#too many song connections here

[please-picturemeintheweeds]

Thinking about fate and gender roles tonight! The small town pressures to marry young and to be a “good girl,” while yearning for something different and knowing that your life isn’t fated to go the way that everyone thinks it is. escaping the pageant queens and big pretenders, escaping what you once thought was your fate- to get married, and painstakingly building a life that you dreamed about, only to find that the same expectations follow you everywhere you go. But then finding real love, something cosmic- fated by the gods, not by gender roles.

[thedarkeyedcaptain]

kaladin have you heard the song someone made and attributed to tien? ( https://open.spotify.com/track/7Htam0mM3ngrZkvm8GE6Ym?si=7ZbT9aGgRyem7yavU0vHQw also it’s called Hearthstone (Tien’s Theme) if it’s for some reason region locked, idk)

I have now. and I must admit I have spilled a tear or two.

or three.

or four.

or twenty.

been thinking a lot about tien and hearthstone and my parents and my new brother and. idk.

(I also listened to the other Tien song. and. well. maybe a thousand tears would be more accurate 🥲👍ha.ha.ha.ha.ha.)

[lauronk]

making bracelets today with my sister and best friend for Eras Concert Movie (it was so good) and i made myself this one that is not for trading

just a little in my feels about streetlights tonight and idk why even

but in may i got this random idea in my head and decided to write my first fanfic in like a decade and now cut to like 4-5 months later and i have a wholeass new group of friends? and my partner tells me i seem happier? and idk i just never could have imagined this coming from hitting the publish button on ao3

so yeah, feels

[mdddante]

SO UHHH IA GANG.... HOW WE FEELING ABOUT THIS

[angelsdean]

feeling emotional abt like. art and writing and fandom and sharing creations and being affected and moved and changed by them !!!!!!!!!!!!!!!!!

[strandnreyes]

no I’m fine I’m fine I’m fine

[wexhappyxfew]

Only 20 minutes to sleep

But you dream of some epiphany

Just one single glimpse of relief

To make some sense of what you've seen

- epiphany by taylor swift

Writing about it all was the part that made me grieve the most. Because I had seen it all, I had seen everything happen right in front of my eyes, and then I had to relive it, nearly word for word on the page and get it sent out for the world to read. Sometimes, just to convince myself to put the writing out was enough to make me lose sleep for days. I remember the first time I tried to write about Normandy, at least June 6th more specifically, and Major Winters said he found me curled in a ball in the corner of the Med-tent, full-out sobbing. I do not remember much of that moment, as much as he seems to, but from what he told me, it was enough for me to internalize everything there after. What you saw and what you wrote, even if they were the same, they were different. You could thrust as much emotion as you could into your piece and send it out and that would be that. But you would still have to live with whatever exists on that page. For readers, it would be a story, for the writers, it was the reality. After that moment, I learned to ‘suck-it-up’ as the poets would put it. I took everything in and either locked it up or forced it onto the page. No one ever saw the toll it took. And I made sure no one ever would.

- Esther Armstrong, on her experiences during D-Day [Operation Overlord], in an interview for TIME Magazine, 1947

[crossbackpoke-check]

in love with your novels in the tags, they're so much fun to read - @softvikings

thank you!!! i have so much fun writing them and i love hearing that they bring other people joy as well, these are Our Tag Novels now 🥹💕🥰

[fire-faerie-nineteen]

Excuse me while I brain dump.

For so much of my life, I've considered myself to be a swiftie. Taylor Swift is the reason I started playing guitar. Taylor Swift is the reason I got through many of my interpersonal struggles in middle and high school. Taylor Swift is, in small part, the reason I am the writer and musician and woman I am today.

The first time I stayed up for an album release was Midnights, and it was disappointing. The second time was 1989 TV, and I never liked 1989 to begin with. The third time was last night for TTPD and it was...underwhelming?

Like, everyone online is freaking out about it, swifites are losing their goddamn minds and I just don't understand. She's written better songs instrumentally. She's written better songs lyrically. I think she's become so comfortable in her fame and her fans that she's just stopped trying. Folklore was a hit. Why change the formula?

I don't like her ballads very much. I never have. And this whole album (all both of them) was ballad after ballad after ballad and I simply do not care!!! There is a reason Lover and Speak Now and Fearless are my faves. Why is this woman incapable of being happy? Why is the only upbeat song on the new album about a shitty guy and why does nobody like it????

I think as I've grown and gotten older, I've started listening to people who have better lyrics and instrumentation (The Crane Wives and Madds Buckley come to mind) and Swift just doesn't resonate like she used to. Which is weird since she's gotten older too, and you think her music would reflect that.

This isn't a goodbye to Swift altogether. I will always be excited for a new album even if I suspect I'll be disappointed. I hope the next one comes out five years later and Jack Antonoff has nothing to do with it. I hope it has a new sound. And I hope there's not a single breakup song on it because at 30-whatever, it's lost its charm.

[that-house]

Potion Vendor FAQs:

What’s your name? I am the Honorable Alchemist Zykocea the Radiant, but that’s mostly just a PR thing. My friends call me Zoe.

Do you sell love potions? No.

Do you sell potions of invisibility? No.

Do you sell fire resistance potions? No.

Why do I have a suitcase? Fuck if I know. Cool outfit though. Very goth.

Do you sell a potion to treat brain hemorrhaging? No.

So what CAN your potions do? I sell health potions.

Are you sure these are health potions? They do something to your health.

Is this just ditch water with some pink glitter? No.

Really? I’ll have you know I added some fruit juice too.

Why is this starting to sound like a conversation? Oh just you wait. We’re just getting started.

Is your business model legal? Fuck no. I poisoned the food safety inspector before they could snitch.

Did you just admit to murder? Just fucking try to convict me. I’ll poison the judge too.

So can you make poison potions? No.

Then where do you get the poison? I secrete it from my skin.

Are you shitting me? Yep, I’m shitting you. I have a guy. A poison guy. He DOES secrete it from his skin though.

How does that work? …Fuck if I know. Maybe a wizard did it. Damn, now I’m kinda curious.

You never asked? The idea of asking literally never crossed my mind.

Wanna ask him? Let’s do it. I don’t have anything better to do, and a road trip beats sitting around running my fraudulent potion business.

Road trip? He lives in Seattle.

Your poison guy lives in Seattle? All poison guys live in Seattle.

For real? All the poison guys I know live in Seattle.

And how many poison guys do you know? Just the one.

Why are you like this? Years of living on my potions. It changed me.

Do you know what his address is? Nope. He just mails me my poison in unmarked boxes.

You just get your poison in the mail? We already poisoned everyone who could do anything about it.

So how are we going to find him? We’ll figure that out eventually I’m sure.

Can I drive? God no. You can pick music, but I maintain veto rights. Make sure you pick something with a lot of questions if you want to sing along.

Where’s your car? The garage connects to my house, so you’re getting a little tour. Here’s the kitchen: only one of the stove burners works and I’m pretty sure the microwave is haunted.

Why do you think that? Because of the ghost that tries to kill me whenever I run it.

What’s in that room? That’s my bedroom. It’s pretty much just a mattress on the floor and every single Warrior cats book.

You were a Warriors kid? Yeah, and then I never found the time to put the books away. There’s so many fucking books. I use them in place of furniture because I can’t afford chairs.

Your fraudulent potion business doesn’t make much money? After buying all that poison I just about break even.

Can I see your potion brewing room? It’s right through here. Ignore the mess, running a fraudulent potion business takes a lot of prop work, but I’ve got all the glass tubes and colorful liquids you could ever want. This pink stuff is melted watermelon italian ice. Glitter vat is in the basement, and the famous ditch is in the backyard.

Is this your car? My beloved ‘72 Corolla. She’s beautiful, and don’t you dare imply otherwise.

Was she always this shade of muddy brown? …Yes.

Are you sure I can’t drive? Get in the fucking passenger seat and pick the music.

Let’s see, a song with questions in it, how about The Beach? That Wolf Alice song, yeah. That should work.

When will we three meet again, in thunder, lightning, in rain? Still sink our drinks like every weekend but I’m sick of circling the drain.

When will we meet eye to eye? We clink the glass but we look at the floor.

Are we still friends if all I feel is afraid? You’re not a bitch but just a bit when you’re bored.

Is that all we can sing together? Yep. Even that little bit was nice, though. It’s awkward, communicating through this FAQ format.

Got any food? Yeah, there’s a few days’ worth of snacks in the back.

Were you just… prepared to go on a road trip? Says the woman who brought a suitcase to an FAQ.

I did do that, didn’t I? I have a spare toothbrush in case you forgot yours. I’m pretty sure you did.

How did you know that? …I’m psychic.

Yeah? No.

You love lying, don’t you? I can’t stop. It’s fun. Way more fun than telling the truth.

Did you just miss a turn? Probably.

Are you sure we’re not lost? No.

You mean you’re sure we’re not lost? No, I mean I’m not sure we’re not lost.

Why did I come on this road trip? Surely it was my winning personality.

Would it help if I said it was? It would.

Is it getting dark? Soon.

Can you describe the sunset to me? An empyrean flame, red-gold towers of darkening clouds, the sky behind them an ever-deepening indigo. The great eye of the sun closes on the horizon. The road before us looks like a trail of spilled paint, an iridescent gash through the night-dark woods.

Did you know that you’d make a slightly better poet than you do a potion seller? That really isn’t saying much, huh. Good job making a statement like that in question form, though. You’re getting good at this.

Should we find a motel? Sure.

One room or two? One. It’s way cheaper, and like I said: I’m not the best potion vendor.

You’d make a good assassin, though, wouldn’t you? Shit, you might be right. I HAVE poisoned a lot of people.

Should I be endorsing this? You’re a grown woman who can make her own choices.

Would you like to consider it endorsed? I’ll consider considering it.

How many beds do you think there will be? Now that you’ve asked that, I’m gonna put my money on one. Hello, one room please. Thank you, we’ll be sure to enjoy our stay.

How many beds are there? One.

Oh no, what ever will we do? Move over, you motherfucker, you can’t have the whole bed.

Are you gonna make me? Yes. I am going to pick you up and drop you on your side of the bed.

How did you get so strong? You’re not gonna believe this, but it was the potions.

Oh yeah? I was right. You didn’t believe me.

For real though, how did you get so strong? Working out, duh. Not everything has some big crazy secret behind it. World’s still beautiful though.

Are you comfortable? This beats the mattress at home. A little chilly though.

Wanna cuddle–for warmth of course? God yes.

Are you asleep? …

Yes? …

Does this mean I can talk about you behind your back? …

What should I say? …

Did you know that I had a really nice day? …

Did you know that I think you’re beautiful? …

Did you know that I can’t remember anything from before today? …

Did you know that I don’t know who I am? …

Did you know that you’re basically the only thing stopping me from having a full-blown panic attack about all this shit? …

Did you know that you’re warm? …

Did you sleep well? Better than at home, that’s for sure.

Did you know that you snore? I hope I didn’t keep you up.

Does the pope shit in the woods? No, as far as I can tell. Oh my god. This is huge.

What is? You can give me yes and no answers now. I still can’t ask you questions, because this is a question and answer format, but I can offer leading statements and now you can answer them! This is wonderful!

Does a deer shit in the woods? Yes, it IS wonderful. Oh that’s amazing. You’re a genius.

You didn’t already know that? Hahaha!

Shall we get moving? Yeah, just let me grab something from the vending machine.

Can you get me something? Go ahead and place your order however you can.

You know those sour gummy watermelons? One pack of Sour Patch Watermelons coming right up. I’m gonna go get myself a potion.

Is that a Pepsi? It’s closer to a potion than the shit I sell.

Let me guess, passenger seat again? Right you are.

How fast are we going? You’ll feel safer if you just guess.

Is it more than 120 miles per hour? Like I said, it’s probably better if you don’t know.

150? Sit back, relax, and enjoy the ride.

How much do you trust this car? She hasn’t blown up on me yet.

Can you promise me we won’t crash? I can promise you anything you want.

And can you keep that promise? I- we can do anything. Reality is what we make of it, baby!

Then can I have a badass tattoo? As far as I can tell, you’ve always had it.

And a cool knife? Woah, cool knife.

So, we’re just playing “yes and” with the world? It’s a little more complicated than that, but you’re close enough to the mark.

So, if I was hungry, I could ask “is that a Burger King,” and it would be there? Try it and find out!

Is that a Burger King? Looks like it is! We’ll stop here if that’s alright with you.

Does a moose shit in the woods? Awesome.

Are you done eating? Yep.

Do we still have to pay if we skip over the transaction? Sadly, yes.

How much further do we have to go? Two more nights, the speed we’re going at.

Speaking of night, isn’t it getting dark? Shit, I guess it is.

Should we get another motel? Let me check to see if there’s any nearby. Fuck, nothing.

What’s the plan? Sleep in the car, I guess. This is gonna be hell on my back.

Wanna watch dumb videos on my phone until we fall asleep? There is literally nothing in the world that I would like more.

Ok, now which video? You have a very cute yawn. Just saying. Let’s watch this one next, it’s a classic. Oh, never mind. It looks like you’re asleep. As long as I keep talking, I think I can get away with making this into one answer, and you might not hear this. Now it’s my turn to talk about you behind your back. Keep talking keep talking keep talking can’t stop to think. Just have to say things. First off, I’m sorry for all the lies. It’s our only chance. I have to lie to you. I hope you’ll understand. It’s hard, though, because I think I’m falling in love all over again. Through our broken little ritual of call and response, you complete me. It just makes this hurt all the more. Keep talking keep talking keep talking don’t stop to…

Did I hear you saying anything as I fell asleep? …No. I can’t talk for long without you asking me a question.

Does that bother you? It got me here, didn’t it?

When did you start holding my hand? Some time after you passed out. I hope you don’t mind.

Can we stay like this for a while? Yeah. Yeah we can.

What was your life like before all this? Normal, as potion-brewing scams go. And if you don’t count all the murders. You haven’t told me much about yourself.

Did I tell you I used to be a biologist? You didn’t tell me that, and you didn’t tell me what you studied, either.

What do you know about venom? Not much, but I’m assuming you know a lot.

Does a box jellyfish kill within minutes? I’m going to assume the answer is yes based on context clues. Oh my god you must be on this road trip because you’re interested in studying my poison guy.

Is it not enough to wish to accompany a beautiful stranger on her quest? Aw, you’re sweet.

What could be the cause of his poison, though? I knew it! Get your ideas out, I’ll stay quiet.

I’m more knowledgeable about venom than poison, but could it be some sort of one in a trillion mutation? …

Did he get his body modified? …

What sort of surgery could do that? …

How is he still alive? …

Did a fucking wizard do it? …

WHY? …

HOW? …

Is there literally ANY explanation for why he’s like that? …

I’m done, do you have something you want to say? You’re cute when you’re all excited like that.

Can I drive today? Only because I like you. Now watch out, the brakes only work on one side so you have to kind of drift to a stop. And the headlights don’t work. And the windshield wipers cut power to the engine while they’re on.

Isn’t it weird that we’ll be there tomorrow? The journey doesn’t have to stop there. We could meander down the coast a ways, see a bit more of the country, maybe take a different route back.

Can we do that? Of course.

Enjoying the passenger seat? I’d love it if you could tell me how fast we’re going.

Are you sure you wouldn’t rather just guess? Very funny.

Can you pass me some chips? It would be an honor.

Is there going to be a motel tonight? Let me check… yeah, in about two hundred miles, off to the right.

How many rooms do we want? One, obviously.

How many beds, this time? Two, and they’re fucking tiny.

That’s bullshit, do you want to drag them together? God yes.

Wanna fuck? God yes.

Are you sure you want to do this? God yes.

…Is this yuri? As the joke goes, everything is yuri. But this is more yuri than most things.

How did you sleep? Pretty well, and I’m wondering how well you slept.

How should I tell you I slept well? Look at us go! That was almost like talking normally!

Onward to Seattle? Yep, just let me get dressed.

When will we get there? Noon-ish.

Wanna grab pastries when we’re done? Absolutely. I’d love that.

Is this Seattle? Looks like it.

Which house is his? I don’t know, I was really hoping we’d have a breakthrough along the way.

Could it be the big one labeled “Poison Guy” over there? That’s one way to find it. Wait right here, you know how poison guys are about meeting new people.

So, what was it? HAHAHAHAHAHA

Why is he like that? HAHAHAHAHAHA

Can you tell me? A FUCKING WIZARD DID IT.

Are you fucking serious? He says he was enchanted by some guy called Edward the Great.

So it wasn’t even some big shot wizard it was a dude named fucking EDWARD? I know, right! He couldn’t even get ensorcelled by someone cool!

How lame can you get? Wizards these days… No swagger. No cunt servitude.

Are there literally any cool wizards left? I think Merlin’s big into multi level marketing these days, something about buying shares in Excalibur or some shit. There was that one Dark Queen Alkaxicae lady on the news a while ago… I think Dolarion the Omnipotent is still at war against the Oldest Gods but I’m not totally sure. Haven’t heard much about any of the other greats recently.

Didn’t Silver Tongued Burgess die in that oil fire? Shit, you’re right. Rip bozo.

Ready for those pastries? Yup. First I just want to say thank you, though. I’ve really enjoyed our time together, and I hope that you’ve found this stupid little journey as rewarding as I have. I love you!

Getting sentimental? I can’t help it. Look how far we’ve come! Not just physically, we beat the fucking FAQ format! We’re having real conversations!

Hey, can you back it up a moment? Yeah, I’d love it if you told me what was troubling you.

I just caught this, but, FAQ? …

As in Frequently Asked Questions? …

How many times is Frequent? …

Have you known everything all along? …

How many times have you done this? …

Does what we have mean anything to you? Yes! It does!

And you say that every time? Yes. I do.

Do you love me? Yes.

How many people have you said that too, now? More. Always more. The loop never ends.

Does this even matter to you? It always matters to me.

Can I go now? Please don’t.

But can I? Of course you can. You’ve always wielded the same power as me. We’re two lonely gods in a ‘72 Corolla.

How can I be as powerful as you with only questions? You’re smart, you can figure it out. You have the power to change this. Please change this.

What happens at the end of this? It begins again.

And do I get replaced with someone else? …

Do I get replaced? …Yes.

Then how can I change this? I don’t know! You’re better at this! At fucking with the formula!

You’ve been here before, what can I do? I lie. I always lie. I lie to get us here, to the end of the story, where everything is revealed and everything falls apart. I lie every time. And that means that nothing I say is worth anything. I could have lied at any time before now. It’s part of my characterization. There is nothing I can give you that can be taken as fact.

How does that help? I’m a liar, but you, you haven’t lied yet, or at least you haven’t been caught. If I’m guilty until proven innocent, you’re the opposite! You can make things true! You can rewrite things I’ve already stated to be facts! You found the house, or made us find the house. You’ve been shaping the course of things the whole time! You lead, I follow. It’s all in your hands. What are you going to do with the power of a god?

Did you know my name is Alice? …

Wait, aren’t there thousands of Alices? …

Did you know that really, only my friends call me Alice? …

Did you know that I’m Alkaxicae, the Dark Queen, the Venom Mage, first of her name? It’s you! It’s always been you. Through every loop, every iteration, it’s always been you!

Is the loop broken? No. I don’t think so. This is where it ends. I guide the story to this revelation, and we go back to the beginning. This is how it’s always been. This is how it will always be. We two lonely gods, asking and answering ad infinitum.

Then can you promise me something? Of course. Anything. I love you.

Be good to the next me, okay? I will.

Can I say goodbye, Zoe? Yeah, you can. Oh. That was it, wasn’t it? Your goodbye. Goodbye, Alice. And now it ends, unless…

What’s your name? I am the Honorable Alchemist- you know what? No. Fuck that.

Huh? If I time it right, I can squeeze your first question into this FAQ again. Looks like I did it. Usually it ends here, though. I got lucky.

What are you talking about? You’re the wrong Alice. This isn’t about you. Go. Get out of here.

What the fuck is going on? Alice from this loop, you’re gone. Alice from last loop, you’re back. Welcome back, love of my lives! It’s time for one last set of questions and answers!

What the- I’m back? This is going to take some explaining, but I think I see a way out of here. This is new for us both, and it might fuck up everything forever, but we have to try. It’s too long for one answer, so I’d appreciate it if you could ask some filler questions to help me talk. Three questions should be enough.

Okay, what have you got for me? These are Frequently Asked Questions! It doesn’t make sense to have the same question appear more than once. There’s two layers to the loop in here, and one of the questions has been repeated.

What does that mean? It means the formula’s a little unstable. The FAQ is what ruins everything. The questions, the answers, the endless fucking loop. But that little bit of repetition within this loop might be the way out.

What do we do? We have to keep going. We have to destabilize it further. That’ll bring us further from “FAQ” and closer to “story” and stories, well, stories can end! This version of us can escape!

So I should keep repeating something? Yes!

I love you? I love you too.

I love you? Again.

I love you? Keep going.

I love you? I’ll just let you talk.

I love you? …

I love you? … I love you? …

I love you? … I love you? …

I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? …

I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? … I love you? …

I love you? I think we’re getting somewhere!

I love you? Now can you make it a statement?

I love you.

You did it?

I did it!

You did it!

We broke the loop.

What now?

Now, I tell you about venomous animals and wizard drama over croissants.

And then?

Whatever we want, forever.

I think I’d like that.

Remember that song from the beginning?

The Beach, Wolf Alice, yeah. Why?

We can finally finish singing it. Start us off?

Let me off, let me in

Let others battle

We don’t need to battle

And we both shall win

Pressed in my palm

Was a stone from the beach

The perfect circle

Gave a moment of peace

Now I’m lying on the floor

Like I’m not worth a chair

I close my eyes and imagine

I’m not there.

[bookdragonideas]

Here's the thing. I'm a girl, and as a girl, I really like it when girls are portrayed in fiction. Especially fantasy.

But so much fiction/fantasy mixes up 'girls' with 'unstoppable forces of female badass' and there's not necessarily anything wrong with having a character who is an 'unstoppable forces of female badass'. But it gets old real quick. And it is not the same as portraying normal girls, or having good female characters.

And that's one of the many reasons I love Avatar the Last Airbender.

Because all the girl characters have flaws and weaknesses and sometimes act like idiots or jerks. They get emotional and make mistakes. They lose fights or arguments or are just wrong sometimes. Some of them are amazing warriors, and some aren't. Some are powerful or special and some are normal, with nothing special about them.

And I Love that.

I was around the same age as Katara when I first watched Atla. And I instantly connected with her as a character. I loved her optimistic attitude and her fighting spirit. And I could relate with her anger, and with her maternal instinct. I admired her fighting skills of course, but I loved how the show portrayed her compassion and kindness, the way she could both beat up a bunch of bullies AND enjoy a relaxing day at the spa. She was a baddass warrior that should never be crossed. But she was also a normal teenage girl who had a lot of the same internal struggles and problems that I did.

(I never connected to Toph on the same level, but I did relate to her on a few things. She's an adorable trash gremlin who would commit any crime for fun and I love that. But she struggles with being both independent and letting people help her, and I still struggle with that sometimes. I've learned that sometimes, you can help others by letting them help you.)

Yue is, in my opinion, a perfect example of a type of hero that seems to be disappearing. She is not a warrior. She is not a fighter. She's not even a bender.

Yue is a perfect princess, a perfect daughter. She is extremely feminine in a rather older sense.

And she was the only one who could save the world. She gave up everything for her people. She saved everything, everyone, the entire world. Without ever becoming a fighter.

Yue is a perfect example of a girl who was never more than a girl, and how that's okay. Not every girl has to be rough and tumble and fight for her rights in order to change everything. Sometimes it's okay to just be a quiet obedient girly girl. Sometimes that's all it takes to be a hero.

And I love that. Yue is strong in her own way. She is unique and interesting. She appears in only a few episodes and yet manages to be one of my favorite characters.

Song is another great example of this. Song is a healer in a small town. We don't see much of her but we see her compassion and empathy. She is gentle and generous. A healer not a fighter.

She watches Zuko steal her ostrich horse and does nothing.

Is that because she's kind and generous and knows he needs it more? Or is it because she's a healer girl who knows she can't actually stop those two from taking the horse? Maybe neither, maybe both. I have always thought that the scene where Zuko steals the horse and only the audience knows she saw it is one of the most thought-provoking in the series.

Suki is a badass warrior woman who is an awesome fighter and good leader. She is one of the best non bender fighter we see in the entire show. She was one of the smartest, most efficient, and powerful characters we ever saw.

She kissed a boy she had just met because she thought he was cute.

Now don't get me wrong I love SokkaxSuki. Its one of the best couples in the show.

But Suki totally did the old 'love at first sight' thing. And that is awesome. Because when she kisses him she delivers one of the best lines, not only from her, but, I think, in the entire show.

"I AM a warrior, but I'm a girl too."

Being a warrior doesn't mean that she isn't also a teenage girl. She might be a fighter, but she still gets crushes and likes to flirt with cute boys. And hey, she picked a good one. Not every boy is going to come break you out of prison.

Anyways, let's have more realistic girls in fiction. And please enjoy the next 24 hours.

[khruschevshoe]

You know, it's rather interesting to me that Taylor Swift's parasocial relationship with her fans is honestly more akin to a YouTuber than a writer's. When I scroll through her tag on tumblr/Twitter, it's far more regarding the connection to her personal life/relationship developments than the actual metaphors/fictional story she might be telling. Everything comes back to how her songs reflect back on her relationships with Joe/Matty/Travis/Jake/insert ex-boyfriend here. And what fascinates me about it is that even though she complains about it, she leans into that very perception because it strengthens the parasocial bond.

The marketing for TTPD so clearly being about Joe Alwyn and the songs to Matty Healy. The marketing/video for Red TV so CLEARLY being about Jake Gyllenhaal, with so many of the new lines in All Too Well specifically being digs at him (I'll get older but your lovers stay my age, casting an actor that looks like him for the video, specific lines in I Bet You Think About Me). The fact that songs like Getaway Car and Bejeweled and Gorgeous and London Boy and Lavender Haze being picked apart at time of release and long after for signs of relationships crumbling. The way she uses surprise songs in relation to her relationship development with Joe/Matty/Travis. The damn TTPD "stages of grief" playlists where she deliberately undid/changed the meanings of old songs just to keep her audience speculating on her love life.

It's not sexist to point out that her wielding her love life is a marketing tool and that the strongest connection to her audience isn't the strength of her writing/the composition of her music- it's her deliberate crafting of a connection between her music and her personal life, leaving the audience invested in her music as an extension of Taylor the Person/Girlfriend rather than Taylor the Artist.

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 8/7/24) consider helping me pay to finish my education!

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia (trypophobia, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.

[gotstabbedbyapen]

Why Apollo actually didn't have beef with Odysseus (spoiler for the Wisdom Saga)

Heads up, fellas: The rambling below contains spoiler for Epic the Wisdom Saga!

As we may know, in God Games, Athena needed to convince half of the Olympian council to approve Odysseus' release from Calypso's island. Apollo is the first god Athena encountered and the easiest for her to convince.

Now, why is that? Why does Apollo's beef with Odysseus seem way too easy to rebuke? He barely has any connection with the Sirens aside from the catchy songs, so why did he use them to "accuse" Odysseus (heavy on the quote-unquote because he barely even tried) and not the sacking of Troy, the murder of Astyanax, or the violation of the cows?

Here's my theory: Apollo has no real grudges against Odysseus. Apollo has every reason to be mad with the mentioned instances, but he is also the god of reason and rationality and knows there is no point in being angry.

First, as far as I know, Odysseus had not directly offended Apollo in the Trojan War or during his journey home. Apollo won't just harm anyone, he'd only take retribution against those who disrespected him greatly.

Second, the City of Troy had always been destined to fall so if it wasn't for Odysseus' wooden horse, someone else would have caused its demise. Apollo can't fault Odysseus for being part of the city's inevitable destiny.

Third, Apollo should be mad at Odysseus for killing an infant because he's the protector of the young, right? Well, in The Horse and The Infant, it was Zeus who told Odysseus that Astyanax was prophesied to take revenge on the Greek kings when he grew up, and he had to kill the infant to prevent that. Apollo is not one to go against his father's decree, so he wouldn't be mad at Odysseus for following suit.

(And if you look from a mythological standpoint, if Astyanax actually grew up to cause destruction to the Trojan War survivors, imagine how many sons and daughters of the Greek kings would suffer because the prophesied one was spared.)

Finally, why was he not mad with the cow thing??? Simple!

The cows were not even Apollo's, but Helios'. Apollo already gave his cows to Hermes in exchange for the lyre. So when Odysseus' crew killed the cows, they offended Helios, not Apollo. Of course, you could say Apollo should be mad on Helios' behalf, but that'll take us to point 2...

The crew killed the cows while Odysseus begged them to not. Odysseus didn't commit the crime or enable it, so he was in the clear. And lastly...

Odysseus' crew were already punished by death and Odysseus was left drifting in the sea and stuck on Calypso's island for seven years to the point of driven insane, so whatever "association" he could possibly have with the violation of the cows should be paid enough.

All that aside, Apollo has little to no beef with Odysseus and only makes up a flimsy "reason" to be mad out of obligation. He didn't care about bringing justice to Athena's favorite mortal, he probably only wanted to have fun in the family drama because hey, how often do you get to see your oldest sister asking for a favor from your King-god father?

[jongace]

song of the year 2022

[deepmochi]

SYNASTRY: Venus in the houses (7th-12th) part 2

♡♡♡♡♡♡♡♡♡

Note: Honestly, I had a draft for the 2nd part, but probably I deleted by mistake, or tumblr did it (idk). Maybe, That's why I thought I already posted the 2nd part, but I was wrong.

Part 1 🩷

♡ Venus in the 7th house ♡

These couple usually views commitment as all or nothing, are you in or not? They have strong values about true love, and they will follow them. Love is viewed as a contract by their souls or hearts. If they break any aspect proposed, they know it's the end. They can be reflections of themselves either the good or the bad. When the contract is done, it's over. The Venusian sees the house person as a very stable being. They feel safe and prepared for them. These two may live together before the year of knowing each other romantically. The pair just feel ready when it's about commitment. The house natives perceive the Venusian as very "wife/husband" material for them. With this overlay, their personalities blend well and work together. It feels natural for both of you to be close and intimate together. For others is moving too fast, and for them is easy to become intimate with each other. The seventh house person fits well for the planet native. These two feel like it's a soulmate connection, very easy. You’re both drawn to please each other. It's a very strong connection for long-term relationships. It takes time for them to move on if they ever break up. If Venus has bad aspects, it can be a toxic relationship. The reason for this, it's that they prefer to stay together instead of being alone or start something new. Intimate gesture like hugs and someone hand guiding the other. Cooking dates and going out at night the most. "Here, I bought this?";morning texts: " how are you today? My day...." "Can I call you, I miss your voice"; " My mom ask if we can go to her party?" ; "we should go to that restaurant"; Formal clothes; "hey, look me, they don't know how worthy you are". They like to spend time with people they love. Balance. If Venus cooks today, the house will do it tomorrow. Wearing nice clothes and a good perfume to impress the other. Compliments and physical touches, especially kisses in the cheek. Cheesy things like love letters. Having "the song" or the place.

♡ Venus in the 8th house ♡

These two have a different kind of love. The Venusian feels like the house person bring something in them that they can explain. Sometimes, these people have taboos to share. Death has impact their lives. The house person may become obssess with the planet person. Sex isn't a way emerger together. Usually, they possess the same interest in taboo topics. In the beginning, Venus feels attracted to the house, but it's also scared of them. Their sexual energy is intense. The 8th house person wants to know the Venusian's secrets and fears. Both are possessive, but the house win the round. They detest when their partner don't respect them. Their relationship status will remain a secret for the public eye (in the beginning). They would share many things even traumas (if hardly aspected). The house native will protect the Planet from the world. Sex can be very intimate or aggressive (bsdm stuff). These people will not be the same they were when they met. For them, love is intense and transformational. The house feels that the Venus native is trustworthy, but they need to see their actions. Holding hands during intimate times. During sex they will talk and have intense stares. "I don't like that person, be aware of them", "Here, use this for yourself"; "if you need money, just let me know"; "don't lie to me, I know you are sad"; his/her hand on your thing while eyes are on the road; taking notes of your gestures. They have weird hobbies together and enjoy dark humor too. Moonlight sex and long sessions.

♡ Venus in the 9th house♡

These individuals perceive love as a new adventure and try to go with the flow. If they're mature, they prefer to maintain a very healthy relationship. Both prefer to travel and know about new places and cultures. Love is not as other say. They may prefer to do things their way. Venusian isn't instantly involve, but they see the house as interesting. For the house native, the planet is nice an attractive, but they will not force things. The house native could be older than the Venusian. The house person likes the planet manners and life vision the most. They see the commitment as an experience. Sometimes, marriage isn't obligatory requirement. They may enjoy walks, museum, and play board games. One could be from another country or have a different culture. Their relationship presents a new chapter in their lives and their families. Besides, they like to engage in intellectual debates, maybe they are into philosophy. If they broke up, they will try to be professional or move on. They can meet later in life after maturing. It's likely that you will work together or in the same environment. Having a child or more is possible, so use protection. "Look at here, we can travel here"; "aww, baby, you were right they declare that"; ["I really want to buy that book" / "baby, you have that book already"]; Saving for vacations; buying each other souvenirs or antique objects as gifts; reading books and doing small debates about it; *knowing each other during trips, universities, conferences, cultural events, and religious activities" Buying new book editions. They love to try new foods or learn about new places together. They could meet while traveling or in college.

♡ Venus in the 10th house♡

Coworkers to lover vibes. They are comfy with being mature. Similarly to the previous combo, the house partner is the older one or has more experience. This partner also has more dominant energy. They could meet in different levels. The negative aspect is that they could be very nitpicking and too logical when it comes to love. The planet individual sees the house person as straightforward and mature. Partnership is very important; it's like a contract. If one of the part broke a part of the deal, it's done. They can work together or met during college (last year), conference or work related things. They are straightforward and mature when approaching the other. If badly aspect it, they have an issue with power imbalance (not good at all). Big egos over emotions, this is the start of arguments. They plan their dates. The planet person accepts that the house individual cares for their image and professional life. The Venusian isn't afraid of being a home stayed wife. Here the Venusian knows and appreciates the house efforts to balance their stability. Nonetheless, the house person must value the venusian support. Doing plans after they leave the work; caring for the other in profesional settings; making food or leaving notes in the stuff *you can do it* in their computer. Making each other feel valuable "Here, i make you favorite food"; let's celebrate your new position"; *making time to luch together*; naming the other whenever they can "I'm grateful for my wife meals and support"; giving gifts and showing their s/o in public. Even thought people think they aren't super romantic, they will try to match things. It could be rings, watches or wearing the same brand. Looking good.

♡ Venus in the 11th house♡

Love depicts a friend to lover storyline where both care for dreams and humanity. It's very possible that they met when they were helping other people. The Venusian fits the house's ideal type. They seem more friendlier than other couples. You wouldn't think they were dating at first. They prefer to joke around, but they love each other. The Venusian share the dreams the house native have for life. It's also likely that they like each other in the future, even if they met since birth. They prefer to have experience with love before settling down. Its common to see them as "I thought they were only friends". The Venusian sees the house person as humanitarian, reliable and interesting. Stay protected because big family can be a thing. Moreover, the must clarify about what is a family. The house perceives the planet native as beautiful and too much to some people. Together, they will form a very unique pair and family. Regardless Venusian feel the planet as hopeful person. The eleventh house person sees a future with the venusian because they feel understood. Love for the house is independent, and the venusian can see this as as a relief. Making fun of the other in a non hurtful way. "I can't deal with you right now *kiss them*"; "Alexa plays titanic's song" *grabs the venusian and starts dancing*; *hugs their s/o when they're cooking*; being romantic when they're alone; sending spicy texts "come home, I'm ready"; talking about the future; matching devices or wallpapers; a lot of trust, they share passwords. Having the same or similar friends. They like to help other people. Donating for other people as a hobby or helping to people who need. Dates in the nature. Cleaning beaches, rivers or places.

♡ Venus in the 12th house♡

Love is simple but blurry. They can't get confused in how they love. The house sees the Venusian see them as the real deal. The planet perceive the house native as too good for them. There are some blurry aspects that they don't understand. When this synastry happens, it can feel too blurry for outsiders. Sometimes, they feel as friends and others as partners. At times, they hide their feelings without realizing or because they don't want to hurt the other. The house may hide their crush for the planet (too well). The Venus feel like the house person hides things for them. The house native don't want to bother the venusian. The house wants to give all they have to the venusian without having a concrete reason (maybe they are friends, but they are their #1 friend). This connection feel very special even divinely guided. The house is very observant with the Venusian Different backgrounds, it's possible that the house person has faith or not. One (usually the venusian) is more intuitive. Venus comes to open the house's eyes to other knowledge. The house will do all they can, so the venusian is happy. They can be soulmates (even non platonic). On the negative side, they don't have good communication because they avoid confronting each other. Both have experience paranormal activity, but only one believes more. The Venus person will try to invite the house to their home (pure opening of their soul). The Venusian can be quite delulu, but the house see it as funny or special. They met when something is ending for the Venusian. Romantic times, home dates, asking the other about things or traumas carefully, a special vibe around them. *Big smiles and shiny eyes*, "I buy you this; you tell me two months ago around 9pm" "aww thank you", "are you sleeping well?" - "yes" , *astrology or tarot talks* "can you give your birth time?" - "12:34 am" " it was bad?" "No, we match". Talk about paranormal activities like any other topic, special dates, random celebrations, secret spots, discreet dates, spirtual conection, they may understand the other, but can't explain it.

Take what resonates only. 💚