I can’t believe it’s gonna be a year since 2022 r/place? Like what the hell lmao 😭
Honestly I don’t expect r/place to come back this year for Reddit’s yearly April Fools joke because it’ll be predictable and it hasn’t been five years yet… although they could possibly add a twist to it (like how 2022’s ended with a white void unlike 2017). But I know people have been speculating and digging into the code and have found “evidence”. Oh well.
In any case, some thoughts from someone who was very chronically online during 2022 r/place and wrote long update posts daily:
1. If you’re part of a fandom and want to contribute to a mural, it’s very likely that some sort of central organisation has been set up on the subreddit and / or on Discord. And you should probably check it out before you do anything about the mural.
Organisation and diplomacy is key to r/place. Just because you personally want to expand doesn’t mean the central organisation wants to because it risks angering allies. Last year I saw people getting frustrated over “rogues” not following the instructions determined by the central organisation, which threatened our harmonious coexistence with a much bigger group (in this case it was Brazil).
I’m not trying to gatekeep but it’s honestly easier if you do want the crowd wants you to do instead of doing it on your own. Especially if you’re a smallish fandom trying to survive.
2. As a follow up to the above point, instructions from central organisations are often fluid and change very quickly. This is due to the ever changing geopolitics of r/place. Allies can become enemies, enemies can become allies. But I think usually people are pretty good at spreading information around.
3. It can be quite easy to get sucked into the virtual world of r/place. I severely needed to touch grass after last year’s craziness. It can be fun, but it can also be very taxing, both mentally, emotionally, and physically (if you’re the type to stay up late). So remember to take care of yourself!
I genuinely think r/place is fascinating. It’s like a microcosm of the world, with its geopolitics, borders, alliances, creativity, and all of that is over pixels on Reddit. Everyone is so serious over unserious things. It’s also extremely funny when you hear stuff like “Love Live wants to nuke Macedonia” and “Sexy Sex requires our help”.
I also like how people have different recollections of this event because naturally people are in different subreddits, timezones, experience things differently, but it all comes together to form a collective story on r/place. And it’s crazy how long the impacts can last for. Like I still fondly think about those four-ish days when Reddit collectively lost their minds. It felt like a fever dream. Truly one of the experiences of all time.
29 notes
·
View notes
blinks tiredly. i decide "hm maybe i should try to expand my circle and step outside of it a little, lets go look at the main community tags" and im just greeted with a bunch of edgelords who think saying "fiction doesn't affect reality, don't like don't read" is peak activism and "fighting censorship". head in my hands. this is partially why i do not ever go into the community tags, my nervous system cannot handle blocking fifty weirdos every single day just so i can have a normal experience in the community tags hfdsjkl
10 notes
·
View notes
I hate the way everything has been reduced down to "discourse" these days. Like I can't even complain about things without being accused of "engaging in discourse", and it's like, no, I'm just complaining about something on my own blog. It's really not that deep, and you really don't need to reply to it.
Not everything requires your personal response. It is okay to just ignore things and move on. You won't die if you refrain from giving your two cents on vent posts that have nothing to do with you.
4 notes
·
View notes
Why are people so weird about any criticism of carver
14 notes
·
View notes
The funny thing is I'm sure there's more IDW MegOP content out there than I give people credit for, but the issue is that I have very exacting standards for IDW MOP. By which I mean I refuse to read takes on IDW/MegOP/Optimus/Megatron that are shit and a lot of fics fall into one or more of those shit takes lol.
Like oh, "IDW is so popular and MegOP is so popular, you should be able to find content of them you like!"
Do you have any idea how hard it is to find IDW MOP content that doesn't feature Megatron being whitewashed as fuck or being written as some tragic misunderstood hero whose crimes aren't actually that bad because he was oppressed first. Or Optimus being completely replaced by a bland continuity soup version of himself (instead of his actual IDW personality). Or an uneven dynamic in which Megatron is treated as some genius while Optimus is an idiot whose only political stances are "killing bad :( ". Or a dynamic in which Megatron has all of his IDW lore and then some to be 10000% fleshed out while Optimus is just written as "oh he was a dockworker/librarian and liked Megatron a lot. And he's nice :) ".
It's harder than you fucking think lmao
11 notes
·
View notes
I am pissed.
7 notes
·
View notes
something i hate is seeing neurotypical/non-psychotic people be all defensive when they have one (1) unpopular/unconventional interest. they make their whole personality into how quirky they are and then turn around and ignore at best, harass and bully at worst when people like me who are 'crazy' when we engage in those same interests because we somehow manage to 'do it wrong.'
2 notes
·
View notes
I know I shouldn't give these kinds of people the time of day or any attention but I'm just like ... How do you think like. How do you think like this. what is your thought process of " it's a fictional character so they can't be a child or teenager " like ??? I think they're just trying to defend ns//fw of children because hurr duhh uhhh durr fiction doesn't affect reality I can draw horribly disgusting things of a 14 year old character because it doesn't hurt anyone it's not a REAAL child !!1!!
6 notes
·
View notes
This is a reminder that leaving disparaging tags, comments, or additions on an artist's or writer's post is super shitty.
It can be about the art, the style, a character there you don't like, a setting you hate, the overall quality, ect. It really doesn't matter, it's always shitty. Complaints were not asked for and are not appreciated when someone is posting the content they spent time creating and are now sharing with you for free.
I mostly reblog content and I expect when someone comments or reblogs a post from me that they are kind and respectful to the original poster. For anyone that needs the reminder, the original poster will see all the tags, reblogs, and comments added to their post in their notifications (and potentially email if they have that turned on for comments) regardless of how far down the reblog chain it is. People that reblog the post (like me) will see the tags, reblogs, and comments added to the post when they are from my reblog only.
Take this as the warning it is. I will be blocking anyone who is shitty on the posts I have reblogged. The creators didn't ask for this and they don't deserve it. I will not be an origin point for this kind of bullshit. Don't like it, don't reblog it or comment on it.
1 note
·
View note
I mean there was a period of time where you were saying shitty things about both Harry and Louis. And it was more mean comments than little criticisms. I can understand why people wouldn't want to see that. It didn't bother me because I agreed with every word you said lmaoooooo. But also people are incredibly sensitive on here and can't handle reading one bad word about their faves.
If there are particular blogs and content you want to be able to interact with again I would just message the blogger. There's no harm in doing so. Chances are they might not even remember why they blocked you in the first place lol.
Alright but how do I message them if I am blocked 🤧
0 notes
hungarian/nomadic magyar tumblr circa 998AD dashboard simulator
🏞️ vándor-ló-979 Follow
not yall still spreading emese's foundation myth??? she literally claims she fucked a bird????? like either she's lying or she cheated and she's trying to cover it up or well. i dont even want to consider the third option
🪺 magánügyek Follow
tengri forbid women do anything???
735 notes
🦅 szél-könnyű-szárnyán-szállj Follow
okay im sick of the discourse let's do this.
8,572 notes
🐎 istván-rovására Follow
that took so long lmao -> !!!!!!!∧◇ᛏ⋈∧
481 notes
🐴 csillagösvény Follow
i'm so serious rn if you support """istván""" in any way just unfollow and block me. we do NOT need him or his dumbass god and what he's been doing to our people to spread his religion is shameful.
🐴 csillagösvény Follow
btw we all know your real name is vajk stop larping as a christian it's EMBARRASSINGGGG
✝️ esztergom-örökké Follow
love seeing my mutuals reblogging this /s anyway op has multiple posts on their blog supporting quartering and human sacrifice. in case you were wondering. anyway stand with István
🐴 csillagösvény Follow
1) we dont even do human sacrifices, are you fucking stupid??? show me ONE post where i talk about that. 2) are you seriously forgetting that your bestie istván LITERALLY QUARTERED HIS UNCLE?????
#sorry to put this dumbass on the dash😭 dont even engage just block them #ur not making it up the tree of life lmao #discourse
3,264 notes
🌅 bolygó-kárpáti Follow
friendly reminder that just because you're white passing doesn't mean you're not a real magyar!! people with mixed parents are just as valid <3
🏇 attila-népe Follow
cranky coz ur ancestors decided to mix with the europeans arent you
🧺 lemezelő Follow
isnt your girlfriend literally frankish????
🏇 attila-népe Follow
you had to have done some serious stalking to find that💀 and first of all i didn't have a choice, my parents picked the tribe, and second of all she's not my "girlfriend" i got her via ritual kidnapping (WITH consent. before anyone gets weird)
🌐 a-kiber-kovács Follow
Couldn't you have kidnapped another magyar woman? Or someone from another mongoloid tribe?
🔅 hadúrsimp Follow
ohh sure so now human pet guy is gonna chime in to advocate for the kidnapping of our women while being lowkey racist. what are you even doing on nomadblr????
🌅 bolygó-kárpáti Follow
what the fuck happened to my post
19,276 notes
🪔 rakabonciás Follow
for the nth time, you're only a true shaman if you were born with teeth OR with extra fingers OR in the sac. the rest of you are faking & we can tell.
🦅szél-könnyű-szárnyán-szállj Follow
okay people keep spreading this but this is literally just wrong?? like congrats on the 6 fingers op im glad u and Little Golden Father have a special connection (genuinely) but like. táltos and sámán and mágus and garabonciás and javas etc are all different things with completely different requirements and life paths which you should definitely know if you're claiming to be one?? especially since your post says shaman but you're listing the criteria for a táltos, and your username looks like a play on garabonciás so. which is it🤔 maybe get your facts in order before trying to gatekeep
anyway don't listen to op!! your connection to the Upper World is yours alone and you're the best judge of what the Fathers and Mothers want your path in life to be!!
646 notes
🛐 mea-culpa Follow
It breaks my heart that the majority of my people still refuse to see the One True God and insist on sticking to their pagan spirits. I fear that when judgement day comes, we will all be wiped out thanks to their foul godless ways.
🐴 csillagösvény Follow
how tf am i godless when i literally have dozens of gods? little mothers and little fathers are in everything all around us & it must suck ass to live in a world where you're not surrounded by the small gods that inhabit everything. manifesting that the fene and the guta tag team beat your ass tonight
🔅 hadúrsimp Follow
hadúr will literally strike op down personally. he told me himself. whispered it to me sweetly even
🐴 csillagösvény Follow
while i agree with you, i feel like you might also have ulterior motives, nomadblr user hadúrsimp
#but live your truth! doubly so on the posts of these freak repressed bible lovers. meanwhile on the #COOL side of magyarhood we walk around butt ass naked!!! op have fun never experiencing joy ever again tho #discourse
198 notes
👑 sanctus-stephanus Follow
posting from an alt so i don't get cancelled but lowkey i'm starting to think koppány was right.... maybe this christianity thing isn't gonna work out after all
👑 sanctus-stephanus Follow
WRONG BLOG
👑 sanctus-stephanus Follow
THIS WAS A JOKE. IGNORE THIS
🪺 magánügyek Follow
ISTVÁN????????????? 💀
1K notes
·
View notes
"Are cishet ace/aro men queer" holy fuck you people are just awful huh. Really just showing that we haven't moved past the Basically Straight ideology.
As a cisgender, heteroromantic ace individual myself, allow me to tell you a little bit about myself.
I spent most of my life wondering what was wrong with me. I knew very quickly that many of the people who confessed their love for me would not want me the moment they found out I was averse to sex. I would daydream of various men I'd had crushes on over the years spending time with me in ways I was comfortable, but rarely did I confess my feelings because a simple saying rang in my ears.
"You'll never find a man who will love you without sex."
And the people in my Instagram DMs who would call me baby and then ghost me after they figured out the flag in my profile picture spoke volumes to that. I was only desirable because I was physically attractive. No one wanted to love my personality, not if they couldn't also fuck me. It just wasn't an option.
I have been ostracized. I have been told I don't belong. The straight community does not want me because I do not actively desire sex. The very people you're trying to lump me in with because I'm "basically straight" will not claim me because I am not like them.
I am The Other. I am Less Than. I am Strange. I am Queer.
A person born male, who identifies as a man, and is attracted to women exclusively but only in one way (romantic) or the other (sexual) is queer.
That is a man who either does not desire sex, and is therefore Not Really A Man by society's gender standards and expectations, or does not desire a romantic relationship/wife/girlfriend and is called a manwhore dirtbag who sleeps around or is asked eternally by family and maybe partners who don't get it When He's Going To Get Married.
To be straight requires you to identify with your gender assigned at birth, to feel romantic attraction to the opposite gender exclusively, to feel sexual attraction to the opposite gender exclusively, and to only desire monogamy in that relationship.
A man, born a man, who is not romantically attracted women, but sexually attracted to them, is not straight.
A man, born a man, who is romantically attracted to women, but not sexually attracted to women, is not straight.
There is no debate. Yes, even the Demisexuals and Demiromantics. Yes, even the ones who are capable of feeling these things only under the right conditions.
They're all queer. Every single one. Because they deviate from the idea that Every Man Wants To Fuck A Woman And Be A Loving Husband By Default.
If you disagree with any part of this post get the fuck off my blog. If you try to start shit in the notes or in my asks you're getting blocked.
We're here. We're queer. Fucking deal with it.
3K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 8/7/24)
consider helping me pay to finish my education!
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, etc.)
for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
for additional phobias: i tag with the specific phobia (trypophobia, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
according to democracy, yes
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Trichosanthes cucumerina, or Snake Gourd flower.
2K notes
·
View notes
Summary of The Cat of The Year poll atrocities of 2023/2024
I'm sure that most people on this side of tumblr have seen the Jellie vs. Nefarious Anglerfish poll going around with like 60k votes at this point, and I'd really like clear up some of what happened since I was around for the whole thing.
Url blocked out for op's privacy. They have already left but don't look for it if you haven't seen it/don't harrass them if you already have.
1. The previous round (preparation)
I discovered the poll in its previous round, needless to say she beat Jort's ass severely. This was around the 3rd of january, meaning that this round finished before jellie's passing with only about 7k votes. Op did add their own piece of propaganda from their main:
...which was FINE. (except for stuff we'll see later) Of course running a poll while biased isn't ideal but I for one didn't even know they were the op until much later. I also added my own piece in a separate thread, and they didn't interact with it at all. There was no drama.
2. The Finale
Jellie unfortunately passed away right before the starting of this poll, which was the catalyst for what happened next. Op did exactly as last time and added a slightly more mean spirited encouragement to vote for the other contestant. This is the point where I believe that i fucked up personally.
I added this thinkpiece accusing op of associating all mcyters with Dream (who we all hate for the record) despite them not alluding to him at all. This is because tumblr has a history of disimissing all mcyters as... everything that dream was been accused of. Op did allude to not caring for mcyt. but they didn't say what i accused them of. This is important to point out because this reblog of mine is still being spread. Jellie was in the lead at the time, but not by the time i woke up next morning.
I won't be including anyone else's additions because I don't want to put blame on any specific person. Just felt like clearing up mine.
3. The Fuckening
Some time later op made this post to their personal blog:
which is insanely shitty because, as other people have pointed out, the "lame ass youtube cat" didn't die to inconvinience op or ruin their fun, and people would have probably voted for her anyway because jelly is universally beloved in the mcyt community. This isn't anti democratic. This post was added to the poll with a caption saying op should not be running this poll, and it took off. Op later went on to say that this was a joke:
This apology was not taken well by people, (including me) because "you were not meant to see it" isn't an apology and they still very much made fun of someone's pet dying. Safe to say this did not make the drama stop and only added fuel to the flame. I believe this was the point where the conversation of mcyt fans being unjustly sent hate to was reignited.
We should discuss that! it's a real thing that happens often and is equal to childish bullying. However, in this case, OP was the only one getting sent hate to my knowledge. The notes were mostly saturated by mcyt fans, and even now i can only find one or two hateful stance towards us under the whole 20k notes post.
4. Conclusions
Op posted a second apology to the catoftheyear blog to try and calm people down (i believe this is comprehensive and a lot better than the previous one) The blog was deactivated shortly after, so i only have my phone screenshots of it that i also added to the poll itself at some point:
(Edit) Here's proof that op did not write the justification they got criticised for, from the notes of the original poll:
This apology didn't get seen, or get accepted by enough people, so op made this statement on their personal:
Needless to say I am deeply dissapointed (and guilty) that it's come to this. Yes, op said tasteless things that made us all angry, but telling a human being to commit suicide is worse than being insensitive about a stranger's pet dying. Even after I posted about the blog being decatived i had someone come into my notes to wish that "they never find happiness" i mean wtf. This isn't like shipping where we can do whatever without the content creator's input. this is fucking harrowing and i can't imagine how i'd feel if this was done in my/my pet's name especially after losing them as recently as a week ago.
I hope no one from hermitcraft who is on here (let alone scar holy shit) learns about this like they did with previous lighthearted tournaments. If you truly respect the creators you claim to be a fan of as people, you do not tell people to kill themselves over them. And finally, let Jellie fucking rest, guys. she had a long, good life. I hope op can come back and also avoids behaving like this if they ever wish to do so. I'm angrier at mcytblr, though.
1K notes
·
View notes
Hi Stays, this is a post to warn everyone to be wary of a SKZ author here on Stayblr with the username @/gimmeurtmi
I followed them not too long ago, but they suddenly blocked me. I was confused why because I have my age in my account and followed all of their rules. However, I have some reasons to suspect that this user is a Zionist. As you can see I am very Pro-Palestine, it’s in my blog title and bio, and I think this is why they blocked me.
They made a post showing anger about Stays educating Felix on his live about Coca-Cola (For people who don’t know, Coca-Cola is on the BDS boycott list, they support Israel and built an R&D center in occupied Palestinian territory of Atarot) In their post they said it’s “pathetic” for Stays to inform Felix about this and that he wasn’t doing anything wrong. Felix made the effort to read about the issue on his live and chose to apologize to Stay for it, but this user thinks that boycotting a brand tied to a genocidal state is the same as bullying.
((Screenshots are not mine))
They also showed strong support for the new SKZ collab with Charlie Puth. Many Stays are boycotting this collab because Charlie Puth is a raging Zionist, and the track also has an Israeli producer, Johnny Goldstein who is also a proud Zionist. gimmeurtmi even made a whole tag for this collab on their blog to show how much they’re excited for it, even though two Zionists worked on it and will be receiving royalties for it. You can also see the tags in the third post showing them speaking of Tommy Hilfiger, yet another Zionist, in a friendly manner.
Furthermore, I talked to other Stays in the community about this because I don’t want to jump to conclusions and gimmeurtmi blocked other users who are showing support for Palestine, not just me. From reading their posts on their other blog (@/stuckonspidey) you can also see how far their beliefs about this go. That’s not to say them being Jewish means they must be a Zionist, because that’s a completely false idea. There are plenty of Jewish people who are not Zionist and support Palestinian liberation because we recognize that what Palestinians are suffering through is a history repeat of what our people went through. But this added with all the other questionable evidence makes me suspicious that this user is a Zionist, or at least an Israeli sympathizer who treats support for Palestine as an inconvenience.
From these posts on their main blog, you can see them refuse to condemn Israel or even say anything about their crimes when they got asked about it. Instead, they just talk about how this genocide has personally affected them. There are no posts (that I could find) of them showing any sympathy or support for Palestine, all their posts about the subject are just self-victimizing posts about how they feel. Yes, it’s a scary time to be a Jewish person as well, I know this as a person of Jewish ancestry, too. But fighting anti-semitism AND fighting for Palestine can and SHOULD co-exist. It’s a huge red flag that the only thing they have to say about the genocide is how Jewish people are the victims in this. They also made another post where they claim that “Zionist” is just a word people use to be anti-semitic. This is a tale as old as time that Zionists have used to excuse, deny, and even justify Israel’s war crimes. I was once told that a genocide of Palestinians doesn’t exist and is just an “anti-semitic blood libel”. This is the exact same rhetoric that Zionists in my community and Zionist news outlets use (which, I add, almost ALL news outlets are strongly biased to Israel because of America’s ties to it. Israel is heavily backed in support from some of the richest and most powerful countries in the world, it is not the victim and never was).
I am not making this for drama. I made this post just to tell fellow Stays to be cautious of which writers you’re reading from and supporting. If you are against the genocide that has been happening to Palestinians for 75 years now, I suggest not supporting this person’s work, because at best they don’t care about what’s happening in Palestine, and at worst, they actually endorse it. There should be no place in our Stay community for this hateful ideology.
941 notes
·
View notes
the boy is mine | a writing exercise
excuse me, can i please talk to you for a minute?
do you know somebody named...y-you know his name.
oh yeah, definitely, i know his name.
well, i just want to let you know that he's mine.
no, no, he's mine.
hi, this is carol and i wanted to create a fun blurb writing exercise a la @superblysubpar and @chechelia considering the current state of the eddie munson x reader fandom. i, personally, can barely stand the seemingly never ending infighting between writers and groups on here. whether it be writing style or characterization, it seems everyone sort of has a problem with everyone. (not me tho, i truly am vibing). in the words of monica and brandy 'you need to give it up, had about enough'.
-- so instead of leaving, i wanted to try something fun, fresh, and cute to bring us together.
we all have our own eddie munson head cannons that we hold near and dear to our hearts. but i think that's part of what's fun about fandom, there's a little something for everyone. so this exercise is a way for us to all be on the same playing field -- same prompt/dialogues we have to use. only written how your personally HC eddie, our og guy (no au versions pls). i loved how this manifested on cece's old blog because it was so fun to see what people came up with.
below is the dialogue and prompt as well as the best way to participate. yes, if you are a steve girl you can participate lol. if you are someone who has me blocked and/or vice versa and would like to participate, please send your link to a friend so i can add it in an upcoming masterlist.
the scene:
a romantic night in at the trailer.
props included/mentioned (in passing or can hold bigger meaning): a throw pillow, vanilla frosting, a small notebook.
dialogue included (can be manipulated slightly if needed, can be placed in any order):
- "i ran out of like, nice cups, is this okay?"
- "aw, don't be like that. that's not even true."
- "and you like that?"
- "if you don't stop, we're gonna have a problem."
these don't have to be sexy. they don't have to lead to anything. it's just a romantic night in -- and it can end in anything. angst, fluff, smut, alien invasion. who cares! i just wanna see how you'd write in your world with YOUR eddie. so we can see all of our eddies!
to participate, please write a blurb or ficlet titled 'the boy is mine (____'s edition)' and tag me so that i can add you to the upcoming masterlist. share each other's ficlets. enjoy how they differ and how they are the same. what do we all think is true? what do we differ on? i think this could be really cool.
here's a list of people i'm tagging from different 'x reader' groups to spread the word -- but everyone feel free to do it, please! share with your friends, encourage your friends to do it too:
@loveshotzz @chechelia @abibliophobiaa @aphrogeneias @jo-harrington @bewilderedbunny @impmunson @queenimmadolla @oneforthemunny @superblysubpar @sweetsweetjellybean @rebelfell @crappymixtape @lesservillain @courtingchaos @bettyfrommars @somnambulic-thing @bimbobaggins69 @blueywrites @lonelysatellites @wroteclassicaly @wheels-of-despair @rip-quizilla @upsidedownwithsteve @powderblueblood
535 notes
·
View notes