oblivious to the way their illness consumed them.  And that’s why you found yourself purchasing a single pack of gum, eyes large and sorrowful before you were even next in line.  Various ways to get the point across were mentally rehearsed and the closer you got to the register, the more you focused on one singular sentence, clinging onto the desire to not stutter or mess it up.  

“Hey you’re back!”  Donnie greets.  “Thought for sure we’d scare you off by now.”

With a wince, you hand her your pathetic excuse of a conversation starter, a pack of spearmint gum with your trembling hand.  If she notices she doesn’t bring attention to it, instead she gracefully takes the pack and rings you up. 

“N-no, no.  I don’t scare that easily.”  You try to convince yourself more than her.

You note that the shop is nearly empty once again just after a handful of customers had done their shopping and went on with their day.  A few patrons still linger, carefully picking out each item from their weekly grocery list; however, you wouldn’t know they were there if not for the squeak of their carts every few feet as they inched forward.

“Could’ve fooled me.”  Donnie respectfully hands back the gum in exchange for your cash.  A crinkled five that had seen better days.

For a moment you debate fleeing once again, nerves tingling and breathing becoming shallow before internally reprimanding yourself.  You can cry all you damn well please in private but right now you need to stand up to the little voice in your head.  “Yeah.  Um, I just–I wanted to say I’m sorry for running out so suddenly like that.”  It didn’t come out as smooth as you’d planned but you’re hoping it came across as sincere enough.  If you could at least look forward to a friendly face at the supermarket every week, well it would be a win.

“Honey, I don’t get offended easily and it seemed like you had places to be.”  She waves a dismissive hand in the air at your apology, not unkindly, more so letting you know you didn’t need to be so formal with her.  And yet you couldn’t help yourself, an unwanted backstory spilling from your lips almost like second nature.  Excuses plucked from the top of your brain.

“I didn’t–I didn’t mean to leave and just not introduce myself.  I just got caught up, with moving and all–”

“You don’t owe me an explanation.  Just your name and we’ll call it good.”  A genuine smile stretches across her face, contagious enough that your lips tug upward as well as you offer your name, a proper introduction this time.

Your shoulders relax ever so slightly, not fully letting your guard down but no longer feeling the need to tense every muscle in your body.  It’s then that you realize that this is the only grocery store that you ever found visually appealing, with its darker toned walls and red checkered floors, the lighting not being so fluorescent and in your face, a bit dim even.  Which for some may be a flaw but for you it was perfect.  You don’t feel so exposed and couldn't be perceived so clearly, the ideal cocktail of a situation for someone so socially anxious.

“I, um, I saw your sign.”  You gesture to the letters reading ‘help wanted’ posted against the window.  If you could land a decent job then maybe living wouldn’t feel so terrifying.  Then again, several things would come into factor other than just your means of income.  

Donnie’s expression turns empathetic and you can feel your breath hitch in anticipation for a brutal rejection.  To be told that you had it all wrong, that you were too unprofessional and too meek and that your help was most definitely not wanted here, that you shouldn’t have even stepped foot in this town to begin with.  The five stages of grief practically take over in mourning over the loss of a potential job.

“I’m real sorry but we already filled the position.  Tom was supposed to take that down around two weeks ago.”  She sounds irritated at the mention of what you assumed to be her coworker.  “Can’t rely on anyone.”  She sighs, striding over to the window and pulling the sign from its temporary home only to abandon it behind the shelf that displayed several boxes of cigarettes.  

“Oh I’m–”

Before you can even begin to apologize for something completely out of your control, Donnie’s eyes light up at something, or rather, someone behind you.

“Hey, Ed!  Isn’t The Bourbon hiring?”

All she receives in return is silence and when you dare to peek over your shoulder behind you, you briefly meet the eyes of the neighbor you had the displeasure of running into twice the day before.  Today he fronts with a black leather jacket and the same black jeans with rips in the knees.  The only thing noticeably different is the chain now dangling at his side and the band shirt you’re unable to read, the letters obscured from your view.  Oh, and a few chunky rings decorating his hand that should make him look tacky as hell but somehow they pull the look together.  

“I dunno, who’s asking?”  He counters, brow raised as he glances at you once more.  You’d barely even spoken a few words to the guy and he was acting as if you committed the most heinous act against him.

“Ed.”  Donnie warns.

“Don, she wouldn’t last a day.”

You were beginning to think that this so-called ‘Ed’ was going to turn into an issue…fast.  Who was he to judge a stranger who he knew absolutely nothing about.  His audacity startled you and while you should step in and defend yourself, you can’t bring yourself to do it, tongue tied in every literal sense, words caught in the back of your throat like they were physical refrigerator magnets lodged in place.

“You don’t know that!”  She grins at him, a grin that silently says ‘watch it’.  “Honey, you got any work experience?”  Attention shifting to you, you felt as if you were burdening two people who had everything figured out in their quaint little lives, guilt plaguing your mind at the fact that you’d shaken things up between what seemed to be good friends or maybe even just well acquainted individuals.

“I–uh–yes.  Yes, I’ve worked at the–at the library and-and–”

“The library?”  Ed questions.  You didn’t dare answer, knowing very well he wasn’t seeking a response.  “What good would that do me in a bar?”

“Well I–”

“Think The Bourbon’s too rowdy for someone like you.”  He continues, only fueling your inner rage as well as pricking the embarrassment that held a permanent home within you, your cheeks flushing hot and palms becoming clammy.

“I’ve also worked at a diner.  Back home.”  Somehow you find a voice, one that isn’t shaky and timid but rather more calm and collected regardless of the absolute fear that pounded in your heart.  

Both Donnie and Ed stare, seconds passing that only feel like lightyears.  Ed still seems bored beyond comprehension, opening and shutting his wallet as he narrows his big brown eyes.  You aren’t sure what to do next, if you should make a dramatic exit once again or continue proving yourself to some stranger who had no business even making you do such a thing in the first place.

“A diner.”  

He says it like a statement rather than a question, as if to mock and discredit you.  

Tears are not an option, tears are not an option.  

“See she’s got experience!”  Donnie attempts to mend the situation, acting as an unofficial moderator.

“Don, no offense but I came here to buy the usual, not recruit.”  Some cash is slapped onto the counter, his patience clearly wearing thin by the way he begs with his eyes.  Donnie’s tolerance appears to be at a dangerously low level based on the glare she forces upon him.  You were beyond unprepared to witness a standoff in the middle of the supermarket at 5:00 PM on a Wednesday.

“Thought you were desperate for a server.”

There’s some bite behind her words, focus never wavering, the two seeming to have a telepathic conversation right before your eyes until Ed breaks the stillness in the air.

“Not in the slightest.  Can I have my shit now?”

Donnie’s sigh lets you know Ed has won and in the process, drained her energy.  Reluctantly, she snatches the cash from the counter and opens the register before grabbing a pack of cigarettes from the shelf behind her and handing them to him along with his change, an unfriendly exchange.  It doesn’t seem to bother him as he clutches the cash and the pack in his hand, not even sparing you another glance on his way out.

Clearing your throat, you pull Donnie’s attention away from the insufferable man now making his way down the cobblestone sidewalk outside.  “It’s okay.  I’m sure other places are hiring.”  

She rolls her eyes and you know it’s not meant for you but you can’t shake the paranoia that screams that she might be fed up with you as well.  “Don’t mind Eddie.  He acts like a hardass but he’ll come around.”

So his name is Eddie.  You only nod in response, unsure of where to steer the conversation from here.

“He’s like a scary dog.  He’ll roll over for the right people.  So if he doesn’t take to you, don’t take it personally.”  She advises.

“Yeah.”  You whisper.  

You were so going to take it personally.

–

As it turns out, no one in Knife’s Edge was hiring, not a single soul seeking a random girl from out of town who urgently needed a job.  Not that you could blame them, they had it all figured out.  Many of the shops were owned by families thus being run by said families and not requiring the additional expense that would come with hiring another person.  And those that did seem to hire outside of their family had already filled in every necessary position.  

Play stupid games, win stupid prizes.  This is what you get for uprooting your life and sticking it somewhere it probably didn’t belong.

And now you were moping along the cobblestone, trying to figure out how to pay the bills, working out how much of your savings you could survive off of until you’d run out.  Then The Bourbon came into view.  Almost like it wanted you to see it, the beaming red lights spelling out its name specifically for you to see.  Mainly because it was the only place you knew to be hiring despite what Ed–or–Eddie–whatever his name was, had said in his unpleasant remarks from earlier.  It seemed to be your only shot at employment.

The bar had a few neon signs flashing in the window, one being the very obvious ‘open’ sign and then of course one that read ‘happy hour’ with a margarita.  The rest appeared to be different beers they might have on tap.  It didn’t look like anything fancy but didn’t seem like a hole in the wall either.  The exterior was paneled in wood just like almost every other building in the area, giving it a cabin feel without actually being a cabin.

Dread settled in the pit of your stomach from just staring at the place so if you were going to act, it needed to be now, before said dread morphed into pure panic.  This was going to determine your foreseeable future, if you couldn’t land this job then you might as well toss yourself right back down that mountain with no money and no plan, right back to square one.

The door was heavy, built out of metal and a bell ringing just above, notifying any staff and patrons of your presence which you could do without but you had to push yourself.  If they were staring, your gaze was glued to the ground and you didn’t notice, too occupied in rehearsing an improvised script in your head.  Some kind of rock or metal song blasted through the bar and you weren’t sure if it was overstimulating or comforting.  Your initial thought was that for being in a small town, they would be inclined to play country music so it only relieved you that your possible future workplace wouldn’t be subjecting you to the unbearable twang you just couldn’t seem to stand.  You’d endure it when all was said and done but it was appreciated that it was one less nuisance in your life.

It was a standard bar, the atmosphere mellow with dull lighting and a haziness smelling of tobacco swirling throughout the room.  What immediately drew you in was the obvious game of bingo, suddenly shifting what was a designated spot for happy hour and a cheap therapy session with the bartender into a retirement home full of seniors.  A man that looked to be in his fifties sat on a stool on the tiny stage in the corner, calling out numbers, which elicited a few victory yells from those who had obviously been having better luck.  

However odd the scene may be, several senior citizens occupying the tables of a bar at happy hour, business still seemed to be booming considering that it was a weekday.  Aside from the group of elderly yet energetic individuals, there were also what looked to be the regulars perched on their assigned stools at the actual bar.  They paid no mind to the intense game happening behind them, sipping away at their beers and mixed drinks leisurely.

A vacant seat called to you, two more on each side guaranteeing that you could sit comfortably without awkwardly scooting in next to someone and disturbing their possible winding down time, no doubt trying to blow off some steam after work.  That’s why people came to bars, right?  It was lost on you, this wasn’t your scene and if you’re truthful, you’re not even sure you should be here begging for a job in the first place.  That Ed guy clearly didn’t take a liking to you and though you didn’t exactly have any knowledge on his role within The Bourbon, he seemed like he had a say in the day to day operations just based on the tiny snippets of information you picked up on.  Hopefully someone with the same level of authority would be working now and actually respect you as a person enough to at least give you a chance.  

Playing it cool—as cool as one could be with constant nagging thoughts and shot nerves, you decide to plant yourself down on the stool, the worn leather material partially squeaking in protest as you wiggle into a comfortable enough position, setting your bag in your lap and clutching it in paranoia.  A glance from the left to the right and back to the left lets you know that no one seems to mind your presence though you still close in on yourself regardless, taking up the least amount of space possible.

The bartender, a man maybe in his early twenties who had short dark hair seems preoccupied as he shakes a drink while balancing a conversation with another man at the end of the bar, the two laughing every other sentence like old friends.  And so you wait.  Never intentionally draw attention to yourself and never disturb anyone else’s night until you find it polite to chime in when the bartender doesn’t seem as busy.  Even then, he doesn’t hear your small ‘excuse me’ every time he rushes by onto his next task.

A sad little ghost settled among lively customers, you don’t seek pity, only a glance your way so that you could get this over with and either face rejection or anxiously resume the job search.  Though no one seems to bother looking your way, you can’t help the heat traveling to your cheeks in pure humiliation, the fact that you’re the only thing out of place weighing heavily on your mind.  More celebratory howls and yells sound from behind you, the room erupting into laughter shortly after from a joke you didn’t care to understand.  Even a few select chuckles are heard from the men scattered along the bar.

“Do you just not listen?”

A familiar voice breaks through your thoughts, forcing you to peek up from where your focus remained on the bartop, where moments before you’d seemed entranced by the surface.  In reality you were running in circles in your head, hoping to make sense of your current situation.  Through your lashes you saw him.  Ed.  Or Eddie.  You didn’t put much effort into feeling too bad for not remembering his actual name, especially when he’d never even had the decency to ask for yours.  His leather jacket was absent from his torso, now only showing off a plain black t-shirt that also allowed you a view of various tattoos scattered along his arms.  You were first drawn to the faded bats on his forearm before becoming puzzled by what seemed to be some kind of a doodle on his inner bicep, not a very good one at that.  And then you remembered he’d asked you a question.

“I’m not allowed to have a drink?”  You ask innocently.  Genuine innocence.  No sarcasm.  You weren’t brave enough for that.

“Only if you’re not here to also beg for a job.”  He grumbles.  A man a few stools over gestures down for another round and in response, Eddie nods coolly.  With a certain kind of smoothness, he pulls a new glass out before slamming it down on the counter.  “If you are, the answer is still no.”  The way he quickly pours liquor into the shaker seems so effortless, measurements probably burned into his brain that allow for more efficiency on busy nights.

“Can I at least speak to someone in charge?”  You do your best to keep your voice steady and unwavering in the presence of someone with infinitely more confidence than you, his eye contact never breaking.

“You’re lookin’ at him, doll.”

His voice drips with his signature condescending tone, the corner of his mouth pulled up slightly in a smirk.  One that tells you that you’ve hit a dead end. 

“You—oh.”  Like an idiot, you swallowed any words that bubbled in your throat, unable to find it within yourself to at least come up with a snarky comeback.

“We’re not hiring.”

“That-that’s not what Donnie said.”  Lousy.  The argument just seemed to fall from your tongue involuntarily, not much thought put behind it before coming to fruition.  It would only give him more ammo.

His eyes further surveyed you, meticulously analyzing your every move, every twitch of every muscle in your face.  An unwanted spotlight shining on you, revealing every flaw in your approach to the current conversation.  You wanted a job and he wanted nothing to do with you, your last statement only sealing your fate, only giving him more reason to deny your advances.

“Donnie doesn’t work here does she?”  Without expression, he begins expertly shaking his concoction, forearms flexing with the movement.  He was a character, some kind of figment of your imagination.  He had to be.  You’d never encountered someone so standoffish, so ill-tempered, especially toward someone he’d never even met before, already passing judgment on you based on seconds of interaction.

Ignoring his rhetorical question, which came off as more of a deterrent than anything, you pursue a fair conversation, a deserving interview at the very least.  “Listen, I’m a really hard worker and—“

“And a fast learner right?”

The interruption was unwelcomed though you gave no indication that it was, face set in a straight expression as you processed his uncivil personality.  You couldn’t even find it in you to convey shock, your brain malfunctioning upon his words, outdoing himself with every sentence he uttered.

“Well, yes.”

“Of course.  And you can multitask too I bet?”

This wasn’t the interview you were hoping for, this was downright degrading.

“If you would just let me talk.”  You plead, fingers digging into the wood of the bartop.

“Listen, kid.”  The liquid he had been shaking for quite some time is poured into the glass, an amber colored liquor filled to the brim.

Kid?  

If you had the guts you would degrade him right back.  But you were you and you could only sit and take each hit to your fragile mental state with as much grace as possible.  And soon after the tears would come.  Not yet, though.  Not just yet.

“You look like you’re about to cry and you haven’t even been hired.  What makes you think you can handle a full house on a Friday night?”  The drink is topped off with an orange twist and a black cherry before he slides it to its awaiting consumer, not a drop spilling over the edge of the glass, clearly a perfected craft that he was proud of.

When he’s met with silence you gather that he thinks he’s won just by the smug look on his face, barely there but still evident nonetheless.  That little voice inside your head screams at you to keep pushing, keep bugging him until he has to give in.  Even if by pure annoyance.  And although you can feel yourself trembling in terror, something urges you to just gulp down the fear and prod at the arrogant man just beyond the bar.

“I work well under pressure, I’m very organized, I’ll clean on my down time…”  You begin to list off your abilities and if he wanted to stop listening, the way he glared at you wasn’t convincing you that he was going to.

This time his response is delayed rather than the other way around, suddenly at a loss for words as his large eyes take in your sudden change in demeanor.  Your slight assertiveness takes him by surprise, you can tell from his mouth opening and closing like a goldfish.  It’s all a front for you to at least get one foot in the door but as they say, ‘fake it ‘til you make it’.

“No.”  He answers suddenly, sternly.  His disinterest is obvious when he pulls out a rag and starts wiping down the counter, no longer letting his gaze fall on you but instead, the droplets he works vigorously to clean up.

If he wants a fight, then a fight he shall receive. 

“I’m a team player, I’m super reliable, my time is flexible, if you need me in a pinch consider it done–”

“Do you understand social cues?”  

Ouch.  If you had an inflated ego it would’ve surely been destroyed by now but you were already working with close to nothing.

“Yes.”  You reply, not a trace of sarcasm, only an honest answer.

“So I think by now you’d understand.  We.  Are.  Not.  Hiring.”  Each word is enunciated and slathered thickly with bitterness, topped with the intention to send you running like a dog with its tail tucked in between its legs.  

What he doesn’t know is that your soft spoken voice and bashful exterior isn’t all there is to you and that deep down, if you wanted something, you were stubborn and able to manipulate the situation should it be required in the most dire of situations.  Whether it would work on him seeing as he was also just as stubborn, if not more, you weren’t sure yet.

“Are you turning me away because I’m a woman?”  

The pure horror in his eyes almost makes you chuckle because now you know you have the upper hand and had anyone overheard, they would probably question their beloved local bartender’s work ethic.  

“I mean–not that I’m accusing you…”  You were definitely accusing.  “I just don’t see any other women working and–”

It doesn’t have the effect you’re hoping for as he leans toward you, forearms resting on the bar, his eyes returning back to their spiteful nature while he taps his clunky rings against the surface in thought.

“I’m turning you away because you don’t belong in a place like this.  Things can get rough and you’re…too dainty.”  His voice is much more hushed than before but his expression remains serious, without a trace of that stupid smirk.

Dainty?  Dainty.  Noted.

“What–you don’t think a woman can handle–”

“It’s not about you being a woman.”  He seethes.  “It’s about the fact that you are dainty.  Polite.  Shy.  I can’t have that when I’ve got a few drunks refusing to leave at 2:00 AM.”  

“I know when to hold my own.  Especially if it's for a job.”  You attempt to convince him.

“What, so you’re just gonna respectfully tell them to leave, then what?  These guys get out of hand, I can’t be babysitting you, I’ve got a business to run.”  He reasons, straightening his posture, conversation already forgotten as he starts to turn away before you speak up again.

“At least let me prove you wrong before you dismiss me.”  You quietly demand, hands clasped in front of you.  “Think I can handle a group of senior citizens.”  You motion to the intense bingo game still going strong behind you.  

With a roll of his eyes, he seems to ponder his thoughts, bouncing them around in his head.  An exasperated sigh escapes his parted lips while a hand drags down his tired face.  

“One night.  A trial.  If you can handle it, fine.  You’ve got a job.”  He finally declares.  “But if I have to stop what I’m doing to babysit you or you so much as–”

“I’ll find another job.  Promise.”  You nod persuasively, a glimmer in your eyes that he doesn’t miss but quickly ignores.

“Good.  Tomorrow night.  Eight.  And just this one time you can park in the back lot.”

He tries to dismiss himself again but your next question forces him to linger a little bit longer.  He was patient, you’d give him that.

“Wait–what, what’s the dress code?”  You ask sheepishly, a contrast to the business woman you’d molded into just seconds before.

He does a once over, as if to judge your fashion choices but what he ends the conversation with only leads you to think that he favors one word way too much.  

“Casual.  Nothing too dainty.”

~end~

Masterlist

Prev | Next

tags - @gravedigginbbydoll @ohauggieo @spicysix @lunatictardis @ali-r3n @batkin028 @mrsjellymunson @witchwolflea @emma77645 @emxxblog @eddiemunson95 @angietherose @lottie-90 @sheneedsrocknroll92 @pullingattheroots @avalon-wolf @vintagehellfire @cryingglightningg @foreveranexpatsposts @winchester-angel

[plumbits]

Leptospirosis: What it is, what it does, and how you can protect yourself and your pets.

People always have questions about leptospirosis (lepto) when they come into the clinic, especially in regards to the vaccine. This post will hopefully clear up those questions or any confusion regarding lepto and its vaccine, and why it's so serious. The information in this post comes from my formal education as a LVT, as well as other sources including the CDC, PAHO, and AVMA. If I missed anything or you see something that's incorrect, please let me know!

First and foremost: What is leptospirosis?

Leptospirosis is a bacterial disease that effects human and non-human animals. It's caused by bacteria in the genus Leptospira. In humans, it can cause a wide range of symptoms that can be very general. This leads to misdiagnoses. Animals such as dogs, livestock, and certain wildlife are all susceptible to infection.

How is leptospirosis spread?

Lepto is most often spread through contact with the urine of an infected animal. This is especially the case (but not the only case) with wild rodents. Infected dogs can seem healthy, but still pass the bacteria on in their urine. In urine-soaked soil, the bacteria can survive for weeks to months.

Dogs typically become infected when their mucous membranes or open wounds come into contact with urine or urine contaminated surfaces (like soil or water). Infection can also be spread through urine-contaminated bedding or food, or the tissues from the carcass of an infected animal. There have been rare instances where lepto has been transmitted by bite or breeding. A pregnant dog who is infected may pass the bacteria to her puppies through the placenta.

Humans contract lepto pretty much the same way: through contact with urine from an infected animal or urine-contaminated surfaces.

What are the signs and symptoms?

In humans:

High fever

Headache and muscle aches

Chills

Jaundice

Vomiting and diarrhea

Redness of the eyes

Abdominal pain

Rash

Humans can also be asymptomatic, which is particularly concerning. It usually takes anywhere from 2 days to 4 weeks post-exposure to the infection source before any symptoms are displayed. The illness begins abruptly and it may occur in 2 phases. The first phase is where you will see a lot of the general symptoms listed above. The person infected may recover for a period of time, but become ill again. The second phase is more severe, leading to kidney or liver failure, and possible meningitis. The illness can last a few days to 3 weeks or longer.

Without treatment, recovery can take several months.

In dogs:

Signs and symptoms may vary slightly depending on the strain of the infected bacteria. The signs are also very general in dogs, but the most common ones include:

Loss of appetite

Vomiting and diarrhea

Lethargy

Abdominal pain

Jaundice

Dehydration

Increased thirst and urination

Weight loss

Stiffness or muscle pain

The disease can also progress to kidney and liver failure in dogs, with damage to other organ systems also noted in the literature. Lepto can also cause bleeding disorders, which can lead to blood in urine, vomit, feces, or saliva, and petechiae on the mucous membranes or light colored skin.

Who is most at risk?

For humans, those who are most at risk include those who work with animals or outdoors where you come into contact with wildlife. The Pan American Health Organization (PAHO) also mentions that sewer workers and military personnel are at-risk populations. Farmers (and generally people who work with livestock) also make the list, as do veterinarians, veterinary technicians, and veterinary assistants.

For dogs, it's all of them. "All dogs are at risk of leptospirosis, regardless of age, breed, lifestyle, geographic location, time of year, and other factors." (source: AVMA)

Situations that can increase the risk of your dog contracting leptospirosis are listed below:

Exposure to drinking from slow-moving or stagnant water sources (this includes puddles)

Roaming on rural property

Exposure to wild animals or farm animals, even if it's only in the yard

Contact with other dogs (such as in urban areas, dog parks, boarding, or training facilities.

How is leptospirosis treated and diagnosed?

Disclaimer: I am NOT a medical doctor or DVM, but I am an LVT. If you think you're experiencing these symptoms, PLEASE go see your doctor. If you think your dog or any of your other animals are experiencing these symptoms, PLEASE take them to your vet.

Diagnosis in non-human animals:

Unfortunately, routine blood tests alone cannot diagnose leptospirosis. That's why it's important for your vet to use all information available to them (i.e. diagnostics, signs and symptoms, lifestyle, etc). There WILL be abnormal results for blood work, most likely high liver and/or kidney values and high white blood cell count. There are specific tests available for diagnosing lepto, such as the DNA-PCR and MAT tests. Both may be needed to reach or confirm a diagnosis. False negatives are possible, so your pet may be treated as if they have leptospirosis, even if the test results are negative. False positives are exceedingly rare.

Diagnosis in humans:

Leptospirosis is diagnosed in a similar fashion in humans. A physical exam, blood work, and urinalysis will likely be run. The same style of tests are used: DNA-PCR and MAT.

Treatment in non-human animals:

Leptospirosis is treated with antibiotics and supportive care. Doxycycline is most commonly used, and will likely be prescribed for 2 weeks or more. Supportive care includes hospitalization with IV fluids and management of electrolyte levels. Additional medications and procedures may be necessary.

Treatment in humans:

The treatment is similar in humans, with antibiotics (usually doxycycline). Your doctor may also suggest to take ibuprofen and monitor yourself at home for less severe cases. If the case is severe, then you'll likely spend time in the hospital. Additional medications or procedures may also be necessary.

Outcomes:

In non-human animals:

Leptospirosis is responsive to treatment with antibiotics. Complete recovery is possible, but some animals that survive may be left with chronic kidney and liver disease. Some animals may not survive if the infection has gotten to the point where it causes severe organ damage or the ability of blood to form clots.

In humans:

You can survive leptospirosis. Most cases have either very mild symptoms that go away on their own, or none at all. Without treatment, leptospirosis can cause kidney damage, meningitis, liver failure, trouble breathing, and even death. PLEASE go see a doctor if you think you're experiencing any of these symptoms, especially together.

Prevention

How can you prevent infection and protect your pets?

For dogs, there's the leptospirosis vaccine. This is an annual vaccine that vaccinates against multiple strains of Leptospira. If you're worried about your dog having a vaccine reaction, let your vet know and they can administer an injection of diphenhydramine (generic benadryl) beforehand, OR you can ask them what the appropriate dose is for your dog and give them the respective amount at home (in tablets or liquid). Vaccine reactions are uncommon, but if they do happen, it's usually immediately after exposure to the vaccine. You can ask to stick around in the lobby/waiting area of your vet clinic for a few extra minutes if you're still concerned.

Limit your dog's access to standing water. Don't let them drink from it. Prevent rodent problems where you can by properly storing food items in appropriate containers, securing your garbage, and patching up any access points into your house if you see them. Try to avoid contact with wildlife, when possible.

For humans, the recommendations remain similar. Don't wade or swim in stagnant water, ESPECIALLY if you have open wounds. Avoid contact with wildlife. WASH YOUR HANDS, often and appropriately. USE PPE if you work in a veterinary setting and properly clean and disinfect surfaces and equipment. Make sure you know or research the area that you're in if you like swimming and boating. Check to see if there have been any recent lepto infections. Cover your scrapes and wounds with waterproof bandages and wear water shoes if possible.

I hope this post answered a lot of your questions! Thanks for reading.

Sources under the cut.

Sources:

[beardedmrbean]

Brownsville, Texas — Federal officials say more than 200 patients could be at risk of fungal meningitis after having surgical procedures at clinics in a Mexico border city.

The federal Centers for Disease Control and Prevention said Wednesday it is collaborating with the Mexican Ministry of Health and U.S. state and local health departments to respond to the outbreak among patients who traveled to Matamoros, across the border from Brownsville, Texas.

Officials have identified and closed two clinics linked to the outbreak, River Side Surgical Center and Clinica K-3.

The Mexican Ministry of Health sent the CDC a list of 221 U.S. patients who might be at risk for meningitis based on their recorded surgical procedures at either clinic from January to May 13. Three additional patients not on the list have also been identified, bringing the total of people in the United States known to have potential exposure to 224, the CDC said.

The CDC is working with more than two dozen state and local health departments to contact people with potential exposure and urge them to go to their nearest medical facility for testing. Meningitis testing includes an MRI and a lumbar puncture, also called a spinal tap.

Last week, the CDC issued a warning to U.S. residents to cancel surgeries in Matamoros, saying five people from Texas who had procedures there developed suspected cases of fungal meningitis. One of them died. A second person with a suspected case has also died, the CDC said Wednesday.

Meningitis is the swelling of the protective covering of the brain and spinal cord and should be treated urgently. Symptoms include fever, headache, a stiff neck, nausea, vomiting, confusion and sensitivity to light. Cases of meningitis can be caused by viruses, bacteria, trauma or fungi.

Patients in the Texas cases started showing symptoms three days to six weeks after surgery in Matamoros.

People leaving the U.S. for prescription drugs, dental procedures, surgeries and other medical treatment - also known as medical tourism - is common, experts say. Mexico, Canada, India and Thailand are all popular destinations.

[whump-queen]

3, 11 and 22 for the ask game :)

Thanks for the ask! <3

3. Least favorite type of whump?

I don’t typically seek out nsfw whump, I kinda prefer good clean torture sesh you know? That being said I can think of a few exceptions where nsfw occurs but isn’t the primary focus.

not usually a big fan of like sick fic or pure caretaking scenarios that don’t involve someone getting hurt first.

Lady whumpee and male whumper is a no-go for me, although it can be a different story with a lady whumper

I’m kinda a germaphobe so anything that’s too ‘gross’ like contagious disease, throwing up, bacteria, bugs etc

11. Favorite whump blogs?

there are so many! I’ll tag a bunch that I can remember off the top of my head but if I miss any I’m sorry, just know the list is nonexhaustive :)

@whumpsday @deluxewhump @whumpshaped @brutal-nemesis @straight-to-the-pain @painsandconfusion @morning-star-whump @pretty-face-breaker @kim-poce @whumpwillow @emmettnet @darkthingshappen @oddsconvert @whumpndump (yes you lol)

22. Most controversial whump opinion?

I don’t know if I’d call this controversial as I’m probably preaching to the choir here, but the trend of whump blogs/writers feeling like they have to put these long disclaimers saying they don’t condone any violence irl and it’s just fiction etc etc, I think that should go without saying. We shouldn’t have to constantly defend ourselves and prove our morals to random people on the internet over fictional content.

Like, we’re all in charge of cultivating our own internet experience. If someone doesn’t like the content a user posts, unless the content is actively causing harm, they can go ahead and scroll on by ✌️

[ooferdanoob]

Edit: some of the vani here may or may not be scrapped lol ( this story thing is a project after all )

Currently figuring out some things for a fan kenopsia story. Wiltawitha will no longer be a disease vani and will instead be a fungus vani! I figured that her Quirk would be more fitting for fungus since Fungi eat decaying matter. ( and her quirk is basically things decaying whenever she touches things. )

I currently have a few ideas in mind for the vani team and their quirks, I just don't have any names for most of them yet lol. So here's a list of the elements I'll be having for the team with their quirks!

1. (Malariac) Flesh vani of deformity ( caused by disease not disorder )

2. Plant vani of plant related allergies

3. Slime vani of bacteria and stomach bugs.

4. Radiation vani of radioactive light fixtures

5. Plasma vani of nerves

6. Spirit vani of Paranoia

7. (Wiltawitha) Fungus vani of decay

8. Sugar vani of prions

9. Music vani of hallucination

10. Disease vani of unnatural causes

Ig that's what I have so far for today, if you have any questions you can always ask! ^^

[thejackofalltrades42069]

Chronic alcohol use (its consequences).

I’ll start by defining what chronic alcohol consumption is, then list the negative effects. I won’t get too much into detail in this post to avoid giving confusing information.

------------------------------------------------------------------------------------------------------------------------------------------

The chronic consumption of alcohol isn’t necessarily being an alcoholic, being an alcoholic is much worse. What consuming alcohol chronically means is drinking about 4 or more drinks a week, it could mean taking 4 drinks 1 day of the week, it could mean taking 1 drink 4 days of the week. Depending on the drink, your weight, if you ate something right before drinking, your genetics, etc, even 2-3 drinks a week could mean chronic drinking, and it has negative consequences.

Ethanol is the alcohol we can drink, it could be defined like a poison we can tolerate, but that will hurt us, it can kill people if they drink enough in one day or overtime.

Many people are used to drink a lot more than 4 drinks a week, the suggestion would be to drink less, whatever the case, it’s only negative results from drinking, and the more you drink, it will be worse. What I’m trying to do personally is to cut down drinking to 2 drinks a week or less, especially after learning all this information that’s unknown to many people and that many times is disregarded.

------------------------------------------------------------------------------------------------------------------------------------------

Here's the list of some consequences for chronic consumption with a small explanation:

-Dehydration. Alcohol will purge your gut, both liquids and solids will come out faster than they usually do, this will cause dehydration. The best way to recover is to drink electrolytes right after drinking alcohol.

-Headaches. Being hungover means you’ll get a headache for different reasons like dehydration and because your whole body took a beating when drinking alcohol.

-Stress and anxiety increase. Whenever alcohol enters our system, we have a “stress response”, our body releases epinephrine (adrenaline), cortisol, dopamine, etc. The more someone drinks, the more stress responses their body will have. Alcohol also means your sleep will not be as good as it could be, not sleeping well enough means more stress.

-Worse sleep. It’s been long studied and proven that even if you only have 1 drink (especially in the evening or later), your sleep cycle will be interrupted multiple times at night, the brain activity is different when we have alcohol in our system, and that will lead to have a sleep that is not as recovering as it would usually be (even if you feel like you had a more deep sleep, that’s not the case really). Adding to this the stress that drinking creates, more stress also affects sleep.

-Damages to your gut microbiome. Alcohol will kill many bacteria in your gut, good and bad, that worsens the condition of your gut microbiome or gut flora. It will also irritate your gut, it can cause pain and discomfort the next day, it can lead to gastritis or even ulcers overtime.

-Liver damage. Your liver must work harder than usual to convert ethanol into something else you can digest, if you drink enough overtime, you can get a liver disease like cirrhosis. Here take into consideration many anti-inflammatory medicines also make your liver take a beating/ work a lot harder, the consumption of alcohol or the combination of alcohol and some medicines can be very bad for your liver overtime.

-Testosterone decrease, increase in estrogen. This happens with chronic use, some studies suggest you get higher testosterone if you drink a little, but not the case with chronic drinking. These unbalances and decrease in testosterone aren’t good for anyone.

-During pregnancy, it damages the fetus development. This is self-explanatory, don’t drink anything at all if you’re pregnant, it will hurt the development of the body and brain of the baby.

-Becoming more impulsive. Alcohol affects how parts of the brain interact with each other; it specifically makes your frontal lobe thinner (lower density of gray matter in the frontal lobe). The frontal lobe has many functions, such as helping us control our impulses, also tied to movement, speech, etc. The reason many people who drink overtime become more impulsive is because the alcohol is affecting the brain negatively, this together with making the person who drinks chronically stressed overtime, no wonder why people become so angry and impulsive.

-Increased chances of getting cancer. This sounds probably like the worst; our body usually spends a lot of time healing/ repairing different parts of our body, our immune system usually protects us from getting cancer by killing cancer cells. When we drink alcohol, a lot of the repairing stuff going on in our bodies is interrupted, the more someone drinks, the more risk that person will have getting cancer. There’s very clear evidence about this.

------------------------------------------------------------------------------------------------------------------------------------------

There are some more negative consequences, the list could go on, but I think this is enough for this post. I'd say that any "positive effects" from drinking alcohol that people can come up with are completely crushed by the negative consequences. Anyone can enjoy 1 drink a week or maybe 2, as long as it's not chronic consumption of alcohol.

------------------------------------------------------------------------------------------------------------------------------------------

Here’s some bibliography:

A few short videos about this:

[oliviajames1122]

Acid Reflux Symptoms, Acid Reflux and Breathing Issues Causing Bad Breath

Changes in how we eat and live have had an impact on our waistlines as well as our susceptibility to heartburn. Heartburn and respiratory difficulties are now connected, according to new studies.

This post is dedicated to answering the numerous questions that individuals have about acid reflux breathing issues. You've come to the correct place if you've ever wondered if indigestion can cause shortness of breath, if acid reflux and asthma are linked, or if heartburn is the source of your bad breath.

Continue reading to the bottom to learn the seven most significant facts concerning breathing and excessive stomach acid, as well as how to improve your heartburn, breathing, and sleep quality by changing your lifestyle many business listing.

1. In a nutshell, acid reflux

Most people will get the unpleasant sensation of esophageal burning at some point in their lives. The rush of digestive secretions might take your breath away in some situations. Acid reflux is a highly uncomfortable, yet all-too-common problem.

Many people still believe that too much stomach acid causes heartburn. This, too, is a misconception, similar to the flat earth belief. Heartburn occurs when your stomach's acidic digestive juices re-enter the esophagus (where they shouldn't be).

The esophagus, commonly known as the gullet, is a tube that connects the mouth to the stomach and is separated from it by a valve called the *lower esophageal sphincter. Stomach acid might be forced upwards and harm the delicate lining of your esophagus if the valve doesn't close properly or opens too frequently business listings.

If this happens more than once a week, it could be an indication of Gastro Esophageal Reflux Disease (GERD or GORD), a disorder in which the esophagus becomes inflamed as a result of stomach acid injury. GERD can cause the following symptoms:

Regurgitation

Heartburn

Chest pain

Vomiting

Sore Throat

Coughing

Wheezing

Bad Breath

2. Bad breath due to acid reflux

Chronic heartburn causes GERD foul breath, which is an unpleasant symptom. Stomach acid can destroy hard tissues and tooth enamel if it gets into the mouth. This generates holes in which bacteria can grow and multiply by trapping food.

Your dentist can usually detect whether foul breath is caused by acid reflux or by poor dental hygiene and smoking, both of which induce oral micro biome symbiosis. Teeth erosion, redness around the tonsils, tongue and gum inflammation, and bad breath are common symptoms of GERD free listing.

3. GERD, acid reflux, and breathing difficulties

Is GERD a cause of shortness of breath? Yes, GERD is connected to a variety of respiratory symptoms, including wheezing, chronic coughing, and shortness of breath. According to one study, 30–80% of persons with asthma also had GERD.

Despite the fact that studies demonstrate that GERD and lung problems frequently occur together, the relationship between the two is still unknown. For example, GERD breathing problems are linked to a variety of respiratory illnesses.

Pulmonary disorders linked to GERD

Bronchial asthma

Chronic obstructive pulmonary disease

Pulmonary aspiration complications

Obstructive sleep apnea syndrome

Bronchitis

Pneumonia

Includes lung abscess, bron Nchiectasis, aspiration pneumonitis

4. Is it possible for acid reflux to produce shortness of breath?

Shortness of breath (dyspnea) due to acid reflux is common at night. Acid rises in the back of the throat, where it can enter the lungs and cause swelling of the airways. Symptoms of acid reflux in the lungs, such as coughing and choking, are caused by this.

Asthma and respiratory symptoms are more common in young individuals with nighttime reflux breathing issues (especially coughing). Researchers have also discovered a link between GERD and obstructive sleep apnea syndrome (OSAS), a disorder in which breathing is disrupted while sleeping, affecting oxygen levels in the body.

5. Shortness of breath due to GERD

Stomach acid has been shown in studies to irritate the windpipe, affecting breathing. However, esophageal acidity can produce GERD wheeze by triggering the vague nerve, which signals the lungs to tighten (bron choc on striction).

6. Asthma, GERD, and shortness of breath

Asthmatic patients frequently experience heartburn, shortness of breath, regurgitation, and dysphasia (when the esophagus contracts and makes it difficult to swallow). This could be due to the pressure created by coughing and wheezing, which can be strong enough to drive stomach acid up the esophagus.

The association between GERD and asthma is now undeniable, regardless of the reason. As a result, clinicians are now looking for GERD in asthmatic patients, particularly if:

They were diagnosed with asthma as adults.

After eating, exercising, or resting down right after a meal, episodes occur.

Despite treatment, their condition continues to deteriorate.

7. How might acid reflux cause shortness of breath?

Because acid reflux can create breathing problems, addressing the problem at its source – acid reflux — is beneficial. Heartburn is intimately linked to lifestyle choices, physical fitness, and diet, which means that simple modifications can help prevent regurgitation, acid breath, heartburn, chest discomfort, and GERD dyspnea.

Risk factors for GERD

Excessive eating or eating at wrong times

Smoking, alcohol, and chocolate

Too much acidic and fatty food slouching, poor posture, tight clothes

Obesity

Stress

Lifting heavy weights

Certain medical conditions and medications

Acid reflux is a serious condition that should not be disregarded. Digestive juices are corrosive to the esophageal lining, causing cellular changes that increase your risk of Barrett's esophagus, which is linked to an elevated risk of esophageal cancer.

Fortunately, there's a lot you can do right now to lessen heartburn symptoms. These steps will benefit both you and your gut micro biome’s general health:

Quit smoking and limit stress

Work towards and maintain a healthy BMI

Choose small meals and avoid overeating

Find out what foods trigger your acid reflux

Avoid fatty foods and fill up on fibre instead

Cut down on alcohol and caffeinated drinks

Avoid wearing tight pants and belts

Stop eating 2–3 hours before going to sleep

Sleep with your upper body elevated

When should I make an appointment to see a doctor?

It's time to see a doctor if you have acid reflux more than twice a week or if your symptoms are severe. Similarly, you should see a doctor if drugs and lifestyle changes haven't provided long-term relief. Always inform your doctor about any medications you're taking, as some can exacerbate GERD symptoms.

Because breathing issues and acid reflux can be signs of a variety of conditions, your doctor may do a few tests to rule out the possibility of a serious illness. Ulcers, esophageal constriction, pH levels, and tissue anomalies are among the things they may need to look for.

As a result, your doctor may propose an endoscopy (a procedure in which a small tube with a tiny camera is placed into your esophagus and samples are taken) to determine the cause and determine the best treatment option for you.

To manage your problem, your doctor may recommend that you start with lifestyle modifications, such as stopping smoking and avoiding fatty meals, in addition to anti-reflux medication. Surgery may be required in some circumstances, such as hiatal hernia.

[wyrmfedgrave]

Pics: Cartoonists concerns on climate change.

1 & 2. Climate denial has become a very well paying job in corporate America.

Sadly, many normal folk still don't get it...

We're not killing the planet - even our best bombs can't do that!

What we're doing is killing ourselves, by producing green house gasses.

A floating garbage that traps the sun's heat in our atmosphere & raises the air temperature, enough to affect - or kill - people & animals.

3. There was a growing public realization about the problem.

But, no industry wanted to lose any money in trying to fix things.

This is a capitalist country, after all.

And, we care mostly about making money...

4. Or course, an ignored problem doesn't go away - it only gets worse!

And, it joins the list of other problems that we've 'avoided' or didn't fix properly.

Now this (& our ever rising prices) only make a true fix much more expensive!!

5 thru 7. Finally, with the evidence of ever worsening weather disasters, most folk came to the realization that scientists weren't lying!

It was mostly Big Oil that lied about the danger & forged 'scientific studies' to delay having to do anything too expensive.

Unsurprisingly, these corporations still deny that there's a problem - or, that things aren't bad enough for them to do anything about it...

8. Climate change continues to get worse.

All estimates about its danger were found to be underestimated!

Temps are going up faster - already forcing some people to leave their homes.

Antarctica's glaciers are melting way faster than once predicted - causing coastal inundations from rising seas.

Some once frozen bacteria have been found to be 'awakening' - leading to fears of ancient diseases.

Yet, the bitter U.S. election, the Middle East massacres & Rump's 1st trial have shoved climate change out of most news sites.

Luckily, there's still folk who continue to test new ideas in reversing an already disasterous danger.

Hopefully, a solid answer will soon be found...

End.

[legionellariskassessments]

The Definitive Guide to Legionella Testing in the UK: Unraveling the Best Company

Legionella, a sneaky adversary lurking in water systems, poses a significant threat. In the United Kingdom, where concerns about water safety are paramount, choosing the right company for legionella testing becomes imperative. Whether you're a business owner, a facility manager, or just someone keen on safeguarding health, finding a reliable partner is crucial. In this guide, we'll unravel the intricacies and explore the best company for legionella testing in the UK.

Understanding the Legionella Conundrum

Before diving into the world of Commercial Legionella Risk Management, let's grasp the gravity of the situation. Legionella bacteria, notorious for causing Legionnaires' disease, thrives in water systems, especially in complex plumbing networks. Imagine it as a clandestine saboteur, silently spreading its influence. Now, the question arises: How do you identify its presence and thwart its nefarious plans?

Why Legionella Testing Matters

Legionella testing is not merely a checkbox on a safety protocol list. It's your detective tool, your Sherlock Holmes in the realm of water safety. Imagine your water system as a bustling city, and legionella as a cunning infiltrator. Would you let an unknown assailant roam freely in your city? Of course not! Similarly, you shouldn't allow legionella to linger in your water systems undetected.

The Quest for the Best: Unveiling the Top Contender

In the vast landscape of legionella testing companies in the UK, one name stands out like a beacon of reliability: SafeWater Solutions. Here's why they are the go-to choice for legionella testing, making them the best in the business.

The SafeWater Solutions Advantage

1. Unparalleled Expertise

SafeWater Solutions doesn't just conduct tests; they orchestrate a symphony of expertise. It's like having a seasoned maestro leading your water safety orchestra. With years of experience, their team of experts is well-versed in the intricate dance of legionella detection. They don't just identify the presence of legionella; they decipher its moves, ensuring a comprehensive understanding.

2. State-of-the-Art Technology

In the world of legionella testing, outdated tools are akin to sending a carrier pigeon in the era of smartphones. SafeWater Solutions employs cutting-edge technology that's like having a legionella-seeking superhero at your disposal. Their advanced testing methods leave no room for ambiguity, ensuring accurate and swift results.

3. Tailored Solutions

One size doesn't fit all, especially when combating legionella. SafeWater Solutions understands this, offering bespoke testing solutions tailored to your specific needs. It's like having a custom-tailored suit – a perfect fit for your unique circumstances.

4. Proactive Approach

Picture this: you detect a storm on the horizon, and instead of waiting for it to hit, you prepare in advance. SafeWater Solutions embodies this proactive approach. They don't just identify legionella; they equip you with the knowledge and tools to prevent its resurgence. It's like having a weather forecaster for your water safety.

5. Seamless Integration

Legionella testing should seamlessly integrate into your existing safety protocols, not disrupt them like a bull in a china shop. SafeWater Solutions ensures a smooth, hassle-free integration, like adding a new player to your winning team without missing a beat.

Frequently Asked Questions

Q: Why is legionella testing essential for businesses in the UK?

A: Legionella testing is the guardian of public health in water systems. It's the shield against Legionnaires' disease, ensuring a safe environment for employees and customers alike.

Q: How often should legionella testing be conducted?

A: The frequency depends on various factors, including the type of facility and its water system complexity. SafeWater Solutions tailors testing schedules to your unique requirements.

Q: Can't we rely on traditional testing methods? Why opt for advanced technology?

A: Traditional methods may miss subtle legionella traces. SafeWater Solutions' advanced technology leaves no room for ambiguity, ensuring precise and reliable results.

Navigating the Legionella Testing Landscape

Choosing the best company for legionella testing is akin to selecting a trustworthy guide through uncharted waters. SafeWater Solutions emerges as the compass pointing north in this labyrinth. With their unparalleled expertise, state-of-the-art technology, and commitment to tailored solutions, they stand as the vanguard of legionella testing in the UK.

In the realm of water safety, ignorance is not bliss; it's a perilous gamble. SafeWater Solutions is your insurance policy against the clandestine threat of legionella. It's like having a vigilant sentry guarding the gates of your water systems, ensuring the safety of everyone within.

Conclusion: Safeguarding Tomorrow, Today

In the tapestry of legionella testing companies in the UK, SafeWater Solutions is the golden thread, weaving reliability, expertise, and innovation into every test. Trusting them is not just a choice; it's a commitment to water safety.

So, when the waves of uncertainty crash against the shores of your water systems, remember the beacon – SafeWater Solutions. Because when it comes to legionella testing, they aren't just the best; they are the safeguard ensuring a water-safe tomorrow.

[macgyvermedical]

Curious if you know much about food sensitivity testing. My cousin's SIL is purportedly a wellness NP and has their whole family getting their sensitivities checked every 3-6 months with lab draws. I always thought allergy testing was done with scratch test on skin. And like how do you cast a wide enough net to test for everything? I didn't think labs really worked like that? I thought you kind of had to test for specific things and almost like a process of elimination.

It seems as though every time cousin gets tested there is a whole list of foods she should remove from her diet because she is "sensitive" to them. It always feels like that list is whatever she's been eating most recently (and usually that food is something that she used as a replacement for something she was sensitive to last time) for example she cut out cow's milk and went oat because oat was ok on the list. Then all of a sudden oat wasn't ok anymore and she went coconut. Now coconut is supposedly causing trouble. Cousin said she didn't think she was having issues with it but is now looking for alternatives and I'm just worried about her.

When I asked the SIL what the sensitivities mean the response was that it causes inflammation which can lead to skin conditions, weight gain, problems in the digestive tract, or cancer.

Obviously I know food sensitivities exist and that there's a lot of processed garbage in our food the whole thing just feels off.

No worries if you don't want to answer thing or if you don't know. This is partially me venting in your askbox

Before we can talk about what your SIL is probably doing, we have to talk about food allergies, food sensitivities, and how we test for them.

A food allergy is an inappropriate immune reaction to a chemical that is present in a food.

The first type is the "immediate" type. When the food is ingested, the body's immune system misidentifies one or more proteins in that food as dangerous and "overreacts" by creating an antibody called immunoglobulin E. Immunoglobulin E (aka IgE), triggers the release of histamine and other chemicals that, in the extreme excess caused by IgE, cause symptoms like itching, swelling, hives, low blood pressure, difficulty breathing, vomiting and diarrhea. These symptoms can be life threatening. Less severe versions of this can trigger gastritis, brain fog, asthma, and non-life-threatening versions of the symptoms listed above.

Proteins from peanuts, tree nuts, cow's milk, eggs, fish, shellfish, soy, wheat, and sesame cause about 90% of these allergic reactions.

There are other immune reactions and other Immunoglobulins. For example, there is immunoglobulin G, which serves as a "memory" and helps protects against viruses and bacteria. IgG essentially makes an impression of everything that comes into the body. When you get titers drawn to determine whether you're immune to something (a test you might need to get if you work in the medical field), the test looks for specific types of IgG to determine whether your body still remembers the virus or bacteria you were immunized against or exposed to. More about this later.

IgG, along with IgA and IgM can contribute to autoimmune conditions like MS, graves disease, rheumatoid arthritis, and lupus (which are very technically allergic reactions to oneself).

A food sensitivity or intolerance on the other hand is a condition caused when a person doesn't have the necessary enzymes or microbiome to digest a particular sugar or protein in a food. Food sensitivities do not have anything to do with the immune system. Instead, they have to do with digestion. A food sensitivity often results in bloating, gas, diarrhea, and abdominal pain. While unpleasant, you won't die from an intolerance or sensitivity.

While not technically an allergy or a sensitivity, people also may have conditions that are exacerbated by certain foods, such as sugar or wheat exacerbating arthritis.

Now onto the testing. Allergy testing comes in several forms. You can do blood testing for specific allergens by looking for specific IgE allergens. For example, if you suspect you are allergic to peanuts, you can have blood drawn to check for peanut IgEs. You can also do a skin test, where a section of skin is marked with a grid and small amounts of allergens, along with control solutions, are injected into each section. A welt forms if the substance triggers histamine, and means the person is allergic to the substance. Another test is simply to give the food (in a controlled setting) in increasing amounts until the person has an observable reaction.

For non-dangerous allergic reactions and intolerances, an elimination diet can be done, where a person limits themselves to foods they know are completely safe, wait for symptoms to go away, and then start adding in foods one by one and documenting responses. This can take several months but can be worth it for someone who feels they have many foods that trigger unpleasant symptoms.

What your SIL is probably doing:

There are many companies that offer home allergy testing. This is usually done with a card, where someone places a few drops of blood on the card, mails it in, and gets results for between 90 and 100 different substances.

The problem is, home allergy tests do not test for IgEs. They test for IgGs. Remember that IgGs don't have anything to do with allergic reactions- just the presence or absence of a recent ingestion. All IgG testing does is say "yup, dude ate some peanuts recently".

You might then connect "hey, when I eat wheat my arthritis gets worse, and you said arthritis is partially caused by IgGs" well yes, but your arthritis is caused by IgGs that have identified your cells (among other things), while the antibodies tested for in the test are the ones which have identified the wheat proteins. Just any ol IgG won't do- it's gotta be specific. Wheat may be doing something to aggravate your arthritis, but wheat IgG's aren't what that is.

To be clear, this isn't just my opinion. Every allergy-related organization in the world is in agreement- IgG testing does nothing to determine what you're actually allergic to. We have lots of tests that work for that. IgG testing just tests for what you've eaten or been exposed to recently. Which sounds exactly like what your cousin is experiencing.

R E F E R E N C E S

[dentistrytips]

8 Common Dental Problems and Treatment – White Lily Dental

Our smiles are a huge part of our identities. They communicate joy, warmth, and confidence. Keeping our teeth and gums healthy isn't just about having a beautiful smile, it benefits our overall well-being. Unfortunately, many people experience dental problems that can be painful, inconvenient, and lead to other health concerns. Let's delve deeper into some of the most widespread dental issues and learn about the treatments available to help restore your sparkling smile.

1. Cavities (Tooth Decay)

No list of dental problems is complete without mentioning cavities, one of the most common issues worldwide. Bacteria in your mouth feed on sugars from your food and drinks, producing acids that can erode tooth enamel. This can lead to sensitivity, pain, and the formation of holes (cavities) in your teeth.

Treatment: Fillings are the most common treatment for cavities. The dentist will remove the decayed part of the tooth and fill the hole with a strong material like composite resin. In severe cases, a root canal in Oakville or crown may be needed.

2. Gum Disease (Periodontal Disease)

Gum disease is a serious infection of the gums caused by bacterial buildup (plaque). Initially, it manifests as gingivitis, characterized by inflamed, red gums that bleed when you brush. Untreated, gingivitis can worsen into periodontitis, causing the gums to recede and potentially leading to tooth loss.

Treatment: Scaling and root planing are deep-cleaning procedures that remove plaque and tartar buildup beneath the gumline. More advanced gum disease may require surgery.

3. Tooth Sensitivity

Many people experience tooth sensitivity to cold, hot, or sweet foods and drinks. This often occurs when the protective layer of the tooth's enamel wears down, exposing the sensitive inner dentin layer. Receding gums can also contribute to tooth sensitivity.

Treatment: Desensitizing toothpaste can help manage mild sensitivity. If the problem is severe, your dentist may recommend special toothpaste or in-office desensitizing treatments.

4. Bad Breath (Halitosis)

While occasional bad breath can happen to anyone, chronic bad breath can be a sign of an underlying issue, often related to dental hygiene, dry mouth, or other health conditions.

Treatment: Brushing twice daily, flossing, and using a tongue scraper helps maintain good oral hygiene. If bad breath persists, visit your dentist at your favorite dental office near Oakville to diagnose and treat the underlying cause.

5. Teeth Grinding (Bruxism)

Bruxism is the involuntary clenching or grinding of teeth, often occurring during sleep. It can lead to headaches, jaw pain, facial tenderness, and worn-down or chipped teeth.

Treatment: Your dentist might recommend wearing a mouthguard at night to protect your teeth. Stress management techniques can also help reduce bruxism.

6. Discolored Teeth

Over time, our teeth naturally become discolored due to foods, drinks, smoking, and aging. Teeth whitening is a popular way to brighten your smile and boost your confidence.

Treatment: Teeth whitening services at White Lily Dental can help brighten your smile several shades. Professional whitening treatments are more effective and safer than over-the-counter options.

7. Impacted Teeth

Impacted teeth, most commonly wisdom teeth, are those that fail to fully erupt through the gums. This can cause pain, inflammation, or damage to nearby teeth.

Treatment: An oral surgeon may need to perform a procedure to remove impacted teeth and prevent future complications.

8. Orthodontic Problems

Misaligned teeth, including crooked teeth, overbites, or underbites, can impact your bite and make cleaning your teeth more difficult. Orthodontics in Oakville treatment can correct these issues, improving not only your smile but your oral health as well.

Treatment: Braces and Invisalign are popular orthodontic treatments offered by White Lily Dental's orthodontics specialists.

Prevention Is Key

The good news is that many of these common dental problems are largely preventable by following good oral hygiene practices:

Brush your teeth at least twice a day with fluoride toothpaste.

Floss daily to remove plaque and food particles from between your teeth.

Limit your intake of sugary foods and drinks.

Schedule regular dental checkups and cleanings (typically recommended every six months) at a trusted dental clinic in Oakville or near you.

Remember, early detection and treatment of dental problems are crucial for preventing complications and maintaining a beautiful, healthy smile. If you're searching for expert dental care, don't hesitate to reach out!

Conclusion

Your smile is one of your most valuable assets. At White Lily Dental, we're committed to providing compassionate and high-quality dental care in the Oakville area. If you're experiencing any of these common dental problems or simply need a routine checkup, our experienced and friendly team is ready to help.

Call to Action – Your Partner in Oral Health

Contact White Lily Dental today at (905) 847-8474 to schedule your appointment and take the first step towards a healthier, brighter smile!

[motherlandgroceries]

Oral Care on a Budget: Affordable Essentials for a Healthy Mouth

Maintaining good oral hygiene doesn't have to break the bank. With strategic choices and a focus on essentials, you can achieve optimal oral health without compromising your budget. In this blog, we'll explore practical tips and affordable essentials to keep your teeth and gums healthy without putting a dent in your wallet.

1. Prioritize the Basics: Toothbrush and Toothpaste

The foundation of any oral care routine is a good toothbrush and toothpaste. Opt for a soft-bristle toothbrush, as it effectively cleans teeth without causing damage to the enamel or gums. Store-brand toothpaste often contains the same key ingredients as their more expensive counterparts, providing fluoride for cavity protection and maintaining fresh breath.

2. Floss Regularly: Affordable Yet Essential

Flossing is a vital step in preventing gum disease and maintaining overall oral health. Fortunately, dental floss is an affordable option. Consider buying the generic or store-brand version, which often works just as effectively as more expensive alternatives. Regular flossing can save you from costly dental procedures down the road.

3. Mouthwash on a Budget: DIY Options

While commercial mouthwashes are convenient, there are budget-friendly alternatives you can easily prepare at home. A mixture of water and a teaspoon of baking soda can serve as an effective mouthwash, helping to neutralize acids and fight bacteria. This DIY option is not only economical but also devoid of artificial additives found in some commercial mouthwashes.

4. Watch for Sales and Discounts: Stock Up Smartly

Keep an eye on sales and discounts at your local pharmacy or online retailers. Many stores offer promotions on oral care products regularly. When you spot a good deal, consider stocking up on essentials like toothpaste, toothbrushes, and floss. Buying in bulk during sales can result in significant savings over time.

5. Prescription Savings Programs: Affordable Dental Care

If you require prescription dental products, explore prescription savings programs offered by various retailers. These programs can provide discounts on prescription toothpaste or fluoride treatments prescribed by your dentist, ensuring that you can access necessary oral care without straining your budget.

6. Choose Generic Brands: Quality at a Lower Cost

Generic or store-brand oral care products often have the same active ingredients as their brand-name counterparts. Choosing generic brands can significantly reduce costs without compromising the quality of your oral care routine. Check the ingredient list to ensure you're getting the same benefits at a lower price.

7. DIY Toothpaste: Simple and Cost-Effective

For those who enjoy a bit of DIY, making your toothpaste at home is not only cost-effective but also allows you to control the ingredients. Baking soda, coconut oil, and a few drops of peppermint oil can create a simple yet effective toothpaste. This budget-friendly alternative is free from unnecessary additives found in some commercial toothpaste brands.

8. Visit Low-Cost Dental Clinics: Professional Care on a Budget

Many communities have low-cost dental clinics or dental schools that offer services at a reduced rate. These facilities provide professional dental care at a fraction of the cost of private practices. Utilizing such services for routine cleanings and check-ups can contribute to maintaining good oral health without straining your finances.

9. Focus on Prevention: Save on Treatment Costs

Prevention is key to avoiding expensive dental procedures. By prioritizing your oral care routine and addressing any concerns promptly, you can save on potential treatment costs. Regular check-ups and cleanings can help identify issues early, preventing the need for more extensive and costly interventions later on.

10. Don't Skip Routine Check-ups: Catching Issues Early

While it may seem counterintuitive to include routine dental check-ups in a budget-friendly guide, catching dental issues early can save you money in the long run. Regular visits to the dentist can identify potential problems before they escalate, preventing the need for costly treatments that may arise from neglected oral health.

In conclusion, maintaining good oral care Products on a budget is not only possible but practical with the right strategies. Prioritize the basics, explore budget-friendly alternatives, take advantage of sales and discounts, consider generic brands, embrace DIY options, explore prescription savings programs, and utilize low-cost dental clinics. By focusing on prevention and catching issues early, you can achieve optimal oral health Care without straining your finances. A healthy smile doesn't have to come with a hefty price tag – it's all about making smart choices and being resourceful in your oral care routine.

[standarddentalsd]

6 Vitamins and Minerals that Make Your Teeth & Gums Healthy.

When exploring how to strengthen enamel, consider trying to incorporate the following 6 vitamins and minerals into your diet. 

A diet rich in vitamins and minerals can naturally help strengthen tooth enamel. It can also help protect your teeth against foods and drinks that cause acid erosion. Below are some vitamins and minerals that help support strong enamel and healthy foods where you can find them. Consider adapting your diet to include some of these essential vitamins and minerals to help support your oral health. 

Each and Every parent wants their child to have a healthy and happy life. Likewise, Vitamins and minerals are important things to have healthy growth of the child. Same way these vitamins and minerals are also important for Good and healthy oral health.

If your Oral Health is healthy and fine then you will achieve a perfect and natural smile without any kind of treatment or fake smile makeover.

Our Teeth and gums and our oral health depend on day-to-day eating habits. Our Gums depend on the daily consumption of food. Nowadays we can see the majority of people especially young people consume so much junk food, sweet products, and sugary drinks which leads to cavities or tooth decay. If people have occasionally all this food is ok, but daily basis is not ok.  

To keep your oral health healthy should have proper food. People should include leafy vegetables, fruits, Fiber, proteins, etc.

Here are the Essential Vitamins and minerals most needed for your Healthy Teeth and gums

1. Calcium :

Calcium is the important element that is needed to keep your bones and teeth strengthened. Calcium prevents your Teeth from decay. Also makes your Enamel layer stronger. You must have a proper Healthy balanced diet/food.  Your Food should include calcium such as:

  Leafy Vegetables

 Nuts

 Milk

Yogurt

Orange & Figs

 Cereals 

 Beans / Lentils

2. Phosphorus:

Phosphorus is another important vitamin for healthy teeth & gums. Phosphorus helps your body absorb calcium and support healthy tooth enamel. Some Food such as sugary product or fast junk food contains a high level of inorganic phosphorus which is not good for proper teeth health to maintain. There is list of food that supplies Phosphorus to your teeth as well as bones.

 Dairy Products

 Nuts

 Red Meat

 Seafood.

 Egg, Egg yolks.

 Whole Grain.

3. Vitamin D:

Vitamin D plays a role in calcium and phosphorus absorption. Even Vitamin D is produced naturally in the body when our body absorbs the sunlight from the sun. Vitamin D deficiency leads to many problems such as gingivitis, cavities, bone density problems in the jaw, and gum disease.

Major Source of Vitamin D:

 Orange Juice

 Fish like Tuna, salmon

 Eggs

 Fortified Milk

 Cod Liver Oil

4. Vitamin C:

Vitamin C is very important for healthy teeth and gums. Vitamin C has many benefits for the immune system. It helps play a part in the health of your connective tissues, which can prevent bleeding gums and other gum diseases down the line. Because of vitamin C, your gums become stronger which reduces gum disease and also helps your teeth to stay in place.

Food that contains vitamin C:

 Berries

 Citrus Fruit (Orange, Kiwi, sweet Lemon)

 Bell peppers

 Spinach

 Tomatoes

5. Potassium:

Potassium helps to reduce the risk of dental plaque, gum disease, and bacteria mouth. 

Food that contains Potassium:

 Bananas

 Dairy products (Milk, Yogurt)

 Leafy Vegetable

 Avocados

 Potatoes

6. B Vitamin : 

B  vitamins (B12) benefits with healthy wound healing. This includes oral sores and gum inflammation. B12 deficiency is linked to more cavities in children, swollen gums, and even tooth loss over time.

Most foods rich in B vitamins are animal sources. Vegetarians and vegans may benefit from a supplement to maintain healthy levels or seek out fortified plant sources of B vitamins.

Major sources of Food:

 Poultry

 Fish 

 Dairy product

 Eggs

 Fortified cereals

Consume all these vitamins and minerals to have a healthy and strong life. 

To know more visit Standard Dental LLC. Book your appointment with us. Call us at (301)299-1505.

[adityabirlawhite]

Elevating Your Outdoor Walls to Premium Excellence

The earliest form of shelter for humans was found in the natural protection offered by trees. Seeking refuge from the sun, rain, and harsh weather, our ancestors discovered the safety that elevated tree living provided. This arboreal dwelling not only shielded them from the elements but also served as a defense against ground-dwelling predators incapable of climbing trees. As time progressed, human innovation and ingenuity led to a transformation in our living arrangements.

Through a process of continuous evolution, mankind transitioned from the rudimentary tree abodes to more sophisticated structures. Innovations and inventions brought forth the utilization of materials like stone slabs and wood, allowing the construction of robust homes capable of withstanding diverse weather conditions and providing defense against various predators. This evolution was not only a reflection of changing needs but also marked a shift in the design and materials employed for constructing homes.

In the contemporary era, marked by a dynamic and ever-changing world, new challenges have emerged. Among these challenges, the threat posed by disease-causing germs and bacteria to both the structural integrity of walls and human health is of paramount concern. Addressing this modern challenge head-on, Birla White has introduced a groundbreaking solution in the form of its latest product – Birla White Bio-Shield Putty. Positioned as India’s first anti-viral putty, this innovative product possesses the remarkable ability to combat bacteria, viruses, fungi, and algae, ensuring both the health of your walls and your well-being.

What sets Birla White Bio-Shield Putty apart?

Unlike regular putty that serves as a base coat, Birla White Bio-Shield Putty goes above and beyond, offering increased coverage, heightened whiteness, a premium finish, and, most importantly, anti-viral and anti-microbial properties. Its unique pre-wetting-free attribute is the first of its kind in any white cement-based putty, adding to its list of distinctive features.

This home shield putty stands out by providing:

1. An exceptional putty-like finish coupled with germ protection

2. Silver ion technology for advanced anti-viral, anti-bacterial, anti-fungal, and anti-algae properties

3. Rigorous testing and certification by NABL Lab

The silver ion technology in Birla White Bio-Shield Putty actively releases silver ions on the coated surface, neutralizing viruses, bacteria, and preventing algal and fungal growth. This groundbreaking technology ensures a healthy and hygienic surface, making Bio-Shield Putty the best anti-microbial putty available in the market.

Durability is a hallmark of Birla White Bio-Shield Putty, as the efficacy of Silver Ion remains intact throughout the product's lifetime. Non-leachable silver ions ensure that the putty doesn't degrade over time, earning it the moniker of anti-bacterial putty or anti-microbial putty. The product's efficacy in killing 99.9% of viruses and bacteria, along with preventing algal and fungal growth, has been rigorously tested and certified by an NABL-approved lab. Birla White Bio-Shield Putty also meets the requirements of Green-Pro standards, qualifying for Green-Pro certification.

Whiteness, a key parameter for any putty, is measured on the Hunter Whiteness scale (HW). Birla White Bio-Shield Putty outperforms regular putty by scoring +94.5% on HW, as opposed to regular putty's +93% on HW. This significant difference underscores its superior whiteness, making it the best anti-bacterial wall putty that also provides a premium marble-like finish for your walls.

Application and Precautions:

Applying Birla White Bio-Shield Putty is a straightforward process:

1. Remove loosely adhering material from the surface.

2. Due to its curing-free property, pre-wetting is not required.

3. Mix 1 kg of Bio-Shield Putty with 45% clean water and apply the first coat uniformly.

4. After drying, rub the surface gently to remove loose particles and apply a second coat.

5. Allow the surface to dry before applying topcoat paint/distemper.

While applying Bio-Shield Putty, certain precautions should be observed:

1. Mix with 45% clean potable water.

2. Thorough mixing is crucial for smoothness and coverage.

3. Prepare only the required quantity for immediate use.

4. Keep Bio-Shield Putty out of reach of children.

5. Seek medical attention if ingested or if skin irritation develops.

In summary, Birla White Bio-Shield Putty offers a unique blend of benefits, including safety, whiteness, and a curing-free feature. Positioned as the best anti-viral putty, its silver ion technology ensures a hygienic surface, making it an ideal choice for those seeking superior protection for their walls. As we evolve to face new challenges, Birla White Bio-Shield Putty stands as a testament to progress, providing a quality product that contributes to a life lived happily, satisfied, and in comfort. Choose Birla White Bio-Shield Putty – Lagayein Deewaro Pe, Paayein Safedi Aur Suraksha Dono.