#I climbed a tree and held a bug
Explore tagged Tumblr posts
Text
I got tree time and bug time today. It's been pretty productive actually.
4 notes
·
View notes
Text
Riptide
// Joel Miller x you
summary: while on a patrol, you get attacked and joel finally comes to his senses and realizes how much you mean to him and how much that hurts him to admit // 2.8k // base content: rainy weather, blood, violence (beating, strangulation), being held at gunpoint, pining
A/N: hello!! just so you all know, unless requested otherwise, all of my joel fics will be written with a 30-40 year old, nonbinary reader. i don't mind to write for specific genders or ages, i just really prefer only a 20 year old age gap myself lolol



Cloudy skies painted the horizon as you and Joel galloped out on your horses, Joel on Dallas and you on Copper. It was your third day of patrols in a row and your body was starting to get sore due to overuse, a stomach bug had made itself around Jackson and there was slack to be picked up.
Today, you and Joel were venturing West, hoping to check off some outposts being neglected at the moment. You two usually took North to East so Joel made you promise to stay close in the unfamiliar perimeter.
The ride was peaceful, the smell of rain in the distance and cool breezes whipping through your hair as you rode alongside Joel. Barring the deep rooted anxiety of the foreboding weather, you were quite content with the moment.
Eventually, you both make it to the first outpost. The horses are easy to secure to a hitch and you jump off with a soft grunt, ghosts of aches rippling through your muscles.
“Y’alright?” Joel asks, peeking a curious glance over to you as he shuffles through his side saddle for something.
“Yep, just feeling the burn of overtime,” you groan as you stretch your arms up and out, loosening what you can. You give Copper a gentle pat and a few words of assurance before you leave her side. Joel smiles softly, rolling his eyes as he finds it endearing that you keep your horse updated with words she’ll never understand.
“C’mon,” he leads, making his way to the aged hunting tower, checking any corner or crevasse for anything that might be off. His gut is unsettled as this is newer territory for him and he can’t rely on memory for what’s potentially out of place.
At the base of the tower snaked up a tree, there’s a small, wooden shed with a few chairs sitting with a log book inside. It’s a tight space, only meant to be a safe barrier between the ladder and the vast woodland surrounding area. You follow Joel inside to grab the pen and log your arrival.
09:32 - Joel and… All Clear -…
Joel tests the sturdiness of the ladder and starts to climb. You set the pen back down and shimmy off your bag, aiming to join him.
“You stay here, keep an eye out. I’m just gon’ see what I can see,” he orders simply, like you wouldn’t take offense to being left behind.
“Screw that, I wanna see the view,” you argue, starting to climb the space he’s already cleared on the ladder.
“I’m not kiddin’,” he looks back down, staring until you cave with a sigh and eye roll.
“Fine, mom,” you pick your bag back up, sticking your head out the door to check on the horses. “Just hurry, this place is too cramped,” you open the door fully.
“Be patient,” he mumbles, opening the hatch and resuming his ascent.
You leave the shed and return to Copper, petting her maine and watching Joel go higher and higher until he reaches the platform about 25 feet in the air.
Joel pulls out his binoculars and surveys the dampened landscape, finding their next post in the distance and looking for any signs of trouble. Once satisfied, he pockets the pair and looks down at you with a simple wave.
You flip him off. Lovingly, of course.
———
Back on your horses, the smoky sky is crying gloomy, misty drizzles that claim your exposed skin.
“How much farther ‘till the next post?” You ask, flipping your hood as the rain picks up.
“Not much more. ‘S bigger, we’ll be able to wait out the rain there,” he nods, squinting through the quickly filling fog. “Stay close,” he states, straightening his posture and staying alert.
It’s not like you can ride much closer to him, but you give the effort regardless since he asked. You haven’t really been able to figure him out just yet. You banter and joke around. You often share dinners or tables at town gatherings. You even fuck out some steam every once in a while.
Okay, most of the while.
But still, neither of you have confronted what it means. You could guess, take a really good guess and go from there, but that’s nothing you can build off of. You need the damn hermit to open up and assert your place in his life if there even is one.
You were never pushy, that you want to make clear. His relationship with Ellie and his commitment to her is admirable and indestructible, despite the rougher teen years that made them seem cold as ice, it was nothing you wanted to intrude on.
It wasn’t until Ellie and Dina moved in together that you started to accept the tide that was Joel Miller and no longer fought against his pull.
“There,” Joel points, pulling you out of your thoughts. In the distance, there was a melting log cabin, molded from the warp of gravity and curse of time.
“Thank god,” you scoff, uncomfortably wet by now as the rain won’t seem to let up. There’s an awning built for the horses, newer and sturdier, and Copper trots under without much convincing. Joel and Dallas follow behind.
Joel is first off, latching the gate around the shelter and going to help you down.
“Y’alright?” He asks, one hand guiding you to him by your waist and the other holding your hand for balance.
“‘M fine, just some rain,” you brush off, looking to the path that leads to the porch of the cabin.
Joel steps beside you, wiping some rain from his hairline. “We can make a run for it,” he states, looking over at you.
“Yeah, make a run for it,” you agree, turning back around to pull off anything you might need from Copper for the next few hours and go back to the gate. “Maybe-.” The words are stolen from your lips and the air forced out of your gut as an arm snakes around your waist and yanks you back.
There’s a rattle of metal and a harsh grunt in your ear. You see Joel whip out his own weapon with a stiff stoic glare, rippled by a snarl he can barely contain.
“Let them go,” Joel demands over the rain, staring right at your captor and not daring to look at you. If he only saw how fear painted your features at the surprise attack, he doesn’t think he could hold himself together.
“Drop your stuff ‘n back away,” the man behind you growls, hot breath invading your senses and making your skin scream.
Joel’s shoulders give him up, rising and falling with the weight of a freight train. He was seething. He slipped off his bag and set it down, taking a small, barely noticeable, step back.
“Grab it,” Joel says like it’s a dare, a glint in his eyes sparkling like a tiger watching its prey.
The metal beside you rattles as the man holding you captive extends his hand, aiming the rusty thing at Joel.
“Back up!” He sounds numb, like all of his effort is used to keep him up right and no passion for living holds up his words anymore as he holds you hostage. Like he’s on auto-pilot and lost to what this world made him.
You’re quick to snatch his outstretched wrist, twisting and forcing the gun out of his hand. The gun goes off as it lands, shooting through the roof of the stable and spooking the horses. The man is surprised at your sudden move but he’s quick to grab your throat and slam you against a beam of the stable.
The motion sucks all of the air out of your lungs again and they burn as you can feel the man bruising your throat. You claw at his hand, then up his arms, trying desperately to find a give but he’s anchored against you.
The rain pelts in, wetting your face and matting your hair further and you swear you must be drowning. You can hear Joel yelling and grabbing the attacker. You can feel the man get ripped off of you but you just sink to the muck beneath you as you gulp down breaths.
Your eyes daze from the impact and restrained oxygen but the color starts to come back in dizzying swirls and the sound funnels back in your ears like you're learning to hear again for the first time.
Joel has the man’s collar gripped in his fist and he’s wailing in on him. His free fist is bloody and trembling but aims stealthy back at its crumbling target. The man is slumped against the railing of the stable and with one more punch of finality, Joel sends the poor bastard through the soaked, rotted wood. He lands in the mud with a slap that spits mud up Joel’s jeans.
Blood is washed from the man’s lifeless face and puddles in the hoof prints sunken in the mud. It mixes with the rainwater and sediment, soon to be forgotten and soaked back into the Earth to provide more good that he seemed to do through the life he lived- in Joel’s opinion, at least.
“Look at me,” Joel’s voice cuts through the slicing rain around you both. He kneels in front of you and a hand- not bloodied- reaches up to cup your face. “Can you breathe? Does it hurt?” He asks too much of you. You blink, holding the moment, and open your eyes again. You nod, a simple answer for all three requests.
“C’mon, let’s get you inside,” he rises, looking off to the porch of the cabin. Your eyes drift over to the bloodied man that you’ve lost the ability to feel remorse for. If anything, he’s like a pesky bug that’s weaseled its way into your home in the old world.
The thought makes you wonder if this world has stripped you of your morals like it had the corpse just five feet away.
Joel pulls you to your feet, mud sticking to your clothes. “Gonna make a run for it,” he repeats from before the attack over the ever-persistent rain. A loose nod rocks your skull.
He leads, dragging you behind him and aiming to get the door open for you to run inside before him.
Mud splatters under your rushed footsteps and you can barely see properly through the curtains of water as you follow him. You slip on the first step of the porch but are able to recoup, with the stability from Joel, and dart past the frame and into the shelter.
Joel follows behind and latches the door behind him, shaking his head to whip out the rainwater. Gloomy skies continue to fight away the sunlight, leaving the room quite dark for noon.
The quick sprint and echo of strangulation on your skin takes its toll and Joel guides you to a chair right next to the logbook.
“Talk to me, baby.” You breathe in the word and it still can’t fill your lungs quite right. You trust him, so as his hands- both bloody and muddy- guide your jaw for him to inspect the ache, you relax. “I’m gonna press here, y’ tell me if it hurts,” he hums softly like he didn’t just beat a man to death, but you don’t mind.
His calloused fingers run along your throat, gentle and caring. You suck in a breath as he presses a particularly sensitive spot and his brows pinch as he mumbles a drawn ‘sorry’.
“Doesn’t seem anythin’s damaged beyond a bruise,” he relaxes his hands slightly so they loosely cradle your jaw. “Y’feel dizzy?” He asks, looking right in your eyes, relieved that they aren’t bloodshot.
“I’m fine,” you insist, trying to push him away but he scowls softly, narrowing his gaze.
“That asshole nearly-.”
“I’m fine, Joel,” you emphasize. “I know the difference between injury and bruising. Trust me, I’m fine,” the words scratch out and a slight wheeze accompanies your breathing, but he knows you’re right. You’ve been worse off in the past but that doesn’t make him feel better, it just reminds him of the other times he’s failed to get to you in time. Something in his gaze is different this time, though. You’d almost bet he’s convinced himself that you had succumbed to the man’s grip and now had to be buried six feet under.
“I’m here-.”
It was his turn to interrupt you and his already ideally placed palms bring you right to him. The kiss is painful for him almost. His face contorts like he’s barely making it through but he can’t pull away- not now.
Fuck, not now. It’s like his senses are cleared and everything clicks. He’s seen you attacked and hurt before, he knows the fear it is to almost lose you, but something about what just happened makes him terrified enough to bear his fear for you in this one, strained kiss that doesn’t feel like enough for him.
You accept how he melts into you, pressing back a bit but not enough where he thinks you’re rejecting him. You want this, you need it, just not as much as he seems to.
His lips only part to bring yours closer, sucking you in like the tide he his, and his breath shivers- he can blame the rain for the latter.
When he finally lets you go, his forehead leans into yours like he needs to feel you against him to remind him that you’re here.
“Joel, I’m fine,” you breathe out and the scent dusts over his face- your scent. He can’t get enough. His eyes open but he doesn’t move away, he just stares down at your lips.
“You coulda’ not been,” he admits and your stomach flips. He’s never been so raw with you before and something about it is unsettling but maybe it’s necessary to lay your roots somewhere else- somewhere deeper. “I can’t-,” he choked but he pulled back like he’s determined to get through this. His face is cooled into a gentle scowl like he’s going against everything he’s ever known and he’s aware of his crimes against himself. “Darlin’, I can’t lose you.”
Darlin’.
That’s new. It’s monumenting of his necessary betrayal.
“You mean more to me than what I’ve shown you and I’m-. I can’t keep goin’ like that. Not when-,” he gets so caught in his own words but you think you know what he’s trying to get at. Your hand, calloused but warmer and softer than what he feels he’s worthy of, reaches up to settle against his stubbled jaw. The thumb caressing his aged and worn skin that ignites under your touch is enough to let the words go and he snaps his mouth shut. His eyes follow as he tries to accept the touch that helps blurt out the words he needs to say. “I love you.”
Your shoulders melt with your head tilt as you take in his appearance- pained and scared like nothing you’ve ever seen. He’s letting you hold his heart in your hands, as deflated and scarred as it is, and he’s convinced you’ll crush it like he had that attacker's skull and he’ll remind himself that he deserves it.
“I love you too,” you admit, keeping your eyes on him as he takes his time to accept your return.
Rain pats along the frame of the old cabin like a thousand loose knuckles rapping against the wood.
He could laugh at how dense he’s been, how self-loathing and ‘woe-is-me’. Here you are, sweet, kind, marked with scars and wrinkles of your own story of life that’s shaped you into the fine, capable person you are today, and he’s acting as if the past year was measuring up to be nothing between you two.
As if the countless nights spent in each other's beds or hours of patrols or empty mornings that craved the other meant nothing but bodies against bodies.
His eyes part, taking you in a new light. That fuckers prints darken around your neck and he feels the boil under his skin but he accepts it in a new box in his mind. It’s not some worthless man attacking another because he needs to survive, it’s a man damned by his own faults the second he touched what was Joel’s, even if neither had known it at the time.
Joel’s hand reaches up to push back some wet hair from your temple, streaks of grey pepper the strands and he smiles almost unnoticeably. It barely relaxes his own cautious look he still holds.
“I love you,” he repeats, testing it out to make sure it feels right.
“I love you,” you match him, and he decides that out of your mouth, anything feels right. Especially when you’re saying it right to him.
thank you so much for reading <3
>> check out my other works here
tags: @blossomingorchids
#the last of us#the last of us fanfiction#tlou#tlou hbo#the last of us hbo#joel miller angst#joel miller x you#joel miller fanfiction#joel miller x reader#joel miller#joel miller fic
396 notes
·
View notes
Note
I love your little primarchs ,it's so cute.
What about a Emps centric story about he being tired but still enjoying his little sons so much ?
"Perturabo, don't play with your food."
The child paused with his sculpture of meat and mashed potatoes. Then he slumped, resting his chin on the table.
"Awwww," he whined, now pushing at it with his fork.
Indignant screaming sounded as the Khan raced through the garden path, Horus chasing after.
"Give me it!" Horus yelled.
"No!" Jaghatai snapped back as he ran onto another path. "It's mine!"
Light singing drew closer, and the emperor glanced at another son.
Ferrus was picking up rocks and putting them in the now empty picnic basket. He sang a song of nonsense. Stating whatever type of rock he grabbed or what bugs he saw.
Fulgrim was just beyond him in the meadow, spinning in circles as he stared up at the sky.
Jaghatai and Horus ran behind him. The first of the two stuck out his tongue, and he held a ball above his head.
Two custodes stood guard near the playground. Konrad, Angron, and Corvus were climbing to the top where the largest slide began. As soon as they reached the bottom, they raced back up.
Roboute and Magnus were using the playground diggers to "dig to Terra's core."
"Can I go?" Perturabo inquired.
The Emperor glanced at him and his untouched plate.
"You need to finish your food."
His son pulled at his cheeks and flopped over on the bench.
Lorgar came running up and presented a crown made of dandelions.
"I made you a new crown!" He exclaimed, looking quite proud.
The master of mankind leaned down, allowing himself to be crowned.
The little boy hugged him and then skipped away.
He turned around and warned those who were climbing the tree, "Do not get stuck."
"We won't," Lion insisted.
"I am!!" Cried out a scared voice.
The Emperor stood and went to the lower branch. Sanguinius was clinging to it, one leg having fallen off.
"I'm stuck!" He claimed, downy wings trembling.
His father reached out and took a hold of him.
"I've got you," he assured.
His son moved his hands to grip his wrists. As soon as he was gently set down, the little angel was off.
He giggled happily as he joined Mortarion and Vulkan in hopscotch.
Four sets of hands hit his leg.
"Boo!" Shouted a voice.
Another followed right after, "Boo!"
He turned to see Alpharius and Omegon disappearing into the bushes while squealing.
Rogal called from above, "Branch!"
The Emperor reached up and caught the falling limb.
"Thank you!" Rogal called as he moved further up the trunk.
Jaghatai came whizzing past. Leman was now hot on his heels, giggling.
Horus was not far behind but out of breath. He leaned against his father's leg.
"I just... need a break..." He said as he caught his breath.
He reached down to pat young Horus' head.
"My lord," Ra called as he approached with two other custodes. "We are here to relieve you. The sigilite says you need your rest."
The Emperor smiled as he spotted Leman now with the ball and Jaghatai chasing him.
"Thank you, but I will decline," he said. "I am fine here."
#requests#little primarchs#good dad emps#emperor of mankind#Perturabo#lion el'jonson#fulgrim#jaghatai khan#leman russ#rogal dorn#konrad curze#sanguinius#ferrus manus#angron#roboute guilliman#Mortarion#magnus the red#horus lupercal#lorgar aurelian#vulkan 40k#vulkan#corvus corax#alpharius omegon#warhammer community#warhammer#warhammer fic#my writing#adeptus custodes#wh40k#warhammer 30k
151 notes
·
View notes
Text


“Nightmare in the Sturniolo House”
Matt sturniolo x sister reader
Warnings: nightmares, crying
The Sturniolo house was silent, the only sound coming from the soft ticking of a clock and the quiet breaths of the triplets sleeping peacefully in their rooms. But in one particular room, a tiny four-year-old was tossing and turning under her blankets, her face twisted in fear.
Y/N was dreaming, but it wasn’t a good one.
She was lost in a big, dark forest. The trees were tall and scary, their branches stretching out like giant hands trying to grab her. The wind howled loudly, and shadows moved all around her.
“Mattie? Nickie? Chwis?” she called, her tiny voice trembling.
No one answered.
Her little heart pounded as she tried to run, but her feet felt heavy, like they were stuck in mud.
Suddenly, she heard a low, growling noise behind her. She turned around slowly and saw glowing red eyes staring at her from the darkness.
The monster was big—too big.
Its sharp claws scraped against the ground as it took a step closer.
“NICK! MATT! CHRIS!” she screamed, but her voice barely came out.
The monster lunged at her, its giant mouth opening wide—
And that’s when Y/N whimpered in her sleep.
Her tiny body shook, her breaths coming out in soft, panicked gasps. Her face scrunched up, and suddenly, she let out a small sob.
Then another.
And then—
Waking Up in Tears
“M-MATTIE!”
Y/N’s eyes flew open, filled with tears as she sat up in her bed, her little chest rising and falling quickly.
It was dark. Too dark.
The nightmare still felt so real.
Her tiny hands trembled as she wiped at her wet cheeks. She needed Matt.
Sniffling, she climbed out of bed, her stuffed animal clutched tightly in one arm. She rushed toward Matt’s room, which was the closest, her tiny feet pattering against the floor.
When she reached his door, she reached up for the handle—but she was too short.
“Mattie!” she whimpered, banging her little fists against the door.
She hit it again, her cries getting louder. “Mattie, pwease!”
Inside, Matt was sleeping soundly—until he heard the banging.
His eyes snapped open.
His heart raced as he immediately sat up. What the hell?
Then—he heard it.
“Mattie!”
His little sister was crying.
Matt jumped out of bed, not even caring that he was only in his boxers. He rushed to the door and swung it open, his chest tightening when he saw Y/N standing there, tears streaming down her face.
“Y/N?” His voice was still groggy from sleep, but he quickly scooped her up without hesitation.
Y/N immediately buried her face into his neck, sobbing. “Mattie, da monster—da monster was gonna get me!”
Matt held her tighter, rubbing circles on her back. “Shh, shh, it’s okay. There’s no monster, I promise. I got you.”
Her tiny body trembled against his as she sniffled. “I was twying to find you but you wasn’t dere…”
Matt’s heart ached.
He kissed the top of her head. “I’m right here, bug. You’re safe, okay?”
She nodded against his shoulder, but her tiny hands were still gripping onto him like he might disappear.
Matt sighed and carried her back inside his room, kicking the door shut with his foot.
Cuddles & Comfort
Matt gently laid back down on his bed, keeping Y/N tucked against his chest. He pulled the blankets over both of them and ran a hand through her messy hair.
“You wanna tell me about your dream?” he asked softly.
Y/N hiccupped, her voice still wobbly. “I was in da fowest… and it was dawk… and a big, big monstah was twyin’ to eat me…”
Matt frowned, hugging her closer. “That sounds scary.”
“It was!” she whimpered, curling up into a tiny ball against him.
Matt rubbed her back. “Well, you don’t have to be scared anymore. ‘Cause you’re here with me now, and no monster can get you when I’m around.”
Y/N looked up at him with her big, teary eyes. “Pwomise?”
Matt smiled sleepily. “I promise, bug.”
She sniffled again but finally let out a small sigh, resting her head against his chest.
The sound of Matt’s heartbeat was soothing, and his warmth made her feel safe.
Her little hand clutched onto his arm as she started dozing off.
Matt chuckled softly, watching as her tiny breaths became slower and deeper.
“Love you, Y/N,” he murmured, closing his own eyes.
“Wuv you, Mattie…” she whispered before falling into a peaceful sleep.
And just like that, the nightmare was forgotten.
#chris sturniolo#matt sturniolo#sturniolo fanfic#matt stuniolo fanfic#sturniolo triplets#chris sturniolo x reader#chris sturniolo x you#christopher sturniolo#nick sturniolo#matt sturniolo x reader#matthew sturniolo#sturniolo smut#sturniolo x reader#nicolas sturniolo#sister sturniolo#sturniolo series
240 notes
·
View notes
Note
hello!
i'm curious if infodumping about my pet frogs will result in a genome of a bug that they could potentially eat (seems more likely than the genome being of a frog).
i have four pet frogs! one is an african dwarf frog named bonk who is an ooooold old man (he's 5, which is the standard life expectancy in captivity for their species) with a genetic deformity on his back right foot (two of his toes are partially fused together! it doesn't impact his life in any way and various foot deformities are common for his species). he is tiny and doesn't eat bugs, but if the genome is a brine shrimp, mysis shrimp, or other tiny aquatic organism, he could eat that. ...i guess those are just aquatic bugs.
my three other frogs are white's tree frogs, piphy, ollo, and beeps. they are 4 years old. piphy is my only girl frog. she is large and peach-colored with light blue starlet eyes and is an extremely physically enthusiastic eater; she does unnecessary backflips in pursuit of waxworms held by feeding tongs directly in front of her face. she also loves swimming in their pool, which has resulted in various melodic renditions of "piphy in the pool." ollo and beeps are smaller and a dark brownish green, i think they are genetically brothers! they enjoy being reverse-roosters by croaking when they wake up at night. they are energetic and enjoy climbing my walls and flinging themselves far distances when i let them out of their terrarium for nightly supervised enrichment hour.
bonus: i also have a black racer nerite snail who is the live-in algae vacuum for bonk's tank. her name is ozmi and she is canonically trans (her species is not hermaphroditic, and when i got her i decided she was a girl because i wanted to bring feminine energy into the aquarium, but she has never laid eggs so i figure she is probably trans). she is also 5 years old which means she has outlived the life expectancy for her species like 3x over. she may be immortal.
okay that's all!!! attached photo of piphy in her pool, looking elated about it (tree frogs tend to open their mouths a few times after eating a bug... i am not sure the physiological reason). i find your blog so delightful, thank you for running it !! :)

String identified: cgattgtagagtattcttaattatggagatgaacaagaaacttaactaccatttctagtctacgttttaatatgtttactaaaattacctatatgttgattaatcgacattatgtataatcgttgattgataaggagaacctgttataatcatatcatcaactagtgcttacagtcatacttaaaaaagttagtcattgtcagtaatgttagtcacgaaggtatactttttagtctaaaacactatagaactaaacacatactatcagtcaagcaattggttaataagggataaacaattctaccataatataattactgatatttgttttatatatgagattgcaaggttagt
Closest match: Hydrocotyle vulgaris genome assembly, chromosome: 39 Common name: Marsh pennywort

(image source)
#tumblr genetics#genetics#asks#requests#sent to me#frogtender#<- fitting#frogs#frog#plants#marsh pennywort#thank you for the silly little frogs#weird how this plant has so many common names associated with money#money plant. dollar plant. lucky plant. copper coin.#i choose to take this as a sign that you should give your frogs money. it's what they crave
601 notes
·
View notes
Note
Hello… I have an angsty request, you can obviously ignore it because it can be a sensitive subject, but you would write it in such a cute and respectful way💝
Any Logan you picture with a reader who was sexually abused, she is kind of sensitive to physical touch, but also needs it, she needs comfort. Even more when it comes to intimacy, Logan and her never had sex because it triggers her, but one day, she decides she wants to, it’s hard and awkward and sentimental, but Logan is a sweetheart.
Again, ignore this if you want to, you’re an amazing writer
xxxx
I'm Here
Logan Howlett X F! Reader
You want to take the next step in your relationship, and Logan supports you through it
A/N: Nonny, thank you so much for this request. I hope this came out the way you imagined <3 I left it open so you could imagine any Logan!
Warning: Sex, MDNI, descriptions of sex, implied PiV, mentions of past abuse (but not descriptive), communication, reader get nervous and anxious, handjob, soft Logan, Logan is nervous too!
Warm sunbeams kissed your face.
You sat curled up on the window bench, your arms wrapped around your knees as you watched the skies become blue, the darkness that hid the sun and brought on torrential downpours slowly fading away.
Birds flew to the wet grass, pecking the ground and searching for bugs to feast on. Slowly you watch the world come out from its hidden niche, basking in the new sunlight and fresh air. You observed all the little details from your 3rd-floor nook.
The small wind blew through the trees, shaking the leaves gently, The squirrel ran across the pavement and grass, both pausing in the open- a shiver of its tail as it observed its surroundings. The slow steady drip from the leaky gutter above your window.
“Here you go love,” Logan's voice drew you out of your daydream, as you turned to look at him. He held out a mug, one that was shaped like the head of the Pokemon Slowpoke, the newest in your ridiculously large collection of mugs. Steam comes off the tan liquid inside and dissipates into the air. You adjusted your position, crossing your legs as you reached out with both hands to grab the mug. “Careful, it’s hot.” He warns.
You nod, grabbing the handle and gently bringing it up to your lips, blowing air over the hot liquids, and then carefully sipping it. A slight bitterness to the tea, the flavor masked with the slices of lemon Logan had added. “Mm… good, thank you.” You hummed.
He gives you a soft smile, before joining you on the window bench seat and sitting across from you. His leg folded and resting on the cushion of the bench, his other foot braced on the floor. He leaned against the wall, a beer in hand resting on his thigh. He looked out the window, his expression relaxed.
Your eyes trailed over him discreetly, as you sipped your tea. You observed his hazel eyes - how they seemed gentle, compared to his usual expression. Down to his lips, soft, set in a something position.
You trailed down to the way his shirt - just a normal, plain black shirt, fit over him. The sleeves were a bit stretched over his biceps - he’s always wearing shirts that fit just a little too tight over him. You’d tease him about it, and he’d wink at you for it.
You moved down to the denim he was sporting. The way he sat with his legs spread, relaxed yet confident. Your eyes lingered a bit longer on his lap than you cared to admit. Swallowing, as you felt a warm feeling grow inside you, you turned yourself away to look back outside to the peaceful Earth.
You both sat in content silence together. The world seemed slow, unmoving. You felt the quiet urge to be closer to him.
You looked at him again, moving to carefully set your tea on a small table next to you, you began to climb over to him. He looked at you, sensing what you wanted, adjusting himself so you could comfortably sit in his lap.
Your legs draped over his, and you curled your body into him. His arms slowly, protectively settling around you, as you nuzzled yourself into his neck. The scent of him, cigars and leather, sent a wave of safety through you, as you relaxed.
You heard a deep sigh of contentment escape him, his chin resting over your head.
It’s taken a long time to get to this point.
You and Logan have been together for some time now. About a year, give or take.
You started as friends first, growing into something more romantic. It had been a slow steady process, with the both of you earning each other's trust.
The night both your growing feelings came to light. Logan cupped your cheek gently with his hand and asked to kiss you.
The feelings you felt from it were hard to decipher.
Happiness, want, and a need for that intimacy. You’ve looked at his lips more times than you can remember.
Then a sick feeling that twisted in your gut, your skin crawling. The two clawed at each other, an inner battle inside you that left you overwhelmed.
Logan, sensing your hesitancy, removed his hand from you. You didn’t have to tell him anything, have to explain your feelings. He understood, deep inside. His own battle raging inside him to allow himself to even touch you, to allow himself to open up. Fear of hurting everything he touches.
“It’s okay love. We can take it slow.”
Thus started the beginning of your budding romance. Logan was a true gentleman. He always asked for permission and learned your cues to what made you comfortable and uncomfortable. He respected any boundaries you asked for. He never made it seem like he was afraid to touch you, while simultaneously respecting your space.
It never felt like a waiting game with him.
You both enjoyed each other. You spent time together, knowing each other with no rush to go anywhere or do anything.
Quiet dates at little cafes and parks. Movie nights with friends. Slow mornings making breakfast.
Over time you felt safe to open up to him. About your past abuse. The history that makes you sensitive to touch, to avoid that intimacy that you also craved at the same time.
He held you while you cried.
Never once did he make you feel rushed, forced, or any sort of shame or guilt because you wanted to take it slow, before or after learning of your past.
The topic of sex had been brought up more than once. He always told you that he wasn’t here for your body, and while he certainly found you attractive. That physical intimacy was something that didn’t need to be rushed. When and if you are ever ready, he’ll be there. For now though,
“I love you, that’s all there is to it.”
You took another deep breath, grounding yourself where you were with him. His hand slowly brushing up and down your arm. It sent chills through you, and you had to remind yourself,
It’s him.
The warm feeling inside you lingered. A mix of apprehension, anxiety, desire, and need. You weren’t sure how to approach this.
“Lo?”
He moved his head back to look at you. You leaned forward, slowly capturing his lips in a gentle kiss. You could feel his surprise for a moment, the way his lips pulled back for a moment, hesitating before returning the kiss, eager, but affectionate.
You parted from him, pulling back gently as you looked up at him. His eyes half-lidded, as he regarded you with softness.
“What was that for love?” He asks gently.
You looked up at him, looking at his lips again, your eyes trailing down to his neck. You leaned in, pressing delicate kisses along his jawline, down to his pulse point. You heard his breath hitch, and you looked up at him.
A sweet, goofy smile across his face as he met your eyes. “Lo…I want to try to…” You purse your lips together, a heat blooming in your face. “To have sex.”
A bit of surprise on his face, his arm around you squeezing you gently. “Really?” He asks. You nodded. You saw his Adams apple bob in his throat as he swallowed - a sign of nervousness, but he masks it. He leans forward and presses a kiss to your temple, his lips brushing against your skin as he speaks. “You don’t have to do anything-”
“I know. I want to do this.” You say. “Just, try. Even if we don’t go all the way.”
He nods. “Now or…?”
You giggled, and he grinned. A nod of your head, “Now sounds good. Unless you got plans?” You ask teasingly. He chuckled, his arms moving around you to lift you like a bride, as he stood up with you in his arms with ease.
“Who you think you’re talking to bub?”
Adrenaline began to hum in your veins. Your arms wrapped around his neck, your fingers slowly climbing into the curls of his hair as he carried you to your bedroom. He moved to sit on the bed, with you still sitting across his lap.
He turned to look at you with a sweet smile, leaning in and pressing his forehead against yours. “We don’t gotta do anything you don’t want. If it becomes too much-”
“We’ll stop.” You nod confirming.
“We’ll go slow.” He says gently - a small firmness in his tone. You nodded again in agreement, smiling in his concern for you. You sat up, moving to straddle his lap.
Your heart began to race as you looked at him. His hands slowly resting on your hips. He looked at you with care. “You okay?” He asks, and you feel embarrassed- remembering he could hear the fluttering of your heart. You nodded.
“Nervous.” You smile. You leaned forward, shaky hands cupping his jaw, as you pressed your lips to his.
Your kiss started gentle, barely there, light and airy. It wasn’t the first time you’ve kissed, nor even the first time you slowly made out. Your nerves made your hands weak though, the idea that the kiss is going to lead to something more.
You wanted it, you did. You loved Logan. His respect, his love for you, has made you feel safer than you have in a long time. You craved the feeling of intimacy, of touch - and knowing you were going to be safe with it.
You pressed further, your arms wrapping around his neck, as you sat further up his lap, pulling him closer. The feeling of him close - his sturdy frame holding you.
It was a slow process. Carefully removing each other's clothes. You lifted his shirt off and allowed him to undress you. His touch sent shivers through you, but there was a warmth to it. The kind of warmth that made you crave more. He always asked you for permission.
“You’re so lovely, baby.” He’d whisper against your lips, after he slowly lifted your shirt over your head.
He gently discarded your shirt, adding to the small pile of clothes on the floor.
You both moved further up on the bed. His back against the headboard of the bed with you straddling him. The mattress creaked from your weight, as your comforted became disturbed from the shifting.
The sunlight beamed through the cracks of the curtains, as you felt warm light floating over your body. Logan's face highlighted from the lighting, the glow in his eyes as he looked up at up at you in reverie
Both of you were down to your underwear, and anxiety and excitement stirred low in your belly.
You reached down to his boxers, your fingers grabbing the hem of the briefs, and slowly pulling them down his thighs. His hard member popped out, you watching it bounce against his stomach and you bit your lip as heat spread over your face.
You stifled a laugh, leaning forward to put your forehead on his shoulder, your hands pressed to his chest. Logan chuckled.
“What’s up pretty girl?” He asked, his hands running over your thighs soothingly.
“Nothing I-” You laughed again. It wasn’t the first time you’ve seen him naked, just from various times of him changing around you, getting out of the shower with a towel. It always sent a syrupy warmth through you, your eyes watching his muscular form as he dried himself off.
This time though, it was a little different. The knowledge of doing something so…
“Too much?” He asks with a hint of humor in his tone. You giggle again shaking your head.
“It’s just nerves.” You say looking at him. He tilted his head, a sympathetic look on his face, he brought his hand up to cup your face, his thumb gently stroking your cheekbone.
“We can slow it down.”
“No, no I’m fine.” You shook your head, leaning forward to peck his lips. Your hands pressed to his stomach, moved downwards, and you gently took him. Fisting around his member, you slowly stroked him, as you looked back into his eyes. He was taking deep breaths, even with your strokes. “This okay?” You asked. He smiled and nodded.
You moved a little faster, and he let out a shaky breath, tipping his head back as you noticed his stomach clenched. The feeling was different- but not unpleasant. You leaned forward, capturing his lips in a kiss - and he let out a small moan. A small shock went up your spine at the sound, as you let out a breathy noise.
“You’re doing great love.” He says, leaning forward to kiss the tip of your nose, before nuzzling into your cheek. “Do you want to keep going?”
You bit your lip, slowing your rhythm over him, and nodded.
His hands, resting on your thighs, moved up to your panties. “Is it okay if I touch you?” He asks softly. You nodded, and his hand came over to cup your mound. It felt warm and comforting- his touch, as he brushed his fingers softly over your panties, which had become increasingly wet during your time together. “You’re so beautiful.” He says softly.
You looked up at him, his eyes filled with adoration as he looked into your eyes, and suddenly it felt as if your nerves eased. He saw you, not just your body, or the sex. “I’m a lucky guy baby.”
“I think I’m the lucky one..” You say softly. He chuckled,
“No no, you’re not going to win this one baby.” He grinned at you. His hand came up to cup your cheek. “Sweet girl you are, as pretty as a picture. Putting up with my bullshit every day. There ain’t a thing I’ve done to deserve you.”
Your eyes softened, as you wrapped your arms around his shoulders and pulled him for a searing kiss.
Slowly, awkwardly - but full of love and communication, you both worked through it together. He took care of you with a tenderness you hadn’t felt before, always checking on you throughout the session.
Your noses would bump against each other, your hands slipping over each other, and you would nearly lose your balance on top of him, making you both laugh as he’d press a kiss to your forehead, reassuring you to take it slow.
In some moments you would need to stop, almost too overwhelmed by the feelings and sensations you were experiencing- they felt good, but you needed to breathe. He would quickly ask you what you needed, but you only just needed him to be there.
And he was.
Eventually, you finally reached a point where your nerves were fading, as you felt more pleasure envelope you. Pressed against his firm chest, your face buried into the crook of his neck, the scent of him, the feeling of him breathing- it brought you down into a zone that was reassuring, that felt like home. It was soft, careful, and everything you needed from him.
He talked you through an overwhelming finish.
“I’m right here baby.” He whispered into your ear. “You’re okay, you’re doing amazing.” He pressed a kiss to your temple, as your muscles relaxed, and you fell over him, your cheek against his chest- listening to his heart, pounding nearly as fast as yours. His hand soothingly petted your hair, as you came back to yourself. “You okay?”
“Yeah.” You speak up. You carefully climbed off of him, moving into his side, your cheek pressed into his pec. “That was….nice.”
“Sure was.” He says, pulling a blanket over you both. “You want anything?... Some water or.. a snack or sumn’?”
“No, I’m okay.” You smiled into his chest. “I just want to be here with you.”
“Mm.” He let out a small grunt. His thumb rubbed soothing circles into your arm.
“Did…You enjoy it?” You speak up, with a small anxiety that maybe you didn’t perform well. You heard him hum.
“Baby, I had to keep myself from making a mess right then and there when you touched me.”
You started giggling. “Really?”
“That funny?”
“A lil bit.” You teased. He quirked a brow glancing at you, and you looked up at him. A warm chuckle came from his chest.
“Yeah, alright.” He squeezed you closer.
“I know one thing though…”
“What?”
“I think…I definitely want to do that again.”
You heard a small breath of relief escaped him. He turned to kiss the top of your head. “Whatever you want baby. I’m here.”
#logan howlett#wolverine#logan howlett x reader#logan howlett x you#logan howlett fanfiction#wolverine x reader#logan howlett fic#vans daydreams#logan howlett smut#logan howlett fluff
213 notes
·
View notes
Text
Eddie’s sitting in a lounge chair in Steve’s backyard. Well, it’s not a backyard perse, it’s a huge patio with a pool and then a whole fucking forest. Who’s house backs up to the forest? Do the Harrington’s own the forest, too?
Whatever, doesn’t matter.
He’s sitting in the lounge chair in nothing but cut off shorts and his jewelry, slowly bakng in the sun. What’s left of his beer in it’s sun warmed can is held loosely in one hand when Max plops down in the chair next to him. El gently sits in the same chair as Max and the both stare at Eddie. He doesn’t look at them though.
After thirty seconds, Max asks, “What are you doing?”
“Just wait for it.” Eddie tells her, sipping on his warm beer but not moving his eyes from the poolhouse across the patio.
Both girls look over, shading their eyes with their hands. All three of them wait silently. After another minute or so, the poolhouse door swings open and Steve comes out, pushing something that looks like a vacuum cleaner. He’s wearing his headphones and sort of bouncing to the beat as he drags a big hose part of it over to the pool filter opening thingy. Popping the plastic lid off, Steve kneels down, reaches through the opening for the vacuumy attachment hose he’s holding through the pool side. It looks very complicated and Eddie doesn’t give any fucks about pool cleaning or safety or whatever the fuck is happening there.
What he cares about is all that lovely golden skin on display. Steve’s shirtless, modesty about that hairy chest or those bat bite scars nowhere in sight, wearing swim trunks so short that Eddie can see the little love bite he himself left on the inside of one of those thick thighs this morning. Left it so high that no one else would see it but he’d forgotten that this man is allergic to inseams longer than his pointer finger.
Steve must get the hose attached because he stands back up, shakes the water off of his hands and gently lowers the pool vacuum into the water, holding the hose thingy as it sinks to the bottom. That done, he dances back into the poolhouse on barefeet, probably listening to fucking Bruce Springsteen or Queen because the guy actually has way more music cred than the kids give him credit for. There’s a click and low drone as he turns the filter on and the vacuum starts to roll around on the bottom of the pool.
Max turns to Eddie and grins. El doesn’t looks away from where Steve has disappeared into the poolhouse. “So we’re ogling Steve.” She says with a wolfish grin. No question. It’s a statement.
“Red!” Eddie sputters, looking away from the poolhouse to give her his best stink eye. “You are children!”
El makes a raspberry noise with her lips and rolls her eyes in a way that looks far too much like Max - or Mike.
Max scoffs, “We’re fifteen, you asshole. Tell us what you were looking at when you were fifteen and we’ll stop.”
Nope. He will not be doing that. No one ever needs to know what young Eddie was using for ....ew he’s not going to think of them doing anything he was doing at fifteen. Gross.
“Mayfield. You’re ruining it. Watch quietly and I won’t tell Steve.”
El grins too this time and settles into a more comfortable position. She and Max share a triumphant look and lean closer together. Probably to whisper to each other where he can’t hear them. Good. Eddie doesn’t want to know.
Steve comes back out, waves at them like the innocent babe that he is and then starts wielding a giant fly swatter - or wait, it’s a pool net. It’s like twelve feet long and Eddie can clearly see the muscles on Steve’s stomach and arms flex as he scoops out leaves and summer bugs from the middle of pool with it. By the time he’s satisfied with the now pristine surface of the pool, there’s a fine sheen of sweat on Steve. If Eddie wasn’t sitting next to two teenage girls, he’d probably be over there by now, climbing Steve like a fucking tree.
Who invited them? Oh wait, they did. Happy fucking summer he guesses.
The captain of the swim team disappears into the poolhouse again and when he comes out this time, he’s got a screwdriver and a lightbulb in his hands for some reason. Setting them on the edge of the pool, he dives in and Eddie was not prepared for that. Steve’s all sleek and long limbed, sunkissed as he barely makes a splash into the pool. When he comes up, he flicks his hair back and swims over to where he left the screwdriver, putting it between his teeth and pushing himself below the surface.
Steve really shouldn’t have let the girls come over to swim today. He should have known what watching this was gonna do to Eddie. Damn him. He hears the girls giggling and sighing as he watches his boyfriend replace the light in the pool underwater. Like, he’s under water the whole time. Jesus, how long can Steve hold his breath for and what else...nope, don’t think about it.
Eddie has zero idea of how much time has passed but eventually Steve gets out of the pool, drags the vacuum thing out - holy wet back muscles Batman - and puts it back in the poolhouse. Dripping and carrying a towel in one hand and his walkman in the other, Steve wanders over to the three of them and then shakes himself like a fucking dog, The girls squeal and Eddie doesn’t because he honestly needed the cool down.
“You guys enjoy the show?” Steve smirks.
Fucking ‘A they did. Thank you very much. Eddie can’t wait to drag Steve inside and ravish him now.
That doesn’t happen. Because the girls, while old enough to thirst after an adult man, are apparently not old enough for Steve to leave alone in the pool for the thirty minutes it would take for him to bend Eddie over his bed and fuck him - honestly they could probably make it happen in fifteen if they tried. So instead, they play babysitters all afternoon and when Hop finally picks the two troublemakers up, Eddie’s too goddamn sunburnt to get laid.
Very gently, Steve rubs aloe into Eddie’s lobster red shoulders and vulnerable spiderweb of scars across his stomach, the tops of his knees and across his nose. “And what did we learn?” Steve snarks at him.
“To put sunscreen on before you take your shirt off.” Eddie replies morosely from where he’s laying on his back on Steve’s cool sheets, staring up at the ceiling and deeply regretting his lack of foresight.
He almost jackknives up when Steve tugs the waistband of his shorts down to expose his still white underbelly and kisses him just above his hairline. “Mmmhhmm, there is one part of you that escaped the mean summer sunshine,” he sucks a bruise into Eddie’s skin where he’d left the kiss, tugging gently to help Eddie out of his scratchy jean cut offs. “And lucky for you, I’m a giver.”
Happy fucking summer indeed.
***That’s all there is of this one but feel free to check out my masterlist of full fics here. If you’re thirsty for Bottom Eddie being feral over Steve, Drummer Steve is the one I suggest. If you’re looking for kinky & clueless Top Eddie then An Accidental Flogging is probably more your thing. Happy reading!
2K notes
·
View notes
Note
The funniest thing about the Creator having a child thing (to me anways) is that the Archons act like their poor dear deity was an innocent in the whole situation, when you just KNOW that all the potential fathers (with the exceptions of Abyss Prince Aether and maybe Childe) were the ones being seduced.
Kaeya is a flirt, but he's not the type to bed someone willy-nilly, much less a deity. Nev is the Hydro Sovereign, he would have too much respect to try anything uncouth towards the Maker of All without their express permission. Kaveh would have to be blitzed out of his mind to even THINK of flirting with the Creator, much less bedding them. Childe, well...honestly it's a 50-50 split on that imo, he might if he thought it would go well and/or get him power of some sort. Traveler Aether would be focused on finding his sister, he wouldn't allow himself to be distracted by things like that...and Xiao? Xiao would never try anything that could even be mistaken as rude towards the Creator. Heck, I think getting a kiss on the cheek would be enough to make the poor guy panic.
So uh, I guess what I'm asking is...how did the dad's initially react to learning the Creator wanted to do the horizontal tango with them?
Help you are actually so right, in most scenarios I can only picture the reader being either shameless or forthcoming enough to say it to their face that they find the boy attractive or anything close.
I know there are at least a handful who while they fantasize about it wouldn't even dreamm of telling you that .

Their grace is so forthcoming

WC 1,2k
Flirty banter gets misunderstood for real flirting but they exploit the bug
Childe
“Your grace, you are shivering a lot!” he exclaims loudly as he pulls his harbinger coat onto your shoulders. The tsaritsa held a kind of ‘greetings party' with her harbingers, even if the atmosphere was tense and the chatting short, each of your sides being taken by the tsaritsa and Pierro. Sooner than expected everyone left. When you notice you left an accessory behind and meet face to face with the redhead alone in the room.
“Hm, I guess I'm a bit cold”
And without missing a beat or looking up from the clasp he was trying to secure he chimes faster than he can think “cold? But you are so hot!” but after he noticed his eyes seem to lack more will to live.
“I'm inc-”
As he attempts to apologize, your hand pulls on his wrist, getting him closer, his blue eyes wide, “You yourself are quite nice on the eyes, don't you want to tell me anything else?”
His Adam's apple bobs as he swallows the spit that pooled behind his teeth, his little Freudian slip ended up better than he expected.
Kaeya
“Oh my, what are you doing alone here?” Kaeya sits down on the chair next to you, only a lonely drink with you
“Mhm, Venti got into a fight with Jose six fingers about who was a better bard” you sigh as you sip your drink, looking down a window at the two bards singing outside trying to get the crowd to decide who was better.
“To leave such an beautiful person alone in a bar, I wouldn't be surprised if a drunkard tried to sweep you off your feet” he sips his alcoholic drink, the burning on his tongue soon settling warmly in his stomach before letting out a roaring laugh from the bottom of his chest “I'm joking~ I doubt anyone would dare attempt”
You let out a simple ‘mhm?’ before leaning your head to the side to look at Kaeya with a mischievous grin “oh, such a shame, I would have allowed you to do something so bold and a bit more” and your hand falls on his thigh under the table and his soon follow.
Venti
Would NEVER, under No circumstances flirt first for reasons
Xiao
-holds too much respect to dar think about you like that-
“Aren't you sweet?” the small apple falls on your hand, Xiao had climbed a nearby tree after hearing your stomach rumble.
“I appreciate your kind words, even then I think I'm too jaded to be considered anything akin to that” He bows his head. It's been a while since he accepted that he would never be clean of the blood he spilled during the war, but that at least managed to make him want to protect Liyue so they will be able to live peacefully.
“You may say that but isn't selflessly protecting liyue sweet? I would say it's sweet how you care about little Qiqi, I saw how you carried her up a cliff to grab qingxin. Undoubtedly pure sugar”
“Your grace…” his eyes soften as he looks down where you are.
“You are almost like candy I could eat up!”
Traveler aether
-shy/ has other things in his mind-
“I have to say aether, your house is surprisingly comfortable” the words slip past your lips before you can think about it. Even if it isn't how you would have furnished it nobody could say he had bad taste. There are lots of fireplaces and cushions and the seats and beds are quite comfortable, an odd combination of styles that sustained the idea of him being a traveler and cherry picking the most comfortable parts of each nation.
“Paimon had a hand at it too! If it was up to aether this would only be cushions and blankets! Paimon had to push for these plants!”
“Well it wouldn't be strange for a traveler to seek mostly comfort rather than looks”
Later into the night he leads you to another room on the upper floor, just a few meters away from his “how strange, I would have guessed the guest's room would be on the lower floor”
Aether just sighs, his braid swaying softly “Paimon wanted her room to be close to the kitchen so it was this or having the game room up here”
A few hours pass, there is a noise like paws on the roof but you pay no mind, Aether already explained that nobody could enter unless he allowed them to and most likely they were one of the many animals he kept inside the teapot. Softly you walk towards his door and knock on it, not without looking down the railing only to see pain passed out surrounded by a few fruits.
“Could I sleep with you?” You stand before his door wearing your piyama, as you say those words you drink in his disheveled appearance, a t-shirt a few sizes too big hanging from his shoulders down the middle of his white thighs, long blond hair usually collected in a braid now loose, some bits tangled and another flowing as they please.
“Huh…? If you are afraid of noises the cranes sometimes go to the roof and you can hear them”
“It's not that… it's more like I want to be close to you, in the same bed” his cheeks, usually milky white bloom peony red, and the last bit of hanging sleep fell from his eyes. He nods vigorously.
He has principles and openly flirting with you almost seems disrespectful
Neuvillette
Melusines are the pride of Fontaine, with their joyful disposition and chubby cheeks even if chronologically they can be hundred if years old they can blend in with 5 year olds seamlessly. Be it their tiny huffing and puffing when things don't go their way, to their attraction to sweets and how clingy they can be with neuvillette. Especially when he misses the usual monthly visit.
“I have already apologized, work stacked up and-”
“You prefer our sisters who stay in the city! It's unfair” the melusine who took over his lap started kicking the air until Neuvillette combs her hair with his fingers.
“You know it isn't like that… could you as a group behave for their grace? they are arriving soon” he attempts to calm her down while looking at the drawing another is showing him and how two others are braiding his hair.
“Never took you for the fatherly type” as you walk inside the grotto some melusines jump on you, they only see you as mister Neuvillette's friend and someone with a gift which you soon give them, it's a small ball with glitter inside, soon the melusines focus on that and start running around chasing it “aren't they a joyful bunch?”
“They seemingly never run out of energy so they can be tiring at times. My apologies for such display, I expected them to be able to be calm by the time you arrived but as you can see…”
“I don't mind, it's adorable, attractive even” he doesn't look too taken aback by your comment other than his slit pupils being thinner and longer than usual.
Diluc
Thoma
Alhaitham
Would actually flirt, holds you in high regard but still sees you as a human
Dainsleif
Abyss aether
#genshin impact#gi#sagau#genshin x reader#self aware genshin impact#genshin sagau#genshin aether#aether x reader#neuvillete x reader#genshin neuvillette#neuvillette x reader#genshin x gender neutral reader#genshin impact xiao#xiao x reader#genshin xiao#kaeya genshin#kaeya x reader#kaeya alberich#genshin kaeya#childe x reader#genshin childe#ajax x reader#genshin ajax#ajax#childe tartaglia ajax#tartaglia x reader#tartaglia#genshin tartagalia
362 notes
·
View notes
Text
Singing the Return
(A followup to Singing the Approach)
Our ship touched down like usual, with the captain in the cockpit along with a pilot (it was Kavlae’s shift), talking to the locals about where to park. In a slight departure from usual, this landing pad wasn’t anywhere near the ground. It was on top of a cactus-tree-thing that thankfully (very thankfully) didn’t sway in the wind.
I waited in the cargo bay with Zhee. He was a little twitchy, flicking his antenna and shuffling his legs and generally not holding still. I wasn’t about to say anything about it, but I suspected Zhee wasn’t a fan of heights.
Luckily for him, the landing pad was broad enough that he didn’t need to get close to the edge. Unluckily for him, Captain Sunlight had suggested that he be part of the delivery crew today because he’d been there when we met the clients before, and they would be expecting him.
With the amount he was flexing his pinchers, you’d think he was the one the clients had offered to give a tour of their skyscraper cactus city.
As the bay door started to open, Zhee asked me, “Did you check if that belt has a full charge?”
“Yes I did,” I told him, pushing the button on my gravity belt to display a full line of power lights. “And Mimi even looked it over for loose wires or whatever. I’m all set.”
“Good,” Zhee said, angling his torso so that his front half was higher — the Mesmer equivalent of standing up straight. I was continually amused by how much praying mantises resembled centaurs, and how much this particular alien species resembled Earth bugs. This wasn’t the time to bring it up, though.
The door was open all the way now, and there was Captain Sunlight, come to lead the way out. I could see a cluster of many-limbed locals waiting outside in the bright sun. The landing surface looked like it was made of red rocks mined nearby. Hopefully they were stable on top of this cactus-tree. The captain waved us forward: Zhee with the crates on a hoversled and me singing my best approximation of the local greeting song.
I’d practiced it on the way here. It was high-pitched but slow, like a songbird in slow motion. Or, more accurately, like a songbird trying to sing like a whale. This particular culture interacted regularly with their ground-bound evolutionary cousins, who wouldn’t have made it past the first climbing spike on these cactus towers.
The Tree-grabber in front stepped forward, chirping a reply song, then switching to the more recognizable trade language. “Greetings! We are delighted to smell you.” He waved his mousy ears happily, all four arms folded in front of him.
“And we you,” replied Captain Sunlight, whose people actually said that kind of greeting themselves. Her yellow scales were extra bright in this sun. “Would you like to inspect the merchandise?”
They would. Zhee did his part by prying open the crates with his mighty mantis arms — I don’t know why the supplier of these fruits insisted on packaging them this way, but it was good we had him along — and the Tree-grabbers all made a big deal of sniffing the fruits. The antigrav belts in the other crate got sniffed too, though thankfully they didn’t stink.
I could smell the fruits from where I was standing; that sour smell made my eyes water even at a distance. But no one was paying attention to me, busy as they were with signing for the delivery on the tablet that Captain Sunlight held out. Zhee put the lids back on. I wiped my eyes and admired the view. It was a nice scenic desert scrubland out there, with only the other cactus-trees in the way. I could see the entire sprawling city where the Ground-grabbers lived, and just barely make out the buildings on the distant Air-grabber mesa.
“Are you still interested in a tour?” someone asked.
I turned back and smiled without baring teeth. “Yes please!”
The lead Tree-grabber was returning the tablet to Captain Sunlight while the others moved the crates onto their own low-tech wheeled cart. Behind them, a hatch slid open in the red stones of the landing pad. Zhee towed the hoversled back toward our ship as soon as it was empty.
Captain Sunlight looked up at me. “Travel with care,” she said, which was a polite way of urging me not to trip and fall off the cactus.
“I will,” I told her. “And I have my phone if anything comes up.” That covered a lot of ground. We’d already discussed keeping an eye out for possible delivery needs: offworld items that I might tactfully suggest to the locals. They wouldn’t have thought to ask about the antigrav belts if the subject hadn’t come up in conversation the last time we were here.
“Then kindly follow me to the handpath,” said the many-limbed monkey-mouse. Dang, what was his name? I thought. He had a name. It translated as just a sound. Chirp, right, that’s what it was. I knew that. Totally professional over here. I kindly followed Chirp in the direction of the handpath.
Which was over the edge, because of course it was. Metal handrails like the kind I usually saw at swimming pools waited next to the steps. Chirp led the way.
I set the gravity belt to “catch me if I suddenly plunge downward,” and followed.
I like climbing, right? Big fan. I was all over the playground as a kid, and I never really stopped. It’s particularly fun when I get to be “the one who can reach things high up,” or otherwise be appreciated for climbing a tree or a spaceship or what have you. Occasionally I’ll meet someone else who enjoys being above the ground. Most species seem to prefer being on a safe, level surface.
Not these guys. Wow. I was glad that Captain Sunlight had insisted on the gravity belt, because this was intense. The entire city street system were basically ladders on the outside of skyscrapers.
“This handpath is designed with elders and the occasional visitor in mind,” Chirp called up to me. “Artificial steps and platforms placed regularly.” When I looked down, I saw that he was indeed standing on a platform already, which even had a railing around it. There were more ladders on either side, and other platforms that could be reached with the help of metal handholds.
“That’s very considerate,” I said. Other cactus-trees were close enough that I could watch the agile citizens scurry along the surfaces, using only the natural cactus spikes and small branches. Wild. “Do you have any handpaths inside?” I managed to make it sound casual as I stepped down onto the platform with a perfectly normal heart rate. There was a door here that I hadn’t seen from above.
“There are some,” he said. “Mostly for emergencies.”
I had to laugh. “That’s the opposite of where I’m from.”
“Really?” He perked up in curiosity. “How so?”
“We have tall buildings like this that we made,” I said with a wave toward the towering plants. “Nothing on Earth grows this big, but we can build it. And we do all our travel between levels inside, except for emergency escape ladders on the outside.”
“Fascinating!” Chirp said. “I suppose if you make the whole things yourselves, you can make sure the inside is strong enough to support as many rooms as you need.”
“Yeah, definitely,” I agreed, laying a palm against the smooth cactus wall. “These are pretty soft at the core, huh?”
“Oh yes, that’s why the rooms are kept strictly to the outer layer,” Chirp said. “Come in; let me show you.”
He opened the door and I got ready to duck, since it was just under human height, then a rapid succession of shadows passed over us.
Chirp made an irritated click. “Air-grabbers, come to get in the way again!”
I looked, curious to see what they actually looked like. Both the Tree-grabbers and the Ground-grabbers had complained about them last time.
They looked a lot like I expected: bats with skinny arms held close while they flew. Everybody seemed to have six limbs on this planet.
And varying opinions about personal space. The Air-grabbers fluttered around the cactus towers, inspecting anything that caught their interest. They circled people carrying groceries. They poked their heads into open doors, only to get shooed back out. They arrowed in on the spaceship parked above. And they flew past me repeatedly, almost enough of them to run into each other. High-pitched voices floated on the breeze, but none of them addressed us directly.
“Inside,” Chirp said, opening the door. I followed him in. He shut it firmly, leaving the squeaking cloud of bats outside.
The ceiling was a bit low here, but at least this was a proper civilized room, not something carved directly from the wet cactus innards. Multiple desks, counters, and couches made it look like an info center, or some other kind of “just arrived from above” hub. I wondered if there was a lot of travel between cactus cities here. Several locals waited in line.
Then someone else rushed in after us, complaining in her own chittering language, and she pulled up short when she saw the tall alien bent over by the door.
“Hello,” I said.
“My greetings,” she said, edging sideways. “Pardon.” With a quick arm gesture that was probably polite — one to her chest and three outward — she hurried off to stand in line. Everyone else was staring.
I’ve been stared at plenty in my time, so this was only a little awkward. I waved. Small windows that I hadn’t noticed in the walls flickered with passing shadows.
Chirp said, “I apologize for the Air-grabbers. They hardly make a visit pleasant.”
“Is there any way to ask them nicely to leave?” I asked. “I assume you’re tried discussing it with their leaders?”
“Many times.” Chirp looked tired. “They don’t care. As far as they’re concerned, the air is their territory, and it’s our poor luck that we have to breathe it.”
“How rude,” I murmured, not wanting to cast judgement on an alien culture. But my present audience more than agreed.
“Yes, they are very rude,” Chirp said, working up to a proper rant. “Shouting at them does no good, since they just find it funny. Bad weather will make them leave, but that’s a problem for us too, and hardly something we can conjure up on a whim. Though they did seem to dislike the sound of the wind through the observatory when half the windows were left open; that we could probably do on purpose. Not very helpful here, though.”
“What kind of sound was it?” I asked, half an idea forming.
“A very high shriek,” he told me. “Almost too high to hear. The wind did some strange things with those windows.”
“I wonder if you could ward them off with noise,” I said.
“Maybe,” he said, not sounding terribly optimistic. “Like I said, yelling doesn’t help, and that’s loud too.”
Somebody else scrambled through the door, complaining. This guy didn’t even see me, just slamming the door and hurrying forward like he was ready to have words with whoever was in charge here. Maybe he was. More shadows passed over the windows.
“Can I try something?” I asked. “A quick loud noise? I’ll do it outside.”
He looked curious at that. “Go ahead. Just make sure not to startle anyone on the handpaths nearby.”
“Of course,” I said. Then I turned my back on the staring eyes, opened the door, and stepped out to where I could stand up to my full height.
No Tree-grabbers nearby. Perfect. I put two fingers in my mouth and let loose with the most ear-piercing whistle I could muster.
Startled bats changed course in midair, flapping and diving to get away, a cloud of chattering alarm and confusion. Judging by the shadows, some of the ones from above had lifted off as well.
I watched for a moment to see that they kept their distance, then I ducked back inside.
“That seemed to work,” I told Chirp.
Chirp was rubbing his ear. “I’m not surprised. Very loud. How well did it work?”
I waved him outside to take a look for himself. He perked up when he saw how far the Air-grabbers had moved back. “That’s the best result I’ve seen yet! I’m sure some of it might be from the surprise of it all, but even so.”
“You said the wind shriek was almost too high to hear,” I said. “Do you think the Air-grabbers can hear sounds that you can’t quite pick up?” Their ears were bigger, but what did I know?
“Now that,” Chirp said decisively, “Is an idea worth pursuing.”
“So there’s this animal on my planet called a dog,” I said. “And a certain kind of whistle that only they can hear…”
By the time my tour was over, I had a representative of the city very interested in having us deliver some offworld noise-makers that might help them keep the peace.
(The rest of the tour was nice; they had some impressive architecture inside those cactuses, and everyone greeted me politely. I didn’t fall off the side once.)
When I climbed back up the ladder to the landing pad, taking care not to focus on the long drop behind me, I was surprised to find a handful of Air-grabbers perched there in conversation with the captain.
Chirp made a disapproving grunt, but said nothing as we walked over.
“Ah, welcome back!” Captain Sunlight said to me. “It looks like our next visit will involve a delivery of fruit to the other above-ground city in these parts.”
The Air-grabber in front smiled with sharp teeth. “Ours is the best.”
“As you say,” Captain Sunlight agreed politely.
“We will need the items delivered directly to an entrance,” said the Air-grabber. “Not to the high ground. Is that something you can do?”
Chirp muttered something that sounded like “Knew it.”
“I’m sure we can manage that,” Captain Sunlight said. “Our ship has some very stable thrusters, and talented pilots. And, failing that—” She looked at me. “Someone experienced with antigrav belts and high places.”
I chuckled and turned off the safety. “That you do.”
~~~
There's an exciting mini-project coming out next week! Details here!
~~~
These are the ongoing backstory adventures of the main character from this book.
Shared early on Patreon! There’s even a free tier to get them on the same day as the rest of the world.
The sequel novel is in progress (and will include characters from these stories. I hadn’t thought all of them up when I wrote the first book, but they’re too much fun to leave out of the second).
#a few people wanted to see what would happen when the crew came back here#maybe learn more about the aliens#whyever not#they're interesting#ALSO check out that link about the mini-project#I'll post more about that soon#very excited#my writing#The Token Human#humans are weird#humans are space orcs#haso#hfy#eiad#writeblr
81 notes
·
View notes
Text
sex pollen
a/n: if i see any bullying of zhang, i will actually bite your fucking head off. don't disrepect my homeboy just because he has a traditional haircut.
pairing: zhang x afab!recom!reader
warnings: nsfw (MDNI), mating press, dubcon (bc sex pollen), overstimulation, pussy eating, finger fucking
you were going to kill Zhang for dragging you out here, you swear to fucking god you were going to kill Zhang once the both of you make it out of the forest
he had dragged you out into the forest to look at some of the greenery, wanting to feel the grass on his feet and his hands, and you had agreed because you had been itching to do so as well
back on earth, seeing greenery was a privilege, touching it was an impossibility, but on Pandora, it was everywhere, all-encompassing and overwhelming
and then the two of you had found a waterfall in the forest and stripped down to your underwear to take a dip in the pool, but when the two of you climbed out, it turns out he had forgotten to bring a compass
now, the both of you trekking back, trying to retrace your footsteps unsteadily, boots held in your hands and only your pants clinging to your moist skin
you’re starting to understand why the na’vi wear such skimpy clothing when it was blazing hot in the weather, and the clothing sticking to your skin was starting to irritate your senses
Zhang, on the other hand, is doing much better than you, fingers trailing along the trees and ears flicking every which way to listen to the fauna of the forest
he’s even humming a song underneath his breath, and you growl and continue to trudge through the shrubbery while slapping at another bug trying to bite you
looking back at you to make sure you were still there, you scowl at him, and he rolls his eyes, not noticing the root of the tree that was lifted off the ground
in an instant, he’s on the ground, hands planted into the greenery of the forest floor as he catches himself, and he frowns as he lifts himself back up and finds his hands covered in a yellow pollen
you struggle to hide a laugh as you grab onto his hand and help him off the ground, and he thanks you quietly, wiping his hands on his pants before rushing some dust out of his face
rubbing your eyes to get rid of some of the sweat and tiredness, the both of you trek for a few more minutes, and you nearly cry in relief at the sight of the compound coming back into sight
your footsteps hurry to rush back into the air-conditioned building, and you nearly moan at the blast of cool air to your heated skin
Zhang lets out a huff of air at the feeling, and he bows his head slightly to say goodbye to you as the both of you head to your separate rooms
the door shuts behind you as you strip off your dirty clothes, and you turn on the hot water and place yourself underneath the spray, moaning at the warmth
while the waterfall was its own type of refreshing and amazing, nothing beat a hot shower, and you soak in the heat, tail flicking and banging against the shower walls in pleasure
the rest of the day passes by idly, training as usual and then working out, and at dinner time, you shove food onto your plate, bits of it falling off the sides
as you sit down to eat, Lyle raises an eyebrow at you, saying that you don’t usually eat this much food, and you glare and growl at him, telling him to back off
he raises his hands, simply sending you a smirk and saying that he was just making an observation, and he goes back to eating his own food
and then you blink, confused as to why you had reacted so aggressively to Lyle making a simple comment about your food
today’s workout was just hard, and you were on your last senses
with that excuse, you go back to your own food, sniffing it carefully before shoveling it into your mouth
a sort of feral hunger has settled into your gut, begging you to eat and eat and eat, and after dinner, you can barely move, stuffed full with food
in your own preoccupation with your thoughts, you don’t notice how Zhang has started to load up on the food as well, plate just about the same size as you
when you arrive back at your dorm, your bed looks empty and sad, hard and cold despite the blanket and pillow you usually only slept with
your hands dig into your drawers, pulling out every soft bit of material that you can find, and you pad up your bed, filling every nook and cranny, fixing the clothing, ripping it apart and starting again until you’re satisfied
it’s a mish mash and mess, shreds of your torn clohing scattered about the floor and all over your bed, in a pattern that only your brain could comprehend
you crawl into your bed satisfied and curl up inside of the softness and let your tail wrap around yourself before falling asleep
the next few days, you feel sluggish at training, mind unable to focus, and you let your body move on instinct to Quaritch’s orders as you try to process through the brain fog
perhaps you were sick, coming down with something, could the recom bodies even get sick?
you’re not sure, but you know for a fact that you can’t seem to focus and let yourself settle into your military training as you turn your brain off
you had attached yourself to Zhang the past few days as well, unable to part from his side for longer than just a few minutes, but he seems just as obsessed
on breaks, his face can be found in your neck, nibbling on the soft skin, and your hands can be found buried in his hair as you purr contentedly
he shoves his clothing into your hands after workouts, soaked in his sweat and his scent, but you only chirp happily and nuzzle into him before scampering off to fix your bed
he sits next to you during meals, and you preen with happiness every time, leaning in closer to him to push the side of your thigh into his
Zhang lets out contented rumbles and presses his shoulder into yours, and you wriggle in happiness as you eat, a smile ghosting your lips
it’s a warm day, and you had just finished training and had made your way to the lunchrooms, tail intertwined with Zhang’s
you shovel food into your mouth, uncaring of how much you were eating, and as you stare at the empty plate, you crave for more
he seems to know and gives you his plate, saying that he’ll grab some more, long legs carrying him easily to the food area as you dig into your meal
Fike elbows at your side, telling you to slow down on the eating with a playful smile, and before you can even turn to respond to the recom, you hear the familiar pounding of Zhang’s feet against the tile as he tackles Fike, snarling and growling like a feral animal and telling him to keep his fucking hands off of his mate
just like you, he had been eating much more than he usually does, putting on more weight and strength onto his body, and you hadn’t noticed with your own preoccupations with your own problems
right now however, as you hear utensils clatter and the resounding shouts of the others telling Zhang to stand down and get off, you don’t move and only watch as Zhang acts like a wild animal
as he claws and growls, Lyle and Z-dog grabbing onto his arms, you feel a twinge inside of you, something angry and dark and possessive
you’re not aware of your own body as you rip Lyle off of Zhang, baring your teeth and hissing as you sink your claws into Lyle’s arms to get him to back off
Lyle lets out a shout of pain and anger, and he uses his strength to throw you to the side to get back at pulling Zhang off of a bruised and swollen Fike
Zhang ear’s twitch at the sound of your yelp and turns his gaze to Lyle, his eyes more pupil than iris as he hisses and struggles in their grip, shouting something incomprehensible
you breathe heavily, the world muffled and body much too warm to be normal, and you stare up at the ceiling as you try to focus back on your surroundings
standing back up, something pricks you in the neck, and you sluggishly turn around to find Quaritch with a tranquilizer gun in his grip
it’s the last thing you remember before you pass out
you wake up to a cold room, floor hard and unforgiving as you wake up, and you whimper when you feel cuffs digging into your wrists
heat prickles underneath your skin, and you groan uncomfortably at how your clothes stick to your sweaty skin and how the bright lights burn your eyes
the room is empty except for you cuffed to the chair, and you let out a low whine at the cold and harsh room, it was everything unlike your soft bed
thinking feels like a struggle as your tail lashes behind you, and your hips rut against the chair instinctively, trying to find some sort of friction as your brain slowly processes the claws of arousal deep in your gut
agonizing pleasure runs through you, and you whine and whimper as you keep rutting your hips against the chair, the friction of your underwear dragging against your sensitive clit
it’s only you and the sound of the chair squeaking as you uselessly chase for a pleasure that won’t come your way
no matter how fast or how hard you try to grind into the chair, your orgasm sits just out of reach, teasing and torturing you as it slips by your fingers every time
time seems to tick by slowly as you start to cry tears of frustration, and your hands clench together, trying to claw at the hard metal to get yourself free
the door opens in your room, and you can barely recognize the figure of your colonel in the room, his body flinching as he sniffs the air
he clears his throat as he uncuffs you, but his touch only sears your skin and your body flinches away from his fingers as he uncuffs you
his heavy hand grabs at the back of your kuru, and you’re helpless to let him guide you through the hallways, steadying your stumbling as you pant heavily and try to deal with the pain cramping in your body the longer he touches you
there’s the sound of something whooshing open, and then Quaritch gently pushes you into a dimmed room, the familiar scent of your bedroom hitting your nose
you rush over to your bed, nearly jumping into it before you realize that doing that would only ruin the carefully built fortress you had built
relief floods you as you bury yourself into the sheets, and you bury your nose into the linens as you sigh in relief, fingers curling into the soft material
a low whine leaves your throat as you hump your own bed, desperate for something more, and there’s a low sob as you bite your lip, orgasm still just a breath away from you
the door creaks open again, a sliver of bright light illuminating the room before it disappears, and you sniff the air, ears perking up as you scent Zhang
he rushes to you, pupils dark and golden irises nothing more than a razor thin ring, and you growl as he steps into your bed without your permission
Zhang pauses, muscles straining with the effort of listening to you, and you get up on your knees and tug at his shirt
hurriedly, he pulls it off and hands it to you, and you press it to your nose and search around your bed on the perfect place to put the soft material
as your hands press it into one of the creases, a small purr leaves your chest and your tail flicks behind you happily as you finally complete your bed
something clicks in your head, and you look back to Zhang, tilting your head for him to come in
slowly, he steps into the bed, and he brings his hands up to cradle your face, his breaths slow and deep as he fully takes in the scent of you and your arousal
and then it’s the clash of your lips against his, claws tearing and ripping at the clothing clinging onto your skin and his
his hands push and pull at the weight you’ve gained, groaning in appreciation at the plush curves, and your hands do the same, squeezing at his thighs and brushing over his soft stomach
his lips never leaves yours as you fall down onto the bed, back pressed into the soft linens, and he ruts his hard cock into the plush of your thigh
Zhang only pulls back to attach his lips to the curve of your jaw and then to your neck, teeth nipping at the sensitive flesh and sucking dark hickeys into your skin
your hands bury itself into his hair as you moan into the air, your hips meeting his as you grind against each other
he pulls a high-pitched whine from your lips when he moves further down and licks at your chest, sucking and placing long flat licks over your nipple
you whimper and arch your back off the bed, pushing your chest further into his mouth, and your legs part further to make way for his body as he shuffles further downward
his teeth bite into your nipple, his other hand kneading at your other breast and rolling the sensitive nub in between his calloused fingertips
he can’t seem to get enough of the taste of your skin, moaning as he teases your chest, and you can barely stand the pleasure swirling in his head
it’s a heat that crawls underneath your skin, one that melts your brain and only heightens everything that you feel, but his touch is only cool to the touch, soothing and calming the fire that burns your nerves
pleasure clouds your thoughts along with need and want and the overwhelming scent of Zhang
he stills your mind while also riling it up at the same time, bringing your head out a fog of unsurety and into the haze of him
his mouth detaches from your nipple with a loud pop, lips swollen and fangs lightly gleaming into the low light of the room, and he moves his mouth to your other nipple
never once does he stop rutting against the bed lazily, his hands kneading at your skin and your chest and everywhere else they could possibly touch
and his tail lazily sways behind him, content and happy with how he tastes and worships your body
finally, Zhang trails his kisses down your chest to your stomach, biting into the slight fat of your lower belly and purring in contentment at the sight
his hands part your thighs wider before he uses an arm to press the tops of your thighs into your torso, presenting your pussy to his eager mouth
he uses his other hand to part your swollen folds, salivating at the sight of your cunt drooling just for him and your clit aching for attention
you whine loudly, hands clawing at the sheets as his tongue presses into you and his nose grinds against your clit so deliciously
it’s too much and not enough at the same time, his tongue fucking into you and trying to find your sweet spot to make pleasure explode behind your eyes
Zhang moves his mouth up to your clit, tongue laying flat over the sensitive and swollen bud and dragging up it as his fingers goes to slide into your pussy
he groans at your taste, and you squirm and gasp underneath his as he sucks on your clit and curves his fingers up inside of you, the rough pads of them massaging right into something devastating
you whine and grab onto his hair with your hands, tugging and pulling at the strands as he laps at your clit, and he only groans as you pull at his hair
his gaze is focused on you however, his eyes meeting yours and watching your every move, how your chest heaves up and down and how his marks litter across his skin
it makes him growl and fuck you on his fingers harder, desperate to make you cum first, and small little whimpers are punched out of you at the pleasure
your pussy clenches around him, so close to your release, and Zhang knows it too, smiling up at you and flicking his tongue back and forth across your clit while his fingers press into your sweet pot
a loud cry pierces through the room as you arch your back off the bed and clench down on his fingers hard, cummong on his hand and letting the tidal wave of pleasure carry you down into the deep
there’s a haze in your mind that curls and coddles you, bringing you into its warm embrace, and you can’t think properly as Zhang fucks you on his fingers through your orgasm, making it last for as long as possible
his fingers slow down in their pace, and he detaches his mouth from your clit as he pulls his fingers out, eyes flicking to look at how your release coats his fingers
white and creamy and dripping down his hands, he places his two fingers into his mouth, tasting your release and moaning at how sweet it is
you can’t notice, head too busy in the clouds to really comprehend what was happening, and you let out a small groan as Zhang shuffles upward, hooking your knees over his shoulders and moving up until you were in a mating press
the length of his cock presses against your folds, hot and heavy and long, and you whine for him to fuck you, please, you need him to fuck you so badly
he licks his lips at your begging and slightly brings his hips back, just enough to line himself up with your drooling cunt and slowly slide in
tilting your head back at the feeling, you whine as he pushes in further and further, seemingly never ending, and you paw at the sheets, overwhelmed
Zhang groans and stops, giving you and him a breather, and you whine that you can take it, just please, you need him to fuck you, please please please
he lets out a slight grunt, saying that he was only halfway and that he needs to give you a second, and you blink at him owlishly and bite your lip, trying to contain a small moan
you already felt so full, you’re not sure if he can even fit all the way, and as if he catches the look on your face, he says he’ll make it fit, a rare smirk on his face
his statement distracts you enough for him to thrust in a little more, and it punches a whimper out of you as you gasp for air
he fucks into you slowly, hips moving back and forth, sinking you deeper and deeper on his cock until finally his hips meet yours, grinding into you and against your clit
stars trail across your vision as you gasp for air, and you whine and groan, the small tears in your eyes falling at how stretched you felt
Zhang kisses the small tears away, and small whines and whimpers escape from you as you try to calm down and adjust
you’ve never felt so full, so full of him and surrounded by him, ever bit of his skin touching yours seems to send your brain in a fritz, and the sound of his heavy breaths as his eyes stare into your sends you heart into a frenzy
soon enough, the pleasure outweighs the pain, and your hips slightly rut into his, begging him to move and fuck you, the instincts in your body driving you to have him
he wastes no time, hips grinding and then fucking into you ruthlessly, the sound of wet slaps echoing in the room along with both yours and his moans
with every thrust, his pelvis slaps against your clit, sending jolts of pleasure into you, and he keeps eye contact with you, refusing to let you look away from him
it makes you whine and your head to grow fuzzy, and you can’t help it as your cunt clenches down on him and you cum on his cock
a growl escapes from his throat at how your pussy hugs his cock, but he keeps fucking into you, hips never faltering or stuttering as he fucks you through your orgasm, trying to chase his own and fill you with his seed
his thrusts are relentless and brutal, bullying your walls, and you let him drive you into overstimulation, cries and sobs leaving your throat
with a barely noticeable stutter of his hips, he groans deep and leans his head down to rest his forehead against yours as he cums into your abused cunt
and yet, he still doesn’t stop, fucking his cum deeper and deeper into you as he paints your walls white
his pace slows down eventually, the last bits of what he had to give you filling you and seeping out onto the sheets of your bed
the both of you pant, and he moves your legs from his shoulders to wrap around his waist
but he stays buried deep inside of you, and he presses his weight into your body and also slots his lips with yours
you sigh into the kiss, wrapping your arms around his neck and closing your eyes as he moans into your mouth and hums at how your legs squeeze his slim waist
it was strange how quickly you had grown attached to him, but the thought flies from your mind when he parts from your lips and flips you around so that your ass is high in the air and so that your face is smushed into the softness of your bed
he mutters that he needs more, needs to fuck you again, and you whine as he fucks into your overstimulated pussy, one hand reaching underneath you to rub at your swollen clit
in the research room, Quaritch sighs when he hears from the scientists that you and his best sniper wouldn’t be available for at least a week, something had triggered your heat and Zhang’s rut, and all of you were helpless to nature
#avatar 2009#avatar james cameron#avatar the way of water#atwow#avatar smut#atwow smut#avatar x reader#avatar x y/n#avatar x you#atwow x reader#atwow x y/n#atwow x you#recoms x reader#avatar recoms#atwow recoms#recom zhang#zhang smut#zhang x reader#zhang x you#zhang x y/n#tangerine writes#summersinpandora2024
117 notes
·
View notes
Text
A/N: This isn't proofread and bug autocorrected to big sometimes so hopefully there aren't too many mistakes !
My weird bug lover… | Francis Mosses x gn!reader 🤍
Content warning | talk of bugs, spiders, fluff
wc - 500+

Francis, he loves you with all his heart, truly he does! but he’d prefer you didn’t try to hand him every bug you came across outside, or try to bring them home. “Francis! Look, look, look!” You shout excitedly, running toward him with your hands cupped, obviously meaning you had something.
He sighs, walking toward you. You halt in front of him with a big smile. “Mmm what did you find this time, my love. Is it a caterpillar? or maybe a pretty looking beetle?” Even though he didn’t like bugs he always held his hand out for you to hand over whichever bug you’d found.
“No, it’s a Ladybird spider!” You say placing the bug in his hands with excitement. Francis froze as the spider started crawling up his hand. “Isn’t she just super pretty! Let’s take it home!” You look at your lover's face which is much paler than it usually is.
“Francis? You okay, you look sick” His hands are shaking slightly as he forces on a brave facade. “I… I think it’s best if we leave the spiders outside love…” He moves his hands slowly toward you gesturing for you to take the spider back. You pout taking the spider from his hands. “But, it kind of looks like a ladybug, what if we just pretend it’s not a spider!” You smile at him, which usually gets him to give in.
He shakes his head though. “I won’t change my mind this time, love. We already have a few too many bug enclosures in our small apartment, we don’t need more.” He is not letting a spider into his apartment. The few different species of beetles, snails, praying mantis were enough, plus you had ordered a scorpion through the mail, if he had to deal with a scorpion plus a spider in his small apartment he might pass away on the spot.
You let the spider crawl off your hand onto a bush giving it a small goodbye, before turning back to your lover. “Mmm, why can’t we just get a cat and dye it ladybug colors?” He said linking your hands. “No way, it’ll knock my enclosures on the ground, and you wouldn’t want a bunch of beetles roaming the apartment would you?” He felt a shiver go down his spine at the thought.
“You're right, let’s stick to just bugs for now.” He said squeezing your hand. You find his reaction a little amusing as you giggle. “Oh! that reminds me I saw an advertisement about this butterfly garden, we should go!” You give him that same smile you use to get something, and this time he gives in.
“Mmm, okay at least it’s butterflies. I can handle butterflies.” You cheer, before seeing a huge beetle climbing a tree out of the corner of your eye. You gasp. “Look! It’s a Hercules Beetle, we have to take him home at least!” You say happily pulling him toward the big bug.
Francis didn’t even bother giving the bug a glance, his eyes not moving your face. You always look so happy finding bugs, though he lost a little sanity everytime you handed them to him, the cheerful look you had always made it worth it.

Sorry it's a little short! Hope you liked it! :3
173 notes
·
View notes
Text
STWG Prompt: Attic
“I think your attic is haunted, Nance.”
Nancy couldn’t hold back her amused snort as she tucked her nose against the back of Barb’s neck. Her hair was shorn in the back, fuzzy to the touch ever since she’d seen Max’s hair get snagged by a wayward vine. “Haunted?” Her fingers drifted up and down Barb’s arm as she felt along the divots of old gashes, long since scarred over.
“After everything we’ve dealt with, don’t tell me you don’t believe in ghosts.” Barb twisted so they were facing each other, tucked in under Nancy’s pink quilt. “Something is bumping around up there and I don’t think it’s a demodog.”
Nancy whined and nuzzled in as close as she could. They were warm, she’d felt safe. She didn’t want to get up and face a threat that could be anything from a bat to a, well. Demobat. She pressed her face against Barb’s chest, but her spine went rigid at the sound of something knocking against the ceiling above them. Barb clutched Nancy a little tighter, fumbling behind herself for her glasses. “Damnit,” Nancy grumbled to herself.
They were still and quiet for a few long moments until it came again and Nancy decided she couldn’t just keep laying there. Not when Holly was down the hall and her parents were continuously none the wiser.
She climbed out of bed, despite Barb’s protests, and jerked her closet door open. She didn’t even have to look to grab her gun, double checking the magazine to make sure it was loaded.
Her thumb rested on the safety as she crept down the hall, easily stepping past the parts of the floor that creaked. The attic steps were pulled up, the string dangling down like a black widow waiting to strike.
…actually they weren’t very aggressive spiders. Neither were brown recluses, the only other venomous spider she could come up with. She’d have to ask El, though the girl was more fascinated by the prettier insects like butterflies or beetles. Or maybe Jonathan, she could remember him mentioning having a big phase when he was a boy.
She shook off the thoughts of bugs and reached up to give the string a tug. She managed to reach up and catch the ladder before it fell, making far less noise than she’d been anticipating. Her arm trembled as she lowered the later. It was heavier than she’d been ready for, but she didn’t let it slip.
Getting up into the attic was a noisier affair, but the muffled bumps had turned into hushed voices and slightly louder bumps. Gun held tightly in her hand, she slowly lifted her head up into the attic, squinting.
“Oh ew!” Her voice was more of a squeak than she would have liked, but it wasn’t her fault she was practically making eye contact with her baby brother while he was pinning his best friend to the floor. She was glad she hadn’t waited longer, they were at least dressed.
“Nancy!” Mike scrambled off of Will and grabbed what looked like a dusty Christmas tree skirt to wrap around himself, like he’d forgotten he was in pajamas.
Will didn’t look quite as embarrassed, more startled and confused. “…hi Nancy.”
“…hi Will.” She sighed, grip relaxing on her gun. “Can’t you do that… not right above my head? I thought a gate had opened in the attic or something.”
Will murmured an apology, but he didn’t look that sorry. Mike’s face was burning red in the low light and he scoffed. “Jesus, fine, we’ll go to the basement instead.”
“Gross.” Nancy huffed. “…don’t do anything stupid.” She managed to duck back down the ladder before an Easter basket could hit her in the head.
She grumbled to herself as she went back to her bedroom, returning her gun to the closet. “Any ghosts?” Barb asked, sitting up with her legs off the bed.
“No. No ghosts, just an annoying little brother and his boyfriend.”
Barb raised an eyebrow as Nancy climbed into bed. “Did he and Will actually talk things out?”
“I sure hope so. I don’t know if there’s a platonic explanation for what I saw otherwise.” She cuddled into Barb’s embrace. “No ghosts,” she sighed. “Guess we can mark that off our list of things that shouldn’t exist but do.”
“For now.”
“Don’t say that!”
17 notes
·
View notes
Note
Gregory would 100% do a dramatic retelling of the events of security breach to Evan campfire style with a flashlight in the dead of night while the other boy is staring at him shook to the core.
Don’t think too much about context or timelines or anything. Just know that the boys are buds and Gregory really went through the (somewhat canon) events of SB.
Lived to Tell the Tale
“—and then I heard these big thumps, like footsteps, getting louder and closer,” Gregory said, waving his flashlight around. “I looked way up to a giant hole in the wall. And do you know what I saw, crawling out of the darkness?”
Evan, chin pressed into the head of his Fredbear plushie, shook his head, enraptured.
Gregory leaned closer, and the flickering light from the campfire between them cast dancing shadows over his face. “It was the DJ. He’d woken up while I was playing the games in the back room, and there he was, looming over me from his tunnel, big as a bus.”
“What’d he do?” Evan whispered.
“He came after me,” Gregory told him. “Climbed right out of the hole and chased me down that long hall. He was so heavy that arcade cabinets were falling over, some almost right on top of me. I ran for my life and just barely made it out before he could squish me like I was the bug.”
“Wow,” Evan breathed.
“And it was like since I’d won our little chase, he’d decided to leave me alone. He went back to his turntables and didn’t bother me again for the rest of the night, not even when I was right in front of him.”
“You went back?”
Gregory tipped back onto his log, laughing. “Of course! I even explored some of those tunnels of his—that arcade didn’t have many other good hiding places.”
“You’re way braver than me.” Evan shook his head, squeezing his plushie tightly. “I never coulda done any of that.”
“I hope you don’t ever have to.” Gregory shivered and absently flicked his light around the nearby trees. A practiced motion, as if he was looking for something in the shadows. “A lot of it was really scary. All the animatronics were so much bigger and stronger than me. Being small and fast were the only advantages I had.” He smiled slyly. “Well, almost. Sometimes I was smarter, too. Have I told you how I defeated Chica?”
Evan shook his head.
“What you’ve gotta understand about her is that she’ll eat anything, but she apparently has a favorite ice cream. I found it thanks to memos left behind by some of the employees. And I used it to set a trap!” He held his flashlight beneath his chin, grinning evilly. “I lured her into the trash compactor!”
“No! Really?”
“Uh huh! But you’ll never guess what happened next!”
51 notes
·
View notes
Text
Day 5 - Animals
Thanks @forlorn-crows for this prompts, it was so much fun writing! Wc:1,4k
“Where are we going, Swiss?” Phantom asked. Swiss had basically kidnapped him and started driving somewhere but refused to tell him where they were going. Swiss just smirked, “You'll see when we get there”.
It felt like they had been driving for hours. Phantom couldn't wait to see where they were going. After a while, Swiss finally parked the car and told him they were there. Phantom jumped out of the car, but there wasn't anything there. He looked at Swiss confused but he just grabbed Phantom's hand and started walking.
They were walking along a path, Phantom trying to get Swiss to tell him, but to no avail. Then finally they stood in front of a building with a big sign. When Phantom read the sign he didn't know what to do. “You took me to a bat rescue!” He yelled, his whole body buzzing with excitement as he turned around to look at Swiss.
“Yeah, I saw an article about this place and thought of you” Swiss couldn't help but smile, the ghoul in front of him was literally vibrating with excitement. “Lets go inside, Bug”
They walked towards the doors, “C’mon Swiss, you're too slow!” Phantom said as he grabbed Swiss’ hand and started dragging him. Swiss was quick to pick up the pace and follow him to the doors. They walked in and were greeted by a lady behind the front desk. “Are you here for the tour?” She asked.
They followed her back into a room with incubators. There was a shelf filled with bottles, medicine and other medical supplies. “This is where we keep our injured bats” She said as she gestured to the incubators. Phantom looked through the glass of the incubators at the little bats. Most of them were asleep, snuggled up with their blankets. Some of them had bandaged feet or a big band aid covering stitches. She continued to talk about how they rescue bats and how they help them recover and Phantom asked all the questions he could think of. Swiss made sure to take photos of Phantom when he didn't notice, to capture his true excitement.
They continued to another room with cages filled with branches and leaves. “This is where we keep our pups that's still a bit too small for the big outside cage” She told them, walking over to the cage. “I think it's time for their bottles, would you guys like to help feed them?” She asked. Phantom stared at her in stunned silence, “Can we really feed them?” He couldn't believe he might actually get to feed a bat. “Take a seat over there and Ill show you how it's done. '' She said as she gestured towards the bench.
Swiss and Phantom sat down and the lady showed them how to hold the bats correctly and how to feed them with the bottles. She handed them each a blanket to wrap the bat up in and then the bat. Phantom held the bat close and made sure it started to drink from the bottle. Swiss’ bat was very hungry and finished quickly, he gave the bottle back and took out his phone to take a picture of Phantom with his bat. Swiss could see the adoration he had for the little bat, it was so cute.
Phantom's bat finished and he gave the lady the bottle. He held the bat for a little while, gently stroking it over the head. The bat's eyes began to flutter and it yawned, showing off its teeth. Phantom sat there with the sleepy bat that now had started purring, watching it until it fell asleep in his arms. Swiss was quick to take a photo, Phantom offering him his biggest smile, when he noticed.
“This is our big outside cage” The lady told them as they walked outside. "It's where we keep the big bats that are getting ready to be released into the wild again" The cage was massive, it had small trees in it, some bushes, flowers and wooden beams for the bats to hang upside down from. There were water bowls placed out and some hideouts made from an old tree log.
Phantom walked over to the cage to look at all the bats. There were a few hanging from the beams and some were in the hideouts, one was climbing on the cage wall. He looked at the bat as it climbed up the wall.
They walked to a big cage, a little shed connected to it. The lady explained that this is where the bats that won't be able to recover enough to go back to the wild stay. There were water bottles connected to the cage wall and a lot of different things to climb on. He took a step closer to the enclosure to see the bats.
Then he was face to face with a bat. The bat had black and grey fur with a little brown patch on its face and it was missing a wing. It was looking at him with its big eyes. But one of its eyes was white and milky and there was a scar going through it. “His eye looks like mine, Swiss” He quietly said. He watched the bat as he stood there. He hated his own scarred eye, it didn't fit in. Maybe he was the only person with an eye like that, but he was not completely alone. “You found a twin, Lovebug” Swiss said as he walked up to stand behind Phantom, placing his hands around Phantom's waist.
“What happened to him?” Phantom asked, turning to the lady. “Someone had found a baby bat in their garden and they took him in but their cat attacked it and they brought him here”
The lady went inside to get some pictures of it when they got him to show Phantom. “It's just like me, Swiss” Phantom whispered as he leaned against Swiss. “You okay bug?”
Phantom was quiet for a moment, he didn't know. “Yeah, I just, I thought- I don't know, but I'm okay” Swiss held him a little closer, kissing him on the cheek.
The lady returned with some pictures and gave them to Phantom to look at. His eye was all bloody and one of its wings was almost not connected to the body. He looked at the picture and then the bat, and then he gave the pictures back. “What's his name?” He asked. “He doesn't really have a name yet” She said, putting the photos back in the folder, “Would you like to name him?”
“Yes!”
What would be a good name for a bat? It needed to be a spookie name that fit this specific bat. Maybe Dracula? no, it needed to be something more special. He only had one wing, but there was no good name he could base on that. His eye was milky white and he was blind, and the bat was just like Phantom himself, but they couldn't share a name. But maybe they could share the meaning of their names…
“His name is Ghost” Phantom stated. He didn't tell them the reasoning but he knew Swiss understood it, and the lady didn't have to know. “That's a wonderful name, I'll write it down immediately” The lady said. “Would you like to hold Ghost? he's a real cuddle bug”
When The lady went to grab Ghost Swiss hugged Phantom from behind again “One more thing you have in common, Cuddle bug”. Phantom giggled and leaned back against Swiss.
He got to hold Ghost and give him some fruit. He sat in the grass with Ghost in his arms, just looking at him and petting him a bit. He could have stayed there for hours but they needed to go home. Phantom put Ghost back in the cage, giving him a kiss on the head and said his goodbye. He was sad, it had been a great day, wonderful day even, but he would miss Ghost very badly and he didn't want to say goodbye.
Swiss thanked the lady for having them and they said their goodbyes. “Thank you for coming, and you are welcome to visit Ghost whenever you want” The lady said as they were leaving. Phantom turned around, “Really!” She smiled, “Of course, Ghost will miss his best friend”
#mushy may 2024#phantom ghoul#swiss ghoul#nameless ghouls#the band ghost#tshm writing#ghost fanfiction
36 notes
·
View notes
Text
You can't hide, Bug.
(Based on the song You can't hide by Ck9c. Specifically, the time stamp 1:12 to 1:40)
This version of Bug the hunter runs from the boys as they try to navigate their way through and out of the trap filled swamp called Silverbend. Whilst running, they run into what seems like help. In a dark and feathery form that says nothing.
(I think of this as an alternative path on how the Blood moon episode could've gone. Left ambiguous on how it concludes, but it seems that our water bug has run out of options.)
The pounding of a frantic heart was deafening in the inexperienced hunter's ears as they clawed their way through thick, untamed brush and swamp mud as they fled from a unwanted fate. They heaved as they climbed atop roots and waded through the murky water, ignoring the shooting and almost immeasurable pain in their right leg, anguished and hurrying to escape the ones who laughed from what seemed like just behind them. Willing to take their chances against whatever lurked just beneath the surface of the water if only to avoid the swamp denizens' searching eyes.
They knew stopping to catch what breath they had left was an awful idea. A dangerous one that might have them at the mercy of one of the beings they had encountered. Two Alligator half-bloods, one who called himself Bodie and the other who remained nameless. Between the two, Bodie was the larger one, thick heavy scales covering multiple parts of his body and knowing desperate yellow eyes. The second unnamed gator was smaller, with seemingly sharper, more pointed scales and longer curled hair. His eyes, a bright golden color, almost glowing enraged eyes that shone with the intensity of the most chaotic sunset.
Both inhabitants of the swamp followed the hunter they deemed the name "Bug" into the swamp after they managed to escape their confines of Bodies shack. To say it scared the now named Bug was an understatement. They had no clue as to whether or not their team survived, the pain in their leg was only growing more intense the farther they ran. They didn't even know where they were in the swamp. The engorged moon above that bathed the entire world in a violent red light was no help as it reflected off the water, painting it a vibrant crimson. Ragged breaths spilled from dry lips as they slowed their pace, reaching a large tree and leaning against it. Pressing their shoulder against the bark to rest, they grasped at their chest to slow down their thundering heart.
They scanned their surroundings quickly. Tears were threatening to fall before faint voices emerged in the distance. 'Oh gods, they're close.'
Almost as soon as the thought came to be, it was quickly forgotten as a sudden sharp caw jolts them from their action. They jump at the noise that rustles from behind them, whipping around to gaze at the source. Their eyes lock onto the culprit.
Surprise takes place of fear as they spot a small, dark figure jumping from one twisted root to the other. Big beaded eyes stare back as feathers turn visible when it jumps in the light, head turned with small croaking noises emitted from deep within its small body. 'A..raven?' More laughter from the younger half-blood erupts from not too far away, sending more fear into the individual. The terror filled human bites back a whimper. 'Be quiet. Be quite. Don't. let. them. hear. you.' A chant forms in their head, pushing themselves off the tree and holding themselves as steady as they could, searching for a path of escape.
The hunter turned prey clenches their jaw. Taking one step forward, then another, ignoring the pain radiating at each step. The raven that was only watching as they walked away not but a second ago lifts its wings, a harsh call emitted from its beak. Bug freezes at the noise, turning harshly at the bird and held their breath, listening intensely as it echoes outward into the uneasy silence that made the ambiance. Body tensed and agitated.
"Don't do that!"
Bug hissed out, looking around before taking another step. 'Damn it. They're gonna give me away!'
Said bird flapped its wings, launching itself forward, curving around the human and landing front and center, its head bobbing up and down. Lifting its wings, it then makes a deep clicking noise before hopping to the ground. It muffled the click of its clawed feet against the soft earth as it looks up at the hunter. Another harsh caw. Then a flurry of feathers as it takes off.
Eyes follow the corvid as it circles above their head thrice before soaring away and landing on a low branch, only to turn back and cry out once again.
Furrowing their eyebrows and wincing at the jarring sound, they changed from their original trajectory to follow the black feathered beacon, irritated and hesitant to tail the animal. Thoughts raced through the exhausted being as they tiredly navigated around wooden spikes that riddled the clouded water. Contemplating their choice of action. To put your trust in the hands of a bird or risk running back into the hands of your captors. It wasn't wise to delay deciding. Not when options were so limited. 'What other choice do I have? Running blindly ain't gonna do nothing but get me even more lost. Gods forbid I step in another trap,' They reasoned in their head, nervously scanning the ground as they trailed the creature that seemed unnaturally quiet now.
In fact, everything was quiet. It was only noticeable now that they had gained control of their breathing, adrenaline fading quickly and being replaced by a deep fatigue that seemed to weigh heavier and heavier with every step. The now still air held a tension that seemed to seep into Bugs' very heart.
No crickets. No frogs. Even the water appeared to freeze solid. The only noise audible being the light flapping noises that occurred when the raven overhead flew another short distance and the splash of wading water when they trudged through a shallow area of it, disturbing small insects in their wake.
Deafening silence continues to ring as they limped further and further on. The raven now staying completely silent as they flew into a tiny clearing of solid ground before lighting down on an exposed root, turning its head expectantly cocking its head to see if the hunter was still following.
Bug stayed at the edge of the open space, staring at the blackbird in confusion. They hesitate for a moment, body quivering as they limp forward slowly.
Something completely depleted their body of energy as they stepped closer and closer to the avain. Every move was heavy and tiresome, blood loss and overexertion finally kicking in ever so slowly.
They stood on unsteady legs in front of the feathered friend and stared at the dark creature, breathing slowing as their vision fades in and out of focus.
All they wanted was to fall, and all that was keeping them up was a mixture of desperation and hope.
They stare at it, perched still and unmoving, following its gaze, pointed at an area beside the clearing where the blood stained light couldn't quite seem to reach. Bugs gaze stays there, focused as a figure grows more and more discernable as their eyes adjusted. A relaxed and laid back figure that leant against the trunk of a large massive tree. Through the small gaps in the branches, the crimson moon light bled through, exposing long black hair, scale spotted skin, and a widening sharp toothed smirk.
The human jolts back in an attempt to back away, managing to stumble a few steps before their leg finally gives in. They collapse backwards onto their rear, visually shaking as they observe the now standing visage and risk a glance to their side. Hoping for a way of escape but only to be met with two more figures that became more recognizable as they crept closer.
"Well, hell," says the smallest of the three. "I gotta give it to ya, you definitely gave us a run for it."
He creeps ever so closer his fallen prey, eyes trained directly on their wounded leg. Bodie followed quickly, making his presence know by taking a large step forward and revealing an upset scowl as he breached into the moons violent glow.
"All's I said was that you had to stay in one place, Bug. Guess I gotta be more careful when it comes to keepin' an eye on you."
All three figures seemed to spin as the water bug's vision turns to black. Voices becoming muffled and muddled as their grip of consciousness releases and they give into the darkness. Their last thoughts echoing quieter and quieter, until nothing remained but a faint whisper of hope.
A hope that only asked that the fate that waited for them when they awoke wasn't unpleasant.
(I am very sorry if this is trash. This is the first fic I've ever posted.)
57 notes
·
View notes
Text
2025 Ostara Ritual
Hello! Long time, no post! I recently wrote an Ostara ritual which my friends and I had a lot of fun with, and since Ostara is still a week away, I thought others might appreciate some inspo. The intent of this ritual is to lean into the childlike joy of Spring. Since this involved an egg hunt around the house, we did not cast a circle as such, but you might if doing it in a smaller space. This one is more fun with friends, but if you'd like to do it solo, perhaps have a friend or family member hide the eggs for you ahead of time.
You will need:
-Stuffable colored eggs -- we used confetti filled egg shells from Walmart, but if you have some of the plastic variety that would work too. -Affirmations - Write some affirmations on pieces of paper to put in the eggs. Suggested affirmations below. -A music-playing device. -Optional: Bubbles, a rock for each person to hold, a drink for everyone to sip
Ritual outline:
Spring Ritual 2025
Check-In
If doing the ritual with a group, have everyone say a word or two about how they're feeling.
Intention
We are approaching the Spring Equinox, Ostara, the time when the Goddess becomes a child again. She can be found in the new buds on the branch, the fresh, green leaves, the squawk of baby birds, and the laughter of children at play.
This Ostara finds us in fearful times. There are forces, by their own admission, working actively to keep us afraid and overwhelmed, so we become complacent. Which is why it is important now more than ever, to nurture moments of joy, levity, and fun in our lives. Joy is the antidote to fear, and levity the fuel for action and resistance. And our spiritual paths can be an important tool in our cultivation of joy. Spirituality is not only the domain of somber contemplation, meditation and spellwork (though those are valuable, too); it can also be a practice that lightens our hearts when they are heavy. So, for this Ostara celebration, let us be open to joy, fun, silliness, and committing to the bit.
Opening Chant
When I Was Young by Beautiful Chorus
Calling the Elements
As we turned and honored each of the elements and directions, we did a little activity for each: we blew bubbles of air, rubbed our hands together for fire, took satisfied sips of our water for... water, and held a cool rock for earth. Just speak a little from the heart for the qualities you associate with each element. Be a little silly!
Charge of the Maiden
Hear the words of the Maiden Goddess, the sound of whose laughter are the sprouts and buds of spring... I who am the scent of flowers on the breeze and the sting of bark on your palms when you climb trees and the infinite rainbow colors of the world. I call upon you ... to come look at this neat bug I found! For I am the spirit of growth that brings renewal and new life. With me do the young and young of heart set forth to explore the world. Let my worship be in the making of messes and mistakes for they are the root of all learning. Let there be curiosity and delight, wonder and humor, innocence and wildness, exuberance and passion within you. And you who seek to know me... have you tried looking under that rock or maybe behind that tree? Keep searching for in the seeking you'll find me. ON YOUR MARK, GET SET, GO!
Egg Hunt!
Once everyone has found their eggs, have them open the eggs, quietly read the affirmations they found, and pick a few for the Affirmations portion. If you picked the confetti-stuffed eggs, encourage making a real mess while breaking the eggs open. Advise that after the dance, we will popcorn around the circle, someone will shout out their affirmation and the group will repeat. Say the affirmations with gusto and confidence!
Circle Dance
Play the Hokey Pokey! If you're doing this with a group, I recommend keeping the song choice a fun surprise.
Affirmations
Some examples: I am brave! I am curious! I am open to wonder! I am wild! I am passionate! I am enough! I am always learning and growing! I am confident! I am creative! I am joyful! I am resilient! I am open to delight! I can do hard things! I am good!
Closing Prayer
As we go forth from this place, May we be grounded in strength and stability, May we feel the flow of love around and within us, May passion brighten our days with creative fire, May we see the magic and wonder always around us, Only playing hide & seek, waiting to be found. The circle is open but never broken. May the joy of the Goddess be ever in our hearts. Blessed be.
5 notes
·
View notes