#the warnings list is sending me to hell but please read them

[throneofsapphics]

haunt me like the wind that blows (part 3)

Feysand x f!Reader

(part one) (part two)

Summary: it wasn’t really a nightmare, it felt more like a gift. Even with the pain, her subconscious was the only place she could taste freedom.

Warnings: dark feysand, toxic relationships, dubcon, kidnapping, nightmares, non-consensual bondage, references to suicide attempt, a bit of smut, gaslighting probably, minors dni!

Word Count: ~2.7k

A/N: this is going to be the last part! please mind the warnings

Seconds after she breached the wards of Velaris, a familiar hand clenched around her wrist - tight enough pain lanced through her hand, and she wondered if he’d break her wrist. 

“Feyre said you could be trusted,” he purred, “but I knew better.” 

The wind, the beautiful and cruel wind whipped around her face, the ends of her hair rising. She could taste it - the freedom on the horizon. Then - gone. She was alone. She stumbled back, eyes wide as she glanced around her. Had she imagined it? Bruises circled her wrist and it still ached as she clutched it to her chest. 

“No, that was real.” Rhys crooned. 

“Leave me-” 

“Alone, yes I know.” His voice took on a cruel tone. “Let’s see if you survive the night, monsters worse than me are out there.” 

Gods. Gods. She was so screwed. She wouldn’t put it past him to unleash something. Something to haunt her, to scare her into coming back. “Anything is better than with you.” Y/n taunted, unable to control herself. A snarl echoed through her mind, but she took off into the night. Maybe this was just a game, but she’d be a fool not to take the chance. But where to go? She didn’t doubt that word spread of her in Vallahan, of the rogue mate to the High Lord and Lady of the Night Court. 

Branches whipped against her arms and legs, small cuts scraping against her but she didn’t care. All pain was drowned out as she sprinted, as fast and far as she could. Temporary freedom was better than nothing. She would take anything she could get at this point.

“You really think you’ll manage without us, don’t you?” Feyre’s voice echoed in her mind - and she didn’t know if it was real or not. Reality seemed to warp around her - the trees shifting in unnatural rhythms, the ground shifting underneath her - rolling like waves of the sea as she struggled to balance. Any trees she tried to grip for balance shifted out of her way. Y/n fell down a hill, tumbling and barely covering her head as she fell -

“Y/n,” a voice shouted, overtaking everything else. Hands braced her shoulders, shaking her awake. This voice was real. She knew that. “Wake up love.” She groaned, rolling away and tugged at her wrists. Chains - still sleeping with the chains on. Her eyes blinked open, spotting Feyre leaning over her, Rhys’s hand stroking down her arm. 

“You had a nightmare,” she brushed her finger over her hand. Y/n glanced down at her bare arms - no cuts or scrapes, no evidence of her wilderness ‘adventure.’ Did they plant this one inside of her, to give her some kind of sick hope? Neither of them replied, or gave any indication they were listening to her thoughts and she let out a slow breath. 

“I wouldn’t have them if you took these off,” she mumbled. At least they’d lined the interior with something soft, after Feyre protested about the bruises on her wrists.  

Her eyes glazed over, and y/n knew she was speaking to Rhys. Feyre had always been a bit … softer, maybe she would argue on her behalf. A few minutes passed as she chewed on her bottom lip. Rhys let out an exasperated sigh behind her, but the chains unlocked and she forced herself not to yelp out of excitement. 

“On a trial.” Rhys warned, flipping her around to face him. His eyes had darkened, a clear warning that if she tried anything, worse consequences would face her. “Do you understand?” 

“Yes.” She spoke softly. Maybe it made her weak, but sleeping in those damned chains had worn her down and she would have begged on her knees to be free of them. Captive. She thought she was trapped before, but it was nothing compared to this. Eyes she couldn’t see followed her everywhere, and anytime she spotted something remotely sharp - it disappeared. If she ate with a butter knife, Rhys or Feyre watched her the entire time. Even the cups and glasses had been charmed not to break. 

A clash clattered across the floor as tea spilt on the kitchen tiles. Rhys winnowed into the room within seconds. His eyes shifted between the cup on the floor, and her face. 

“I dropped it, I promise.” She nearly wailed at the dark look on his face. She felt him rifling through her mind, and gave a nod after deciding she was being truthful. A snap of his fingers cleaned the liquid up, the mug disappearing. 

“You need to be careful my love,” he said in a soft voice, gathering her in his arms. “We don’t want you getting hurt.” Or hurting yourself, went unsaid. He made her sit, brewing her another cup and almost made her feel loved. It was all a game, everything was a game to earn her trust and wear her back down. At least she told herself that. 

The memory faded, and she hadn’t realized she was facing Feyre again, her back pressed firmly against Rhys’s chest, his hands wrapped around her waist as Feyre rubbed out her wrists. Like she would every morning. Always checking to see if she could feel everything, if anything was injured - like it wasn’t them inflicting any injuries. 

“Aren’t you going to thank us?” the High Lady teased her. 

“Thank you.” She said quickly, not wanting to risk anything. 

“Such good manners when you get what you want.” Rhys’s sleepy voice came from behind her. She loved that voice, when he was soft and gentle - first thing in the morning or in the middle of the night. Loved. Y/n threw that word out of her mind. No love for them, nothing redeemable about them. 

“Sleep.” Feyre ordered both of them, “I’ll take the nightmares away,” her hand kissed the inside of her wrist. But - it wasn’t really a nightmare, it felt more like a gift. Even with the pain, her subconscious was the only place she could taste freedom. How sad everything had become, how painful of a trap she fell in. She thought of everything she lost, of everything gone to her. Gone with the wind, swept away at every moment. 

-

When she woke, alone, the sun was already shining, and she rose, a genuine smile on her face for the first time in months - but something pulled at her. Chains. Gods was that a dream too? But, they were longer this time, long enough she could reach the side table. A note placed on it. 

We had to leave early, we’ll come back as soon as we can. 

Tears spilled, dripping down on the paper and smudging the ink. The best dream she’d had in months, and it was soured. But, her favorite book and a still-warm mug of tea sat on the side table, within reach. She could indulge in this small kindness, just this once. 

They returned at the same time, looking pleased to see the book propped on her knees, one hand holding her page open as the other held her mug. 

“I told you she’d be happy.” Feyre elbowed Rhys. Maybe happy was an overstatement. The male rolled his eyes. 

“I still like her in chains.” Feyre hummed an agreement. Speaking of her like an object. That’s all she was to them. 

“You’re our mate.” Feyre frowned at her. “If you’re not going to be grateful …” 

A few minutes later, she was spitting out apologies and thank you’s as Feyre’s hand landed on her ass, her body draped over her knees. She would pause, letting Rhys run his hands over her already bruised ass. His hand slipped between her legs, and she fought back tears of embarrassment as he felt how wet she was. 

How sick was she that this turned her on? At being punished for her thoughts. 

“How else would we correct them?” Rhys’s voice entered her mind. “It’s alright to feel this way,” he spread her arousal over the small abrasions on her ass, and she winced as it stung. “The bruises will remind you.” 

The chains unlocked, but the freedom was temporary as her hips were dragged back, and she was shoved to her knees in front of Feyre, her legs spreading, dress hiked up around her hips with nothing underneath. “Take your reward now.” She cooed, one hand on the back of her hair, guiding her towards her core. She wanted to fight and protest, but the temptation and taste of her was too much. The desire to please her mate was so ingrained in her that sometimes she couldn’t resist it, and this was a way to alleviate it - a less harmful way, she justified to herself. 

-

Three months passed before she could wake alone and unchained. A treasure, and she prized herself on earning back that trust. But, she shoved that thought deep down - in a place nobody could reach. The thought was filled with a sense of vindication, and the last thing she needed was them catching wind of that feeling.

She moved silently, sneaking through the halls how she’d learned, and heard voices coming from one of the small dining rooms. 

“That could work.” Feyre said. “It would keep her here.” 

Keep her? How? Hadn’t they already done everything to keep her? 

“I have to go,” Rhys said and a chair shoved back she quickly took a few quiet strides back, before reapproaching with louder footsteps - the ones they’d become accustomed to hearing. 

Rhys exited just as she approached, a smile curving on his face as he spotted her and wrapped one arm around her waist, tugging her into his chest. He pressed a quick kiss to her lips, “Good morning.” 

“Good morning.” She repeated, forcing some inflection into her voice. Not overly so, but enough for it to come off as natural. 

“You enjoyed your gift?” 

“Thank you.” The smile actually did reach her eyes. 

“You’ve been so good.” He ran a thumb over her cheek, brushing across her lips. 

“You’re going to be late. Rhys.” Feyre said from the doorway, shooting her a smile. “Want to go to the markets today?” 

She nodded eagerly, picking up any crumbs they would string out for her, and tried not to despise herself for it. Feyre had a pleased expression on her face at her excitement, and Rhys reluctantly released her. 

“I’m the High Lord. I’m never late.” He muttered, but winked at her as he winnowed away. 

Feyre’s grip on her was tight as they walked through the city streets, arm in arm. Not giving her an inch unless she allowed it, but she would take it. No familiar faces, either. Some she recognized as old neighbors, ones who used to work with her in town, but their eyes glazed right over her as if she didn’t exist.

Her mouth opened once, as if to try and call out to them, but she couldn’t find her voice. As she met Feyre’s eyes, there was a warning glare there. Don’t talk to anyone. Feyre didn’t have to speak the words for her to understand the message. She swallowed and gave her a nod. Immediately, her expression lightened and she reached over to squeeze her arm, stopping for the next person to greet her. 

Popular, Feyre was incredibly popular with her people, they loved her. If only they could see how she is behind closed doors, the wicked cruelness and quickly shifting moods. What her love really looks like. 

“And who is this?” An older female smiled, her face lined with wrinkles - hair just starting to silver. As soon as she’d acknowledged her, the woman’s eyes changed as if she didn’t register her at all. Feyre was making sure nobody recognized her - that she was forgotten. 

No talk of “who was that on the High Lady’s arm?” or “Did you see y/n, she’s been gone so long!” would go around Velaris that night. Nobody would remember her. Nobody except who Rhys and Feyre allowed. 

- Two years and three days to the date after she was first returned, y/n got another chance. Gods did she take it. She ran and ran and ran. Breaching the words of Velaris, just as a hand clamped around her wrist - bruisingly tight as it ached. 

“Feyre said you could be trusted,” he purred, “but I knew better.” The same words from that nightmare, but this time he didn’t let go. Fear might have rung from every sense of her being, but she brought up as much determination as she could as she turned to face him and took a step closer. His brow furrowed in confusion, but she spat. The drops glistened on his cheek, surprise evident in his eyes. A satisfied smile crossed her features, but his gaze turned feral quickly and it was gone as soon as it came. 

He leaned towards her, his breath grazing her ear. “Run.” He dropped her wrist, and she did. 

Wind whipped her cheeks, branches scraped at her skin, but the floor and trees didn’t move this time. Of course, it was useless and futile, of course it would end as quickly as it began - but she’d take the chance to feel the wind against her hair, to feel the strain of her legs as she got a mockery of freedom. 

Rhys let her run, maybe gave her a ten minute head start before she began to feel his presence nearby. She would catch a glimpse of him, and cut a sharp angle to another direction, weaving in and out of trees to try and lose him. She didn’t know how long it lasted - but her lungs burned and legs threatened to give out under her. Keep going, keep going, she chanted to herself, wanting to draw this out as long as possible. 

She screamed as a weight slammed behind her, shoving her down to the forest ground. Her face pressed into the dirt and a hand yanked the back of her hair - arching her neck as his other hand circled her throat. 

“You believed it, didn’t you?” He murmured. “That I would be that stupid to give you that chance.” His hand tightened around her neck. “I don’t make the same mistakes twice.” 

A whimper left her throat. “Fuck you.” She said weakly, and her cut some of her air off, keeping any words from coming out of her mouth. 

“You’re already in trouble. Don’t make it worse.” If she’s already in trouble - she threw an arm back, a weak punch landing against his shoulder. He laughed at her, finally releasing his grip on her hair and neck as she flopped back into the ground, and scrambled to turn, backing on her knees as the rough bramble scraped the bottom of her thighs. 

He shook his head, looking at her almost fondly. A shield quickly deflected the rocks and sticks she tried to throw. But, she couldn’t stand - her legs fell out under her as she tried, already worn out from all of the running. He must’ve entertained her for at least an hour or two. 

“Three.” He corrected. “I was impressed with you.” A game, this was all a gods-damned game to him. The curve of his lips told her she was right. “A game for me,” he taunted, “but it’s so sweet when you think it’s real.” 

She threw out a string of creative curses at him, but he rolled his eyes and she watched his patience slowly wane. Still, she kept cursing as he heaved her to stand, keeping a firm grip on her as he winnowed back to the river house. 

He let her go and she fell onto the tile, wincing as her knee hit the ground. Feyre stood with her arms crossed. “You let her hurt herself.” She frowned at Rhys. 

“I let her have some fun.” Rhys hedged, but even he wilted slightly under Feyre’s disappointed stare. At least she wasn’t alone in that. In everything else, she’d be alone. For the rest of eternity. 

“Don’t be so sour,” Feyre tutted, reaching out a hand for her. “You have us, that’s all you need.”

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[captainkirkk]

✩ WEEKLY FIC ROUND-UP ✩

All the fics I’ve read and really enjoyed in the past week-ish. Reminder: This list features any and all ratings and themes. Please look at tags and warnings on ao3 before reading.

Marvel

how to return home by JBS_Forever

Flash Thompson is a good person, but not a great one, so when Peter Parker accidentally gets drunk at his house party, all he can do is say, “Shit.”

Or: the one where Flash is just trying to be a decent person and get a drunk Peter home. Peter, on the other hand, has different plans.

scandal of the century by joshriku

The headline reads:

STEAMY SEX TAPE BETWEEN MAGNETO AND PROFESSOR X LEAKED!

“All right,” Charles says. “I wouldn’t call it steamy, you know, that’s an exaggeration.”

“That is seriously not the point, Professor,” Jean answers.

(A sex tape is leaked. PR crisis ensues).

DC

two vigilantes carry a cake across gotham by JBS_Forever

Jason's had a nagging suspicion that Bruce keeps stalker-esque levels of tabs on all the places he’s lived, so when Tim Drake shows up at his apartment door, it takes only a half second for Jason to level his gun directly at Tim's stupid face and to say, bored, “Give me one reason not to shoot you.”

Honestly, he knew Bruce had a problem, but sending a bat to his doorstep? This is just ridiculous.

Or: in a scheming attempt to make them bond, Bruce forces Jason and Tim on what should be a simple quest: retrieve Alfred’s birthday cake from across town and make it back before the party.

But this is Gotham. And nothing is ever simple in Gotham.

racing on the thunder by merils

Fortunately or unfortunately, Clark Kent is kind of used to getting phone calls about his too-curious-for-her-own-good wife being held hostage somewhere. Superman usually handles it.

Conner Kent gets a phone call meant for Clark Kent, who is Superman, who is currently in space. Uh.... Have no fear, Superboy is here!

What could possibly go wrong?

Original Works

Halfway Home for Wayward Mages by hoebiwan

Part 24 of mage in a wolf pack (This whole series kills me)

He wouldn’t mind it if Lada collared him, if Khalida or Dimitri collared him, because none of them have forced him to hurt anyone, whether human or wolf. They mostly just want him to—

Live, Jaime. Live.

In which the wolves rescue Jaime, but he doesn't realize he's free.

the sin eater by whitegeraniums (puertoricansuperman)

Part 25 of mage in a wolf pack

Lada, alpha of the Hearthstone wolf pack, finds herself in possession of a captured, broken werewolf hunter.

ATLA

Keeping Ones Head Down by ApoplecticAtPeace

Part 3 of May You be Noticed by The Fire Lord

Bao lost his ability to walk when he was 19. Despite the prejudice of many Fire Nation citizens, he got a job as an accountant in the Royal palace, in the Department of Education. After 11 years of working quietly, keeping his head down and allowing his work to be claimed by others, he expected nothing to change when Fire Lord Zuko took the throne. He didn't expect the entire department to be reformed under the new Minister Shu-Lin, and Bao's overlooked position with it.

Clone Wars

Something in the heart beat like a drum by CombatBootsandDreams

Most Jedi only have to take three formal sexual education classes. Obi-Wan, in all their blessed biology has to take five.

Or: Obi-Wan growing up in a galaxy where Stewjoni are Succubi. This changes very little--but it does make certain things a hell of lot more interesting.

A Stewjoni are succubus au that has way less to do with sex, & is more about logistics, medical problems, and cuddling. Featuring Qui-Gon being an excellent master, codywan, aromantic Quinlan Vos, Obi-Wan using he/they/she pronouns, and plenty of costume changes.

[qu1cks1lversb1tch]

A Deal | Vox x Gen Z Reader

A/N— Decided to turn my little drabble into a little series of one-shots based off of ideas I come up with and any requests y'all may have for it 💅🏻 ALSO a huge thank you to @writteninlunarlight-years for the idea that inspired me to kickstart the series! It's very much 'enemies to lovers' core (kinda, I guess?), but I have no idea how far this will go lol. Hope everyone enjoys this — sorry it took so long :)

Warnings: Reader is implied female, Valentino existing, mentions of souls being owned, reader is close to being an overlord

Word Count: 1,724

Summary: You were a growing threat — and what better way to keep an eye on said threat, than to have you start living under the same roof as three of the most influential overlords in Hell? This is only the beginning. . .

Since your arrival to Hell, things had been nothing short of interesting — from your offers that couldn't be refused, all the way to the demon's that warily approached or backed off when you were near.

It was quite the spectacle.

You were quickly rising within the ranks of Hell, from a mere sinner to damn near an overlord — for all the souls you claimed in a few short months. It was noticeable — your social climbing.

What you hadn't expected was two overlords reaching out in the same day, both itching for some sort of deal.

You'd heard whispers of the feared Radio Demon and practically laughed at the thought of people being scared of him — sure his smile was off-putting, but other than that, you didn't really see the hype.

So when he approached you outside of the Café you'd began to frequent, striking up casual conversation as if you were old friends, you quickly understood what was going on.

He was powerful. You were becoming more powerful. He offered guidance and you knew there was a 'but' coming.

When it dropped, you sighed, before sipping on your warm beverage.

"I can offer you guidance, and in return, I want your soul as a pledge of undying loyalty, my dear!" He made a hand motion, as if he planned on writing your name in the stars — could you even see the stars from Hell?

"I'm sorry — but other than guidance, what do I get out of it? I've done well on my own for the last six months."

Protection. Respect. Free housing. It had almost been tempting — especially the free housing, especially in that economy. . . But in the end, you had told him that you'd think about it.

In reality, you wouldn't.

Giving up your freedom for half the shit you could get on your own? He had you fucked up.

Then there was Vox; the wide open rival of Alastor. You'd actually seen him around, having been in a couple clubs he was coincidentally visiting at the same time.

When he approached you, it was three hours later and you were actively sending a message to the group chat of demons whose souls you owned, over Sinstagram. You were simply reminding them of the consequences if they took the food that CLEARLY had your name written on it.

You didn't care that you were sitting in a restaurant — if any of them touched that leftover sub quarter, you'd kill them, and not in a funny or ironic way. You'd actually kill them double dead with no return. 

When you looked up, he questioned your business with 'the fossil' and was met with a blank stare rather than words.

He clarified that he meant Alastor.

"Oh. I don't have any." You replied simply, reading the few messages that popped up on screen.

At the revelation, he was pleased and began listing off all of the things he could provide that Alastor 'would fail miserably at'.

Money. Protection. Respect. A sounding board for ideas. Anything your heart desired. All at a small cost of being under his surveillance almost 24/7.

That snatched your attention away from the two demons who began arguing in their native languages. Did you understand them? Fuck no. Would you be translating that later? Abso-fuckin-lutely.

"And what's in it for you?" You asked the TV demon. You didn't like the thought of being under surveillance and having little to no privacy, but his deal had already been sweetened by Vox not wanting your soul.

"Power all the way around. With my influence, you can be a billion times better than that staticky prick. You'll practically have demons begging on their knees."

"Tempting." You admitted.

"What do you think?"

"Eh, fuck it. Why the hell not?"

From there it was a flurry of events — you remembered eating, but then you were leaving with Vox and then quickly found yourself in a meeting room with the other Vees and shit you had to sign, stating that you wouldn't spill any details of the inner workings of any of the three companies.

Who did he take you for?

Once you read each document thoroughly, making sure it wasn't a contract for your soul, you signed your name on the tablets screen and sat back in your seat, pulling out your phone to begin translating the argument from the beginning.

"Great! Ground rules — our private spaces are off limits unless we explicitly tell you otherwise, that includes bedrooms, offices, and basically everything that isn't a —"

"Uh-huh, got it." You mumbled — snorting at the beyond creative insults that began to flood the screen in English.

"Listen—"

"It's my nap time, TV boy. If you can put this conversation in a text, do it." You sighed, stretching your limbs. They popped as you stood — who showed these fuckers how to make gifs of each other?

Oh.

You did. HA!

"You know I can kill you, right?" Vox questioned, his claws digging into the table.

"So could a really motivated duck — or a Canadian goose. Those things are straight out of Hell, Box."

"It's Vox." He growled.

Ooh spicy. "Whatever —"

"Can you be serious for five minutes?"

"Ok boomer."

His screen glitched and his claws dug further into the desk as he stared at you.

Velvette barked a laugh and looked away from her phone long enough to see Vox on the verge of malfunctioning, a smirk slipping onto her face. "Can we keep her? I like this one."

"This one's more tolerable than the last." Valentino mused, blowing his smoke into the air. He leaned forward in his seat, uncrossing his legs. "And we don't even know her name."

"The name's Y/N. Don't wear it out." You winked before turning around and exiting the door you had been ushered through, however long ago. The moment the door closed, you heard Vox angrily talking with Velvette and Valentino, who were much calmer than the TV overlord.

Oh, this will be fun. A good idea, for sure.

Thirty minutes later, when you were in the room Vox had told you was yours, both Velvette and Valentino followed you on Sinstagram before adding you to the Vees official group chat.

Your first week living with the Vees went by rather quickly — of course, you respected their privacy as requested, spending most of your time in your room or the common areas which mostly consisted of the kitchen, living room, and game room.

Still, you'd managed to piss Vox off three more times, and got Velvette and Valentino to join in without trying.

Velvette quickly picked up your terminology, calling Vox a boomer at any given opportunity. It pissed him off to no end. Valentino had only done it twice, mostly because they both spent a lot of time working and only interacted with Vox when he had the time to.

Within the first seventy-two hours, you noticed the weird obsession Vox had with Alastor and you sarcastically quoted a scene from a movie at dinner that night.

"Is this love, Agent Romanoff?"

And he had looked at you weirdly, pausing mid rant. Later you had to explain to the other two that it was from a movie — and who Agent Romanoff was.

Vox avoided you mostly, which you chalked up to him thinking you were annoying. Good.

By the end of the first month, Velvette had you chilling with her while she worked, usually with you being the sounding board for her ideas.

More often than not, you had good ideas.

That little fact prompted her to throw you a sketch book, telling you to get to work.

You were getting paid to be there, so whatever.

When you weren't with Velvette, you were declining Valentino's countless invitations to sit with him while he worked — you wanted nothing to do with that. Porn wasn't really your thing, even when you were alive, but you had a bunch of friends who were super into it.

Instead you went out alone, claiming you were getting lunch for yourself. You'd get lunch, after making a few deals with wayward demons who would thrive under your influence.

That one particular day, you hadn't noticed either presence behind you, until a fight broke out, causing you to turn around to see Alastor and Vox going at each other's throats — and not in an interesting way.

You somehow broke it up just after Alastor cracked Vox's screen.

"Why the fuck are you here?" You bit out harshly, directed at the two overlords who now stood three feet apart like scolded children, neither pleased to be there.

"You left without saying anything." Vox crossed his arms.

"You hadn't reached out, my dear." Alastor hummed, distastefully glancing over at the TV demon.

You groaned, throwing your head back. "Listen, get the fuck over yourselves! At this rate, I answer to Velvette, not the two of you boomers. Got it?"

Alastors eyes began to twitch as static filled the air, whereas Vox's cracked screen glitched as you walked away.

Later, when Vox approached you, you noticed that his screen was fixed. That was good.

"Got a minute, [Y/N]?" He questioned.

You looked up from the sketch book in hand and nodded, mumbling 'sure' as you closed it. You were tired from the long day.

So his next question caught you off guard.

"Why do you do this to me?"

"Do what?"

"Why do you purposely piss me off? You get along with everyone else, yet you call me names and disrespect my entire existence. Why?"

You sighed, not really having a real answer. "That's just the way I am, how I've always been. . . And in my defense, I call everyone names. . . Not just you. So, don't think you're special, Box—"

"— Vox —"

"I'm a bitch to everyone, just most don't realize it because their bitch scale broke a long time ago. Now, go. I have shit to do that doesn't involve stroking your fragile ego."

Vox wasn't sure what it was, but he knew he was going to keep a closer eye on you. What was so different about you?

You were close enough in biological age to Velvette, yet while there were similarities, there were so many differences. . . He wasn't sure what to think about any of it. Especially with you climbing up the power ladder.

[corrodedcoffinfest]

Welcome to Corroded Coffin Fest!

This is a fanworks challenge/event that is all about Corroded Coffin. It will take place from July 1st thru July 31st.

Thanks so much for showing interest in this event during this post! If you have friends that you think would like to participate, please considering reblogging this announcement!

The calendar of prompts is located here:

Since there are so many events going on (and we love to see it!) we've decided to set a word count range for this event, so the love can be spread around to more events.

GUIDELINES:

Ideas for works include: fic, art, gifsets, fanvids, moodboards, edits, playlists, or anything else you can think of to celebrate Corroded Coffin!

For fics, there is a word count minimum/maximum of between 300-1000 words per drabble. We'll use wordcounter.net to check the word counts before reblogging, so make sure you stick to that range!

Do one prompt, do them all. Hell, do them all twice! It's totally up to you. You can pick and choose what you're interested in. And we're not going to police how you interpret the prompt. Just use them as a jumping off point to be inspired by the boys of Corroded Coffin, and then share that inspiration with us! (Not everything has to be band related, we encourage you to explore other parts of their lives, too!)

Submissions can absolutely be connected to other prompts from the event, or even past works, but should still be able to stand alone each day.

Every morning a new prompt card will go up, reminding everyone of what that day's prompt will be.

All submissions should include any pairings featured, content rating and any content warnings (CW) or tags that you think are appropriate. Please put the prompt you are fulfilling as well, just to keep things straightforward. A sample could look something like this:

Prompt Day 9: The Hideout, Word Count: 666, Rating: M, Pairing: None, CW: Underage Drinking, Recreational Drug Use, Tags: Corroded Coffin, First Gig, Partying, Eddie, Gareth, Jeff, Freak, The Hideout

Also, please consider putting any explicit material under a read more cut, because anything rated E that's not hidden under a cut will not be reblogged.

For the artists! Your art submission must be posted on the same day as the current prompt in order to be reblogged by this blog. Your piece of art (or other creation) must be Corroded Coffin focused, using any combination of the guys, together or solo. Of course, other characters can be included, too! But you need to have at least one of the CC band members in it for it to count for this event. Thank you!

All ships are welcome, as long as they include at least one member of Corroded Coffin: Eddie, Jeff, Gareth & Freak. (Who I look forward to learning the name of from you all, time and time again!)

Please tag us here @corrodedcoffinfest when you post your work for the day so we can reblog it!

Be respectful of your fellow participants and readers. We're all here to have fun and share the love of all parts of Corroded Coffin.

Definitely feel free to ask me anything if the rules weren't clear in places, or if I straight up forgot something (or if you just have anything else you'd like to ask). You can send an ask/message to this blog or reach out to @thisapplepielife.

Please submit your post by 11:59 PM EDT on the day of the prompt in order to not be missed for reblogging.

 If posting on AO3, please feel free to use the collection associated with this event: Corroded Coffin Fest AO3 Collection after your submission has been reblogged by this account.

Most importantly, have fun! We can't wait to see what Corroded Coffin fanworks come out of this new event!

More info below, including full prompt list with jumping off suggestions, the warm-up rounds for April, May & June, and a spreadsheet you're free to use:

PROMPTS:

JULY 1ST - FIRSTS

First gig, first check, first award, first...anything.

JULY 2ND - IN THE BEGINNING

How did Corroded Coffin come to be?

JULY 3RD - BEST FRIENDS

Who are the best friends in the band in your head? Let's find out.

JULY 4TH - EDDIE

We all know Eddie. Let's hear some more about him today.

JULY 5TH - ON THE ROAD AGAIN

Get them out on the road, in any way you see fit.

JULY 6TH - HEARD IT IN A LOVE SONG

Let's have some romance. Any pairing(s) that tickle your fancy.

JULY 7TH - CELEBRATE GOOD TIMES, C'MON

Let them celebrate! Maybe that's a birthday/holiday/celebration show. Maybe it's a wedding, etc.

JULY 8TH - BAND POLITICS

Fight! Fight! Fight! Not everything goes smoothly all the time.

JULY 9TH - THE HIDEOUT

Catch them there, every Tuesday, playing for five drunks.

JULY 10TH - PRIDE

Let's see them celebrate Pride! Or let's see them be proud, etc.

JULY 11TH - JEFF

Let's spend some time with the guitarist of Corroded Coffin.

JULY 12TH - OW!

Injuries happen. Tell me more.

JULY 13TH - SEX, DRUGS & ROCK N ROLL

Tell us about the seedier parts of being in a band! 18+ for adult content, please!

JULY 14TH - AND THE WINNER IS...

It's time for awards season. Do they win? Lose? Let us know.

JULY 15TH - LET'S TALK ABOUT THAT

Press Tour/Interviews. Sometimes they need to promote themselves.

JULY 16TH - STRUGGLING

They're working their asses off, grinding it out, but they haven't hit the big time yet. Or they're struggling in other ways...

JULY 17TH - "THIS ONE'S FOR YOU"

Dedicate a song to someone special.

JULY 18TH - FREAK (GRANT, FRANK, GOODIE, ETC.)

Whatever name you given him, let's all focus on the bassist of Corroded Coffin.

JULY 19TH - IN THE GARAGE

Get them in the garage. Band practice, fixing the van, etc.

JULY 20TH - UNDER THE COVERS

Let them cover some real songs. Or, you know, get under the covers in another way...

JULY 21ST - HATE THIS TOWN

Hawkins. How was it dragging them down? Or, maybe they hate LA...

JULY 22ND - ALTERNATE UNIVERSE (AU)

Use your imaginations and put them into a whole new world!

JULY 23RD - UP AND COMING

They're finally gaining a little traction. Or maybe they're up...and coming. *wink wink, nudge nudge*

JULY 24TH - BEHIND THE SCENES

What's it take to get this show on the road? Or, what are they really like, off-stage? Let's get a peek behind the curtain.

JULY 25TH - GARETH

Bang them sticks! Let's catch up with the drummer of Corroded Coffin.

JULY 26TH - TOUR DATE

Let's focus on a specific show.

JULY 27TH - YOU'LL BE IN MY HEART

Navigating love while on the road.

JULY 28TH - BACK TO INDIANA

Let's go back to Hawkins and/or Indiana. Send these boys home.

JULY 29TH - BEHIND THE MUSIC

You know there's drama. A story. Probably enough for VH1 to come knocking.

JULY 30TH - FAME & FORTUNE

They've made it big! Now what?

JULY 31ST - YOUR SONG

A Corroded Coffin song? A work inspired by a song? A song that makes you think of Corroded Coffin?

WARM-UP ROUNDS:

Let's get a little practice before the full event in July!

Here's a prompt each month leading up to the event to work out the kinks and get in the rhythm of it all!

APRIL 15TH - TAXED

It's tax day. Do they need to pay their taxes? Is this a write-off? Or, are they just taxed from being on the road? Tax them.

MAY 15TH - GET A JOB

Put 'em to work. First jobs, side hustles, etc. Surely they've had some other jobs besides being in the band. Tell us about them.

JUNE 15TH - BAND ON THE RUN

Are they late for a gig? Running from monsters in the Upside Down? On a tour from hell?

Same guidelines as the full event will apply.

SPREADSHEET:

If you'd like a spreadsheet to help you keep track of the prompts and your progress, here's the one I personally use for other events, and will be using myself for this event. If you'd like to use it yourself, just go to File>Make a Copy and you'll get a version you can edit in your own Google Sheets.

Thanks for showing interest in having a Corroded Coffin event this year! ❤️🦇🖤 - @thisapplepielife (and thanks for the help and adding to the prompt list, @wormdebut!)

[scoonsalicious]

Unwanted: Chapter 23, Undressed - Pt. 1

Pairing: Bucky Barnes x Avenger!Fem!Reader

Summary: When your FWB relationship with your best friend Bucky Barnes turns into something more, you couldn’t be happier. That is, however, until a new Avenger sets her sights on your super soldier and he inadvertently breaks your heart. You take on a mission you might not be prepared for to put some distance between the two of you and open yourself up to past traumas. Too bad the only one who can help you heal is the one person you can no longer trust.

Warnings: (For this part only; see Story Masterlist for general Warnings) Language, mentions: of drug use, drug dealing, stripping, prostitution, drug overdose, seizures, organized crime.

Word Count: 1.6k

Previously On...: After using your quick wit and computer skills to get you both out of a sticky situation, Tony offered you a job, and a beautiful friendship was born.

A/N: And we are ON THE MISSION! Welcome to Atlantic City, besties!

NOTE! The tag list is a fickle bitch, so I'm not really going to be dealing with it anymore. If you want to be notified when new story parts drop, please follow @scoonsaliciousupdates

Banner By: The absolutely amazing @mrsbuckybarnes1917!

Thank you to all those who have been reading; if you like what you've read, likes, comments, and reblogs give me life, and I truly appreciate them, and you!

Taglist: (Sadly, tag list is closed; Tumblr will not let me add anyone new. If you want to be notified when I update, please Follow me for Notifications!) @jmeelee @cazellen @mrsbuckybarnes1917 @blackhawkfanatic @buckybarnessimpp @hayjat @capswife @itsteambarnes @marygoddessofmischief @sebastians-love @learisa @lethallyprotected @rabbitrabbit12321 @buckybarnesandmarvel @fanfictiongirl77 @calwitch @fantasyfootballchampion @selella @jackiehollanderr @wintercrows @sashaisready @missvelvetsstuff @angelbabyyy99 @keylimebeag @maybefoxysouls @vicmc624 @j23r23 @wintercrows @crist1216 @cjand10 @pattiemac1@les-sel @dottirose @winterslove1917 @harperkenobi @ivet4 @casey1-2007 @mrsevans90 @steeph-aniie @bean-bean2000 @beanbagbitch @peachiestevie @wintrsoldrluvr @shadowzena43

Tumblr will not let me directly tag the following: @marcswife21 @erelierraceala @jupiter-107 @doublejeon @hiqhkey @unaxv @brookeleclerc

The Wiggle Room was nothing like Beantown Burlesque, of that you were certain. For a stripclub, Beantown had still managed to cater to a relatively upscale clientele, demanding exorbitant cover charges, selling overpriced drinks, and charging a premium for lap and private dances– hell, Tony Stark had gone there. And they never, ever, encouraged you to take on any ‘extra’ services for customers. Sure, clients asked, but girls were fired for accepting, and if a client wouldn’t take your ‘no’ for an answer, Beantown’s bouncers were more than happy to send them flying out the door on their asses.

You quickly learned that The Wiggle Room played by an entirely different set of rules when a customer asked if he could snort a line of coke off of your ass during your first shift. Everyone, it seemed, was high on some kind of drug, customers and coquettes alike. It made it surprisingly easy to get information out of people without rousing too much suspicion onto yourself.

Within the first two weeks, you and Sam were able to uncover that most, if not all, of the missing women you were investigating had either been, or tried out to be, dancers, bought drugs, or prostituted themselves out of the club. You were definitely in the epicenter of the disappearances. You positively had the where, but you were still far from discovering the why and the who.

You and Sam had set up a temporary caseboard in the dining nook of the apartment you were using as your safehouse. The two of you had already been good friends, but playing a couple at the club and sharing tight accommodations had intensified the power of your bond, and as you sat in front of the caseboard eating your Chinese takeout together, you couldn’t help but rib one another.

“Lavender definitely has a thing for you,” you pointed your chopsticks at him, referring to one of the club’s older dancers, who, at 45, had taken a shine to the Falcon from the moment he’d taken his position as member of the club’s security team.

“Well, can you blame her?” Sam said, slurping up the noodles of his lo mein. “Hard to resist a good piece of dark chocolate, and Ole Sammy’s a fine box of Godiva.”

You wrinkled up your face. “Okkkay,” you said, “ignoring the fact that there’s so much gross in that statement that I don’t even know where to begin, should I give her your number, then?”

Sam nearly choked on his food. “Absolutely not!” he coughed. “She’s got six kids!”

“Wow, Samuel,” you said, pretending to be offended on Lavender’s behalf, “I didn’t realize you were prejudiced against single moms. Does Sarah, know that fascinating tidbit about you?”

“Nuh-uh, Baby Girl. Don’t you go tryin’ to put words in my mouth. I got nothin’ against single moms– they’re the backbone of this country– but Lavender’s also got six baby daddies she doesn’t know how to quit. I ain’t lookin’ for that kinda drama in my love life, thank you very much.”

You took a bite of your chicken & broccoli. “Fair point,” you conceded. “I’ll allow it.” Sam tipped his head to you in his thanks. 

You let your attention drift back to the board. In addition to photos of the missing women, you’d also managed to populate it with a combination of ID photos and mugshots of the club’s employees and management. As you’d learned the identities of your coworkers, you’d been able to piece the hierarchy of the organization together, but you only got as far as the club’s owner, Vladimir Kozlov. When you’d sent his name and some covert photos back to the Tower, you hadn’t been surprised to receive word back from Natasha that Kozlov had, at one point, been a low-level thug in the Russian mob. What you hadn’t yet been able to decipher, however, was how he kept the club afloat. According to your research, the Wiggle Room was hemorrhaging money, its expenses far surpassing its recorded income, yet Kozlov dressed himself in the finest European suits and drove a seemingly never-ending rotation of sports cars that would rival Tony’s. 

You and Sam had both come to the shared conclusion that Kozlov didn’t have the brain cells to run a successful, let alone lucrative, criminal operation on his own, and therefore, there must be silent partners involved in the club that you’d not yet been able to identify. The drugs that were sold out of the club could account for some of its income, but not nearly enough. 

“I’ve got an idea,” you said, turning back to Sam.

“Why do I feel like someone just walked over my grave when you said that?” he asked you with an exaggerated shiver.

You cocked your head. “Probably because it’s a terrible one.” Nibbling on your lower lip, you debated whether or not to tell him. He was going to hate it, but you couldn’t think of a better way to get closer to Kozlov’s inner circle. “I think I should start buying drugs from Kozlov’s men.”

The look Sam gave you was withering. “Pocket,” he warned, “that’s an actual crime.”

“I’m not going to do them, Sam!” You put down your carton of rice. “I just need to make them think I am. Kozlov keeps the girls that buy from him close– he likes how they come to rely on him. I think it gets his rocks off to have them be dependent on him. I wouldn’t be the least bit surprised if he lets things slip in front of them because they’re too strung out to pay attention.”

Sam seemed to consider your proposal. “I don’t like it, Baby Girl,” he said. “It sounds dangerous. What if he tries to take advantage of you?”

You held up the silver bangle that served as your distress signal. “Then I call for the calvary,” you said. “I won’t actually be high, so I’ll still have my wits about me.”

“So, you think you know enough about gettin’ high to fake it in front of a bunch of drug dealers?” Sam asked, clearly thinking you were overestimating your acting abilities. 

You puffed a breath out of the corner of your mouth. “Yeeeeah. So, here’s the thing… I might have spent a good chunk of my teen years on a variety of illegal substances.”

Sam’s eyebrows went comically high. “Come again for Dark Chocolate?”

How to be truthful yet maintain your sense of dignity here? “Everyone at the Tower knows how my childhood was rough, yeah? That my parents were shit? And that’s the reason I don’t have anything to do with them?” Sam nodded. This much of your past, at least, was common knowledge, and you were more or less keen to leave it that way. “Alright, so, part of that shit was that my mom and her boyfriend were drug addicts. Mom preferred meth and booze, but the boyfriend was less discriminate. He’d do anything if it got him high enough. When he needed me to… let’s say ‘behave,’ he’d give me something, whatever he had on hand. Weed, MDMA, coke, benzos, Special K, opiates. Really didn’t matter to him. The drugs made me easier to control. So, I know how to act like I’m high, because I’ve been high. A lot.”

The look in Sam’s eyes morphed from disappointment at your idea to horror at your revelation. “Fuck. Baby Girl, I had no idea.” You couldn’t meet his gaze; unlike your past as a stripper, this was something you were deeply ashamed of.

“It’s fine, Sam,” you told him, picking your food carton up again just to give you something to focus on. “It was a long time ago.

“What made you stop?” he asked, no judgment, just genuine sincerity in his question.

“Same thing that saved the rest of my sorry ass,” you shrugged, playing with the flaps of the paper carton. “Tony. By that point, though, it was mostly just Adderall to focus on school work and so I could stay awake to take more shifts at the club, and weed for when the Adderall wouldn’t let me sleep.”

“One time, I took too much Adderall to cram for a final, and I had a seizure. Tony had to take me to the hospital, and he was furious– I’ve honestly never seen him so mad. Trust me when I say it made his fight with Cap look like a playground spat. I thought for sure he was going to wash his hands of me. I wouldn't have blamed him.”

The memory of it played through your mind, the sheer disappointment in Tony’s eyes as the doctors told him what they’d found in your system. 

“But, the thing was, Tony blamed himself, said he’d put too much pressure on me. Kept saying he was turning into his father, and he couldn’t have that. So, instead of tossing me out on my ass like he should have, he got me help.”

Sam’s mouth hung open. “I’m sorry, but I think we know two different Tony Starks. This altruism does not jive with the man I work with.”

You smiled and shrugged your shoulders again. “Not my fault he likes me better than you, Samuel. I am a lot cuter.”

“Debatable,” Sam replied before taking a swig of his beer. He looked thoughtful for a moment. “If you don’t think it’s gonna be too much of a temptation for you,” he said after a pause, “I think the drug-buying might work. We can give it a shot, at least.”

You sipped your iced tea. “Won’t be a problem, Sammy. The girl who constantly did that stuff is gone, and she’s not coming back.”

<- Previous Part / Next Part ->

[denaliwrites]

Don't Turn Your Back

Tenth Doctor x GN!Reader

Part 1: Don't Blink Part 3: Don't Look Away Part 4: Dreams See Us Through

Summary: If you never see a Weeping Angel again as long as you live, it'll be too soon.

Requests: Open!

Tag List: @nyxiethesimp

Warnings: Weeping Angels.

When the Doctor said "Let's find out why this Weeping Angel is stalking and torturing you," you weren't exactly sure how he intended to do that.

You were not expecting him to propose establishing a psychic link between you and the Angel in question.

"Absolutely not," you'd said, adamantly. "Find another way -- I won't have that thing inside my head."

"It's the only way," he'd said, and damn if he wasn't a bloody good liar.

"I hate you," you'd said.

To which he'd smiled and replied, "You know you're dying to know." And damn if you weren't convinced he couldn't read your mind, sometimes.

So now, here you sat, with some odd machine he'd fashioned out of scraps sitting atop your head. "I don't like this," you told him nervously.

"Oh, but you look great," he told you with a smile. Despite his blasé attitude, you remained unconvinced. He was a little too casual, yet for some reason he wouldn't meet your eye.

"What's wrong Doctor?" you finally asked as he adjusted the machine you wore. "Why won't you tell me the other options?"

"Because there aren't any," he said, yet again.

"Doctor, I know when you're lying."

"Because the only other option is to let you die," he snapped, voice broken and movements suddenly jerky as he was overcome with emotion. "And I will not let you die."

"Oh."

You regretted asking. And yet, you persisted.

"So this is safe?"

"No," he replied with a sigh. "But you have a better chance if we do this than if we do nothing. If we do nothing... the Angel will get bored, and..."

"It may not send me back... like the other Angels do."

"Are you ready?"

"No."

"Starting on the count of three."

He counted down, turned the machine on... and then everything went black.

You could tell something was off even before you opened your eyes, but opening them certainly confirmed your suspicions. You found yourself back in your flat, but the world around you was strangely dark and covered in thick mist -- even though you were inside.

Not a fan of that, you decided.

Walking through your flat didn't reveal anything out of the ordinary, besides the darkness and the fog. There were no ghosts, no angels, no Doctor, no... anything.

You were alone.

How were you supposed to tell him? How would he know to pull you out? Those thoughts, among others, ran through your head as you made your way outside to look around the garden. Finding more nothing, you moved on to the street.

You saw the TARDIS on the other side of the road, its light dim and ominous in the oppressive dark of whatever Hell this was.

You wanted to run towards it, and into the safety of the TARDIS, but movement to your left caught your attention.

Oh.

The Angel.

You sucked in a steadying breath and walked towards it.

"Why are you doing this?" you asked as you neared. You hadn't expected your voice to echo. It freaked you out a little. This whole place did. The situation, too.

The Angel didn't answer you.

"Oh. Do I need to turn away?" you asked, genuinely. You blinked and when your eyes opened you could've sworn the Angel's lips were slightly more upturned. "Okay. I'm here to talk. I'm here in good faith. Please don't kill me... I... I'm trusting you."

It was a terrible decision, really, but what choice did you have?

So you turned -- and closed your eyes for good measure.

"Why are you doing this?" you repeated.

A voice not unlike two rocks grinding against each other whispered in your ear, "Revenge." And as quiet as that single word was, it still echoed around you.

"But I've never seen a Weeping Angel before," you whimpered. "How could I have done anything to you worth revenging over?"

"Not you," the voice whispered.

Oh. Well, the only other person that left was the Doctor.

"What did he do?" you asked, even though you didn't actually want to know.

"He killed my sisters."

"I... I'm very sorry," you started, swallowing thickly. "That must've been... terrible. I can't imagine."

"He took something from me," the voice continued, "something I loved. So now I will take from him something he loves."

A nervous laugh bubbled out of your throat. "The Doctor doesn't love me."

"Foolish human," the voice said, and there was just enough threat in those words for you to instinctively open your eyes and turn around.

The Weeping Angel was gone.

Nerves alight and mind about a hundred times more exhausted than it was when you first entered this place, you sighed and wearily turned to the TARDIS. Walking inside revealed that it was just as dark, misty, and creepy as everywhere else.

But you could see yourself sitting in one of the seats by the console, unconscious. The Doctor hovered beside you, his hands clutching yours desperately. He kept whispering to himself, but in this place they echoed right over to you, clear as day --

"Come on, come on, come on."

Over and over, just those two words.

You watched sadly for a moment before you made your way to... well, yourself. You weren't really sure how to wake yourself up, but were willing to try anything and everything that came to mind.

Which was how you found yourself going through a series of ridiculous attempts that included yanking on wires, chanting in Latin, screaming in your face, slapping your face, and dancing the hula.

After everything you tried failed, you dropped to the floor with a whimper and closed your eyes.

You awoke with a jolt, gasping desperately as if you'd been holding your breath for several minutes.

The first thing you saw was the Doctor, still hovering over you. He looked incredibly relieved to see you back, unharmed. You let him take the machine off, and though you felt incredibly heavy suddenly you let him pull you into a hug, too.

"What happened?" he asked as he pulled away. "What did it say?"

"It..." God, you were so tired. Why were you so tired? "It says it wants to kill me because you killed its sisters...?"

You could see him pondering that, eyes searching the air as he tried to recall a time he may've killed some Weeping Angels. All the while, his hands still held yours. It was a small comfort, but a comfort nonetheless.

If he remembered at all, he did a strangely good job of hiding it, though you supposed it helped that your sudden swaying drew his attention away. "Hey, hey," he cooed, pulling you up and into his chest. "Let's get you to bed, eh?"

You shook your head, pushing yourself gently away from him. "I need... to think. Erm. I'm gonna take a shower. And then I'll go to bed..." You nodded tiredly but resolutely and made your way to your bathroom.

The shower you took was long, just shy of blisteringly hot, and not nearly as productive as you'd hoped it would be. Your thoughts kept running in circles, or else running away from you altogether, and chasing them only served to wind your anxiety up like a rubber band about to snap.

And snap it did.

You hadn't even realized you were screaming until the Doctor was pulling you out of the water and gently shushing you. You only sort of quieted, your screams simmering down to sobs as you clung to him. He held you firmly, protectively, whispering such gentle words of comfort and encouragement in your ear even as your cries filled his.

"Oh, it's all right now," he soothed, petting your wet hair. "I won't let it hurt you, eh? I promised I'd keep you safe, didn't I?" He sighed when the only response he got was a sob, and pressed a kiss to the top of your head.

Carefully, and much to your confusion, the Doctor managed to move to a stand with you cradled in his arms. You didn't protest as he carried you to your room (again), nor as he set you down and swaddled you up under the covers.

As you started to come down, you realized you were still naked -- that the Doctor had pulled you out of the shower and held you and carried you all while you were naked, but honestly dealing with that would have to wait until you weren't exhausted.

Once he was, seemingly, satisfied with the cocoon he'd surrounded you in, he leaned forward and pecked your forehead, then moved to leave.

"Doctor, please don't," you begged quietly, still sniffly.

He paused for only a moment before he turned back to face you, before he came to sit on the edge of your bed, before he scooted in next to you and laid beside you.

He didn't even need to speak for you to feel comforted. Even just turning to face him and nuzzling up to his shoulder had you feeling immensely better.

He rested his cheek against the top of your head and silently stared up at the ceiling as you yawned and sank into him. It took a long while for sleep to come for you, but when it finally did, it came hard and fast.

You were haunted by nightmares of moving statues.

[scoonsaliciousupdates]

5.3 Lily

Pairing: Bucky Barnes x Fem!Reader

Summary: Lily McIntyre, trainer for new SHIELD recruits at the Avengers Tower, has been in love with her best friend, Bucky Barnes, from the moment she met him. She's been content with her role of the #1 girl in Bucky's life, even if it means she has to sabotage a romantic relationship or two. It'll be worth it when he realizes that they're meant for each other, right? There's just one small problem: Lily McIntire never expected Bucky Barnes to fall for You.

Warnings: (For this part only; see Story Masterlist for general Warnings) Language,

Word Count: 500

Previously On...: Bucky got a call from Lily, wanting to know where he was. He lied to her, of course. That definitely won't come back to bite him in the ass.

A/N: Sorry this is so late going up! Had a last-minute Mother's Day dinner with the family, and then some quality time with @cazellen, and when you add on an hour+ drive each way, it ended up eating my entire evening. But! I wouldn't leave you hanging, so here is today's update, just... six hours late :(

Also, PLEASE NOTE: There is one more section of Chapter 5 to go up tomorrow, and then I will be taking a one-week break from posting so I can focus on writing. So, Chapter 6 will start on Sunday, May 19th. I probably will not be as active on here as I normally am, so if you send me a message and I don't respond right away, it's because I'm busy making more content for you!

NOTE! The tag list is a fickle bitch, so I'm not really going to be dealing with it anymore. If you want to be notified when new story parts drop, please follow @scoonsaliciousupdates

Thank you to all those who have been reading; if you like what you've read, likes, comments, and reblogs give me life, and I truly appreciate them, and you!

Lily clutched her phone to her chest, shocked. Something was wrong. Something was very, very wrong. He had lied to her. She couldn’t believe it. Her best friend had lied to her about what he was doing and who he was with. 

She hadn’t planned on coming to the Compound that night– she’d realized she’d forgotten some files in her office that she needed to look over before she went back to work on Monday, and had just stopped in to pick them up. She figured, since she was there, she might as well go see what Bucky and Sam were up to. She didn’t want to crash their boys’ night, per se, but if they happened to invite her to join them? Well, how could she refuse such an invitation?

That’s why it came as such a shock when she rounded the corner to the rec room and saw Sam and Steve, in front of the large television, watching football together, and Bucky nowhere in sight. She hung back for a few moments, giving him the benefit of the doubt, that maybe he’d been in the bathroom, or in the kitchen grabbing snacks. But when fifteen minutes went by, then thirty, and Bucky still hadn’t shown himself, she began to worry.

She was about to barge into the room and demand answers from Sam and Steve, when she heard them talking during a commercial break.

“So, how do you think the date’s going?” Steve asked Sam.

“Knowing Tin Man, I’d usually say ‘terribly,’” Sam said with a laugh, “but this girl seems to actually like him, so who the hell knows? I guess it depends on what time he comes home tonight… or tomorrow morning, doesn’t it?” 

Lily brought a hand to her mouth to stifle her gasp as she backed away from the entrance to the rec room. 

No. No, no, no, no, no, she thought. He wouldn’t do this, wouldn’t just start seeing someone without telling her, warning her, would he? 

So, she’d called him. 

“I promised Sam we’d do guys’ night,” he’d told her at brunch, the lie coming so smoothly off his lips. But she’d heard a woman’s voice on the line with him.

Lies.

And then, he’d snapped “I already told you what I was doing… You don’t have to keep checking up on me.” He’d never used that exasperated tone with her before. Never. And to just hang up on her, without even a proper goodbye?

She felt hurt. She felt betrayed. In their years of friendship, Bucky had never lied to her before, had he? And why? Why now? Who was this girl, and what was so fucking special about her that Bucky felt the need to lie to his best friend about her? 

Lily felt like she was going to be sick.

She needed to find out who this mystery woman was, immediately. And she needed to do everything in her power to make sure Bucky never saw her again.

<- Previous Part / Next Part ->

[nekovmancer]

Broken porcelain

pairing: Ramattra x f!reader  prompt: sexual tension when tending to someone's wound from this list warnings: semi-nsfw, mentions of blood, injuries, semi-nudity, swearing, reader being a bit masochist etc etc word count: 2272 a/n: backstreet's back, alright! and finally. 😎 I’ve been a bitch with a big B for Ramattra over the past couple months, and of course I had to write a piece on that robot guy. He gives me… feels I can’t explain. So, for all my fellow robot fuckers, hope you enjoy reading this as much as I’ve enjoyed writing! Feedback is always appreciated and please please please send an ask, a chat, anything so we can talk about this big guy and more fanfiction prompts. 😭 also on ao3!

Who would ever say to be a human amongst killing machines would, impressively, be a dreadly task? Or deadly, you would remark to yourself after a long walk of dragging your wounded body through the corridors from the training field to Ramattra’s personal workshop. At least, those new assassin omnics would perform their duties impeccably, you could tell from the way they cut through your skin without a single issue.

The wound was still covered under the thin layer of the tank top you have on, the white fabric damp of crimson blood denouncing something went terribly wrong, not to mention the pained expression contorting your face. 

As soon as he eyes your state, if Ramattra could bring a worried expression to the surface of his faceplate, he would, a mirror to the torment running through his systems. He was an engineer, not a human healer, but you needed him to act more as such in the present moment if you’re both willing for you to stay alive, which you indeed were. 

Growing impatient, not to mention the pain reaching under your skin, you adjust yourself slowly on top of his workbench, holding your side to prevent any further damage. Your fingers get moist with blood, and that has your lips twitching. “Can you fix me or not?” 

“That depends on your meaning of fixing,” he states, a stoic demeanor on the outside despite feeling quite the opposite inside. Feeling. Something he didn’t think to be inclined to, at least not when those diverged from the violence he was shaped to perform as a being… and yet, here they are, as foreign to him as the surgical aspects of flesh and bone. “I can’t weld you, obviously. At least, not as a first resource,” his slight humor brings a faint smirk to your lips, slowly shaking your head in a quiet response. In a lighter tone, Ramattra proceeds, and now it’s definitely a command. “I would like to have a closer look.”

Quietness follows, not as fast as the warmth spreading from your neck to the tip of your ears. To say you hadn’t considered you’d need to remove your shirt was unnecessary, in front of him of all people, ‘cause you’d rather overcome your own fear of blood if a second thought had you aware of the chances before. But as the old saying remarked: if you are in hell already, just go and sit on the goddamn devil’s lap.

Proceeding a thick swallow, you do as you’re told, diverting your eyes to a corner to avoid examining the cut yourself, or to avert them from Ramattra’s, anything and everything were an excuse in such a situation. It hurt just enough to be something you knew you couldn't handle alone, and considering how sharp that assassin’s knives were… fuck’s sake, what a weak fool you were.

On the other hand, at the sight of your almost bare torso, Ramattra felt inexplicably tense. The wound itself was not too deep to reach anything vital, but would need a patch up indeed in order to heal properly. Yet, his sight wasn’t restrained to that minor part of your skin, and that’s when tension was found. Maybe the vocabulary wasn’t a perfect fit, ‘cause that jolt of electricity running through his circuits was something else, something as sublime as the curve of your hips, and the way you shallow breaths of anticipation had your body quivering, despite an enormous strength to keep it still. He could hardly find beauty in human beings, and let’s not even mention himself, but that was a whole different scenario… warm, with a hint of degradation he couldn’t ignore, and something that could only be named as akin to desire. 

The silence was killing you now, almost making you forget the very pain which brought you there in the first place. “Will we be helding any funerals?” you risk, in the same light humor he used with you before. At least, if you didn’t consider the shaking tone in each syllable you’d pronounced. You thought Ramattra couldn’t  never understand your concerns fully, even if he invested all his force to: if the worst happened, he could be reconstructed, you were there for it after all. But as a human, it’s not like you have a respawn chance anytime. That’s why, aside the anxiety turning your stomach into a knot, you needed him to act. 

“You speak as if it's more severe than it is in fact,” he muses, tilting his head as the scanners on his optics do the rest of the work, searching for the right proceeding in a shared data file, where he was hoping to get anything from an omnic model whose initial propose, contrasting his, was to heal, not to kill. “No funerals, you have my word. The pain may be harsh, but the wound itself is of little harm in the bigger picture. You’re safe,” the addition of the last sentence has you sighing in relief, and a pinch of pain reaches you once more, but it’s bearable. Ramattra made you feel protected, or better, cared for. The warm feeling is enough to soothe your anxiety, dissipating the chill air in the workshop for a little while before rushing up to your cheeks as you’re reminded you’re still half naked in front of him. 

“Lay,” he commands, and your breath gets caught in your throat in the act. Only if your mouth were open, your heart would surely jump out if it during one of its chaotic heartbeats, contrasting the steady tone on Ramattra’s voicebox, echoing those words without a single trace of malice. But when they hit you, they sounded profane, leaving a delicate trace of forbidden to the tip of your tongue. 

You curse your mind as you lay down, a shiver erupting from the contact of warm skin to the cold metal of his workbench’s surface. Fuck, he’s your commander, superior office or whatever goes between you both, your boss to be short. Thing is he saw a purpose for you and spared your life long ago, and that purpose goddamn sure didn’t imply any… deeper contact than the occasional intellectual help you provided, with efficient (and smaller) hands and a cunning mind. After all, no Ravager was made to indulge in such a thing as intimacy, the very same thought cursing through Ramattra’s systems right now. He wasn’t built for delicacy, a single gentle touch for his standards would be brutal enough to leave you bruised for days, and how he would lament to see such perfect skin ruined by his own hands… unbearable to even think of it without feeling a strange sensation housing between his metallic limbs, pushing further inside in search of a bloody beating heart among the cold hardware. 

It wasn’t the first time he felt unsure in his existence, but that was a whole new thing. To think one like him was able to possess a spirit tender enough to be mesmerized by such a fragile thing as you touched him not physically, but deeper than it could ever be… how thrilling it was, but insufficient to make him search for its source on his internal data to completely erase it. No, never. He was actually holding into it with every fiber of his soul, curious to see which path it would lead him through. A bit embarrassing, at first impression, like the sight of you would burn his optics until they melt.

After all these years working along, was it there all the time? Within him, within you? He would search for it later, revisiting each time you shared each other's company in his memory, to see where a quiet admiration turned into this. 

After gathering the resources to fix you, ensuring everything was sterilized, he turned to sight over your form once more. Ramattra could sense the rapid heartbeat against your chest controlling your breath motions, the rising and falling of your chest following along, where he caught a peek of your nipples drawing a small circle under the fabric of your top, the last barrier between him and your fully exposed torso. Thankfully, unlike any human, his faceplate didn't betray any of his thoughts. They’re guarded within his systems, safe in his memory and imprinted there forever. Nothing could ever make him forget of you, nor time, nor enemies, nor… fuck, the injury. 

“It would feel better if you were asleep,” he commences, carefully. You’re already scared for it seems, and it’s not on his wishes to make it worse. “Instead, I will ask you to bite on this,” the discarded cloth of your tank top is brought to your lips, and your heart could have stopped right there. Instead, avoiding the disbelief, you silently obey. “Try not to move. I shall be slow.”

A nod follows, and you gather your best to not whine, or flinch, or sob too much when his hands begin to work, stitching the wound close. Whatever sounds leaving your mouth are muffled, and the pain is great. But erotic. And, fuck, you should be loosing your mind by this point. How could your brain process such agony in a pleasurable way? You’d be blaming the omnic in charge of patching you up, for sure. It was him, after all, all about him. 

Ramattra was enormous, and the effort he put in each precise movement didn’t go unnoticed. He could have discarded you, blamed you for your mistakes, assigned anyone else to deal with this bullshit, but there he was: the infamous Null Sector leader, treating you as a precious porcelain tea-cup, once broken, now being patched in threads of gold, despite the gold being metaphorical. It was a form of art, wasn’t it? You’ve read of it somewhere, once. If so, right now, you’re his masterpiece.

To say he’s being delicate is a statement. Ramattra is afraid he could shatter you again, worse than they did with you before. The responsible for it would be severely corrected, later of course. The pads on his fingertips could never be soft as your skin feels under them, and an eagerness to venture further brings a shiver of electricity through his spine. Should he ever be thinking of it in your state? In fact, was it reasonable to have you consuming his memory like this, injured or not? What could be a groan echoes from his voicebox, and within a few long minutes, it was done. 

Your jaw clenches to the minimum effort of raising your torso, sitting on his workbench once more as a small discomfort to the newly sewn cut emerges. Covered in bandages, you can’t see his work, but there’s no blood and the pain is moderate, so you trust with your eyes closed it’s perfectly fine. Your shirt is sitting by your side, bloodied and wet from your own saliva, but you don’t mention reaching for it. 

Blinking, your eyes search for him, meeting the stoic faceplate turned to you. Silence lingers as you both stare at each other, considering every single thought that coursed through your minds during the late couple of hours. Was it genuine? Absolutely. Would you voice them? No, surely not. Tension is still there, so palpable you could touch it, and shattering it would come with a price. 

A small blush color your cheeks red, and you finally manage to break eye contact with a hint of timidity. Too much to ask of you for a little time of strong, contrasting emotions, still tickling under your skin as the adrenaline begins to sparse. Clearing your throat, you’re the first to speak. “I apologize,” it begins as simple as it, almost ending the sentence there as your eyes don’t dare to move from your lap and you choose carefully what to say, and what to keep to yourself. Ramattra may have performed a solid progress towards emotions, but you feared he would fail to comprehend the turmoil in yours. “It wasn’t strict of your concern, nor a matter you should care for as you did, and I-”

“I had to,” he cut you off, sternly. Now that you’re safe, his worries tend to other subjects, still resonating over you. Was he too obvious, despite his best efforts? Couldn’t be, and yet he wished fervently for you to point it out, verbalizing what he was too afraid to: he wanted to keep you close, and safe, more than he ever did. “Whatever happens to you is my business, especially if it's a menace to your well being,” Ramattra takes a step closer, his fingers aching to reach for your face, and soothe that sorry expression out of it. Instead, he keeps them to his sides, clenching them a fist. “So don’t apologize for it. It wasn’t your fault, in the first place, and yet I’ll ask you to be careful and not wander over the training field whenever a new IA is being tested.”

A short nod follows a faint smile. His words were gentle, not explicitly voicing what he meant in between the lines, but you knew it nonetheless. Ramattra cared for you, more than you could have thought, and enough to satisfy your heart. “I don’t even know how to begin thanking you.”

“Dressing will do,” a chuckle reverberated in his metallic rib cage, and if his words alone wouldn’t catch you yet, it would be enough to make your face red as a cherry for, somehow, you were able to sense a trace of malice in Ramattra. “Rest now, human. I shall meet you when the day is done.”

[cryptidghostgirl]

Drawing Down the Moon (Alastor x Ancient Roman!Witch!Reader)

Pairing: Alastor x Reader

Warnings: I don't think there are any? Please correct me if I am wrong. The subject matter is a little niche.

Description: Alastor reencounters an old friend.

Word Count: 2,871

Master Lists:

All Master Lists 

Hazbin Hotel Master List 

Alastor Master List 

Click here and leave a comment if you want to be added to any taglists or send me an ask about it.

A/N i’ve been reading about roman magic laws for school okay?? don’t judge me. Maybe one of the nichest things I've ever written (except that one Akutagawa x Reader fic I have on my Wattpad where I made them talk to one another in ancient Greek and Latin (its called Leo, Leonis and tbh, that fic slaps if I do say so myself)). Won't be surprised if no one reads or likes this one but I don't care. This will be a monster of a fic, she's been lurking in the recesses of my mind for a hot second now.

"Why would she lie for so long? Does she think I wouldn't accept her?" Charlie was animatedly talking at Alastor as they walked the streets of Hell, "What about me, ME, says un understanding... misunderstanding?... Disunder- Wait, w-where are we?"

Alastor sprung to life as Charlie finally asked a question he had an answer to. Theatrically, he stepped into her curious line of sight, his arms held wide.

"Cannibal Town!" respectfully, Alastor turned and took Charlie's arm in his own, "There's a friend of mine I think you should meet."

"In Cannibal Town?" Charlie doubtfully asked as Alastor began to lead her towards a crowded shop entrance, "But it's... it's... surprisingly nice here."

"Isn't it, though?" Alastor proudly replied, "And it is all thanks to a very special someone."

Alastor opened the stained glass doors to the emporium, allowing Charlie to walk through them before he followed in her wake. The store was full, packed to the brim with cannibals of all sorts, all of whom seemed to part respectfully in the face of Alastor, allowing him to approach the front counter with Charlie trailing after him.

"Ah, Johnny my good fellow." Alastor hummed to the cashier, leaning casually on the counter.

The demon seated behind the table looked up with a wide smile.

"Mister Alastor, it has been quite a while since we've seen your face around these parts."

Charlie watched the interaction in mild surprise. It wasn't often she had the pleasure of meeting someone Alastor knew who didn't hate him or want him dead. Curiosity clouded her mind as Alastor waved the man off.

"I don't mean to be rude but, we're in a bit of a rush." Alastor said, politeness pooling delicately around his words, "Rosie wouldn't happen to be in, would she?"

"Ah, well, you see, Mister Alastor..." the demon seemed slightly uncomfortable, scratching at his ear slightly, "She's a tad... preoccupied at the moment?"

"A guest?" Alastor asked.

"A guest." Johnny reluctantly confirmed.

"Well, no matter. Is she in the back?"

"Yes," Johnny got to his feet, leaning forward as Alastor linked arms with Charlie once again, leading her behind the counter, "but I really don't think it's a good idea to... and they're gone."

"Wasn't that rude?" Charlie asked as Alastor pulled her behind the curtain that separated the main store from the backrooms and Rosie's apartment, "Oh no, is that guy going to get in trouble? Because of us?"

"Everything will be just fine my dear, don't you worry." Alastor patted her hand reassuringly as they came to stop before a door.

Letting Charlie's arm fall free, he straightened his jacket just the slightest bit before knocking on the door. There was a moment of silent anticipation before a voice from the other side called:

"Who is it?!"

"Alastor, Rosie." Alastor replied calmly.

There was a rustling of fabric, a handful of hasty footsteps, and the door swung open to reveal a woman. She was tall and beautiful in her long dress and her wide brimmed hat.

"Oh my stars!" she exclaimed with a bright smile, "Do my eyes deceive me? Alastor? Alastor! Where have you been? These halls really lost some of their sparkle without your lively presence and-"

The woman, Rosie, trailed off as she caught sight of Charlie standing beside her dear friend.

"Oh, who's this you brought with you? Come now, Alastor, she's much too young for you. Oh, I'm just kidding. But where are your manners, Mister? Introduce us, why don't you?"

"Ah, yes, Charlie, this is Rosie: the most darling, delightful, and dangerous Overlord this side of the pentagram."

At his words, Rosie smiled, giving a perfect curtsy. It was as her form lowered that Charlie caught sight of the interior of the room, and the strange seated figure it housed. Alastor seemed not to have noticed and as Rosie straightened herself up again, she laughed slightly.

"Oh, always such a charmer."

"And Rosie," Alastor continued, "it is my pleasure to introduce you to Princess Charlie Morningstar, daughter of Lucifer and heir to the throne of Hell."

Charlie smiled weakly, waving slightly at the imposing and nearly off-puttingly cheerful woman.

"How do you do?" she asked awkwardly, "I am very sorry for interrupting your meeting, I tried to get Alastor to wait but..."

"Oh, yes!" Rosie suddenly exclaimed, almost as if she had forgotten about her previous guest in all the excitement, "Come on in you two, I'm sure she wouldn't mind."

Charlie was about to protest when Rosie grabbed her by the arm, dragging her into the room. Alastor followed, turning his back as he shut the door behind them. Charlie's mouth fell open slightly as her eyes finally saw the truth of Rosie's guest.

She was tall, probably tall enough to rival Alastor or Rosie herself. Skin tinged slightly blue, she seemed to be covered in a faint gold dust that clung to her draped, toga-like dress and skin in equal amount. Heaps of gold jewelry hung on every inch of her as well, wrapping her wrists, her neck, her ankles, her fingers, even braided into her hair. Resting atop her head was a crown of gold with a half moon on it, her feet were bare. With wide, white eyes that nearly seemed unseeing, the woman watched Charlie carefully.

"Can I offer you something to eat?" Rosie was asking, but Charlie could barley hear her, unable to break eye contact with the woman, "I'm sure I have a leg around here or something..."

"I am afraid were not here for food." Alastor thankfully stepped in, turning to Rosie with closed eyes and a wide smile, "We happen to be in need of some help."

"Alastor?" the woman spoke and her voice resounded in itself, loud yet soft at the same time, singular and yet somehow plural.

"Well, aren't you fresh."

That was the first thing she had ever said to him. Alastor had been wandering Hell, minding his own business when he had heard that voice say those words and felt a fire ignited in him. Slowly, he had turned around to see a pair of towering demons. Overlords, he realized, and big ones at that. Alastor's smile sharpened at its edges as he began to formulate a plan.

Charlie turned at last, as if whatever spell the stranger had cast on her had broken at the sound of her voice, to look at Alastor in mild confusion. She heard his breath hitch in his throat. The man in question was frozen, his ears twitching wildly, his eyes now wide open.

"Is that you?" the demon asked again.

Alastor somehow seemed to reassemble himself before their very eyes. Slowly, he turned to the room's only occupied chair.

"Who are you?"

Alastor feigned innocence, looking up at the titan herself as she took a step forward. In an instant, she stood at his height, looking him dead in the eyes.

"An odd one too." she hummed thoughtfully, white eyes tracking the stars, reading his future it almost seemed, "Most people go with what before who."

Alastor was unsure how to respond to that one. The titan chuckled, a grin flashing across her face. It was unexpected, disconcerting. Alastor hadn't thought her face capable of any expression save solemn disinterest. She turned her head slightly to the side, looking back over her shoulder to her companion.

"Zestial, cara mea?"

The spidery demon took a step forward, meeting her eyes.

"Yes?"

"Don't you have something you need to be getting to?"

Alastor may have been dumbstruck, but he wasn't stupid. He heard the order as clearly as if she had not bothered with the formalities of disguising it. It shocked Alastor to his core. This might be his first time encountering Zestial but, he had heard the demon's name before. Most frequently, it had been spat at him by his victims who claimed that one of Hell's oldest and most respected demons would come for him. So who was this other overlord, the titan? Sure, he'd heard of her before but enough that such blatant disrespect towards Hell's most respected made sense? No. Not at all, in fact.

Zestial paused a moment before bowing his head slightly.

"You're quite right." he hummed, "I will be seeing you presently I expect?"

"Perchance." the titan lazily replied, her gaze having long since switched back to Alastor, set on analyzing his features, "I'll let you know."

With another polite bow, Zestial had turned and began walking in the opposite direction. The titan held an arm out for Alastor. He looked at it curiously before meeting the demon's eye's again. She laughed.

"So suspicious. I thought you we're the one killing overlords, not me."

His eyes went wide.

"How do you..." he cleared his throat, "how did you know?"

It was a stupid question and he knew it. There hadn't been any secret keeping, not really. Sure, he never outright said he was the Radio Demon who broadcasted screams but he supposed there couldn't be many Radio Demon's out there really. It didn't matter that he had only been going after overlords for a month or so now, she was one. Of course she would know.

"Let's go for a walk, shall we?"

All it took was one look. Suddenly, he was new again, spat fresh out of life on Earth and in to Hell's gaping maw. One look at her, and he dissolved at the edges, forming and reforming his own ability to speak and comprehend the world around him.

"It is." the woman hummed, a wide smile breaking across her face, revealing the blackness of her teeth, her mouth.

Alastor soon formed a bit of a soft spot for the inhuman overlord. It was that first meeting, that first walk. He had asked, hunting for information to wield against her, about her life on Earth and in Hell. It was her fault really, for answering. That's what had him stuck.

Y/n had laid her life out for him like a freshly pressed table cloth. She had been raised on the streets of ancient Rome and executed as a witch. She was perhaps the oldest demon remaining in Hell, the exterminations having eventually wiped out even the strongest members of her times. Just as Alastor had been reborn as a deer due to his death, so too was she reborn as what they had accused her of. Every ritual, every spell, prophecy itself all worked for her. It was then Alastor understood the interaction he had witnessed between Zestial and Y/n, then he understood the respect.

He found himself drawn to her more and more and, somehow, he always seemed to be able to find her when he went searching. He assumed it was some strange magical nonsense she controlled. Alastor didn't question it.

Y/n showed him Hell in a way he had never seen it before. She taught him where to gather herbs and how to use them, how to bend the earth to his will, how to spin iunges and call down the storms, the rain, the moon. Alastor devoured, fed by her hand.

It was odd, Charlie had never seen a demon like her before. The white eyes, the teeth black with what seemed to be darkness, the gold. All of it was off putting yet somehow, captivating. Alastor seemed to be acting weird, his eyes flitting wildly across the woman, taking in her every detail. Charlie wasn't sure what to do about that.

In some sense, Alastor seemed to be scared. In another, he was in an overjoyed state of disbelief. Charlie wasn't sure which was more disconcerting, or how to respond to either and so, she simply watched.

"I have a question, mea ocella."

Y/n announced one day and Alastor turned from where he sat spinning stories into his microphone at her feet. That was what she had called him, her little eye. She told him it was a term of endearment. Alastor had no reason to doubt. The red grass swayed slightly in the breeze as he looked up at her, immediately bringing a halt to his broadcast.

"What is it?"

"You've been so set on ending all us overlords for so long now," she hummed, "wouldn't you like to do something different?"

"Something like what?"

"See from the other side of the glass."

Her white eyes glowed blue, the gold on her skin shining out into the world around like stars. Alastor sighed.

"You're prophesying again."

She nodded in agreement. Y/n had never seen the point in lying, she had never known its use. Not since before she could remember, back in the times she lived. They were so distant now, so immaterial and unimportant she rarely payed those memories much mind.

"So, what is it you see me doing?"

"Simple riddle or play on words?"

The two types of prophesy, the two options. Alastor put a finger to his chin, humming in thought.

"Simple riddle. Please, not in dactylic hexameter if you would, decoding that always gives me a headache."

"But that has been the meter of prophecy since Justice herself sat on the Delphic throne, mea ocella." Y/n retorted in surprise, meeting Alastor's eyes.

"Yeah, well."

Y/n laughed lightly, looking back out blankly toward the future.

"As you wish, ocella. Just this once. My gift to you."

Alastor hummed his non-comital thanks, turning his gaze back out the the skyline of the city as well.

"One will be two, two will be four, when that number comes be ready for more. Seven years past under grim sudden stress, four becomes ten, I'll tell you what happens next. Help one bright star to the top, not too far, and you will be free from the one not the three."

"Rhymes? Really?"

Y/n looked down at him, the glow fading from her as their eyes met and the future vanished from the scope of her vision.

"You asked for no hexameter, I still get to have fun."

"Yeah, yeah."

The pair fell into a comfortable silence. Alastor ran the words of her fortune in his head, trying to gain any semblance of reason from them.

"They don't sound very... avoidable."

"That's because it's not one of the ones you can change."

"Oh."

Y/n pulled herself to her feet suddenly, her chiton swirling around her. Alastor watched in awe as her image flickered in the air for a moment between the image of herself just a head shorter than him, the one who loomed around nine feet tall, and some three headed monster at what must've been five stories. Leaning, she held a hand out for him to grasp. It took Alastor a moment to realize, shaking his head slightly as he at last accepted Y/n's help and got to his feet.

"Where are we going?"

"I've decided you are going to be an overlord, mea ocella."

"Why?"

"I think it might help you down the line."

It had been years since Alastor had seen her. Long before he had taken his so called seven year sabbatical, Y/n had vanished. Alastor knew she wasn't dead, he would have been able to tell if she was dead. Surly the world would have shifted in some new and strange way to lose the goddess of the crossroads, the titan, Hekate made flesh and blood. Nothing like that had happened and so he knew she was alive, just not where or how.

Y/n's prophecies were always accurate. Standing here before her now, Alastor recalled her words from all those decades before.

One will be two, two will be four. When that number comes, be ready for more.

One had been just him. Two? When he had died and met his shadow. Alastor realized now that three had been Y/n herself and that the fourth important person who had come into his afterlife was the very person who owned his soul.

Seven years past under grim sudden stress, four becomes ten, I'll tell you what happens next.

Seven years he'd been gone, indeed under an unexpected and disastrous situation. When, after seven long years, he had returned to Hell, he had gone to the hotel. It was at the Hazbin Hotel that he not only met Charlie, Vaggie, Angel, and Sir Pentious but that they became vital parts of his life along with Husk and Nifty who before then had mostly existed on the periphery. Those six, plus the original four, made ten.

Help one bright star to the top, not too far, and you will be free from the one not the three.

All along, all those years ago, she had known. Alastor had always respected Y/n, always harbored a soft and disconcerting love for the witch. Never before now had either felt so overwhelming. Alastor took a trembling step forward from his place at Charlie's side. The world closed in, she was the only thing he could see.

Y/n smiled as he sunk to his knee before her, his head bowed.

"Mea ocella." she happily hummed, lifting his head up gently with the tips of her bluish grey fingers.

"Y/n."

----

This fic will probably have a part two.

TAGS:

@willowshadenox @i-love-jafar @elfyeet @reader3 @lazygirlfanfic0-0 @kahlan170 @wendyphan01203-blog @fairyv-ice @clarakainda @lunaramune @mcueveryday @luxky-aish @peterpankat @corvid007 @juskonutoh @simpingsohard @sethianaa @gabile18 @slytherin4ever @skyeliteratures @zombiesnips-blog

[hannie-dul-set]

the breakup soup [preview].

SYNOPSIS. you and jeonghan get into an argument in the middle of the meeting. the rest of your organization’s officers slowly start to realize that this isn’t just about whether the mountains or the sea would be the better venue for your event.

PAIRING. yoon jeonghan x female! reader. GENRE. lovers to exes to lovers, humor, romance, mild angst, orgmate! jeonghan, college! au, a whole lot of forced proximity, there is only one bed trope will be sprinkled in there somewhere. WARNINGS. written breakup (obviously), so much swearing, sex jokes, will add more as i move forward. WORD COUNT. preview: 2.8k | full fic: est. 15k.

RELEASE DATE. november to december. TAGLST. send an ask/dm/reply to be added.

NOTE. had a bathroom thought. wondered "wouldn't it be funny if a couple breaks up during an org meeting" and it has led me to this dumpster fire. i think it's funny. i hope you think it's funny. i understand that there might be some unfamiliar org jargon here and there, so please feel free to ask me for clarifications if some things are unclear so i can fix them in the final fic!

preview under the cut.

“TODAY IS SEPTEMBER 7, 20XX. THE MEETING WILL NOW PLEASE COME TO ORDER. Mr. Secretary, please call the roll.”

The words robotically fall out of Seungcheol’s mouth as he turns over the pages of his clipboard, marking a precise, red dot next to the word ‘agenda’ on the page. Another day, another meeting. He can’t wait for the moment he can finally retire from this god damned position. Every single time he repeats his presiding officer script, it feels like a digit gets added to his age.

“Yes, Mr. Chair. Please say ‘present and voting’ once your name is called to be acknowledged.” 

Wonwoo starts the roll call, and Seungcheol is desperately trying to cover his yawn with the clipboard, else Seungkwan is gonna grate at him again for dozing off in his own meeting— the aforementioned straightening himself in his seat when his position is called.

“Public Information Officer 1?”

“Present and voting.”

“PIO 2?

“Present—” says Joshua, flicking a paper clip across the table and into Vernon’s nth latte of the day. “—and voting.”

“Next. Assistant Business Manager.”

“Prese—”

“Okay, got it.” Chan brandishes a look of offense when Wonwoo cuts him off. “Business Manager?”

“Present and voting. Do we really have to keep doing this one by one?” 

Mingyu has a point, Seungcheol mentally agrees. But his god damned seniors wrote in the damned constitution and bylaws that every meeting of SVT (Society of Virtuous Timetravellers. He’s in the process of renaming it because your organization that’s supposed to be for history and culture is attracting weirdos instead— and two of them are Soonyoung and Seokmin) must abide by strict parliamentary procedures, so he has no choice but to suck it up and listen as Wonwoo continues to read out the succeeding positions on the attendance list, and it’s starting to sound a lot like a lullaby.

“Secretary, yours truly, present and voting.” The scratch from Wonwoo’s throat signals Seungcheol that it’s to zone back in. “Vice Chairperson-External?”

“Present and voting.”

Your voice draws Seungcheol's attention. He turns his head towards you and he notices the sheets of binded up papers you have in your hands, straightened with a few taps on the table surface before you settle them back down, a swell of pride when he sees what’s printed on the topmost page. 

It’s impeccably organized, the task he assigned to you only three days prior. Hell, you even have page tabs sticking out of the sides of every page. Your work ethic never fails to impress him. On top of that, you’re always so professional— able to separate your personal and org life with strict barriers in between because even though you and Junhui have been friends for ten years, your sharp glare holds no reservations when you catch him folding paper turtles with sticky notes right next to you when inside the meeting room.

“Sorry,” Jun breathes out. You retract your leg from under the table after giving him a discreet kick.

Anyway, Seungcheol has high hopes for you, and he’s eyeing you to replace him as SVT’s Chairperson next year (he’s already in the process of manipulating you into taking the job: the compliments he gives away aren’t for free). You’re perfect. You’re flawless. There’s no one else fit for the position but you. 

Which is why the next course of events comes as nothing less than a shock to him.

“Vice Chairperson-Internal?” Wonwoo calls out but is met with silence. He looks around. “VCI?”

No answer. You scoff.

“Alright, moving on. Mr. Chair?” 

Seungcheol stiffens, second-guessing what he’d just heard, but the near-invisible crooked twitch of the corner of your mouth proves that no, that wasn’t just his imagination. You just scoffed. A sharp noise laced with derision and contempt. That should’ve been the first sign that something is off.

“Present,” he coughs out, resigning his attention back to the meeting he has to preside over. It must be nothing. Even you can get annoyed sometimes. Maybe Jun is fucking around again and you’ve just had about enough.

“There are thirteen out of fourteen officers present, Mr. Chair. We are in quorum.”

“Thank you. Seeing that we are in quorum, it is now legal for us to conduct business. Mr. Secretary, will you please read to us the agenda for today’s—”

The office door swings open. 

“Sorry, I’m late!”

And Mr. VCI rushes in with his white coat still hanging off his shoulders. The meeting is put to an abrupt pause as Jeonghan hastily walks up to his assigned seat, trying to explain the reason for his tardiness. “Our lab session took longer than expected,” Jeonghan huffs out, dragging out the chair next to him. “Dr. Han wouldn’t let us—”

“It’s common decency to enter the room and sit down quietly when you’re late so as to not disturb the ongoing meeting. Especially when you haven’t informed the body beforehand.”

Seungcheol flinches when he hears the interruption of your sharp tone. His head quickly snaps to your direction before gleaning Jeonghan’s reaction. His friend’s jaw tightens but he says nothing. That should’ve been the second sign.

“Mr. Chair, may we proceed with the reading of today’s agenda?”

He eyes you carefully and, with a hesitant drawl anchoring his tongue, proceeds with the meeting while Jeonghan quietly settles into his seat. “Mr. VCI, you may send your excuse letter later for record keeping. Anyhow, Mr. Secretary, please read to us the agenda for today’s meeting.” Wonwoo does as instructed. The problem is, Seungcheol can’t hear anything that he’s saying. Not when his seat is exceedingly uncomfortable at the moment.

It’s not his seat. It’s the two people cornering his seat that’s the problem.

Cold sweat breaks out from his forehead. The air is stuffy. You and Jeonghan lock eyes for zero-point-five seconds and there’s a chill in the atmosphere that only Seungcheol can feel. What the fuck is going on?

“Thank you Mr. Secretary. We’ll begin with the first agenda— SVT’s Orientation and Membership Training. Alright. As you all may know, this will be our organization’s first event for the academic year, thus I am expecting everyone’s undivided cooperation in making sure that this event will be a success. We have already discussed the initial details of the event during the previous meeting, and we also distributed the tasks to the officers and committees.” He flips through a page and clears his throat. “I believe our Vice Chair External was tasked to scout for the venue. Ms. VCE, have you prepared your presentation?”

You nod, rising from your seat. “Yes, Mr. Chair. I’ve prepared a comprehensive list of all our options.” Okay, Seungcheol breathes in through nose. You seem normal now. Maybe he was just overthinking things. “I ask for everyone’s assistance in distributing the copies.”

Seungcheol looks at the text written in bold when you pass a copy to him— SVT ORYE & MT 20XX: VENUE PROPOSAL. While everyone is passing the paperclip-bound photocopies to each other, you take the liberty start speaking. “If you look at the second page, you can see the overview of the entire document. I’ve listed five possible venues and compiled their respective addresses, rates, inclusions, menus, and of course, pictures for your reference. We’ll look at each of them one by one, starting with—”

You pause. Jeonghan is raising his hand. Your eyebrow twitches. Seungcheol gets a bad feeling. “Yes, Mr. VCI?”

“Thank you for the acknowledgement,” he says. “I’d like to ask why exactly are all of these venues located in the mountains? Don’t we have other options? It would be fine if it were just us officers, but I believe holding the event in such terrains would be far too inconvenient for more or less a hundred people.”

A very bad feeling.

“I appreciate your insight,” you respond. Uh oh. Your smile is strained and Seungcheol knows it. That’s the smile you wear when you’re about to pulverize a representative for a disadvantageous partnership to the ground. “However, I’d like to bring to your recollection that the theme of this year’s Orye is traditional South Korean folklore. That considered, I came up with the judgment that the mountainous and forested areas would be the most appropriate and immersive venue if we wish to bring this concept to life. I hope that is clear, Mr. VCI. Anyway—”

“It’s still impractical, Ms. VCE.” 

Your face stiffens.

Jeonghan just cut you off. 

Shit, he just cut you off. 

He stands up, leveling you from across the table. “What about our members with asthma? Heart problems? What if it rains on the day of the event? Do you expect everyone to climb up a mountain trail in all these conditions?”

“If you read through my document before inadvertently interrupting me, Mr. VCI, you’d know that three out of the five venues offer uphill transportation in order to get to the accommodations. And although I understand your reservations about the possibility of inclement weather, may I remind you that it’s also the driest season of the year. You’re being unreasonable.”

Fuck. Seungcheol thinks he needs to butt in but he can’t find the timing when there’s literally an invisible fucking electric fence deterring him from reaching the both you. He catches a glimpse of Joshua’s concerned eyebrows. ‘Do something,’ his friend’s eyes say. He’s about to until you drop a sentence that shoots the tension off the roof.

“Furthermore, I’ve surveyed all of the officers through text if they agree with my venue proposal and I was met with no objections. You’d know if you opened any of my messages last night, Jeonghan.”

Holy fuck.

Holy fuck, you called him by his first name. 

You never call anyone by their first name. At least not during meetings and it’s very clear that this is a reason for alarm because everyone else’s eyes fly wide open. Except Jeonghan’s. He just looks pissed— mirroring your very own expression. Something is wrong. Something is very wrong and Seungcheol is slowly starting to realize that this argument isn’t just about the venue conflict.

“Ahem.” He clears his throat for the nth time, a wound might break open. “We will take our VCI’s concern into consideration. If you believe holding our Orye in the mountains is impractical, where do you suggest we should hold it instead?”

Jeonghan’s shoulders relax. He gives you a momentary look before settling back into his seat. “Thank you, Mr. Chair.” You do the same. Seungcheol breathes out a sigh of relief. “I’d like to suggest that we hold it by the beach and sea. Not only would it be more accessible, it would also be considerably cheaper considering there’d be no extra expenses for transportation up the hiking trail. There are also more options if we hold it on the beach. I already have contacts from last year’s set of events. We don’t have to worry about negotiations.”

Seungcheol nods in response. He’s about to say something but once again, he hears an unmistakable scoff from your direction. “Of course, you’d go for the low effort option.”

Oh no. Oh god, no.

Jeonghan’s eyes dart towards you. “What was that?”

Seungcheol doesn’t get paid enough for this shit.

“I’m just saying that it’s so like you to go for the easy way out.”

He doesn’t get paid for this at all.

“What are you trying to tell me here, Ms. VCE?” Jeonghan’s tone is getting more pointed, and the rest of the table are starting to pick up on what’s going on. Mingyu is slowly inching off of his seat and finding the right time to book it. Chan and Seokmin are nervously flitting their eyes back and forth between Jeonghan and you. Minghao hao stopped paying attention. He’s got his airpods on and scrolling through his phone. 

“The sea is not theme-appropriate for our event, Mr. VCI,” you firmly press on. “There are myths and folklore that reference the sea and ocean, however as an introductory event for our organization we should defer from making far too uncommon references since most of our members are beginners to our advocacy.”

Vernon is about to be swallowed by his chair. Seungkwan has his face in his hands. Seungcheol’s phone vibrates and it’s a message from Wonwoo. Should I include all of this in the minutes? he asks. Seungcheol isn’t even sure if this argument is still about the venue.

“May I also add that beach events are overused. Everyone holds acquaintance parties, Christmas parties, sensitivity trainings at beaches and beach resorts. Should we follow that template, I doubt our event would be memorable enough for our members to remember.”

“Then it’d be the obligation of the program committee to make it memorable.” The said committee flinches upon hearing Jeonghan’s words. Joshua and Junhui don’t look like they agree with the additional burden. Jihoon’s forehead is wrinkling from secondhand stress. “We don’t need to sacrifice the affordability and accessibility of our location in order to hold a note-worthy event. And, may I also reiterate that we should consider our members with health problems, Ms. VCE.”

This is enough. This is probably enough. Maybe it’s time for Seungcheol to intervene.

“However, I understand,” Jeonghan continues. “I understand that it’s not easy for you to be considerate.”

But how the fuck is he supposed to do that when you two fucks won’t stop provoking each other?

“Oh, for god’s sake!” It’s hopeless. It’s gone out of control. Your voice has bordered on yelling ang Seungcheol himself is afraid of being caught in between. “Are you still mad about the cat thing?!”

What is the cat thing? What in the hell is actually going on?

“This is not about the cat thing and you know that.” There’s a ruffle in Jeonghan’s voice. He lets out a groan and throws his head back with his fingers digging into his hair. “Fuck. Let’s talk later.”

Yes. Yes, please just talk later so we can move on with the meeting.

“Did you just swear at me?”

Nevermind.

There’s a second silence. One second— until the corner of Jeonghan’s mouth twitches and he expels a huff of incredulity. It’s ominous. It’s a harbinger of uncomfortable destruction. “So swearing is crossing the line, but refusing to let me meet your parents and forcing us to keep this relationship a secret is completely justifiable?”

Well shit.

This meeting is done for.

Silence washes over the office once again. Wide eyes are being exchanged and not even Wonwoo is filling the tension with his incessant typing on the laptop. Chair, I don’t think I should include this part in the minutes, Seungcheol receives another message from him. Of course he shouldn’t. A relationship reveal isn’t part of the agenda. Neither is a breakup but he fears it’s teetering to that outcome.

It’s uncomfortable. It’s suffocatingly uncomfortable and Seokmin looks like he’s about to cry at any moment.

“Well,” you simmer. “I guess it’s not much of a secret anymore, isn’t it?”

“Damn.” Soonyoung receives an elbow from Jihoon. He gets hushed down very quickly to make room for another agonizing exchange between you and Jeonghan. 

“Is that literally all you have to say? You’re so insensitive, it drives me fucking nuts. This is why it’s so hard to keep seeing you—”

“Oh, so you think I’m not having a hard time? If you can’t understand why I had to do that, then let’s just stop seeing each other!”

“Fine, I’m glad we’re on the same page this time.”

“Great!”

“Great.”

“Your clothes better be out of my closet by tomorrow.”

“Throw them away, I don’t need them.”

“I will! Thanks for the suggestion!”

Things have now gone beyond the point of salvation and he can’t even interject to formally end this disaster of a meeting.

“Mr. Chair, I apologize, but I’m afraid I will be leaving early today.” Oh, so now you remember his existence. You’re fuming, slinging over your shoulder bag and haphazardly collecting your things from the table, and Seungcheol simply massages his temples and nods in acknowledgement to your sudden leave. “Please go through the document at your discretion and I’ll be respecting whatever decision the body makes. Thank you and have a good day.”

Just like that, you’re gone. Jeonghan also starts collecting his things. “My phone lines are open in case you need anything. Goodbye.” With that, he also disappears with the harsh swing and slam of the door, leaving behind another blanket of uncomfortable silence for everyone else to drown in.

Seungcheol sighs. He feels a headache kicking in. 

“So...are we having the event in the mountains or by the sea?”

He groans.

Is it too late to file a resignation?

THE BREAKUP SOUP. © hannie-dul-set, 2023.

[quack-quack-snacks]

Time Will Tell - Chapter 20

My Time Will Tell Masterlist

My Cha Hyun-su Masterlist

My Navigation and Masterlist

The Time Will Tell Glossary

Warnings: Blood and injuries Word Count: 2,575

prev | current | next

“It will only be for a little while, okay? I’ll be back before you know it,” you promised, placing a kiss on Yeong-su and Su-yeong’s foreheads as they started to worry about you and the new plan you made. 

“Please, don’t get hurt,” Su-yeong begged you and you nodded with a smile, promising her you would come back safe and sound. 

You walked over to Jin-ok who was watching the scene between the three of you and placed your hands on her shoulders. “Please, take care of them while I’m gone. I’ll be back soon,” you pulled her into a hug and whispered your next words. “But if I don’t come back, don’t let them fall into despair. They deserve a good life.”

She nodded at you when you pulled away and you smiled. With a quick grab of your bag, holding just the bare essentials you had - including your soiled sweatpants after you changed into your work pants - you walked out of the nursery and started heading in the direction of the stairs. 

You hadn’t told Eun-hyuk you would be joining Hyun-su. Hell, you hadn’t even told Hyun-su you would be joining Hyun-su, but you were joining him no matter what. You didn’t expect him to stay with you anyways, you just needed to go to the 12th floor and grab the things you needed before heading back down. 

Because you hadn’t told either of them, Hyun-su had already started ascending the stairs and Eun-hyuk had already returned to the surveillance room when you reached the staircase entrance. You knew he would see you on the cameras and scold you when you got back but you didn’t care. You slipped through the doors as quietly as you could and started running up the stairs. You could see the messy mop of hair that belonged to Hyun-su just reaching the third level. 

“Hyun-su!” You called out and you could see the flinch it caused him to make. You felt bad but kept ascending. “Hyun-su, it’s me!” You said again, hoping to ease his fears. You got up to where he was pretty quickly - especially with him descending to reach you faster as well - and saw him standing there with a confused and concerned expression on his face. 

He said your name in a whisper, looking at you like you weren’t real. “What are you doing here? You shouldn’t be up here, it’s dangerous!” He said, trying to lead you back downstairs. 

“Cha Hyun-su, I am not going back downstairs. I need to get some stuff from my apartment so I am coming with you.”

He looked even more confused then. “Why didn’t you just tell me what you needed when I asked?”

You smiled lightly. “I don’t want you to worry about my stuff. You have enough things with those lists everyone’s been giving you,” you said the last sentence bitterly. “I’d prefer if you weren’t doing this at all but I know that won’t happen.”

You saw the light blush that started to creep up his neck but decided not to mention it. “I would’ve gotten them for you,” he tried one more time; this time, less confident in his words. 

“I know you would’ve. That’s why I turned your offer down,” you told him gently, slightly teasing but not wanting to scare him off. “Now come on, let’s go get the things everyone ‘needed’,” you told him as you held up air quotes with your fingers. 

He nodded reluctantly and looked at the list given to him by the residents. “The first room is 613.”

“Okay,” you agreed. “What do they need?” You asked and held out your hand for the paper. He gave it to you without any protests and you read it, your face getting more annoyed as you read through each item. “This is fucking ridiculous,” you cursed under your breath. You kept your walking at an even pace despite your anger and allowed him to continue taking the lead. “Sending you up here to get tarot cards of all things.”

He stayed silent and you decided to not say anything else about it. He probably had been thinking the same thing anyways. The two of you continued walking up the stairs in silence until you got to the 6th floor. 

After a lot of protesting from the boy, Hyun-su finally agreed to let you go with him and not just wait outside the staircase’s doors. You helped him enter the code to the door of the first apartment and search the rooms for everything they asked for. Luckily, the list only had three rooms to check on it. The rooms just had a lot of stuff you had to retrieve from it. 

You reached the door to the 12th floor and stopped in your tracks. Hyun-su stopped after a few steps, realizing you weren’t following him, and turned around. His face was confused, wondering why you were stopped on a floor they didn’t need to stop at. 

You smiled at him, albeit a little sadly. “I just need to grab some stuff from my room. You go ahead without me, yeah? I’ll catch up in a bit.”

It was then he realized the floor you stopped in front of was the 12th floor. Your floor. You walked over to the door when he didn’t respond and opened it, prepared to go in alone until the door opened wider without your help. Looking over your shoulder, you saw Hyun-su there with a determined look on his face. “I’ll come with you.”

“But what about-?”

“I’m not leaving you alone,” he interrupted you to promise. 

You held the intense eye contact between you, both determined and unwilling to back down, but you couldn’t help the way you melted under his caring gaze. After a few more moments of staring, his gaze unwavering while yours started to falter under its intensity, you looked away and sighed. “Fine. Let’s go then; don’t want to waste any more time,” you conceded. 

He smiled a little as you turned your back to him and reached for the door. His smile dropped though and he rushed forward when your hand touched the door knob. “Wait!” He said loudly before clearing his throat and trying again. “I should go first, just in case something’s in there.”

You frowned. “If something is in there I don’t want you going first just to end up getting hurt. That’s awful.”

His stare was blank as he watched you, unrevealing of the storm of emotions whirling within it: confusion; relief; protectiveness; anxiety; but more of all, a growing affection he couldn’t quite seem to control. That last one made him more and more nervous regarding his monster. Whether he wanted to recognize it or not, he was falling for you and it was a hell of a dive. His desire - previously only being his want deep down to give back all the hurt he received to everyone who wronged him in his life, as well as his slight resentment towards anyone who was happier than him - started to include you in it.

He desired you.

Not in the resentment part, but in the way that he wanted you by his side forever. 

He wanted you by his side as he killed everyone, taking back what he deserved.

He hadn’t even realized his eyes turned black and he lost all control until it was already too late. 

You watched as the darkness unfurled from his pupil and covered the whites of his eyes, leaving them as a pair of bottomless pits that you could get lost in. The small gasp of shock you let out was almost unconscious, as was the step back when he took a step closer to you. Your hand was still on the doorknob, trapped under his from when he grabbed it to stop you from opening the door. A manic grin placed itself upon his lips, showing more of his monster’s side than his human’s. 

You didn‘t realize how you were being backed into the door until your back hit it with a soft thump. You would’ve hit your head on it too but Hyun-su’s hand was already covering it and protecting you; it made you blush a bit. 

“Um… Hyun-su?” You asked hesitantly. His eyes were still fully black and his smile manic but you couldn’t bring yourself to fear any part of him. Eun-hyuk would call you stupid, no doubt, but you just couldn’t be afraid of him. Not him. Never him. 

Not when he always looked at you so softly. 

Not when he always asked you if you needed anything before his trips.

Not when the few times he’d ever touched you he acted like you were made of glass. 

Not him. 

“I’ve been waiting to meet you,” he giggled, his hand protecting the back of your head sliding down your neck and shoulder to your waist. You gasped when his burning touch met you there but you must have been Rhianna because you liked the way it hurt and stilled your body in fear that one move and he would pull away. (Love The Way You Lie by Eminem ft. Rhianna)

“What do you mean?” You asked. You had a suspicion of what he meant but you weren’t sure. 

“The last thought he thinks about before he falls asleep… I have to say, the memories he holds pale in comparison to how you look in person,” he complimented and you felt your cheeks burn. He lifted the hand holding yours on the doorknob and brought it to your face, brushing a knuckle down the slope of your cheekbone. His eyes followed the path of his fingers as he did. Or… at least you thought they did. It was hard to tell when they were just a black void. “So pretty…”

You cleared your throat, trying unsuccessfully to cool the heated skin on your face before speaking. “Wha- I don’t understand,” you confessed. 

He laughed and buried his face in your neck as he answered; his words vibrated against your skin with each word. “You’ll find out soon enough.”

He then completely disconnected from you and you watched his eyes start to fade back to their natural brown. His face immediately formed one of concern as he looked at you. 

“Are you okay-?”

“Are you okay-?”

The two of you spoke at the same time. You lightly chuckled but he didn’t seem to find it amusing as he continued to watch you with worry. 

“I’m okay,” you promised when his glare wouldn’t abate. “Are you okay, though? You look a bit shaken up.”

He nodded, his eyes lingering on your flushed face before going to the door behind you. “Yeah. Let’s go,” he then looked at you, a hint of amusement in his eyes but mostly remaining serious. “And let me go first.”

You rolled your eyes with a fond smile while he opened the door. The spear which you hadn’t even realized he set down at some point was back in his hands and gripped tightly. He was ready for anything and promised himself he wouldn’t let anything happen to you. 

The door opened with a soft creak and you cringed. Hyun-su stepped out first, looking back and forth in each direction of the hallway before deciding it was clear. He shot you a glance over his shoulder to make sure you were following before stepping through the door. 

You crept around behind the messy-haired boy, cursing yourself for not bringing some sort of weapon. If anything were to happen you would have to rely entirely on Hyun-su.

‘Fuck,’ you thought to yourself with a frown. ‘I’m no better than anyone downstairs.’

After that thought, you were determined to not be a damsel and looked around for something, anything, to protect yourself with. Your eyes brightened when they landed on a glass case with an axe inside. The case said ‘BREAK GLASS IN CASE OF EMERGENCY’ and you thought this was emergency enough for you to take it. 

The only downside was you couldn’t figure out how to break it and you didn’t want to slow Hyun-su down any more than you already had. So, with an intrusive thought you didn’t think about nearly as much as you should have, you sent your non-dominant fist flying into the glass. It hurt like hell but you held your breath to keep from making any excess noise as the glass broke; luckily, the sound of it shattering was much quieter than you expected it to be, but that could’ve been because you were in the staircase for 12 flights of stairs and each of them made your voice echo loudly no matter your volume. Your knuckles were bloody, shards of the shattered glass had cut them. Damn, you were stupid sometimes.

Hyun-su whipped his head around at the noise so fast you would’ve thought he might have given himself whiplash if you were looking at him. Instead, you were reaching your non-dominant hand through the broken glass to grab the axe and pull it out. The bigger pieces of glass still connected to the case grazed your skin even more when you pulled the weapon through and the blood dripped down your fingers and onto the handle before falling to the ground. You didn’t notice Hyun-su was right next to you until you saw his hands enter your peripheral and ever so gently grab the axe from your hands. He placed it on the ground, leaning it against the wall beside his spear. After that, he wrapped a hand around the wrist of your injured hand and pulled it closer to him. 

“Why would you do that?” He asked softly, lightly scolding you but mainly worried and confused. 

“I don’t want to be a burden, so I’m choosing not to be one,” you said with a determined tone. He raised his gaze from your hand to look at you scrutinizingly. 

“You’re not a burden. Why would you think that?”

You sighed, trying to shove the guilt down for making him worry. You were so stupid, why didn’t you just use something else to break the glass? “If a monster comes and attacks, I would be useless and just have to depend on you to protect me. I don’t want to use you like that.”

He smiled gently, squeezing your wrist lightly. “It’s not using me if I offer it,” he tried to reassure you but you still frowned. He leaned down and grabbed both weapons in one hand while the other still held your wrist. When he stood back up, he turned to you with a look in his eyes that looked almost fond, but you pushed that thought away, not wanting to get your hopes up. “Come on, let’s go find your apartment.”

You followed behind him quietly, his hand still lightly wrapped around your wrist to keep you close as he led you down the hallway. He kept his eyes and ears peeled for any monsters but there weren’t any, luckily. Before you knew it, the two of you made it to the apartment and you entered the code quickly to get in. 

0717. It was the date of your parent’s wedding. You let out a shaky sigh just thinking about your parents but entered the apartment quickly nonetheless. Hyun-su followed close behind you and closed the door as quietly as he could. 

[captainkirkk]

✩ WEEKLY FIC ROUND-UP ✩

All the fics I’ve read and really enjoyed in the past week-ish. Reminder: This list features any and all ratings and themes. Please look at tags and warnings on ao3 before reading.

Marvel

Dumb, Dumber and Dumbass by tempestaurora

As Coach Wilson peered out the window in the living room, May said, very quietly, “You didn’t realise your brother worked at Peter’s school?”

“We all make mistakes!” Sam hissed.

Then Coach Wilson was leaning back and a figure in a hoodie and jeans stepped through the window and into the living room, and Peter’s heart sank into his stomach like a rock. Sam’s brother was, true to story, scarred from head to toe. He could see the puckered skin on his hands, the burns across his bald head. But that wasn’t the shocking part—the shocking part was that he’d already seen it before: he’d seen it when a certain vigilante’s suit had been destroyed three nights before, and Peter had walked with him back to his backpack to loan him some clothes.

“This is Wade,” Sam introduced.

Sam Wilson had two brothers: one was Peter’s gym teacher, and the other was fucking Deadpool.

OR: A Terrible, Horrible, No Good, Very Bad Family Dinner, during which Peter and May meet Sam's family. Meanwhile, Tony sends constant text updates about his search for whoever graffiti-ed Avengers Tower.

Death Before Inaction by hppjmxrgosg

"Fuck off, Nicky.” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ “Hasn’t anyone ever told you spider-napping is illegal?” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ “You can’t hold me here, I know my spider-rights.” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ “God, you guys are so old. What are you? Like 27?” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ “Scale of 1 to 10, how upset would you be if I told you I banged your mom?” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Or, I got my grubby little hands on the spider-man time line and fucked around a little bit. Not much (everything) changes.

DC / Star Wars (Crossover)

Obi-Wan in Gotham by hoebiwan (+ podfic)

Obi-Wan falls through a hole in the universe and ends up in the Batcave.

Clone Wars

the war has just begun by unintentionalgenius

The first problem was that the Supreme Commander didn’t give them enough warning about what they were stumbling into, when they were ordered out into it. Someone above General Kenobi’s head sent the men planetside in standard-issue gear, without thermal clothing or heat packs or sleeping kit or enough food for more than a single day. They had no extra ammo, no tents, no heavy artillery. They had barely any warning.

The second problem was that Supreme Command underestimated the strength of the enemy; it was supposed to be an easy enough job, holding the planet long enough to route the Seppies and then right back to the ship, leaving a contingent of troopers stationed there to retain what they’d won.

The third problem - the real problem - came when they let themselves become surrounded and the Separatists cut their supply line. Cody’s partially at fault for that one; a better Commander would’ve seen it coming. A better Commander would’ve had more backup plans, been prepared for more contingencies.

Being cut off from re-supply would’ve been a problem before the snow started.

Then the snow started.

I've never made it with moderation by Trixree (+ podfic)

He’d known how some of the men are with younglings—known from Waxer and Boil how sharply those attachments can form with little ones. Hell, the men were raised to be protective, so much so that Obi-Wan has often wondered if their protective drive was not written into their very atoms, some intrinsic part of their DNA.

It wasn’t something Obi-Wan had ever questioned. He’d thought he had understood the scope of it. In reality, he hadn’t understood a thing.

Not until Kamino.

Or: Not all that dive from cliffs make a running head start. Sometimes, the Fall is only a natural progression.

Standards of Professionality by Trixree

"Are we going to pretend I didn’t just find you fucking your General, vod?” Rex hisses over private-comm.

Cody doesn’t even turn his head to look at him. Rex can hear the smile in Cody’s voice when he replies, “No, because I am not fucking my General, Rex’ika. I am fucking Obi-Wan. We are professionals.”

5 times Cody and Obi-Wan struggled to maintain plausible deniability regarding their affections for one another + 1 time they decidedly Did Not.

The Hunger Games

Lover & Loner by amateurwordbender

Haymitch once told him that he’s a survivor. It hadn’t been a compliment; he’d slurred out the words in pity after finding Finnick shaking apart from a panic attack.

Jo’s a survivor, too.

(Finnick and Johanna, from the moment they meet to the bitter end)

Original Works

for the want of a jewel by FormlessVoidbeast

With his country fallen to the unstoppable tide of the Dread Warlord, a terrified king sends a peace offering of his own flesh and blood in the hopes of buying leniency.

When Prince Damian of Miska is accepted as the symbol of his country's surrender and immediately wedded to the Warlord, he expects his fate to be both painful and humiliating, and his death inevitable. To his confusion, the Warlord and his terrible Warlock seem to have no interest in abusing that which they have claimed as their own. As Damian finds his feet and gains friends in a new land, he begins to question everything he once thought was true.

But some jewels were never meant to be sold, and the consequences of Damian's sacrifice are more far-reaching than anyone expected.

[explosionkatsu]

Random Number (Upcoming Series)

Pairing: Adult!Bakugo x F!Reader

Summary:

Bakugo Katsuki's phone beeped as he received a text from an unknown number. Feeling curious about the contents of the message, he unlocked his phone and opened the text to find an unexpected list of grocery items. Perhaps it was a wrong number or maybe someone was playing a prank on him.

Warnings: None. Ya’all know I don't write stuff like that! Haha!

PROLOUGE ————

Y/n had put in a lot of effort throughout the week and was eagerly awaiting her paycheck. She had been looking forward to her evening, filled with relaxation after a long day at work. The idea of having some quality 'me time' was exciting, and she couldn't wait to indulge herself by staying up late and binge-watching her favorite series on Netflix. She had also planned to treat herself to some delicious food, which would only add to the enjoyment of her well-deserved break.

"Hey, Y/n! Do you want to join us for some Shabu-shabu?" Y/n's colleagues asked her.

"That sounds like fun, Mika. But I already have plans for my evening. You know, some 'me-time' would be nice," Y/n replied.

"Haha! Well, you deserve it after this hellish week we've had. You're probably the hardest worker here," Mika responded playfully.

"Oh, shut it. Haha. Well, I'll be off now! Say hi to everyone for me and have fun with the team!" Y/n giggled as she picked up her bag and waved goodbye to her colleagues.

As soon as Y/n got out of the building, she rushed to the nearest cash dispenser and withdrew a good amount of money from her account to pay her bills and buy groceries for the month. She had worked overtime the previous week, and she felt pleased that her hard work had paid off.

Humming happily, she walked towards the supermarket, enjoying the cool breeze of the night. When she reached the store, she fished her grocery list out of her bag, only to realize that it was missing.

Panic set in, and Y/n started to rummage through her bag in search of the list. She even planned on flipping her bag upside down, but it was nowhere to be found.

Frustrated, Y/n muttered under her breath, "It's not here. I must have left it at home." She pondered for a moment about what to do next. She could either go back home to get the list or try to remember the items she needed to buy.

Finally, Y/n decided to use her phone to make a list of the things she needed to buy. She hoped that she could remember most of the items, but she knew that she might forget some of them. She sighed and muttered to herself, "Hopefully, I still remember some of it."

Without wasting any time, Y/n pulled out her phone and opened the messages app instead of the notes. She swiftly listed all the items she required and then hit the send button. However, she immediately noticed that she had left the contact details empty. Not wanting to waste any more time, she quickly typed in her number and hit send again. Unbeknownst to her, the last digit of her number was incorrect.

—

"Hey Bakugo, I'm so pumped up! Our dine-out is going to be epic!" Kirishima exclaimed with unbridled enthusiasm as he met up with a scowling Bakugo, who was already bundled up in a thick scarf to protect himself from the chilly weather.

“I'd rather spend time alone than be with you idiots,” Bakugo said under his scarf.

“Aw, come on bro. We’ve rarely got this chance,” Kirishima insisted. “Besides, today is the only day we’re all free!”

“Tsk.” Bakugou only said in response.

As they started walking, there was a sudden sound of "ding" emanating from Bakugo's device which caught their attention.

“You should check that out. It's probably something important,” Kirishima pointed out and continued walking.

“For god’s sake," Bakugo said with a hint of frustration evident in his voice, as he reached for his phone in his pocket.

Bakugo's eyes widened in disbelief as he read the message. "What the hell?" he blurted out, scanning the text again. His mind raced as he tried to make sense of it. Could this be some kind of sick joke? “Is this a prank?”

Kirishima glanced at Bakugo's phone and asked, "What's up, bro?" After reading the message, he snickered and said, "I told you it's important. And let me tell you, strawberry milk is amazing. Don't be shy about enjoying it." He teased.

Bakugo's voice boomed with anger as he shouted, "Shut the hell up, Shitty hair!" His outburst drew the attention of everyone in the vicinity, causing them to turn and stare at the source of the commotion.

“A-ah! Sorry about that! That's just nothing!” Kirishima apologetically said to the people looking at them. “Bakugo! Keep it down will ya!”

"Whoever this person is, is screwed!" Bakugo exclaimed, clenching his jaw.

“Hey, hold on a minute. What if that person is an elderly woman who’s unfamiliar with using phones?" Kirishima suggested. "Also, have you thought about how it might affect your reputation if she finds out you're Dynamight? Think about this carefully, man.”

“Tsch!” Kirishima's reaction might seem excessive, but he has a point. It's best to just let it be.

————

Upcoming series? Does that mean sluggish uploads again? Haha. As you all know, the series I'm currently working on is coming to an end. Only two chapters more. 👀

See you again in my next series! 😘

[wings-of-ink]

Hear ye, hear ye!

All of you who have been anxiously awaiting Chapter 4 can send a big thank you to the Microsoft mayhem that happened on Friday. Because of it, I have had two entire, unprecedented, days off of work during which all I did was write and edit chapter 4! Stuff like this never happens to me either, so I ate it up. My work computer is still super broken too, so who knows what will happen tomorrow, lol.

So, chapter 4, barring anything disastrous that I do not yet foresee – is coming very soon. Like, any day this week soon. For now, I am looking for bugs and other errors until I feel comfortable getting the update loaded. I will also be updating the warning list and some things on the itch page. I keep feeling like I'm forgetting something I wanted to do, and am having a hell of a time remembering what it was…

Anyway, if it interests you, more details below!

In going through some of the Google Error Reports, I had a couple that I either could not resolve or find.

It was reported that checking player stats in chapter 1 would not work – that it would flash only for a moment. I could not recreate this. If anyone else has seen this, please let me know.

In the end of chapter 2 where there are multiple ways to spend your time there seems to be some issues with how choices become unselectable after certain clicks and it just doesn't seem to function correctly. I have fixed the issues I have found, but could not recreate all of the instances that were reported. This section may get an overhaul in the future since I understand the coding a bit more now.

It was also reported that fonts are not changing. There is definitely a weird issue with this and it will take some time for me to sit down and hammer out. The fonts do change for me, but notably, I don't think they are switching to the correct font types. They don't even appear to be the same fonts from when I first starting this project, lol. This issue is on hold for now.

The last 2 bonus segments for the end of chapter 3 are being pushed aside for the time being. I kept finding myself feeling like I was hammering them into the chapter and it was a little exhausting. If I force it, it will be less enjoyable to read. The segments that are missing are the ones for hanging out with Zahn and Nathanael. Zahn's is easy to wiggle in elsewhere at least, but I'm not sure if Nathan's will make it in or not. We'll see, my motivation was purely for chapter 4, so now that it is ready to go, I'll have another crack at it before I drop or move them completely. They aren't super important to the story, but are just for fun (and if Oswin got his, it's only fair that Zahn gets theirs too). That last section of chapter 3 ended up way too long, so it may get adjusted later anyway.

As with any work in progress, I can't guarantee that your old saves will work. That's probably how we are going to have to roll for a bit until I really get things nice and smooth. Eventually, I will add an option to start from a later chapter and go through and make the (MANY) relevant choices to skip ahead. This may be implemented when Chapter 6 is ready to go since all the ROs will be available.

I also want to figure out how to implement named saves to make it easier for you to sort. I appreciate IFs that feature this, but I do not yet know how to do it, but I'm going to research. I like to play through with several MCs, and I'd like to offer enough info in the saves and/or Stats Menu that you can do this and easily know who you are playing as. Let me know what you would like most in the Player Stats Menu too. Note, that some options do not appear here until you choose them in the story.

Coming up…

Since Chapter 4 is down, I will soon be posting a big poll about future IFs. I've been compiling info for it here and there for a couple weeks on possible options for me to write in conjunction with God-Cursed. So, stay tuned for that in the coming days.

I will FINALLY get to my inbox in earnest as well! I will keep reaction asks paused until further notice since they take me the longest to answer. Feel free to still send in comments or quicker questions. If your question is too spoilery to answer, I will not be able to post about it.

Anyway, hope you are all doing well! I can't wait to see what you think of chapter 4. I hope you enjoy it. I'll get it out just as soon as I feel comfortable enough with it. ^_^

[bump1nthen1ght]

The Prince of Hell is Not a Gentleman (F!Reader x M!Demon)

Pairing: Fem!Reader x Male!Boss!Demon

Genre: Urban Fantasy

Warnings: Non-Con, Forced Exhibitionism, Forced Infidelity, Abuse of Power and Work Dynamics, Degradation, Misogyny

Word count:  2815 words

Summary: You’ve tried your best to ignore the ridiculously inappropriate behavior of your boss, desperate to keep your job and knowing a filed complaint will get you nowhere. But one fateful meeting pushes your relationship to a whole new level

Request: I got a request!

Female human coworker with a scummy male demon boss. When I mean scummy I mean a proper PoS. Coercing her into sex when she is already with someone, smoking cigars and blowing it in her face, and making her call her partner while he is fucking her.

Isn’t workplace sexual harassment supposed to be subtle?

You think to yourself, simultaneously wondering how the fuck you got in the position to be thinking such a thing in the first place.

You’ve been to HR training, seen those types of creepy bosses. The ones who hide behind being overly “friendly” and saying “everyone’s so sensitive these days.” You’d known to report them, to not stand for their gaslighting. 

But nothing really prepared you for this.

Sugartits, in my office ASAP. 

The crude sticky note stuck to your computer monitor reads, sending your heart all the way into your gut.

You’ve only been at this job for two months, settling in nicely to the routine and your fat paycheck every two weeks. The only issue so far has been your boss.

The demon himself is named Solvaloth, AKA Sol, and is the supervisor for your entire department. He’s a high prince of hell that no one felt like dealing with down there, so was kicked upwards and saddled with a cushy position in this hell-associated company. He’s big, loud, and frustratingly handsome. The kind of handsome that has treated him well his entire life and in turn convinced him that he’s Lucifer’s favorite creation.

You’re the only human in this whole department and that novelty probably drew him your way in the first place. He quite literally cornered you on your first day, his clawed hands pressed against the wall behind you, a leering smile full of canines looking down at his new toy.

“Damn, it must be my lucky day.”

Since then, he has been the bane of your very existence. Grabbing your hips when he ever needs to “scoot” by, whispering dirty compliments in your ear, even looking down your blouse whenever he “pops” by your cubicle. Not to mention the patronizing nicknames.

“File these papers for me, won’t you sweet cheeks?”

“Looking good today, princess.”

“C’mon baby girl, give me a break here.”

Guess you can add Sugartits to the list.

You try not groan audibly as you trudge your way to his office. Knowing that no matter what he does, how inappropriate he is, HR will do nothing. 

(You would know, you tried. The message of “don’t bring this up again” was made very clear.)

His door is stupid tall, meant to accommodate his giant size and extra large horns. You open it as slow as possible, trying your best to delay this ‘meeting.’

“You know how to keep a demon waiting, honey.” Sol turns around in his opulent office chair, legs spread wide and head thrown back without a care. His hair hangs loose and wild behind him, a white mane tucked in between two curving horns. Despite the snarky tone, he’s got a sickeningly sweet grin on his face. “Lock the door, please. We’re gonna need privacy.”

Ugh, I cannot deal with this today.

But you comply, flipping the lock. You don’t notice the way his curtains have been drawn, or how everyone else has been encouraged to go on a long lunch. 

“Is everything okay?”

Sol leans forward, that smug grin still on his face. He puts a hand up to his ear, batting his eyes in a cartoonish display of “what was that?”

You sigh.

“Is everything okay, sir?”

“That's my girl.” Sol laughs, slapping his knee and gesturing for you to sit down.

You pull back your chair, keeping your ankles crossed. You curse yourself for wearing a pencil skirt today, chiding morning-you for forgetting where you work. Sol’s eyes burn as they roll up your pantyhose, not even trying to hide his leering.

“Actually, everything’s not okay.”

That has you sitting up, a seed of worry in your gut. As much as he sucks, this job pays really fucking well, and you can’t risk loosing it.

“You see, I overhead Mazey in accounting gossiping over the water cooler. Said something about how the human has a new boy-toy.” Sol crosses his arms across the table, making his large chest seem even bigger.“That true?”

You fight the urge to roll your eyes. Of course he called you in for that.

“Not that it’s anyone’s business, but yes. I am seeing someone.”

A nice human guy you met at a bookstore, named Rich. He was cute, with fluffy hair and a sweet smile. You had only been on a couple dates, nothing exclusive yet, but you saw a potential future with him.

Sol clicks his teeths, his eyebrows furrowing as that smug grin drops down to a disappointed pout. 

“That’s gonna be a little problem, because last I checked-” Sol gestures back and forth between you two, “-I’m your boss.”

You raise a brow. “So?”

“As your boss, I kind of get final say in everything. I mean, everything.” Sol leans even farther forward, gut pressed into his desk. He’s so close you can feel his breath, see the way his hair falls from behind his pointed ears. “That includes who you spread those little legs for, capische?”

A hot blush runs up your neck, a combination of shock and anger shot through you like adrenaline. 

You had kept a stiff upper lip for most of his shenanigans, for his stupid ego and this job, but this? This was crossing a line.

“That is not-”

“You want to keep your job?”

In just a sentence he steals the thunder out of your voice, a vice grip clutching around 

your heart.

“You wouldn’t.”

Sol shrugs, eyes rolling.

“Why not? Can’t have a little slut like you distracted all day, thinking about some human.”

He says the word like a curse, practically spitting it.

“This, this isn’t-” Your lost momentum has you floundering, trying to find ground to stand on. But you’re trapped; You know it, and he knows it.

You take a deep breath, trying to reel in the desire to leap across the desk and strangle him.

“What do you want.” You state, not ask.

His lips curl up, his devilish nature on full display.

“I want you to do what you were always meant to do.” Sol leans back, tapping his chin. “You’re gonna plant that pretty pussy on my face, and let me show you a good time.”

Your ears feel hot, tears bubbling at the corner of your eyes. There's a distinct taste of shame in your mouth. 

But you can’t lose this job. Can’t be blacklisted in the industry, which this spiteful bastard probably would do to get back at you.

So you sit up, kick off your heels, and ignore the way Sol licks his lips.

Your thumbs go down under the waistband of your skirt, before Sol stops you.

“No, keep it on.”

You stop, wondering what his plan is, and tepidly walk towards him.

Sol’s eyes elevate up and down, switching the knob on his chair to recline slightly. He pats his chin again, a long tongue poking out between his teeth.

“That’s right, baby. Come to papa.”

You hate the way the curdles your stomach, the way your legs begin to shake.

Just to be an asshole, Sol does nothing to help you climb up his chest. He sits with his arms crossed behind his head, smug as you struggle up his body.

Your skirt begins to naturally hike up as you shimmy, almost to your underwear by the time your legs are around Sol’s shoulders. You have to lean your hands in the walk behind his head to stay stable, a deliberate placement that forces your crotch right in his face.

With your legs slotted around his neck Sol's hands find their place in your ass, yanking you forward and taking a deep whiff of your pussy. A wet tongue follows it soon after, soaking the thin fabric and rubbing dangerously against your clit. You bite your lip, feeling the skin almost burst under teeth and pressure. He’s already humiliated you enough, Sol is not getting noises out of you.

Sol is ravenous, his sharp canines deftly tearing apart the fabric of your tights and panties, just missing the fat of your thighs on their way in. He has no patience once he reaches his prize, thick tongue shoved in with little preparation. Your hands scratch at the cheap company paint of the wall behind you, still refusing to let a peep out. Even as your body betrays your mind and your pussy begins to slicken.

Your eyes can’t help but wander downward, a jolt shooting up your spine when you realize Sol is looking directly at you. His nostrils flare as your eyes meet, his tongue curling and stretching open your walls. He must see the way your brow scrunches, how flushed your face is getting. There's a look of pride in his eyes that makes you burn.

Sol nuzzles his nose, digging his tongue deeper inside and you hate the way it rubs against your clit and makes your toes curl. It sucks how good he is at this, how your legs are beginning to tremble not from fear but from pressure. You’ve been able to stay quiet so far, but the moans are fighting towards the surface with every sultry lick.

You know you’re in trouble when one of his hands sneaks from your ass and over your thigh, Sol’s thumb coming to rub and flick at your clit. A moan crawls up your throat and you try to choke it down with another bite of your lip. But your legs clench around Sol’s head, your hips chasing the friction as he pulls you taught like a bow string.

Damnit, it had given you a sort of satisfaction to assume he was one of those guys who was all talk, no action. A dirty mouth that probably never went down, never brought his partners pleasure. This is just another slap in the face.

“Hmmph!” Your hand throws across your mouth, hunching forward as Sol finds that sensitive spot inside. Electricity shocks across your abdomen.

Please, no.

Sol is relentless in his chases, spurred on by your noise and fucks his tongue like a piston against your g-spot.

Too good, too good. I’m gonna-

“Angh~!” Your back arches, breath finally escaping as your orgasm hits you like a tidal wave. You refuse to look down, refuse to see the satisfied look on the bastards face.

But you never get a chance, as Sol hooks his strong arms around your legs and picks you up like a ragdoll. With a surprising gentleness he is able to sling you down his abdomen, turn you around to your stomach and pinned to his desk. Your skirt stays bunched around your hips, the slutty hole in your stockings ripped wider by fervent claws.

“Hey, kitty kitty~” Sol coos, fingers spreading your pussy’s lips wide open for him. “I knew you’ve a nice cunt, baby. Knew it right when I saw you.” Sol slaps your pussy, chuckling when you flinch. “Perfect for daddy.”

A hot head presses against your entrance and you know immediately that he is too big for you.

And he has a big dick?! What the fuck?!

“Wait, Sol-”

“Waited long enough, sugar tits.” The head presses deeper, the stretch cutting any words right out of your mouth. “Let’s fuck that attitude right out of you.”

Sol plunges in, aided by your slick and a fresh glob of spit. The dam being broken, your humiliation at its peak, you don’t try to hide your gasping breathes.

“Fuck!” Your shout, hips traitorously swinging backwards, urging him deeper into your guts. There's a deep groan from Sol’s chest and the scratching of hardwood. A glance to your side sees his claws have dug lines into his fine desk.

“S-shit. You’re fucking tight.” Sol gives an experimental thrust, the desk and bouncing forward. “That little boy toy of yours must have a pencil dick or something.” A large hand grabs your jaw, forcing your back to arch as he pulls you back to him. “Or has he not fucked you yet?”

You don’t dignify him with a response. Sol clicks his teeth.

“Whelp, I guess we’ll have to ask him.”

That jolts you awake, eyes widening as you realize Sol’s slipped your phone out of your skirt's pocket. The home screen is in front of you, your face unlocking it with ease. That fight instinct comes back and you begin squirming.

“Ah, ah.” Sol needs only one hand to pin you down, back on your stomach now that he’s on your phone. “What’d Mazey say his name was, Richie?” Sol casually scrolls through your contacts, humming as he spots Rich’s contact, with an emoji heart next to it. “There he is. Let’s give him a call, clear this up.”

You squeak in exertion, trying your damnedest to wiggle away and escape. But Sol’s grip is like iron, and Rich answers on the second ring.

“Hey there, what’s up?” 

Sol leans down to look at you, tapping the speaker option, and makes a motion for you to talk.

“N-nothing much. Just-” Sol gives another hump, the desk legs squeaking against the linoleum. “-just thinking about you.”

You hate how Rich’s ‘aww’ is tainted by Sol, tainted by the noise of his hips slamming against your backside. You pray Rich’s phone has shitty audio, that he’s totally oblivious today. That he overhears the slapping of skin and the shaking of the desk to be some weird aspect of your demon company, and not what it really is.

“Thinking about you a lot too.” Richie says, and you try to dim the breathy moan that gets through. Sol’s nails dig into your hips, yanking you like a fleshlight. “Wanna meet up this weekend?” Sol slams a hand down, clawing a NO into the hardwood. Rich tone switches to concern. “Woah, what was that?”

“S-sorry, dropped a stapler, heh.” You throw your head down, chest heaving as another knot pulls in your stomach. Your words are beginning to feel foggy, your brain fuzzy as Sol finds your g-spot and starts brutalizing it with his cock. “Can’t this weekend unfortunately. Got some extra w-work to do.”

“Damn, wish I could help.”

Sol barely muffles his chuckles, patting your ass as he leans forward, whispering filth in your ear.

“Cum around my cock, baby~ I know you want to.”

You shake your head, tears dripping down your cheeks as you nuzzle your face into the desk. Sol laughs into your neck, his cock twitching at your frustration.

“Well, I gotta get back to w-work. Just wanted to-” You suck in a deep breath. “-hear your voice.”

“I love hearing your voice too, babe.”

Your heart aches at the sincerity in his tongue, imagining his sweet face. Wishing it was him behind you right now, making you feel this good.

“Ok, see you later.” Your voice whines as a shaky hand taps the phone to off, making sure you’ve hung up before collapsing back into the desk.

Sol cackles behind you, hips swiveling.

“Sounds like a fucking loser. I guess I was right.” Sol’s tongue licks up the side of your cheek. “If he had fucked you, he wouldn’t be calling you ‘babe’.” Sol pitched his voice up high, mockingly, before pulling back his teeth in a snarl. “He’d be calling you whore.”

Sol yanks on your hair, baring your neck and sucking huge hickies right below your jaw. His hips begin to stutter, the balls slapping against your clit feeling tight as he exhales through his nose.

“Please…not inside.”

“I know you’re on birth control, bitch. I do what I want.”

Sol detached with wet lips from your neck, hand now on the back of your skull and forcing you down to the cool desk surface. Your breath leaves a foggy trail in its wake, your eyes rolling back as Sol reaches a peak in his intensity.

“Fuck, fuck!” Sol cries, claws digging lines into your skin as he begins to jerk and twitch. Soon after you feel a heavy warmth shoot deep inside of you, rivulets of cum dripping out between your two bodies and on to the desk.

There's a distinct feeling of emptiness in your gut when Sol pulls out, even with the sticky strings of semen stuck in between you. A thick finger pushes back in any lealing cum, Sol’s cooing voice admiring your fucked out pussy.

You can hardly think, your brain caught in a self-defensive haze as you just try to catch your breath. If you think you’ll hear Rich’s voice, have to feel the intense shame burning inside your chest, feel the red hot anger that you’re too tired to act on.

A warm hand caresses your face, pushing messy hair out of the way. Somewhere distant, Sol chuckles. “Yeah, just like I thought.” You hear the brief click of a camera. “Such a perfect cock-slut, all for me.”